KR102433456B1 - Tph1 knockout mouse - Google Patents

Abstract

The present invention relates to a Tph1 or Htr2b knockout mouse and a method for preparing the same. The Tph1 or Htr2b knockout mouse of the present invention has a high knockout efficiency of a target gene and has a reduced proliferative ability of β cells of the pancreas, so it can be usefully used in the study of various metabolic diseases, including type 2 diabetes and metabolic syndrome.

Description

Tph1 knockout mouse {Tph1 knockout mouse}

The present invention was made under project number 2018018200 under the support of the Ministry of Science and ICT of the Republic of Korea, and the research management institution for the project is "National Research Foundation", the research project name is "Original Technology Development Project", and the research project name is "(EZBARO) Production and clinical application of stem cell-derived biomimetic beta-cell clusters", the lead institution is "Korea Advanced Institute of Science and Technology", and the research period is 2018.04.01-2019.01.31.

The present invention was also made under the support of the Ministry of Science and ICT of the Republic of Korea under project number 2018074646, and the research management institution of the project is "National Research Foundation", the research project name is "Basic Research Project in Science and Engineering", and the research project name is "( EZBARO) Characteristics of Diabetes in Women and Improvement of Pancreatic Beta Cell Functions According to Pregnancy and Lactation", organized by the "Korea Advanced Institute of Science and Technology", and the study period is 2018.09.01-2019.02.28.

This patent application claims priority to Korean Patent Application No. 10-2019-0048126 filed with the Korean Intellectual Property Office on April 25, 2019, the disclosure of which is incorporated herein by reference.

The present invention relates to a knockout mouse and a method for preparing the same.

Serotonin (5-hydroxytryptamine [5-HT]) is a monoamine neurotransmitter synthesized from the essential amino acid tryptophan. The biosynthesis of 5-HT is regulated by tryptophan hydroxylase (TPH), which is a rate-regulating enzyme for the production of 5-HT enzyme. Since the discovery of two isoforms of TPH (TPH1 and TPH2) that exhibit distinct tissue expression patterns, it is well known that the central and peripheral 5-HT systems are functionally distinct. This spatial separation is due to the fact that 5-HT does not cross the blood brain barrier; Thus, 5-HT is biosynthesized centrally by TPH2 and peripherally by TPH1. On the other hand, 5-HT has various functions in both neural and peripheral tissues. Neuronal 5-HT is known to regulate sleep, mood and appetite, which are under the control of the central nervous system, as well as to regulate gastrointestinal motility, which is regulated by the enteric neuvous system. In contrast to the well-known function of neuronal 5-HT, the role of 5-HT in peripheral tissues has not yet been clearly elucidated. Peripheral 5-HT has been shown to modulate liver regeneration, bone formation, immune response and energy metabolism. More than 90% of 5-HT in the human body is peripheral 5-HT, and the majority is produced by enterochromaffin cells in the intestinal mucosa and stored in platelets. Recent studies have shown that pancreatic beta cells and adipocytes are catalyzed by TPH1 to produce 5-HT.

To study the function of 5-HT in peripheral tissues, several Tph1 knockout (KO) alleles were generated in mice. The first Tph1 KO mice demonstrated the duality of the 5-HT system spatially separated into neural and peripheral compartments. These mice lacked the ability to regenerate the liver and had impaired insulin secretory function. Studies in other systemic Tph1 KO mice have revealed an important role of peripheral 5-HT in cardiac function and fetal development. Yadav and co-workers created the first conditional Tph1 KO allele to discover previously unknown functions of 5-HT in bone regulation and energy metabolism. Although the initial Tph1 floxed allele proved useful for studying the function of peripheral 5-HT in other tissues, the resulting Tph1 KO mice still contained 5-HT-positive cells in the intestinal mucosa, indicating residual 5-HT synthesis. , and thus the intestinal TPH1 activity was incompletely disrupted.

All KO mice available to date have been generated by targeting exon 2 and/or exon 3 instead of exon 5 and 6, exons 5 and 6 encoding the catalytic domain of TPH1. Thus, all previously generated Tph1 KO alleles could potentially express an aberrantly spliced Tph1 transcript comprising exons 5 and 6 and catalyze TPH1 despite deletion of exons 2 and/or 3 of Tph1. A protein with activity was produced. Therefore, there is a need to develop a new Tph1 knockout mouse in which the production of 5-HT is completely removed.

Republic of Korea Patent No. 10-1748575

While studying the function of 5-HT in peripheral tissues, the present inventors confirmed that 5-HT production was not completely eliminated in conventional Tph1 knockout mice, and obtained novel Tph1 knockout mice in which 5-HT production was completely stopped. tried to develop. As a result, by identifying that 5-HT production was completely eliminated in knockout mice targeting exon 5 and exon 6 of the Tph1 gene, the present invention was completed.

In addition, the present inventors developed a mouse in which the Tph1 or Htr gene is knocked out in a pancreas-specific manner to identify the mechanism and type of serotonin receptor (HTR) essential for β cell proliferation in mice, before and after birth and β cells of adult mice. Proliferability was observed. As a result, in mice in which the Tph1 gene or the Htr2b gene was knocked out specifically for the pancreas, β The present invention was completed by finding that cell proliferation was reduced and their phenotypes were similar.

Accordingly, it is an object of the present invention to provide a novel Tph1 knockout mouse and a preparation method thereof.

Another object of the present invention is to provide a mouse in which the Htr2b gene is knocked out and a method for preparing the same.

According to one aspect of the present invention, the present invention provides a transgenic animal in which exon 5 and exon 6 of the Tph1 gene are knocked out.

In one embodiment of the present invention, the Tph1 gene (mRNA) can be identified in NCBI Reference sequence NM_009414.3.

In one embodiment of the present invention, exon 5 and exon 6 of the Tph1 gene consists of sequences 845-912 and nucleotide sequences 913-1109 of SEQ ID NO: 11, respectively.

In another embodiment of the present invention, the transgenic animal is a tissue-specific Tph1 gene knockout, and the tissue is a pancreatic β cell.

In another embodiment of the present invention, the transgenic animal is a mouse, but is not limited thereto.

In a specific embodiment of the present invention, the transgenic animal is Tph1 fl/fl x Insulin2-Cre +/- mouse (Tph1 beta cell specific knockout mouse, Tph1 βKO mouse) or Tph1 fl/fl x Pdx1-CreER +/- mouse It may be a mouse (Tph1 beta cell specific inducible knockout mouse, Tph1 βiKO mouse).

The Tph1 fl/fl x Insulin2-Cre +/- mouse (Tph1 beta cell specific knockout mouse, Tph1 βKO mouse) is a transgenic mouse in which the Tph1 gene is removed from birth, and the Tph1 fl/fl x Pdx1-CreER + // Mouse (Tph1 beta cell specific inducible knockout mouse, Tph1 βiKO mouse) is a transgenic mouse in which target gene knockout is induced when tamoxifen is administered after birth.

In another embodiment of the present invention, the transgenic animal may be used as a model for metabolic diseases such as type 2 diabetes, nonalcoholic fatty liver disease and hepatitis or metabolic syndrome, but the use is not limited thereto.

According to another aspect of the present invention, the present invention provides a method for producing a tissue-specific Tph1 gene knockout mouse comprising the following steps:

(a) crossing a Tph1 floxed mouse in which loxp sites are inserted on both sides of exon 5 and exon 6 of Tph1 and a mouse that specifically expresses Cre-recombinase; and

(b) obtaining a next-generation mouse obtained as a result of the crossing.

In one embodiment of the present invention, the tissue-specifically expressing Cre-recombinase mouse is an Insulin2-Cre mouse expressing pancreatic-specific Cre-recombinase.

In another embodiment of the present invention, the tissue-specific knockout tissue is a pancreatic β cell.

In a specific embodiment of the present invention, the present inventors purchased embryonic stemm cells having the same genomic structure as Tph1 ^tm1a of FIG. 2A , and implanted in a surrogate mother to produce mice. A mouse having the produced Tph1 ^tm1a genome is crossed with a mouse expressing Flippase, the gene between FRT is removed, and then crossed with a β-cell-specific Cre-recombinase-expressing Insulin2-Cre mouse. . In the progeny obtained by the cross, exon 5 and exon 6 of Tph1 targeted to both sides of loxp in the genome are removed. Thus, β-cell-specific Tph1 KO mice can be obtained.

In the Tph1 βKO mouse of the present invention, it was confirmed that the mRNA expression of Tph1 was decreased in the pancreas on the day of birth (Postnatal day 0, P0), and thus Tph1 was knocked out. In addition, it was confirmed that 5-HT (serotonin) was removed from the result of immunofluorescent staining (IF, immunofluorescent), and it was confirmed that serotonin production was suppressed in pancreatic beta cells of Tph1 βKO mice.

There was no difference in body weight between the Tph1 βKO mouse and the wild-type mouse of the present invention, and the glucose tolerance test (GTT) showed a delayed decrease in blood glucose in the Tph1 βKO mouse, indicating a type 2 diabetes phenotype. On the other hand, it is characteristic that there is no difference in insulin tolerance test (ITT) in Tph1 βKO mice.

In addition, the Tph1 βKO mouse of the present invention exhibits a phenotype similar to type 2 diabetes because the amount of pancreatic beta cells is reduced to less than half.

In addition, in the Tph1 βKO mouse of the present invention, it was found that the insulin secretion ability of Tph1 βKO was decreased in a glucose stimulated insulin secretion (GSIS) test for evaluating the insulin secretion ability of pancreatic beta cells. That is, the absence of serotonin in pancreatic beta cells causes a problem in insulin secretion, and in this respect, the Tph1 βKO mouse of the present invention exhibits a phenotype similar to type 2 diabetes.

In addition, it was confirmed through H&E staining and immunofluorescence staining that the Tph1 βKO mouse of the present invention had a decreased amount of β cells on the day of birth (P0), and the proliferation ability of β cells was confirmed by phosphohistone H3 (pHH3) and Ki-67. As a result, it was confirmed that the beta cell proliferation ability was reduced in Tph1 βKO. Therefore, the Tph1 βKO of the present invention can be usefully used as a model for the onset of type 2 diabetes in adults due to a decrease in the amount and proliferative capacity of beta cells before and after birth.

As a result of measuring the mRNA level of cyclin, which is another indicator for evaluating the β cell proliferation ability of the Tph1 βKO mouse of the present invention, it was decreased in the Tph1 βKO mouse, indicating that the β cell proliferative ability was reduced.

In addition, as confirmed in the modified STAM mouse model of the present invention, a decrease in pancreatic beta cells causes nonalcoholic fatty liver, hepatitis, liver fibrosis and/or cirrhosis. As a result of this decrease, since the amount of beta cells is reduced, it can be usefully used as a model animal for nonalcoholic fatty liver disease and hepatitis.

According to another aspect of the present invention, the present invention provides a transgenic animal in which the Htr2b gene is knocked out.

In one embodiment of the present invention, the Htr2b gene is exon 2 is knocked out, but is not limited thereto.

In addition, the Htr2b gene (mRNA) can be identified in NCBI Reference sequence NM_008311.3.

In one embodiment of the present invention, exon 2 of the Htr2b gene consists of nucleotide sequences 103-685 of SEQ ID NO: 12.

The transgenic animal of the present invention is a tissue-specific Htr2b gene knockout, specifically, a pancreatic β cell-specific Htr2b gene knockout.

In one embodiment of the present invention, the transgenic animal is preferably a mouse, but is not limited thereto, and all animals including monkeys, pigs, horses, cattle, sheep, dogs, cats, rabbits, etc. may correspond to this. can

In a specific embodiment of the present invention, the transgenic animal is Htr2b fl/fl x Insulin-Cre +/- mouse (Htr2b beta cell specific knockout mouse, Htr2b βKO mouse) or Htr2b fl/fl x Pdx1-CreER +/ - Mouse (Htr2b beta cell specific inducible knockout mouse, Htr2b βiKO mouse).

The transgenic animal is an Htr2b fl/fl x Insulin-Cre +/- mouse (Htr2b beta cell specific knockout mouse, Htr2b βKO mouse) is a transgenic mouse in which the Htr2b gene has been removed from birth, and the Htr2b fl/fl x Pdx1 -CreER +/- mice (Htr2b beta cell specific inducible knockout mouse, Htr2b βiKO mouse) are transgenic mice in which target gene knockout is induced when tamoxifen is administered after birth.

In another embodiment of the present invention, the transgenic animal may be used as a model for type 2 diabetes, non-alcoholic fatty liver disease, hepatitis, or metabolic syndrome, but the use is not limited thereto.

According to another aspect of the present invention, the present invention provides a method for preparing a mouse in which the tissue-specific Htr2b gene is knocked out, comprising the following steps:

(a) crossing Htr2b floxed mice in which loxp sites are inserted on both sides of exon 2 of Htr2b and a mouse that specifically expresses Cre-recombinase; and

(b) obtaining a next-generation mouse obtained as a result of the crossing.

In one embodiment of the present invention, the tissue-specifically expressing Cre-recombinase mouse is an Insulin2-Cre mouse expressing pancreatic-specific Cre-recombinase.

In another embodiment of the present invention, the tissue-specific knockout tissue is a pancreatic β cell.

The present inventors crossed an Htr2b floxed mouse with an Insulin Cre mouse to prepare an Htr2b beta cell-specific knockout ( Htr2b βKO) mouse of the present invention. The Htr2b floxed mice were obtained from Professor Gerard Karsenty of Columbia University.

The Htr2b βKO mouse of the present invention did not show a weight difference with the control group, and on a glucose tolerance test (GTT), the Htr2b βKO mouse had a phenotype similar to type 2 diabetes due to worsening of blood sugar. On the other hand, Htr2b βKO mice showed no difference in phenotype on ITT (insulin tolerance test), and there was no difference in insulin resistance.

In addition, the amount of β cells of the Htr2b βKO mice of the present invention was reduced to less than half, indicating a phenotype similar to type 2 diabetes.

In addition, it was found that the Htr2b βKO mouse of the present invention had decreased insulin secretion in a GSIS (glucose stimulated insulin secretion) test that evaluates the insulin secretion ability of pancreatic β cells. That is, the absence of serotonin in pancreatic beta cells causes a problem in insulin secretion, and in this respect, the Htr2b βKO mouse of the present invention exhibits a phenotype similar to that of type 2 diabetes.

In addition, it was confirmed through H&E staining and immunofluorescence staining that the amount of Htr2b βKO beta cells in the Htr2b βKO mice of the present invention was reduced on the day of birth, and the proliferation ability of beta cells was confirmed by phosphohistone H3 (pHH3) and Ki-67. was confirmed, and it was confirmed that beta cell proliferation was reduced in Htr2b βKO mice. Therefore, the Htr2b βKO mouse of the present invention can be usefully used as a model for the onset of type 2 diabetes in adults due to a decrease in the amount and proliferative capacity of beta cells before and after birth.

In addition, as confirmed in the modified STAM mouse model of the present invention, the decrease in pancreatic beta cells causes non-alcoholic fatty liver, hepatitis, liver fibrosis and/or cirrhosis. It can also be usefully used as a model animal for hepatitis.

Accordingly, according to another aspect of the present invention, the present invention provides a method for screening a therapeutic agent for a metabolic disease comprising the steps of:

(a) administering a metabolic disease treatment candidate to the transgenic animal in which the Tph1 or Htr2b of the present invention is knocked out;

(b) measuring an index for a disease by comparing the transgenic animal administered with the candidate substance with a control animal not administered with the candidate substance; and

(c) determining the candidate substance as a therapeutic agent for metabolic diseases when the indicator is improved in the transgenic animal administered with the candidate substance compared to the control animal.

In the present invention, the "candidate substance" means a substance to be tested as a therapeutic agent for a metabolic disease, for example, the candidate substance to be analyzed in the present invention includes various substances. For example, the candidate substances include, but are not limited to, chemicals, proteins, peptides, antibodies, nucleic acids, and natural extracts. A candidate to be analyzed by the screening method of the present invention may be a single compound or a mixture of compounds (eg, a natural extract or a cell or tissue culture). Candidates can be obtained from libraries of synthetic or natural compounds. Methods for obtaining libraries of such compounds are known in the art. Synthetic compound libraries are commercially available from Maybridge Chemical Co. (UK), Comgenex (USA), Brandon Associates (USA), Microsource (USA) and Sigma-Aldrich (USA), and libraries of natural compounds are available from Pan Laboratories (USA). ) and MycoSearch (USA). Candidate substances such as proteins and peptides can be obtained by various combinatorial library methods known in the art, for example, biological libraries, spatially addressable parallel solid phase or solution phase libraries (spatially addressable parallel solid phase or solution phase libraries) , a synthetic library method requiring deconvolution, a "1-bead 1-compound" library method, and a synthetic library method using affinity chromatography selection. Methods for synthesizing molecular libraries are described in DeWitt et al., Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al. Proc. Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckermann et al., J. Med. Chem. 37, 2678, 1994; Cho et al., Science 261, 1303, 1993; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2059, 1994; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2061; Gallop et al., J. Med. Chem. 37, 1233, 1994, et al.

In the present invention, the metabolic disease includes, but is not limited to, type 2 diabetes, non-alcoholic fatty liver disease and hepatitis, or metabolic syndrome.

In the present invention, the "indicator for disease" refers to the result of a test routinely performed in the art in relation to the above-described metabolic disease. For example, in the case of diabetes, it means the results of a blood sugar test and glucose tolerance test after fasting, and in the case of hyperlipidemia among dyslipidemias, it means the results of total cholesterol, LDL cholesterol, HDL cholesterol, triglyceride test, and the like. In the case of obesity, this includes weight or body mass index (BMI). In addition, in the case of fatty liver, it refers to the results of changes in ALT, AST, or blood bilirubin concentration, the distribution of fat in the liver tissue by abdominal ultrasound and liver biopsy, and ballooning, fibrosis, and inflammatory cell infiltration in the case of hepatitis. do.

In the present invention, the transgenic animal used in the screening method is treated to induce the onset of a metabolic disease. For example, the transgenic animal may be fed a high-fat diet.

In the present invention, the transgenic animal used in the screening method is the same as the above-described transgenic animal of the present invention, and therefore, descriptions of common contents among them are omitted to avoid excessive complexity of the present specification.

The present invention provides a Tph1 or Htr2b knockout mouse and a method for preparing the same.

The Tph1 or Htr2b knockout mouse of the present invention has a high knockout efficiency of a target gene and has a reduced proliferative ability of β cells of the pancreas, so it can be usefully used in the study of various metabolic diseases, including type 2 diabetes and metabolic syndrome.

1a to 1g are Tph1 ^tm1kry Tph1 KO mice constructed using 1A shows the genetic structure of Tph1 ^tm1kry . Figure 2b shows wild-type and Tph1 ^tm1kry The concentration of 5-HT in the jejunum of GKO mice is shown ( n = 3-7 per group). All data are expressed as mean ± standard deviation. (** P < 0.01 vs. wild-type, Student's t -test). Figure 1c shows wild-type and Tph1 ^tm1kry The results of immunohistochemical staining showing 5-HT in the jejunum of GKO mice are shown. Scale bar, 50 μm.
1d is Tph1 ^tm1kry The results of immunohistochemical staining of pancreatic islets from βKO mice are shown (n = 3 per group). Pancreatic sections were stained with insulin (green) and 5-HT (red). Control: MIP-Cre-hGH; βKO: Tph1 ^tm1kry βKO. Scale bar, 50 μm.
1E shows the amino acid sequence of TPH1. Red text indicates overlapping splicing locations; RD, regulatory domain; CD, catalytic domain; TD, tetramerization domain. 1f shows Tph1 transcripts and Tph1 ^tm1kry from wild-type mice. The results of amplifying the duodenal KO transcript of GKO mice by RT-PCR using Tph1 Exon1 forward and Tph1 Exon11 reverse primers are shown. An empty triangle indicates 1000 bp, and a black triangle indicates 1500 bp. Figure 1g is Tph1 ^tm1kry The results of detection of TPH1 (50 kD) and cleaved TPH1 (37 kD) by immunoblot analysis from pancreatic islets of βKO mice and hetero βKO mice are shown.
2a to 2e relate to the construction of a novel Tph1 floxed mouse model. 2A is a schematic diagram of a targeting strategy for construction of novel Tph1 floxed mice. 2b shows Tph1 ^tm1a and Tph1 ^tm1c It is a diagram showing the genotyping of a mouse. 1c shows Tph1 ^tm1c A diagram showing the genotyping of pancreatic islets in βKO mice. Empty triangles represent 500 bp and black triangles represent 1000 bp. 2d and 2e show wild-type and Tph1 ^tm1a A diagram showing the results of X-gal staining in mouse brain (2d) and small intestine (2e) (n = 3 mice per group). The red circle is the pineal grand. Images were taken using a stereomicroscope).
3a to 3c are Tph1 ^tm1a Expression of Tph1 and 5-HT levels in mice are shown. Figure 3a is Tph1 ^tm1a The Tph1 mRNA level in the mouse jejunum was measured by quantitative real-time RT-PCR, and the result is expressed relative to the Tph1 mRNA level of the wild-type mouse. Figure 3b shows wild-type mice and Tph1 ^tm1a. 5-HT 1 immunohistochemical staining in the jejunum of mice is shown. Scale bar, 50 μm. Figure 3c shows 5-HT levels in serum, jejunum, and brain measured by LC-MS/MS. All data are presented as mean ± standard deviation ( n = 5-8 per group; * P < 0.05, ** P < 0.01, and *** P < 0.001 vs. Tph1 +/+, Student's t -test).
4a to 4d are diagrams showing Tph1 expression and 5-HT levels in newly prepared Tph1 floxed mice. Figure 4a shows wild-type mice and Tph1 ^tm1c GKO Tph1 mRNA levels in the duodenum, jejunum, ileum, and colon of mice were measured by quantitative real-time RT-PCT and expressed as relative values compared to wild-type (n = 3-5 per group). Figure 4b shows the results of measuring 5-HT levels in the duodenum, jejunum, ileum, colon, and brain by LC-MS/MS (n = 3-8 per group). All data were expressed as mean ± standard deviation (** P < 0.01, *** P < 0.001 vs. wild type, Student's t -test). Figure 4c shows wild-type mice and Tph1 ^tm1c Representative immunohistochemical staining for 5-HT in duodenum, jejunum, ileum, and colon of GKO mice. Scale bar, 50 μm. 4D shows representative immunofluorescence staining results in pancreatic islets of MIP-Cre-hGH (Control) and Tph1 ^tm1c βKO mice (n = 3 per group). Pancreatic sections were stained with insulin (green) and 5-HT (red). Scale bar, 50 μm.
5A to 5F show that serotonin regulates β cell mass and proliferation in the perinatal period. 5A is a diagram showing the histology of human perinatal pancreas by immunohistochemical staining for H&E and 5-HT (24 weeks of pregnancy, 8 days of age, and 3 months of age). FIG. 5b is a diagram showing immunofluorescence images of perinatal islets obtained from C57BL6/J mice. Green represents insulin and red represents 5-HT. 5c to 5f are diagrams evaluating the pancreas of the control group and Tph1 βKO mice at 0 days of age (P0). Figure 5c is a diagram showing the whole pancreas by H&E and immunofluorescence staining. Insulin is shown in green, and amylase is shown in red. FIG. 5D is a diagram illustrating the result of quantifying the β cell mass as a percentage of the β cell area to the total pancreatic area. Figure 5e is an immunofluorescence image of β cell proliferation. Insulin is shown in green, phosphor-histone H3 (phosphor-Histone H3, PHH3) is shown in red, and the arrows indicate cells that are positive for both insulin and PHH3. Its quantification was expressed as the percentage of cells positive for both insulin and PHH3 in all β cells. Figure 5f is a diagram showing the mRNA expression of the cyclin family (cyclin family) in the pancreas of P0 by qRT-PCR. Data are presented as mean ± standard deviation. * P <0.05, ** P <0.01 and *** P <0.001.
6A to 6F show that serotonin determines β cell mass in adults and maintains glucose homeostasis. 6A is a diagram showing blood glucose measured after intraperitoneal glucose injection (2 g/kg) after 16 hours of fasting in 9-week-old male control mice and 9-week-old male Tph1 βKO mice. do 6b is a diagram showing plasma insulin levels measured after intraperitoneal glucose injection (2 g/kg) after fasting for 16 hours in 9-week-old male control mice and 9-week-old male Tph1 βKO mice. 6c is a diagram showing the results of ex vivo GSIS analysis of 9-week-old male control mice and 9-week-old male Tph1 βKO mice. Insulin secretion after administration of 2.8 mM or 16.8 mM glucose was expressed as a multiple of the basal insulin secretion. 6D is a diagram illustrating quantification of β cell mass as a percentage of the β cell area to the total pancreatic area of a 9-week-old male control mouse and a 9-week-old male Tph1 βKO mouse. FIG. 6e is a diagram showing the β cell proliferation of 9-week-old male control mice and 9-week-old male Tph1 βKO mice using immunofluorescence images and quantitative results. Insulin is green, Ki-67 is red, and arrows indicate cells that are positive for both insulin and Ki-67. Figure 6f shows the results of a 9-week-old male control mouse and a 9-week-old male Tph1 βKO mouse. A diagram showing the weight of the pancreas. Data are presented as mean ± standard deviation. * P <0.05, ** P <0.01 and *** P <0.001.
7A to 7J show that serotonin receptor 2b (HTR2B) is a downstream target of 5-HT in perinatal β cells. Figure 7a is a diagram showing the mRNA expression of HTR in the development of the pancreas evaluated by qRT-PCR. 7B is a diagram showing the pancreas of 0 days (Postnatal day 0, P0) of control and Htr2b βKO mice by H&E staining. 7c is a diagram showing the β-cell mass of the pancreas at 0 days old (Postnatal day 0, P0) of control and Htr2b βKO mice. Figure 7d is a diagram showing the pancreas weight at 0 days (Postnatal day 0, P0) of the control group and Htr2b βKO mice. 7e is a diagram showing immunofluorescence images and quantitative results of β cell proliferation in the pancreas at 0 days of age (Postnatal day 0, P0) of control and Htr2b βKO mice. Insulin is shown in green, PHH3 is shown in red, and arrows indicate cells that are positive for both insulin and PHH3. Quantitative results indicated the percentage of cells positive for both insulin and PHH3 among all β cells. 7f is a diagram showing blood glucose measured after intraperitoneal glucose injection (2 g/kg) after fasting for 16 hours in 9-week-old male control mice and 9-week-old male Htr2b βKO mice. 7G is a diagram showing plasma insulin levels measured after intraperitoneal glucose injection (2 g/kg) after 16 hours of fasting in 9-week-old male control mice and 9-week-old male Htr2b βKO mice. 7h is a diagram showing the results of ex vivo GSIS analysis of 9-week-old male control mice and 9-week-old male Htr2b βKO mice. Insulin secretion after administration of 2.8 mM or 16.8 mM glucose was expressed as a multiple of the basal insulin secretion. 7I is a diagram illustrating quantification of β cell mass as a percentage of β cell area to total pancreatic area of 9-week-old male control mice and 9-week-old male Htr2b βKO mice. 7j is a diagram showing the weight of the pancreas of a 9-week-old male control mouse and a 9-week-old male Htr2b βKO mouse. Data are presented as mean ± standard deviation. * P <0.05, ** P <0.01 and *** P <0.001.
Figure 8a is a diagram showing blood glucose after intraperitoneal glucose injection (2 g/kg) in 12-week-old mice fed a high-fat diet for 4 weeks after fasting for 16 hours. Figure 8b is a diagram showing blood glucose after intraperitoneal glucose injection (2 g/kg) in 12-week-old mice fed a high-fat diet for 8 weeks after fasting for 16 hours. FIG. 8c is a diagram showing β cell proliferation after 7 days of administration of S-961, an insulin receptor antagonist, to these mice. Quantitative results of β cell proliferation were expressed as a percentage of cells positive for both insulin and Ki-67 relative to total β cells. 8D to 8E are diagrams showing the 0-day-old pancreas of control, Prlr βKO, Stat5 βKO, and Ghr βKO mice. 8D is a diagram showing 5-HT (red) and insulin (green) immunofluorescence staining of 0-day-old pancreas of a control group, Prlr βKO, Stat5 βKO, and Ghr βKO mice. 8E is a diagram showing immunofluorescence images for H&E staining and β cell proliferation of 0-day-old pancreas of a control group, Prlr βKO, Stat5 βKO, and Ghr βKO mice. Insulin is shown in green, phosphor-histone H3 (PHH3) is shown in red, and arrows indicate cells positive for both insulin and PHH3. FIG. 8f is a diagram showing the percentage of cells positive for both insulin and PHH3 among all the β cells of the quantitative results of β cell proliferation in the 0-day-old control group and Ghr βKO mice. FIG. 8G is a diagram showing the quantification results of the β cell mass of the 0-day-old control group and the Ghr βKO mouse as a percentage of the β cell area to the total pancreatic area. 8H is a schematic diagram of the GHR-STAT5-TPH1-HTR2B axis of β cell proliferation during perinatal period. Data are presented as mean ± standard deviation. * P <0.05, ** P <0.01 and *** P <0.001.
9A-9B show that serotonin is produced in human and mouse β cells during the perinatal period. 9A is a result of immunofluorescence staining of a fetal pancreas at 14 weeks of gestation. Insulin (green), glucagon (grey) and 5-HT (red). 9B is a diagram showing the expression of Tph1 and Tph2 mRNA transcripts in the C57BL6/J pancreas during the perinatal period.
10A-10E show the perinatal characteristics of Tph1 β KO. Figure 10a is a diagram showing the expression of Tph1 mRNA in the control group and Tph1 βKO pancreas on the day of birth (P0). 10B is a diagram showing the IF staining results of 5-HT of control and Tph1 βKO pancreatic islets at P0 and during pregnancy (14 days). 1c is a diagram showing the results of day-of-birth immunostaining of the control group and Tph1 βKO for β cell markers (PDX1 and NKX6.1). Figure 10d is a diagram showing the pancreas weight at P0. 10E is a diagram showing TUNEL IF staining of Tφ1 βKO and Htr2b βKO at P0. Apoptosis was rare in all samples, and the portion treated with DNase was used as a positive control.
11A-11C show the adult phase characteristics of Tph1 β KO. Fig. 11a shows body weight, and Fig. 11b shows the results of an intraperitoneal insulin resistance test (0.75 U/kg) after 6 hours of fasting. 11C is a diagram showing the results of immunostaining of β cell markers (PDX1 and NKX6.1).
Figure 12a is a diagram showing the quantification of the beta cell proliferation capacity of Htr1b KO mice as a percentage of cells positive for both insulin and pHH3 on the day of birth. 12B is a diagram illustrating the beta cell proliferation ability of Htr1d KO mice by quantification as a percentage of cells positive for both insulin and pHH3 on the day of birth.
13A-13C show the adult phase characteristics of Htr2b β KO. Figure 13a shows the body weight, Figure 13b shows the results of an intraperitoneal insulin resistance test (0.75 U/kg) after 6 hours of fasting. 13C is a diagram showing the results of immunostaining of β cell markers (PDX1 and NKX6.1).
14 is a diagram showing a method for producing a modified STAM mouse model of the present invention and a phenotype thereof.
15 is a diagram showing the change in the amount of pancreatic beta cells before and after administration of STZ (streptozotocin) through insulin immunostaining.
16 is a diagram showing the effect of STZ administration on blood glucose after fasting in mice.
17 is a diagram showing the effect of STZ administration on the liver of mice.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example

Throughout this specification, "%" used to indicate the concentration of a specific substance is (weight/weight) % for solid/solid, (weight/volume) % for solid/liquid, and Liquid/liquid is (volume/volume) %.

Example 1: Construction of Tph1 KO mice

1-1. Construction of Tph1 KO mice

Tph1-targeted embryonic stem (ES) cell clone EPD0195_1_C03 was obtained from the trans-NIH Knock-Out Mouse Project (KOMP). The mutant Tph1 allele (Tph1 ^{tm1a (KOMP) Wtsi} ) contains an En2 SA, FRT site, loxP site, lacZ and neomycin cassette inserted into an intron located between exons 4 and 5 of the Tph1 gene (Fig. 2a).

Target ES cells were injected into blastocysts of BALB/c mice, and C57BL/6N × BALB/c chimeric Founders carrying the Tph1 ^{tm1a (KOMP) Wtsi} allele were crossed with C57BL/6J mice. Germline transmission in F1 mice was analyzed and the identified progeny were crossed with transgenic flippase mice to recombine the LacZ exon trap and the FRT site adjacent to the neomycin resistance cassette. Mice carrying the FRT-KO allele ( Tph1 ^{tm1c (KOMP) Wtsi} ) were crossed with the indicated tissue-specific Cre mice. Tph1 ^tm1a Mice carrying the ( ^{KOMP) Wtsi} or Tph1 ^{tm1c (KOMP) Wtsi} allele were backcrossed and maintained in the C57BL/6J genetic background.

Hereinafter, the mutant allele is Tm1a ( Tph1 ^{tm1a (KOMP) Wtsi} ), tm1c ( Tph1 ^{tm1c (KOMP) Wtsi} ) and tm1d ( Tph1 ^{tm1d (KOMP) Wtsi} ), the mutant allele, Tph1 ^{tm1a (KOMP) Wtsi} or Tph1 ^{tm1c (KOMP) Wtsi} -bearing mice are abbreviated as Tph1 ^tm1a mice and Tph1 ^tm1c mice, respectively.

Primers used for genotype analysis are listed in Table 1.

primer order SEQ ID NO Tph1 forward TTCTGACCTGGACTTCTGCG One Tph1 reverse GGGGTCCCCATGTTTTGTAGT 2 36B4 forward TCCAGGCTTTGGGCATCA 3 36B4 reverse CTTTATCAGCTGCACATCACTCAGA 4 CSD-Tph1-F TCAACATAGCCCTGAGCTCCTTAGC 5 CSD-neo-F GGGATCTCATGCTGGAGTTCTTCG 6 CSD-Tph1-ttR ATGCAAAGCTCCTACAGTGACAACG 7 CSD-Tph1-R CACATTCCCTTGCAACTCTGCTACC 8 Tph1 exon1 forward GACTCTTTAAACTCCAGTGG 9 Tph1 exon11 reverse TCACACACTGGGCCACCTGG 10

1-2. animal care

Tph1 ^tm1kry (MGI: 3837399), Villin-Cre (MGI: 2448639), and MIP-Cre-hGH mice were bred in a specific pathogen-free barrier facility (SPF) under a climate-controlled environment with a 12-hour light-dark cycle, general food and water. was fed indefinitely. All mouse studies were approved by the Institutional Animal Care and Use Committee of the Korea Advanced Institute of Science and Technology, and all experiments were performed according to the relevant guidelines and regulations.

1-3. Preparation of Serum and Tissue for Measurement of Levels of 5-HT

Blood samples obtained from posterior orbital bleeding in mice were collected in serum-separation tubes (BD, 365967). Blood was clotted at room temperature for 15 minutes and then centrifuged at 2000 × g for 10 minutes at 4°C. The collected serum was mixed with methanol in a ratio of 1:9 and centrifuged at 12000 × g for 15 minutes at 4°C. The resulting supernatant was immediately frozen and stored at -80 °C until further analysis. The duodenum, jejunum, ileum, and colon were dissected and washed with phosphate-buffered saline (PBS). The pineal gland was excised from the brain. The duodenum, jejunum, ileum, colon, and brain were homogenized in RIPA buffer (Thermo Fisher Scientific) using a FastPrep-24 bead homogenizer (MP Biomedicals) and centrifuged at 12,000 × g at 4 °C for 5 min. The supernatant was mixed with methanol in a 1:1 ratio, centrifuged at 12000 × g at 4 °C for 15 min, then immediately frozen and stored at 80 °C until further analysis. The supernatant aliquot (100 μL) was transferred to a new sample tube and used for protein quantification by BCA analysis according to the manufacturer's (Thermo Fischer Scientific) protocol. A separate 100-μL aliquot of the supernatant was transferred to a clean sample tube and mixed with 300 ml of HPLC-level pure methanol (Sigma-Aldrich). After mixing, centrifugation was performed at 12000 × g at 4 °C for 15 min. A 100 μL supernatant sample was used to measure 5-HT by isotope-dilution liquid chromatography-mass spectrometry (LC-MS). For this assay, 20 μL of a 1 mg/kg 5-HT-α,α,β,β-d4 Creatinine Sulfate complex solution (CDN isotopes Inc.) was added to the sample solution and 100 μL of methanol was added. After mixing, the sample was distilled in vacuo. The residue was dissolved in 50 μL of distilled water, filtered through a disposable syringe filter, and then put into an LC-MS system for analysis.

LC-MS/MS analysis was performed at the Korea Research Institute of Standards and Science using an ACQUITY series UPLC system connected to a Xevo TQ-S electrospray ionization triple quadrupole-mass spectrometer (Waters, Waltham, MA, USA). carried out The sample was placed in a Capcell core ADME column (2.1 mm ID × 100 mm, 2.6 μm; Shiseido, Japan), and 75% mobile phase A (30 mM ammonium formate): 25% mobile phase B (methanol) to 60% mobile phase A: 40% Elution was carried out at a rate of 400 μL/min for 3 min with a linear gradient to mobile phase B, followed by a wash step with 20% mobile phase A:80% mobile phase B for 1 min, followed by re-equilibration for 1 min. The dose was 3 μL, and the ionic changes ( m/z ) of 5-HT and its isotopes were 159.8 > 104.9 and 163.8 > 109.1, respectively.

Prior to sample analysis, source ionization and fragmentation parameters were optimized by monitoring the MS signal. Analysis software MassLynx (Version 4.1; Waters) was used for data acquisition and system manipulation. The concentration of 5-HT was normalized to the corresponding protein concentration.

1-4. X-gal staining

X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside) staining was performed as described by Seymour et al. The brain and small intestine were fixed by placing them in ice-cold tissue fixative (4% paraformaldehyde, 2 mM MgSO4, 5 mM EGTA) for 1 hour. The fixed tissue was washed with rinse solution A (2 mM MgCl2, 5 mM EGTA in buffer) for 30 min at room temperature, and rinse solution B (2 mM MgCl2, 0.01% w/v sodium deoxycholate, 0.02% w/v Nonidet P-) 40 in buffer) for 5 minutes at room temperature. Then, the tissue was stained with staining reagent (2 mM MgCl2, 0.01% sodium deoxycholate, 0.02% Nonidet P-40, 5 mM K3Fe(CN)6, 5 mM K4Fe(CN)6·6H2O, and 1 mg/mL X-gal in 100 mM Sorensen's phosphate buffer, pH 7.4) and incubated overnight at 37 °C. The stained tissue was washed 3 times in PBS. Images were analyzed using a stereomicroscope (SZ61, Olympus).

1-5. Immunohistochemistry and immunofluorescence staining

For immunostaining, first, tissues were fixed in 10% neutral buffered formalin solution (Sigma-Aldrich) for 4 h at room temperature, washed with deionized water at room temperature for 1 h, then embedded in paraffin and sectioned at 4 μm thickness. ) was sliced. After deparaffinization and rehydration, the tissue sections were placed in sodium citrate buffer (10 mM sodium citrate, pH 6.0) and heated to recover antigens, and blocked by incubating in 5% donkey serum for 30 minutes at room temperature. Then, the tissue sections were incubated with guinea pig anti-insulin antibody or rabbit anti-5-HT antibody at 4 °C for 16 h. Immunohistochemical analysis was performed using the VECTASTAIN ABC HRP Kit (PK-4001; Vector Labs) according to the manufacturer's instructions. The sections incubated with the primary antibody were washed with the supplied buffer, and then incubated with the biotinylated anti-rabbit antibody at room temperature for 30 minutes. Tissues were incubated with VECTASTAIN ABC reagent for 30 minutes and then incubated in DAB peroxidase substrate solution (SK-4100; Vector Labs). The sections were then stained and mounted.

For immunofluorescence staining, tissue sections incubated with the primary antibody were washed with PBS and incubated with one of the following secondary antibodies at room temperature for 2 hours:

FITC-conjugated donkey anti-guinea pig IgG (1:1000; Jackson ImmunoResearch), rhodamine-conjugated donkey anti-rabbit IgG (1:1000; Jackson ImmunoResearch), or Alexa Pro 647 donkey anti-mouse IgG (1:1000) ; Jackson Immuno Research). Images were analyzed using a confocal microscope (LSM 780, Carl Zeiss) and a bright field microscope (DS-Ri2; Nikon).

1-6. RT-qPCR

The duodenum, jejunum, ileum and colon were individually homogenized using FastPrep-24, and total RNA was extracted using TRIzol (Thermo Fisher Scientific). cDNA was synthesized from total RNA using High Capacity cDNA Reverse Transcription Kits (Thermo Fisher Scientific). cDNA (10 ng/μl per reaction) was analyzed by real-time PCR using a Viia7 system (Thermo Fisher Scientific) and Power SYBR Green PCR Master Mix (Thermo Fisher Scientific). The primers used for gene expression level analysis are listed in Table 1.

1-7. Immunoblot analysis

Pancreatic islets were isolated and lysed in RIPA buffer containing protease inhibition cocktail (Sigma-Aldrich). Protein concentration was determined using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific). Proteins from whole cell lysates were separated by SDS-PAGE on a 10% polyacrylamide gel and transferred to a polyvinylidene difluoride membrane. The membranes were blocked with 5% (w/v) skim milk in TBST (150 mM sodium chloride, 20 mM Tris, 0.1 % Tween-20, pH 7.6), followed by rabbit anti-TPH1 antibody (1:1000; Cell Signaling, # 12339). Incubated overnight at 4 °C. After washing 3 times (10 min each) with TBST at room temperature, the membrane was incubated with HRP-conjugated anti-rabbit IgG secondary antibody (1:5000; Cell Signaling, # 7074) for 1 hour at room temperature. After washing three times (10 min each) with TBST at room temperature, immunoreactive proteins were detected using a Pierce ECL Plus Western Blotting Substrate (Thermo Fisher Scientific). Images were analyzed using a ChemiDoc MP system (Bio-Rad).

1-8. result

To date, Tph1 ^tm1kry was the only conditional allele that could be used to generate tissue-specific Tph1 KO mice using the Cre-loxP system.

The KO strategy used to generate Tph1 ^tm1kry is to target exons 2 and 3 of the Tph1 gene (Fig. 1a). Although Tph1 ^tm1kry KO mice have been demonstrated to be useful for delineating the function of 5-HT and related phenotypes in the intestine and adipose tissue, we have demonstrated that 5-HT production in the gut of gut-specific Tph1 ^tm1kry KO ( Tph1 ^tm1kry GKO) mice is It was demonstrated that it was not completely stopped. Overall, 5-HT levels were reduced by 54.7%, and 5-HT-positive cells were readily detected in the jejunum of Tph1 ^tm1kry GKO mice (Fig. 1b, Fig. 1c).

As previously reported, we confirmed that 5-HT was easily detected in pancreatic β cells of MIP-Cre-hGH mice by immunofluorescence staining (Fig. 1d) due to increased Tph1 expression. .

To evaluate the KO efficiency of the Tph1 ^tm1kry allele in pancreatic β cells, the present inventors constructed β cell-specific Tph1 ^tm1kry KO ( Tph1 ^tm1kry βKO) mice by crossing Tph1 ^tm1kry mice with MIP-Cre-hGH mice. Immunofluorescence staining showed robust 5-HT production in β cells of MIP-Cre-hGH mice; Notably, this production was not reduced in β cells of Tph1 ^tm1kry βKO mice (Fig. 1d). These data indicate that 5-HT production was not significantly changed even after exons 2 and 3 of the Tph1 ^tm1kry allele were deleted.

Tph1 ^tm1kry βKO and Tph1 ^tm1kry One explanation for the residual TPH1 activity observed in GKO mice is the incomplete deletion of the Tph1 ^tm1kry conditional allele. However, given the high recombination efficiency of Villin-Cre and MIP-Cre-hGH mice, it is more likely because the Cre recombinant Tph1 ^tm1kry allele produces aberrant Tph1 transcripts, encoding proteins with residual TPH1 catalytic activity.

A detailed review of the Tph1 genome structure revealed the presence of methionine in exon 4 that could serve as a start codon to generate a truncated TPH1 protein after deletion of exon 2 and exon 3 in the Tph1 ^tm1kry allele (Fig. 1e).

Reverse transcription polymerase chain reaction (RT-PCR) and subsequent sequence analysis revealed that three splice variants of Tph1 lacking exons 2 and 3 were expressed in the duodenum of Tph1 ^tm1kry GKO mice (Fig. 1f). This transcript contains the start codon of exon 4, which is predicted to produce a polypeptide with the same reading frame as wild-type Tph1.

Actually, Tph1 ^tm1kry Immunoblot analysis of tissue lysates from pancreatic islets from βKO mice revealed the presence of 37 kD cleaved TPH1 protein ( FIG. 1G ). The TPH protein consists of a regulatory domain, a catalytic domain and a tetramerization domain. The cleaved TPH1 contains a catalytic domain and a tetramerization domain. We therefore concluded that sustained 5-HT production in Tph1 ^tm1kry GKO and Tph1 ^tm1kry βKO mice could be attributed to the expression of truncated TPH1 protein as a result of deletion of exons 2 and 3.

Example 2. Construction of new Tph1 floxed mice and analysis of KO efficiency

2-1. Construction of new Tph1 floxed mice

To completely halt 5-HT synthesis by TPH1, we constructed new mice containing the Tph1 ^tm1a allele targeted to exons 5 and 6 encoding the catalytic domain of TPH1. Subsequent Flp-mediated recombination of the Tph1 ^tm1a allele produced the TGF1 ^tm1c allele, which can undergo Cre-mediated deletion of exons 5 and 6 ( FIG. 2A ). The Tph1 ^tm1a allele was detected by PCR amplification of genomic DNA with CSD-neo-F and CSD-Tph1-ttR primers (Fig. 2b), which produced a product of 642 bp.

Generation of the Tph1 ^tm1c allele via Flp-mediated recombination was confirmed by PCR amplification with primers CSD-Tph1-F and CSD-Tph1-ttR generating an 826 bp product (Fig. 2b). We crossed Tph1 ^tm1c mice with MIP-Cre-hGH mice to generate β-cell-specific Tph1 ^tm1c KO ( Tph1 ^tm1c βKO) mice, followed by PCR primers CSD-Tph1-F and CSD-Tph1-R (Fig. 2c). ) was used to confirm deletion of exons 5 and 6 of Tph1 in β cells of Tph1 ^tm1c βKO mice by amplifying a 793 bp genomic fragment. The Tph1 ^tm1a allele contains a splice acceptor sequence designed to express β-galactosidase, according to the endogenous pattern of Tph1 gene expression. A β-galactosidase reporter for endogenous Tph1 gene expression was identified by visualizing β-galactosidase activity using X-gal staining in the pineal gland and intestine ( FIGS. 2D and 2E ).

2-2. Efficiency of Tph1 KO in new Tph1 KO mice

We evaluated the efficiency of Tph1 KO in newly developed Tph1 KO mice.

We examined Tph1 ^tm1a mice, which we initially expected to have had a complete loss of the peripheral 5-HT system. Although the level of Tph1 mRNA was significantly decreased and the number of 5-HT-positive cells decreased, 5-HT-positive cells were still observed in the jejunum (Fig. 3a,b). Serum 5-HT levels were reduced by 91.4%, whereas in jejunum 5-HT levels were reduced by 77.6%. In contrast, as expected, 5-HT levels in the brain were similar to those of wild-type mice ( FIG. 3C ). These data indicate that the clearance of 5-HT synthesis is still incomplete in the gut of Tph1 ^tm1a mice; Thus, some cells from Tph1 ^tm1a mice were able to avoid KO. A similar example in which the exon-trapping approach led to a hypomorphic rather than a null allele includes Slc25a21 KO mice carrying the Slc25a21 ^{tm1a (KOMP) Wtsi} allele.

Next, to evaluate tissue-specific KO efficiency, Tph1 ^tm1c mice were crossed with Villin-Cre and MIP-Cre-hGH mice, respectively, to induce intestinal-specific Tph1 ^tm1c KO mice ( Tph1 ^tm1c GKO) and β cell-specific mice. Tph1 ^tm1c KO mice ( Tph1 ^tm1c βKO) were produced. Tph1 mRNA levels were significantly decreased in the small and large intestine of Tph1 ^tm1c GKO mice (Fig. 4a). Thus, tissue 5-HT levels were substantially reduced in the small and large intestine of Tph1 ^tm1c GKO mice (Fig. 4b). Given the known recombination efficiency of Villin-Cre and the activity of TPH2 in the enteric nervous system, 5-HT synthesis was almost completely stopped in the intestine. In particular, no 5-HT-positive cells were observed in the intestinal mucosa of Tph1 ^tm1c GKO mice or β cells of Tph1 ^tm1c βKO mice (Fig. 4c, d), which almost completely abolished 5-HT production in intestinal and pancreatic β cells. indicates that it has been These data indicate that 5-HT production was completely stopped using the newly constructed Tph1 ^tm1c mouse model.

2-3. discussion

5-HT is responsible for many physiological functions not only in nerve tissue but also in peripheral tissues. So far, it has been thought that gut-derived 5-HT functions primarily in peripheral tissues. However, recent studies have shown that cells in peripheral tissues, including pancreatic beta cells and adipocytes, can synthesize and secrete 5-HT, which plays an important role in local tissues. In pancreatic β cells, 5-HT induces compensatory β cell proliferation and increases glucose-stimulated insulin secretion during pregnancy. In adipose tissue, 5-HT functions as an obesity hormone that reduces energy expenditure and increases lipid accumulation. As such, 5-HT may act in an autocrine or paracrine manner in peripheral tissues.

Research that has elucidated the function of peripheral 5-HT over the past few decades is limited, as most studies have been conducted using traditional Tph1 KO mice or TPH inhibitors or chemicals targeting the 5-HT receptor.

Therefore, developing an efficient tool to analyze the in vivo function of 5-HT in local tissue is a tissue-specific KO strategy for conferring the tissue-autonomous function of 5-HT. It provides great value as an approach.

To date, Tph1 ^tm1kry is the only Tph1 floxed allele that has been used to construct a tissue-specific Tph1 KO model. Tph1 ^tm1kry mice contributed to the initial identification of numerous peripheral functions of 5-HT. However, we found that despite the successful deletion of exons 2 and 3 of Tph1, 5-HT continued to be produced in the target tissues of Tph1 ^tm1kry KO mice. Although previous studies demonstrated that Tph1 ^tm1kry mice were effective, the specific phenotype was unclear in this condition. The amount of 5-HT required to maintain a given physiological function may vary depending on the type of tissue, the phenotype to be observed, or the experimental conditions. Indeed, despite a significant reduction in 5-HT, mammary gland-specific disruption did not appear to alter lactogenesis or alveolar morphology during lactation. In contrast to previous reports, these results indicate that incomplete cessation of 5-HT production affected the phenotype. Thus, intact Tph1 KO mice are essential to unambiguously interpret the full range of effects of Tph1 deletion in specific tissues.

To create a more improved Tph1 conditional allele, we constructed a new Tph1 floxed mouse model, the Tph1 ^tm1c mouse. The Tph1 ^tm1c allele was designed to induce Cre-mediated deletion of exons 5 and 6 encoding the catalytic domain of TPH1. Tph1 ^tm1c mice showed higher KO efficiency in representative 5-HT-positive tissues such as intestinal and pancreatic β cells. Therefore, the use of Tph1 ^tm1c mice of the present invention can reduce misunderstanding of results due to residual 5-HT and provide a more accurate analysis than previously possible, ultimately revealing new functions of the peripheral 5-HT system. .

Example 3. Construction of Tph1, Htr2b tissue-specific KO mice

3-1. Production and breeding management of KO mice

All mice used in this example were strains of the C57BL/6J background. Mice were bred under the same temperature and humidity conditions with a 12-hour light-dark cycle in a specific pathogen-free facility at KAIST. A regular diet (SCD, D10001, Research Diets, Inc.) and water were given ad libitum.

Insulin-Cre mice were crossed with other floxed mice ( Tph1 floxed, Htr2b , Prlr floxed, and Stat5 floxed) and Ghr floxed Ins2-Cre mice to construct β cell-specific knockout mice. Htr1b ^{tm1.1(KOMP)Vlcg} mice and Htr1d ^{tm1.1(KOMP)Vlcg} mice were purchased from KOMP.

In the adult mouse experiment, 9-week-old male mice were used. In the high-fat diet experiment, a feed (D12492, Research Diets Inc.) containing 60% kcal of fat was fed to 12-week-old male mice for 4-8 weeks. In the S-961 (insulin antagonist) study, 100 nmol/kg of S-961 was administered intraperitoneally twice a day for 7 days.

3-2. Immunostaining and β cell area measurement

The mouse pancreas tissue was immediately fixed in 10% neutral-buffered formalin solution for 2 hours (for perinatal mice) or 4 hours (for adult mice) at room temperature, and then washed with tertiary distilled water for 30 minutes.

After washing, the pancreatic tissue was dehydrated with a tissue processor (Leica) and embedded in paraffin. The FFPE tissue was sliced to a thickness of 4-μm and mounted on a glass slide. The slides were deparaffinized with xylene and rehydrated in ethanol for subsequent staining. Antigen retrieval was performed in a pressure cooker with sodium citrate buffer (10 mM sodium citrate, pH 6.0) for 15 minutes.

For immunofluorescence staining, samples were blocked with 2% donkey serum diluted in PBS for 1 h at room temperature. Primary antibody-treated slides were incubated overnight at 4°C; Anti-5-HT antibody (rabbit, ImmunoStar, dilution factor 1:1000), anti-glucagon antibody (mouse, Sigma, 1:1000), anti-insulin antibody (guinea pig, Dako, 1:1000), anti-Nkx6 .1 antibody (mouse, DSHB, 1:100), anti-Pdx1 antibody (mouse, DSHB, 1:100), and anti-phospho-Histone H3 antibody (rabbit, Millipore, 1) :1000).

After incubation and washing, secondary antibodies were treated and incubated for 2 h at room temperature: Alexa594-conjugated donkey anti-mouse IgG (Jackson ImmunoResearch, 1:1000), Alexa647-conjugated donkey anti-rabbit IgG (Jackson) ImmunoResearch, 1:1000), and FITC-conjugated donkey anti-guinea pig IgG (Jackson ImmunoResearch, 1:1000). Samples were treated with DAPI (Invitrogen, 1:2000) for 5 minutes and then mounted with fluorescence mounting reagent (Dako). Images were obtained using a confocal microscope LSM780 (Cal Zeiss) or a fluorescence microscope (Nikon) equipped with a DS-Ri2 camera. Immunohistochemistry was performed for 5-HT with a biotin-free polymer detection system (MACH3, Biocare Medical LCC). After application of a secondary antibody against rabbit IgG, the immune response product was developed with diaminobenzidine (Thermo Fisher Scientific). Specificity was confirmed through the absence of positive staining after replacement with primary antibody untreated or non-immune serum. Section images were observed and captured with a bright field microscope (Axio imager A1 or Axio imager M1, Carl Zeiss). For the measurement of β cell mass, FFPE pancreatic sections were obtained at 80 μm intervals (at least 8 slides). These pancreatic slides were immunostained with insulin, and all slides were scanned with a JuLI stage (NanoEnTek). β cell mass was measured by dividing the area of insulin immunoreactivity by the total pancreatic area.

3-3. Glucose dynamics

For intraperitoneal glucose tolerance test (GTT) and in vivo glucose-stimulated insulin secretion test (GSIS), mice were fasted overnight for 16 hours, and D-glucose (2 g /kg body weight) was injected intraperitoneally. Blood glucose levels were measured using a glucometer (GlucoDr Plus, Allmedicus) by taking blood from a caudal vein. For insulin measurement, blood was drawn into heparin tubes at 0, 15, and 30 minutes after glucose injection, and centrifuged at 1500 g for 10 minutes at 4 °C. Plasma insulin concentrations were measured using an ultrasensitive insulin ELISA kit (80-INSMSU-E01, ALPCO). For insulin tolerance test (ITT), mice were fasted for 6 hours, and then Humulin R (Eli Lilly) was injected intraperitoneally (0.75 U/kg body weight).

For ex vivo GSIS, mouse pancreas islets were isolated with collagenase. First, pancreatic islets were cultured in RPMI-1640 medium (Thermo Scientific) supplemented with 10% FBS (Thermo Scientific) and 100 U/ml penicillin-streptomycin (Thermo Scientific) at 37° C. under 5% CO ₂ conditions. After incubation for 4 hours, pancreatic islets were incubated in Krebs-Ringer-HEPES (KRH) buffer (pH 7.4, 115 mM NaCl, 25 mM HEPES, 24 mM NaHCO ₃ , 5 mM KCl, 1 mM MgCl) containing 2.8 mM glucose. ₂ , 2.5 mM CaCl ₂ , and 1 mg/ml BSA) and incubated for 30 minutes. Cultured pancreatic islets were taken 10 per sample and transferred to 12-well uncoated dishes. To measure basal insulin secretion, samples were incubated in KRH buffer containing 2.8 mM glucose for 15 minutes, and 50 μL of the supernatant was taken and used for insulin measurement. In addition, for high glucose stimulation, samples were incubated in KRH buffer containing 16.8 mM glucose for 15 minutes, and the supernatant was taken. All supernatants were immediately frozen in liquid nitrogen and cryopreserved at -80°C until used for ELISA experiments.

3-4. Quantitative reverse transcription PCT (qRT-PCR)

RNA was extracted using TRIzol (Invitrogen) according to the manufacturer's protocol.

1 μg of total RNA was used to prepare cDNA with the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems). qRT-PCR was performed using the Viia 7 Real-time PCR System (Applied Biosystems) with Fast SYBR Green Master Mix (Applied Biosystems). Gene expression was calculated by relative gene expression analysis using the delta Ct (threshold cycle) method, and the Actb gene was used as an internal control.

statistical analysis

All data were measured as mean ± standard deviation. Statistical significance was obtained by Student's t -test (two-tailed). Statistical analysis was performed using SPSS version 22 (IBM Co). The levels of statistical significance are as follows:*; P < 0.05, **; P < 0.01 and ***; P < 0.001.

3-5. result

The present inventors confirmed the presence of 5-HT in human pancreatic islets in the perinatal period through immunohistochemistry from 14 weeks of gestation to 3 months of age ( FIGS. 5A and 9A ). 5-HT staining was restricted to endocrine cells during the perinatal period, and its intensity peaked at 8 days of age. Strong 5-HT staining was also observed in beta cells of the day of birth (P0) mice (Fig. 5b). The expression of Tph1 mRNA in the mouse embryonic pancreas was higher than that of Tph2 , and its expression pattern corresponded to the change in 5-HT immunostaining ( FIG. 9b ). In both human fetal and adult beta cells, TPH1 mRNA expression was higher than TPH2 mRNA, and TPH1 mRNA expression was higher in fetal beta cells than in adult beta cells. These data suggest that 5-HT performs a common function in both human and rodent beta cells during perinatal period, and that the production of 5-HT in beta cells may be mainly dependent on TPH1 rather than TPH2.

In order to elucidate the physiological role of 5-HT in beta cells in detail, the present inventors constructed a mouse ( Tph1 βKO) harboring the beta cell-specific disrupted Tph1 gene. Tph1 βKO mice showed decreased Tph1 mRNA expression in the pancreas on the day of birth (P0) (Fig. 10a), and 5-HT production in perinatal and gestational mouse beta cells was reduced to undetectable levels by immunofluorescence staining (Fig. 10b) was confirmed. It was demonstrated that loss of 5-HT production does not affect the differentiation of beta cells in that PDX1 and NKX6.1 are normally expressed. (Fig. 10c)

Interestingly, in Tph1 βKO mice, β cell mass was significantly reduced, while the size of the pancreas did not change (Figs. 5c, 5d, and 10d). Immunofluorescence staining for pHH3 (phospho-Histone H3 ) and TUNEL revealed that β cell proliferation was reduced by 75% in Tph1 βKO mice without increased β cell death ( FIGS. 5E and 10E ). In addition, mRNA expression of cyclin family members (ie D1, D2, D3, A2, and B1) was reduced in the pancreas of Tph1 βKO mice on the day of birth (P0) (Fig. 5f). These data suggest that 5-HT increases β cell mass by promoting proliferation of perinatal β cells.

The present inventors further evaluated the metabolic phenotype of 9-week-old Tph1 βKO mice to confirm the long-term effects of Tph1 βKO in adult Tph1 βKO mice. Tph1 βKO mice grew normally and showed normal insulin sensitivity ( FIGS. 11A and 11B ). However, glucose tolerance was impaired (Fig. 6a).

The plasma insulin level was low 15 minutes after fasting and glucose administration, and the insulin secretory ability of Tph1 βKO pancreatic islets was impaired ( FIGS. 6B and 6C ).

In adult Tph1 βKO mice, β cell mass was reduced by more than half (up to 40%) of control mice despite β cell proliferation, but the size of the pancreas was similar to that of control mice (Figs. 6d, 6e, 6f). . Therefore, it was found that 5-HT stimulation of perinatal β-cell proliferation is essential for full adult β-cell mass development and prevention of the onset of diabetes.

Of the 14 HTRs in rodents, 6 HTRs are expressed in pancreatic islets. To identify the downstream HTRs involved in perinatal β proliferation, the present inventors confirmed the expression of six HTRs (HTR1B, 1D, 2A, 2B, 3A, and 3B) in the embryonic pancreas.

The expression of Htr1b , Htr2b and Htr3a mRNA showed a tendency to increase as the embryo developed ( FIG. 7a ). Among these HTRs, HTR3 was involved in insulin secretion but not in β cell proliferation, and loss of HTR1B or HTR1D did not reduce β cell proliferation at P0 ( FIG. 12 ). In contrast, β cell mass was reduced by 55% at P0 in mice with β cell-specific disruption of Htr2b ( Htr2b βKO), and total pancreatic weight remained unchanged (Figs. 7b, 7c). , 7d). A decrease in β cell mass was associated with a decrease in β cell proliferation in Htr2b βKO mice, and no increase in β cell apoptosis was observed ( FIGS. 7E and 10E ).

In adulthood, Htr2b βKO mice were glucose tolerant, although body weight and insulin sensitivity were normal ( FIGS. 7F and 13A, 13B ). Plasma insulin levels were lower in Htr2b βKO mice after 15 minutes of fasting and glucose feeding ( FIG. 7G ). However, glucose-stimulated insulin secretion from isolated Htr2b βKO pancreatic islets was not significantly impaired ( FIG. 7H ). Instead, β cell mass was continuously reduced in adult Htr2b βKO mice to a level of 40% of that of control mice ( FIG. 7i ). The size of the pancreas was similar to that of the control group, and β cell markers were appropriately expressed in Htr2b βKO mice ( FIGS. 7j and 13c ). Therefore, Htr2b βKO mice were very similar to the phenotype of Tph1 βKO mice (phenocopied). These data support the conclusion that 5-HT stimulates β cell proliferation through HTR2B in the perinatal period and determines adult β cell mass.

High fat diet (HFD) does not induce 5-HT production in β cells, but is known to induce β cell proliferation to compensate for the increased insulin demand. To further evaluate whether 5-HT is required for β cells to withstand metabolic stress, mice were fed HFD from 12 weeks of age to 8 weeks. Neither Tph1 mRNA nor 5-HT production was induced in β cells by HFD.

Tph1 βKO Mice showed similar weight gain and worsening of insulin sensitivity compared to control mice. Glucose tolerance worsened more rapidly in Tph1 βKO mice fed HFD than control mice, whereas β cell proliferation was similar ( FIGS. 8a and 8b ). These data suggest that 5-HT is not involved in inducing β cell proliferation in response to metabolic stress. This conclusion was further supported by measuring β cell proliferation in mice with insulin resistance induced by the insulin receptor antagonist S961 ( FIG. 8c ). Thus, 5-HT stimulates β cell proliferation not in response to metabolic stress, but in response to more physiological stimuli during the perinatal period.

Example 4. Construction of a modified STAM (Stelic Animal Model) mouse

4-1. Production and breeding management of modified STAM mice

The present inventors prepared a modified STAM (Stelic Animal model) to further confirm the phenotype of metabolic diseases according to the destruction or reduction of beta cells of the pancreas. Briefly, streptozotocin (STZ, Sigma, S0130) was intraperitoneally administered to C57BL6/J male 　 7-week-old 　 mice daily for 5 days at a dose of 40 mg/kg (body weight), and after administration of STZ (streptozotocin) 8 A high-fat diet was fed for 54 weeks from the age difference until the mice reached 62 weeks of age. As a control group, 7-week-old mice not administered with STZ were used. In addition, the following tests were performed by sacrificing mice every 6 weeks (ie, 8, 14, 20, 26, 32, 38, 44, 50, 56, and 62 weeks of age) starting to feed a high-fat diet (Fig. 14). ).

4-2. Immunohistochemistry of pancreatic beta cells

The present inventors performed immunostaining of pancreatic beta cells to confirm the effect of STZ administration on pancreatic beta cells. For immunostaining of pancreatic beta cells, pancreatic tissue was pretreated as described in Examples 1-5, and then anti-insulin antibodies (A0564, Dako) were used as primary antibodies, and anti-porcine IgG as secondary antibodies. (dilution ratio; manufacturer) was used. Immunohistochemical staining results are shown in FIG. 15 .

As shown in FIG. 15 , it was confirmed that the amount of stained beta cells after STZ (streptozotocin) administration was reduced compared to mice not administered with STZ. Therefore, it could be confirmed that the modified STAM mice had pancreatic beta cells destroyed by the administration of STZ.

4-3. Blood glucose measurement results after fasting

In order to confirm the effect of STZ administration on the blood glucose of the modified STAM mouse, the present inventors fasted for 6 hours before sacrificing the modified STAM mouse prepared in 4-1, and collected blood from the caudal vein to measure the glucometer. (GlucoDr Plus, Allmedicus) was used to measure blood glucose. The results are shown in FIG. 16 .

As shown in FIG. 16 , the modified STAM mouse exhibited a diabetic phenotype by increasing more than twice as compared to the blood glucose of the control mouse from 14 weeks of age. Considering the results of 4-2, it is estimated that the modified STAM mice have elevated blood sugar due to the destruction of pancreatic beta cells.

4-4. Results of H&E staining of liver tissue

The present inventors analyzed the modified STAM mice prepared in 4-1 above for each week of age (7, 8, 14, 20, 26 , 32, 38, and 44 weeks of age) were sacrificed and liver tissue was collected and then H&E staining was performed. The results are shown in FIG. 17 .

As shown in FIG. 17 , in the liver tissue of the modified STAM mouse, the size and number of lipid particles in the hepatocytes increased to induce fatty liver, as well as ballooning and fibrosis of the hepatocytes, resulting in hepatitis findings. It was confirmed that the symptoms of liver cirrhosis were severe. Therefore, the present inventors confirmed that fatty liver and cirrhosis occurred when pancreatic beta cells were destroyed from the results of 4-2 and 4-3 obtained using the modified STAM mice.

<110> Korea Advanced Institute of Science and Technology <120> Knockout mouse <130> PN190056P <150> KR 10-2019-0048126 <151> 2019-04-25 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Tph1 forward primer <400> 1 ttctgacctg gacttctgcg 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Tph1 reverse primer <400> 2 ggggtcccca tgtttgtagt 20 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> 36B4 forward primer <400> 3 tccaggcttt gggcatca 18 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 36B4 reverse primer <400> 4 ctttatcagc tgcacatcac tcaga 25 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CSD-Tph1-F primer <400> 5 tcaacatagc cctgagctcc ttagc 25 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CSD-neo-F primer <400> 6 gggatctcat gctggagttc ttcg 24 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CSD-Tph1-ttR primer <400> 7 atgcaaagct cctacagtga caacg 25 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CSD-Tph1-R primer <400> 8 cacattccct tgcaactctg ctacc 25 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Tph1 exon1 forward primer <400> 9 gactctttaa actccagtgg 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Tph1 exon11 reverse primer <400> 10 tcacacactg ggccacctgg 20 <210> 11 <211> 4581 <212> DNA <213> Artificial Sequence <220> <223> Mus musculus Tph1 gene <400> 11 gctacttgag agactaaagc agtcttgcct ggtcactcaa ggccagtctg agcaatatag 60 tgaatcccaa attgctctgt gtgtgtttgt gcgtgcgtgc acgagtgcaa gccaaggttt 120 caagagaggc cagaagaggg tgtcagattc tctggtgcat gagttacagc tggctgtgaa 180 ctgcctgatg tcggggctgg aaactaaact caggcccaag aacagcaagt gctcttatct 240 gatgagccat catcccagcc ccatgcccag cagacatggg ggctgttaac tgaaacatta 300 gaagtatgtc cacgggcctc cccttttctg aagagaaagg ggagaggaat gcatggagga 360 gagagaaggc gtggaggaag gactgagagg agaggaagga cgaaaaaccg cagtctggat 420 gtaaaaattc accatgattg aagacaacaa ggagaacaaa gagaacaaag accattcctc 480 cgaaagaggg agagtgactc tcatcttctc cttggagaat gaagtcggag gactcataaa 540 agtgctgaaa atcttccagg agaatcatgt gagcctgtta cacatcgagt cccggaaatc 600 aaagcaaaga aattcagaat ttgagatatt tgttgactgc gacatcagcc gagaacagtt 660 gaatgacatc ttccccctgc tgaagtcgca cgccaccgtc ctctcggtgg actcgcccga 720 tcagctcact gcgaaggaag acgttatgga gactgtccct tggtttccaa agaagatttc 780 tgacctggac ttctgcgcca acagagtgct gttgtatgga tccgaacttg acgccgacca 840 ccctggcttc aaagacaatg tctatcgtag aagacgaaag tattttgcag agttggctat 900 gaactacaaa catggggacc ccattcccaa gattgaattc acggaagaag agattaagac 960 ctgggggacc atcttccgag agctaaacaa actctacccg acccacgcct gcagggagta 1020 cctcagaaac ctccctttgc tctcaaaata ctgtggctat cgggaagaca acatcccgca 1080 actggaggat gtctccaact ttttaaaaga acgcactggg ttttccatcc gtcctgtggc 1140 tggttacctc tcaccgagag attttctgtc ggggttagcc tttcgagtct ttcactgcac 1200 tcagtatgtg agacacagtt cagatcccct ctacactcca gagccagaca cctgccatga 1260 actcctaggc cacgttcctc tcttggctga acccagtttt gctcaattct cccaagaaat 1320 tggcctggct tcccttggag cttcagagga gacagttcaa aaactggcaa cgtgctactt 1380 tttcactgtg gagtttgggc tgtgcaaaca agatggacag ctgagagtct ttggggccgg 1440 cttgctttct tccatcagtg aactcaaaca tgcactttct ggacatgcca aagtcaagcc 1500 ctttgatccc aagattgcct gtaaacagga atgtctcatc acgagcttcc aggatgtcta 1560 ctttgtatct gagagctttg aagatgcaaa ggagaagatg agagaatttg ccaagaccgt 1620 gaagcgcccg tttggactga agtacaaccc gtacacacag agtgttcagg ttctcagaga 1680 caccaagagc ataactagtg ccatgaatga gttgcggtat gaccttgatg tcatcagtga 1740 tgccctcgct agggtcacca ggtggcccag tgtgtgatgg tttccagtgc atatccaaaa 1800 agcctttgag catcagtcta gagccagggc tagttcttgc ttcccctgaa gacctgcttg 1860 gggagggaca gcagctccca gcttagcaat gtctctcgcc tctctccata ttcaatcact 1920 cactctctct gaaaatgcac acctggaact gcttatcttc tacttctgtt ttgtcttctg 1980 gaacctgctg agggaaatat agttcacgtg ccacgtgatg cccaggacac acatttaaaa 2040 tattttattt cattaaaatg taattgaatc attctctccc ttccctttct tccctccaac 2100 ccctccctct caaattcatg gcctttctac caaatgcccg tctttgatgg gtgagttgtc 2160 tgacactggc cagagctgga ctcatggtga tgccattttc cccagcccat cattagtgga 2220 tggcctctct ggatgccacg atgaatgtgt ctgttaccta ttactgactg tgtgacagcc 2280 caggcacagt cacacactag acttcaaggg gactcgctga aacagaagtg tggatgactt 2340 tgcgctagag catggctagt aaagtgcaag ctggcttcaa gtgctgtgtc agacagggac 2400 gtagaagcca ccaagactca gccagtgctt tctggcactt tgtttcaagg tgtaacccta 2460 ggatatagtg agaaggtatg tgtgtgtgtg tggggtggtg cagagggtag gaaatgggga 2520 tgggaatgga gaagggccaa agggagcagt ttgtatctga gactgtactt atgcgaggga 2580 gagctgtgag gattggagca catgtggtgt ccgcataagc agttgtataa gcttttcact 2640 actgtaacaa agtgtcaggg acaatcagct tatacagaga aaaggtttct cttggatgct 2700 ttggtccatt agaagttgtt cccgtggttt aagccactgg tgaagcaagg catgatagga 2760 gaatgtgaca gagcaaactt cataaagcta tacacgtcat aaaggatgga aagagaaaga 2820 gtgaaggatt ttagagaagg aagaagggag agagggaaag agagagggag gaggacacac 2880 acacacacac acacacacaa agggggtgag agagagagtc agagacagag acagagacag 2940 aaagatccta cagttcagtt taagagttca ctaccagggt aagagagagg gctcagcagt 3000 taagagtacc agctgttctt ccagaggacc ctggtttgct tcccagcatc cacactgtgg 3060 cttagaacca tctgtaactc tagttccaga ggatccagtg ttttctggcc tccatagaga 3120 gcaggcaggc atgcaagtgg tacacagata tgcatgcagc aaaaacaccc atacacatac 3180 aataaaaagt agaagaccct acctctgctt ttcccattaa tagtgaaatt atataccatt 3240 ggacaggctt catctcaagc ccactagata tattttcaca ctagattttt aaaaacacct 3300 tttaaggatt cagaggaaac tattgaaagc tgcgcttcac cccatgctct acaaggaagt 3360 gtaatccagc cgtctcagat ctttagaaac atacccactt taacagctgg tgagcacgca 3420 tccgtccgca agtagatacg ttagctctga aatcacctga agtacaaacc agctagttta 3480 cagcctgctt gattaccagg gaaagcacta taaagaaatc ctaccgacag caaacagaga 3540 gtgccgtctg ctgtttctgg ttatttccac tagactctgg tggtgctgaa gaatcactta 3600 ttggcttttt aattggttgt gctctgacta aagcacttta aactgtaaag ccacaacctt 3660 accgtttgta acttcaggat agaaaaaata agcgaagggc ttgactttgt ctctgctctg 3720 cttctgtgat atttggcaag tcagggttcc aagagccttg gagtcttcaa aacacctaag 3780 aatcttttaa tagttattca aacaccaggc cagatcaaa caaaaagcaa ggcttgcaat 3840 tctttcctgg agagccattc ctcgacagca gcagcgtgct tgactttttg aagaaaacac 3900 aaatgctaat cgtcagagtg cctgcgttcc ttaatctcat gctttggcat ttggaattac 3960 ataagtagca agatgcagca aaatgcacag aattattgct catttttaag ttggcttcta 4020 aaccacagaa agaagaaagc caggacttct caaaagcact aaataactga gaccgtatgt 4080 tcatttccag gaagtggata aaaagataac agtggtccat ttcactcttc atgttacagt 4140 gccacataca cttataattt aagaatttgt tccactgggt aataaactta aagttcatga 4200 tctcaagaag tatttttttt aaagcacatt taaaactttt attttatgtg tgtgggcccc 4260 aggaatcaaa ctccagttgt caggcttggc cacaagcccc tttatttgct gagccagttt 4320 ttgccacccc ctcccccaat tcttttaatc aaacacacat taaaaacagt ttcaatttta 4380 tgttcacaat gttataagtt cagagaccct agcagtgatg atggttggta caaagaatca 4440 gccttggggg ttagacaaag tatgaacatg cctcaatgga acccattact ttgtatacca 4500 ctttaaaata tttttacaaa aagaaatcac aaaatataca ataaaaaata tacatcactc 4560 taaaaaaaaa aaaaaaaaaa a 4581 <210> 12 <211> 2082 <212> DNA <213> Artificial Sequence <220> <223> Mus musculus Htr2b gene <400> 12 gctaagactc agagcaagtc agtgggggag gatctgccag gagagggagt ccaactgaac 60 agacacagga cggctggctt aggaagccac agaagacaag cgtcttctgg aatctaagcc 120 tctagaaaat ctaaaatgtg gatgtcttac ctgcaaacac ggacagacgt gtacacagtc 180 ccatcttcga gagcctgaat ctttttagaa ggaagaagtc accttggctg tgagtgtctg 240 gtaggtttgc taaatgcttt gctaaagcag atgacttgct tagctactga ccatgctgac 300 cactgtctgg aactggactg agtcaccaaa aggcgaatgg cttcatctta taaaatgtct 360 gaacaaagca caacttctga gcacatttta cagaagacat gtgatcacct gatcctgact 420 aaccgttctg gattagagac agactcagta gcagaggaaa tgaagcagac tgtggaggga 480 caggggcata cagtgcactg ggcagctctc ctgatactcg cggtgataat acccaccatt 540 ggtgggaaca tccttgtgat tctggctgtt gcactggaga aaaggctgca gtacgctacc 600 aactactttt taatgtcctt ggcgatagca gatttgctgg ttggattgtt tgtgatgccg 660 attgccctct tgacaatcat gtttgaggct atatggcccc tcccactggc cctgtgtcct 720 gcctggttat tcctcgatgt tctcttttca actgcctcca tcatgcatct ctgtgccatt 780 tccctggacc gctatatagc catcaaaaag ccaattcagg ccaatcagtg caactcccgg 840 gctactgcat tcatcaagat tacagtggta tggttaattt caataggcat cgccatccca 900 gtccctatta aaggaatcga gactgatgtg attaatccac acaatgtcac ctgtgagctg 960 acaaaggacc gctttggcag ttttatggtc tttgggtcac tggctgcttt cttcgcacct 1020 ctcaccatca tggtagtcac ttactttctc accattcaca ctttacagaa gaaagcttac 1080 ttggtcaaaa ataagccacc tcaacgccta acacggtgga ctgtgcccac agttttccta 1140 agggaagact catccttttc atcaccagaa aaggtggcaa tgctggatgg gtctcacagg 1200 gataaaattc tacctaactc aagtgatgag acacttatgc gaagaatgtc ctcagttgga 1260 aaaagatcag cccaaaccat ttctaatgag cagagagcct cgaaggccct tggagtcgtg 1320 tttttccttt ttctgcttat gtggtgcccc ttttttatta caaatctaac tttagctctg 1380 tgtgattcct gcaatcagac cactctcaaa acactcctgg agatatttgt gtggataggc 1440 tacgtttcct cgggggtgaa tcctctgatc tatacactct tcaataagac atttcgggaa 1500 gcatttggca ggtacatcac ctgcaattac cgagccacaa agtcagtaaa agcacttagg 1560 aagttttcca gtacactttg ttttgggaat tcaatggtag aaaactctaa atttttcaca 1620 aaacatggaa ttcgaaatgg gatcaaccct gccatgtacc agagcccaat gaggctccga 1680 agttcaacca ttcagtcctc atcaatcatc ctcctcgata cccttctcac tgaaaacgat 1740 ggcgacaaag cggaagagca ggtcagctac atatagcaga acgggccgcc ctcatctgag 1800 agaggtgatg agcaggacgc acgcgcaaca tggaaaggta cagagtgaat gaaaacccca 1860 ccctctcctg agtgaagtac caaggctgtc cagcttcctt atctaaacaa actcaagcat 1920 ggctaaagta gatctgatgg cttcaaacaa acgcaatctc tactctggtt ttcaaataca 1980 attaaataag ttgataaatt tcagtctttt aaaaaaaaag aatgtcaaca aatttttaag 2040 tttctaatgt gtgtaaagtt gtgttaagaa agaaataaaa tg 2082

Claims (21)

Exons 5 and 6 of the Tph1 gene were transferred to pancreatic β cells by crossing a Tph1 floxed mouse with loxp sites inserted on both sides of exon 5 and 6 of Tph1 and a mouse expressing Cre-recombinase specifically for pancreatic β cells. A transgenic mouse specifically knocked out.
The transgenic mouse according to claim 1, wherein exon 5 and exon 6 of the Tph1 gene consist of nucleotide sequences 845-912 and 913-1109 of SEQ ID NO: 11, respectively.
delete delete delete The method of claim 1, wherein the transgenic mouse is Tph1 fl/fl x Insulin-Cre +/- mouse (Tph1 beta cell specific knockout mouse, Tph1 βKO mouse) or Tph1 fl / fl x Pdx1-CreER +/- mouse (Tph1) beta cell specific inducible knockout mouse, Tph1 βiKO mouse), the transgenic mouse.
The transgenic mouse according to claim 1, wherein the transgenic mouse is used as a model for metabolic disease.
A method for preparing a tissue-specific Tph1 gene knockout mouse comprising the following steps:
(a) crossing a Tph1 floxed mouse in which loxp sites are inserted on both sides of exon 5 and exon 6 of Tph1 and a mouse that specifically expresses Cre-recombinase; and
(b) obtaining a next-generation mouse obtained as a result of the crossing.
The method according to claim 8, wherein the tissue-specifically expressing Cre-recombinase mouse is an Insulin-Cre mouse expressing pancreatic-specific Cre-recombinase.
delete delete delete delete delete delete delete delete delete delete A screening method for a therapeutic agent for a metabolic disease comprising the steps of:
(a) administering a metabolic disease therapeutic candidate to the transgenic mouse of any one of claims 1, 2, 6, and 7;
(b) comparing the transgenic mice administered with the candidate substance with the control mice not administered with the candidate substance, measuring an indicator for the disease; and
(c) determining the candidate substance as a therapeutic agent for metabolic diseases when the indicator is improved in the transgenic mice administered with the candidate substance compared to the control mouse. delete

Images