JP2008510488A - Novel gene disruption, compositions and methods relating thereto - Google Patents

Abstract

  The present invention relates to transgenic animals and compositions and methods relating to the characterization of gene function. In particular, the present invention includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, RO1 Provided are transgenic mice having a disruption in the PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 genes. Such in vivo studies and characterization include: neuropathy; cardiovascular, endothelial or angiogenic diseases; ocular abnormalities; immune disorders; oncological disorders; bone metabolic disorders or disorders; lipid metabolic disorders; Can lead to valuable identification and discovery of therapeutics and / or treatments useful in the prevention, amelioration or repair of diseases or dysfunctions associated with cerebral dysfunction.

Description

The present invention relates to compositions comprising transgenic and knockout animals and methods of using such compositions for the diagnosis and treatment of diseases or disorders.

BACKGROUND OF THE INVENTION Extracellular proteins play a particularly important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, such as proliferation, migration, differentiation or interaction with other cells, is typically governed by information received from other cells and / or the immediate environment. This information is often transmitted by secreted polypeptides (e.g., mitogens, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones), which in turn are received by various cell receptors or membrane-bound proteins. Is interpreted. These secreted polypeptides or signaling molecules usually pass through the cell secretory pathway and reach their site of action in the extracellular environment.
Secreted proteins have a variety of industrial uses, including pharmaceutical, diagnostic, biosensor and bioreactors. Most protein drugs currently available, such as thrombolytics, interferons, interleukins, erythropoietin, colony stimulating factor, and various other cytokines are secreted proteins. Its receptor, which is a membrane protein, also has potential as a therapeutic or diagnostic agent. Efforts have been made by both industry and academia to identify new natural secreted proteins. Much effort has been devoted to screening mammalian recombinant DNA libraries to identify novel secretory protein coding sequences. Examples of screening methods and techniques are described in the literature [see, eg, Klein et al., Proc. Natl. Acad. Sci. 93; 7108-7113 (1996); US Pat. No. 5,536,637].

Membrane-bound proteins and receptors play an important role in the formation, differentiation and maintenance of multicellular organisms, among others. The fate of many individual cells, such as proliferation, migration, differentiation or interaction with other cells, is typically governed by information received from other cells and / or the immediate environment. This information is often transmitted by secreted polypeptides (e.g., mitogens, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) that are then received by a variety of cell receptors or membrane-bound proteins. Interpreted. Such membrane-bound proteins and cell receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatases, receptors involved in cell-cell interactions, and cell adhesion molecules such as selectins and integrins. Including. For example, the transmission of signals that regulate cell growth and differentiation is regulated in part by phosphorylation of various cellular proteins. Protein tyrosine kinases, enzymes that catalyze the process, can also act as growth factor receptors. Specific examples include fibroblast growth factor receptor and nerve growth factor receptor.
Membrane-bound proteins and receptor molecules have a variety of industrial uses, including pharmaceutical and diagnostic agents. For example, receptor immunoadhesins can be used as therapeutic agents that block receptor-ligand interactions. Membrane-bound proteins can also be used to screen for peptide or small molecule inhibitors with potential for related receptor / ligand interactions.
Efforts have been made by both industry and academia to identify new natural receptors or membrane-bound proteins. Much effort has been devoted to screening mammalian recombinant DNA libraries to identify novel receptor or membrane-bound protein coding sequences.

  Once the importance of secreted and membrane-bound proteins in biological and disease processes is known, in vivo studies and characterizations can provide valuable identification of therapeutic agents and / or treatment methods useful in preventing, ameliorating or repairing a disease or dysfunction Can bring discovery. In this regard, genetically engineered mice are very useful for functional detailed analysis of biological processes related to human diseases including immunity, cancer, neurobiology, cardiovascular biology, obesity and many other diseases. Proven to be a useful tool. Gene knockout can be viewed as modeling the biological mechanism of drug action by predicting the activity of highly specific antagonists in vivo. Knockout mice have been shown to model drug activity; the phenotype of mice lacking specific pharmaceutical target proteins can resemble the human clinical phenotype caused by the corresponding antagonist drug. Gene knockout allows for the discovery of side effects based on the mechanism of action of the target, the dominant physiological role of the target, and the mechanism of action that may result from inhibition of the target in mammals. Examples of this type include angiotensin converting enzyme (ACE) [Esther, CR et al., Lab. Invest., 74: 953-965 (1996)] and cyclooxygenase-1 (COX1) gene [Langenbach, R. et al., Cell, 83: 483-492 (1995)] are included. Conversely, knockout of a mouse gene can produce a phenotypic effect opposite to that observed in humans after administration of an agonist drug to the corresponding target. Examples include erythropoietin knockout [Wu, CS et al., Cell, 83: 59-67 (1996)], which is the production of red blood cells with poor mutation results, and GABA ( A) -R-β3 knockout [DeLorey, TM, J. Neurosci., 18: 8505-8514 (1998)]. Both of these phenotypes are opposite to the effects of erythropoietin and benzodiazepine administration in humans. A notable example of a target identified using mouse genetics is the ACC2 gene. Although the human ACC2 gene was identified several years ago, interest in ACC2 as a target for drug development became very recent after analysis of ACC2 function using knockout mice. I was just stimulated. ACC2 mutant mice have more appetite than their wild-type littermates, but burn less fat and store less fat in their fat cells, and this enzyme is a possible target for chemical antagonism in the treatment of obesity [Abu-Elheiga, L. et al., Science, 291: 2613-2616 (2001)].

  In this application, mutated gene disruption refers to central nervous system (CNS) / neuropathies or diseases such as anxiety neurosis; ocular abnormalities and related diseases; cardiovascular, endothelial or angiogenic diseases including atherosclerosis; serum Abnormal metabolic diseases including diabetes and dyslipidemia with increased levels of medium triglycerides and cholesterol; immunological and inflammatory diseases; oncological diseases; abnormal bone metabolism or diseases such as arthritis, osteoporosis and marble bone disease; Or phenotypic observations associated with various disease symptoms or dysfunctions, including developmental abnormalities such as embryonic lethality.

(Summary of Invention)
A. Embodiments of the present invention include PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1413, PRO11513, PRO11513, PRO11513 Provided is an isolated nucleic acid molecule comprising a nucleotide sequence encoding a PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.
In one aspect, an isolated nucleic acid molecule is (a) a full-length amino acid sequence disclosed herein, an amino acid sequence that lacks a signal peptide disclosed herein, with or without a signal peptide disclosed herein. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357 having the extracellular domain of a transmembrane protein or any other specifically determined fragment of the full-length amino acid sequence disclosed herein , PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO57 5, at least about 80% nucleic acid sequence identity to a DNA molecule encoding a PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, or (b) the complementary strand of the DNA molecule of (a); Or at least about 81% nucleic acid sequence identity, or at least about 82% nucleic acid sequence identity, or at least about 83% nucleic acid sequence identity, or at least about 84% nucleic acid sequence identity, or at least about 85%. Nucleic acid sequence identity, or at least about 86% nucleic acid sequence identity, alternatively at least about 87% nucleic acid sequence identity, alternatively at least about 88% nucleic acid sequence identity, alternatively at least about 89% nucleic acid sequence identity, or At least about 90% of the nucleic acid acid Identity, alternatively at least about 91% nucleic acid sequence identity, alternatively at least about 92% nucleic acid sequence identity, alternatively at least about 93% nucleic acid sequence identity, alternatively at least about 94% nucleic acid sequence identity, or at least about 95% nucleic acid sequence identity, or at least about 96% nucleic acid sequence identity, alternatively at least about 97% nucleic acid sequence identity, alternatively at least about 98% nucleic acid sequence identity, or at least about 99% nucleic acid sequence identity An isolated nucleic acid molecule comprising a nucleotide sequence having sex is provided.

  In other aspects, the isolated nucleic acid molecule is (a) the full-length PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731 disclosed herein. , PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO7169, or cDNA of PRO7909 PRO196, PRO217 lacking the signal peptide PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, RO1518 PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide coding sequences, transmembrane PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO with or without the signal peptide disclosed herein 87, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO9740 A DNA molecule comprising the coding sequence of the extracellular domain of a PRO779 polypeptide, or the coding sequence of any other specifically defined fragment of the full-length polypeptide amino acid sequence disclosed herein, or (b) (a ) At least about 80% nucleic acid sequence identity to the complementary strand of the DNA molecule, or at least about 81% nucleus Acid sequence identity, or at least about 82% nucleic acid sequence identity, alternatively at least about 83% nucleic acid sequence identity, alternatively at least about 84% nucleic acid sequence identity, or at least about 85% nucleic acid sequence identity, or At least about 86% nucleic acid sequence identity, alternatively at least about 87% nucleic acid sequence identity, alternatively at least about 88% nucleic acid sequence identity, alternatively at least about 89% nucleic acid sequence identity, or at least about 90% nucleic acid Acid sequence identity, or at least about 91% nucleic acid sequence identity, alternatively at least about 92% nucleic acid sequence identity, alternatively at least about 93% nucleic acid sequence identity, or at least about 94% nucleic acid sequence identity, or At least about 95% nucleic acid sequence identity, or at least about 96% nucleic acid sequence Identity, or comprises a nucleotide sequence having at least about 97% nucleic acid sequence identity, alternatively at least about 98% nucleic acid sequence identity, alternatively at least about 99% nucleic acid sequence identity.

In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by any of the human protein cDNAs deposited with the ATCC disclosed herein, or (b) (a) At least about 80% nucleic acid sequence identity, alternatively at least about 81% nucleic acid sequence identity, alternatively at least about 82% nucleic acid sequence identity, or at least about 83% nucleic acid sequence identity to the complementary strand of the DNA molecule Or at least about 84% nucleic acid sequence identity, alternatively at least about 85% nucleic acid sequence identity, alternatively at least about 86% nucleic acid sequence identity, alternatively at least about 87% nucleic acid sequence identity, or at least about 88 % Nucleic acid sequence identity, or at least about 89% nucleic acid sequence identity, or at least about 90% Nucleic acid acid sequence identity, or at least about 91% nucleic acid sequence identity, alternatively at least about 92% nucleic acid sequence identity, alternatively at least about 93% nucleic acid sequence identity, or at least about 94% nucleic acid sequence identity; Or at least about 95% nucleic acid sequence identity, alternatively at least about 96% nucleic acid sequence identity, alternatively at least about 97% nucleic acid sequence identity, alternatively at least about 98% nucleic acid sequence identity, or at least about 99%. It relates to an isolated nucleic acid molecule comprising a nucleotide sequence having nucleic acid sequence identity.
Other aspects of the invention are either PRO196, PRO217, PRO231, PRO236, PRO245, PRO246 that are either transmembrane domain deficient or transmembrane domain inactivated, or that are complementary to such an encoded nucleotide sequence. , PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO18960, PRO18991 , A nucleotide encoding a PRO61709 or PRO779 polypeptide Providing an isolated nucleic acid molecule comprising a fault sequence, the transmembrane domain (s) of such polypeptide are disclosed herein. Accordingly, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1104, PRO11513, PRO11513 The soluble extracellular domain of the PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides is contemplated.

  The present invention also includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or a fragment of a PRO779 polypeptide-encoding sequence, or a complementary chain thereof, which may be, for example, anti-PRO196, anti-PRO217, anti PRO231, anti-PRO236, PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1298 PRO196, PRO217, which encodes a polypeptide comprising a binding site for anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10282, anti-PRO61709 or anti-PRO779 antibody, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, RO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, RO5759, PRO5925, PRO5925, PRO5925, PRO5925 The use of peptide-encoded fragments as hybridization probes or as antisense oligonucleotide probes is found. Such nucleic acid fragments are usually at least about 10 nucleotides long, alternatively at least about 15 nucleotides long, alternatively at least about 20 nucleotides long, alternatively at least about 30 nucleotides long, alternatively at least about 40 nucleotides long, alternatively at least about 50 nucleotides long, Or at least about 60 nucleotides long, alternatively at least about 70 nucleotides long, alternatively at least about 80 nucleotides long, alternatively at least about 90 nucleotides long, alternatively at least about 100 nucleotides long, alternatively at least about 110 nucleotides long, alternatively at least about 120 nucleotides long, or At least about 130 nucleotides in length, alternatively at least about 140 nucleotides in length, alternatively at least about 150 nucleotides Long, alternatively at least about 160 nucleotides long, alternatively at least about 170 nucleotides long, alternatively at least about 180 nucleotides long, alternatively at least about 190 nucleotides long, alternatively at least about 200 nucleotides long, alternatively at least about 250 nucleotides long, alternatively at least about 300 nucleotides long Or at least about 350 nucleotides long, alternatively at least about 400 nucleotides long, alternatively at least about 450 nucleotides long, alternatively at least about 500 nucleotides long, alternatively at least about 600 nucleotides long, alternatively at least about 700 nucleotides long, alternatively at least about 800 nucleotides long, Or at least about 900 nucleotides in length, or at least about 1000 nucleotides A Reochido length, wherein in this context the term "about" is meant to refer to a nucleotide sequence length plus or minus 10% of that referenced length. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 Novel fragments of the PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide-encoding nucleotide sequences can be generated using any of a number of well-known sequence alignment programs, PRO196, PRO217, PRO231, PR 236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1359, PRO1857, PRO1586, PRO1586, PRO1586 Align a PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide-encoding nucleotide sequence with other known nucleotide sequences and align any PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328 PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5910, RO5997, RO597 It can be routinely identified by determining if the fragmented nucleotide sequence fragment is novel. Such PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO12483PRO , PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide-encoding nucleotide sequences are all contemplated herein. These nucleotide molecule fragments, preferably anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO10425, anti-PRO10425, anti-PRO10425, anti-PRO10425 PRO196, PRO217 containing binding sites for anti-PRO10282, anti-PRO61709 or anti-PRO779 antibodies PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, RO1518 PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, encoded by PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide fragments. RO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO8225, PRO8225 .

The present invention relates to isolated PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, encoded by any of the isolated nucleic acid sequences identified above. , PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, RO1079
In certain embodiments, the invention provides a full-length amino acid sequence disclosed herein, an amino acid sequence lacking a signal peptide disclosed herein, an extracellular domain of a transmembrane protein with or without a signal peptide disclosed herein, or disclosed herein. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1100, PRO1100, PRO1 , PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, At least about 80% amino acid sequence identity to RO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, alternatively at least about 81% amino acid sequence identity, alternatively at least about 82% amino acid sequence identity, or at least about 83 % Amino acid sequence identity, or at least about 84% amino acid sequence identity, alternatively at least about 85% amino acid sequence identity, alternatively at least about 86% amino acid sequence identity, or at least about 87% amino acid sequence identity Or at least about 88% amino acid sequence identity, alternatively at least about 89% amino acid sequence identity, alternatively at least about 90% amino acid sequence identity, or at least about 91% amino acid sequence identity. Or at least about 92% amino acid sequence identity, alternatively at least about 93% amino acid sequence identity, alternatively at least about 94% amino acid sequence identity, alternatively at least about 95% amino acid sequence identity, or at least about 96 An isolated PRO196 comprising an amino acid sequence having% amino acid sequence identity, alternatively at least about 97% amino acid sequence identity, alternatively at least about 98% sequence identity, alternatively at least about 99% amino acid sequence identity; PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11 51, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.

  In a further aspect, the present invention provides at least about 80% amino acid sequence identity to the amino acid sequence encoded by any of the human protein cDNAs deposited with the ATCC disclosed herein, or at least about 81%. Amino acid sequence identity, or at least about 82% amino acid sequence identity, alternatively at least about 83% amino acid sequence identity, alternatively at least about 84% amino acid sequence identity, or at least about 85% amino acid sequence identity, or At least about 86% amino acid sequence identity, alternatively at least about 87% amino acid sequence identity, alternatively at least about 88% amino acid sequence identity, alternatively at least about 89% amino acid sequence identity, or at least about 90% amino acid Sequence identity, or at least 91% amino acid sequence identity, or at least about 92% amino acid sequence identity, alternatively at least about 93% amino acid sequence identity, alternatively at least about 94% amino acid sequence identity, or at least about 95% amino acid sequence identity Or an amino acid sequence having at least about 96% amino acid sequence identity, alternatively at least about 97% amino acid sequence identity, alternatively at least about 98% sequence identity, or at least about 99% amino acid sequence identity Isolated PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, RO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, relates PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.

  In one aspect, the invention is at least about 10 amino acids long, or at least about 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180. 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430 PRO196, PRO217, PRO231, PRO236, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600 amino acids in length or longer PRO245, PRO246, PRO258, PRO287, RO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, RO5759, PRO5925, PRO9725, PRO5925 Body polypeptide. In some cases, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1213, RO1213, PRO1213, PRO1213 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 mutant polypeptides are native PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO283, 8, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO59725, PRO9725, PRO9725, PRO9725 Has no more than one conservative amino acid substitution compared to the peptide sequence, or is native PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO73 32, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709, or PRO779, compared to three, PRO779 Has no more than 5, 6, 7, 8, 9, or 10 conservative amino acid substitutions.

In a particular aspect, the present invention relates to isolated PRO196, PRO217, PRO231, PRO236, which has no N-terminal signal sequence and / or initiation methionine and is encoded by a nucleotide sequence encoding an amino acid sequence as described above. PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1540, RO1840, RO1540, PRO10102, PRO10282, PRO61709 or PRO779 Repeptides are provided. Methods for producing them are also described herein, which include host cells containing vectors containing appropriate encoding nucleic acid molecules, including PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, RO7410 RO Cultivate under suitable conditions, PR from culture medium 196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1398, PRO1298, PRO1398, PRO1398, PRO1298 Recovering a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.
In another aspect, the invention relates to isolated PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, wherein the transmembrane domain is deleted or the transmembrane domain is inactivated. , PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5925, PRO9985, PRO1097 To do. Methods for producing them are also described herein, which include host cells containing vectors containing appropriate encoding nucleic acid molecules, including PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, RO7497 Cultivate under suitable conditions, PR from culture medium 196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1398, PRO1298, PRO1398, PRO1398, PRO1298 Recovering a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.

The present invention is defined here as PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1413, PRO1213, PRO1213, PRO1213 , PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides. In particular, agonists or antagonists include anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO731, PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO1022, anti-PRO1022, anti-PRO1022 Anti-PRO61709 or anti-PRO779 antibody or small molecule.
The present invention includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or a method of identifying an agonist or antagonist of a PRO779 polypeptide, which includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO24 , PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO18960, PRO18991 , PRO61709 or PRO779 polypeptide with a candidate molecule, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO732, PRO732, RO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides mediated by biological activity Including. Preferably, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1286, PRO1187 , PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides are native PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, RO328, PRO328P 4, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5925, PRO9985, RO9 is there.

The present invention includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, or PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO32, PRO28, PRO28, described herein. , PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5910, PRO7497 Or anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO732, anti-PRO732 Anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10102, anti-PRO10282 Alternatively, a composition of matter comprising an anti-PRO779 antibody in combination with a carrier is provided. In some cases, the carrier is a pharmaceutically acceptable carrier.
The present invention includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides, or agonists or antagonists thereof as described above, or anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-P O246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1313, anti-PRO1513, anti-PRO1513 Anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10282, anti-PRO61709 or anti-PRO779 antibody, anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, RO237 Anti-PRO246, Anti-PRO258, Anti-PRO287, Anti-PRO328, Anti-PRO344, Anti-PRO357 Anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5997, anti-PRO5997 , Anti-PRO7425, anti-PRO10102, anti-PRO10282, anti-PRO61709 or anti-PRO779 antibodies for use in the preparation of a medicament useful for the treatment of symptoms.

The present invention provides a vector comprising DNA encoding any of the polypeptides described herein. Host cells containing any of such vectors are also provided. By way of example, the host cell may be a CHO cell, E. coli, or yeast. Further provided is a method for producing a desired polypeptide described herein, comprising culturing a host cell under conditions suitable for expression of the desired polypeptide and recovering the desired polypeptide from the cell culture. .
The present invention provides chimeric molecules comprising a desired polypeptide described herein fused to a heterologous polypeptide or amino acid sequence. Examples of such chimeric molecules include an epitope tag sequence or a desired polypeptide described herein fused to an Fc region of an immunoglobulin.
The present invention provides antibodies that specifically bind to any of the above or below polypeptides. In some cases, the antibody is a monoclonal antibody, a humanized antibody, an antibody fragment or a single chain antibody.
The present invention provides oligonucleotide probes useful as isolation of genomic and cDNA nucleotide sequences, measurement or detection of expression of related genes, and antisense probes, which probes can be derived from any of the nucleotide sequences described above or below. Can be induced. Suitable probe lengths are as described above.

The present invention also includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or a method that identifies a phenotype associated with disruption of a gene encoding a PRO779 polypeptide, the method comprising:
(A) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1270 Providing a non-human transgenic animal whose genome comprises a disruption of a gene encoding a PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide;
(B) measuring the physiological properties of the non-human transgenic animal;
(C) comparing the measured physiological properties with those of wild-type animals of matched gender, wherein the physiological properties of the non-human transgenic animal differ from the physiological properties of the wild-type animal. Identified as a phenotype resulting from gene disruption in In one aspect, the non-human transgenic animal is a mammal. In other embodiments, the mammal is a rodent. In yet another aspect, the mammal is a rat or mouse. In one aspect, the non-human transgenic animal is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO1104 , PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides. In other embodiments, the phenotype exhibited by the non-human transgenic animal compared to gender-matched littermates is: neuropathy; cardiovascular, endothelial or angiogenic disease; ocular abnormality; immune disease; tumor Or at least one of a bone metabolism disorder or disease; a lipid metabolism disorder; or a developmental disorder.

  In yet another aspect, the neurological disorder is an increased anxiety-like response during an open field activity test. In yet another aspect, the neurological disorder is a reduced anxiety-like response during an open field activity test. In yet another aspect, the neurological disorder is an abnormal circadian rhythm during a home cage activity test. In yet another aspect, the neurological disorder is increased motor coordination during an inverted screen test. In yet another aspect, the neurological disorder is impaired motor coordination during an inverted screen test. In yet another aspect, the neurological disorder includes depression, generalized anxiety disorder, attention deficit disorder, sleep disorder, hyperactivity disorder, obsessive compulsive disorder, schizophrenia, cognitive dysfunction, hyperalgesia and sensory organ disorder. Such neurological disorders include, but are not limited to, those in the category defined as “anxiety disorders”: mild to moderate anxiety, anxiety disorders due to general medical conditions, and Unspecified anxiety disorder, generalized anxiety disorder, panic attack, panic disorder with agoraphobia, panic disorder without agoraphobia, post-traumatic stress syndrome, social phobia, social anxiety, autism , Specific phobia, substance-induced anxiety disorder, acute alcohol withdrawal, obsessive compulsive disorder, agoraphobia, monopolar disorder, bipolar disorder I or II, bipolar disorder not otherwise specified, circulatory temperament disease, depression Cognitive impairment, major depressive disorder, mood disorder, substance-induced mood disorder, increased cognitive function, but not limited, loss of cognitive function due to Alzheimer's disease, cerebral infarction or trauma to the brain, not limited Not Cans, learning disorders / learning impotence, diseases or stroke resulting from damage including cerebral palsy. In addition, anxiety disorders may be applied to personality disorders including, but not limited to, the following types: paranoia, social dislike, avoidance behavior, borderline personality disorder, addiction, narcotics, self-loving, obsessive Neurosis, schizophrenia and schizophrenic personality.

In other embodiments, the eye abnormality is a retinal abnormality. In yet another aspect, the eye abnormality is visual impairment or blindness. In yet another aspect, the retinal abnormality is consistent with retinitis pigmentosa or is characterized by retinal degeneration or retinal dysplasia.
In other embodiments, retinal abnormalities include retinal dysplasia, various retinopathy including retinopathy of prematurity, post-lens fibroplasia, neovascular glaucoma, age-related macular degeneration, diabetic macular edema, corneal neovascularization, corneal transplantation Angiogenesis, corneal transplant rejection, retinal / choroidal neovascularization, angle angiogenesis (rubeosis), ocular neovascular disease, vascular restenosis, arteriovenous malformation (AVM), meningioma, hemangioma, angiofibroma, thyroid hyperplasia Formation (including Graves' disease), transplantation of cornea and other tissues, retinal artery injury or obstruction; retinal degeneration causing secondary atrophy of the retinal vasculature, retinitis pigmentosa, macular atrophy, Stargardt disease, congenital Stationary night blindness, congenital choroidal deficiency, brain atrophy, Leber's congenital cataract, retinal sequestration, Wagner syndrome, Usher syndrome, Zellweger syndrome, Sardino-Mainser syndrome Senior-Loken Syndrome, Valday-Beedle Syndrome, Alport Syndrome, Alstrem Syndrome, Cocaine Syndrome, Congenital Spondylodysplasia, Flynn-Eyed Syndrome, Friedreich Ataxia, Hullgren Syndrome, Marshall Syndrome, Albers-Schonberg Disease , Lefsum disease, Keynes-Saire syndrome, Wardenburg syndrome, Alagille syndrome, myotonic dystrophy, Olive Bridge cerebellar atrophy, Pierre-Marie syndrome, Stickler syndrome, carotinemeia, cystinosis, Wolfram Consistent with syndrome, Bassen-Kornzweig syndrome, abetalipoproteinemia, dystaxia, Batten disease, mucopolysaccharidosis, homocystinuria, or mannosidosis.
In yet another aspect, the eye abnormality is cataract. In still other embodiments, the cataract is a systemic disease such as human Down syndrome, Hallerman-Streff syndrome, Rho syndrome, galactosemia, Marfan syndrome, trisomy 13-15 disease, Alport syndrome, myotonic dystrophy, Fabry disease , Hypoparathyroidism or Conradi syndrome.
In yet another aspect, the developmental abnormality includes embryonic lethality or reduced survival.
In yet another aspect, the cardiovascular, endothelial or angiogenic disease is an arterial disease such as diabetes mellitus; congestive nipple; optic nerve atrophy; atherosclerosis; angina; myocardial infarction such as acute myocardial infarction; And heart failure, such as congestive heart failure; hypertension; inflammatory vasculitis; Raynaud's disease and Raynaud's phenomenon; aneurysms and arterial restenosis; venous and lymphatic diseases such as thrombophlebitis, lymphangitis, and lymphedema; Vascular diseases; Cancers such as vascular tumors such as hemangiomas (capillary and spongy), glomus tumors, peripheral vasodilation, bacterial hemangiomas, vascular endothelial tumors, angiosarcomas, angioderma, Kaposi's sarcoma, lymphatic vessels Tumors and angiogenesis; tumors angiogenesis; wounds such as wounds, burns, and other damaged tissues, graft fixation, scars; ischemic reperfusion injury; rheumatoid arthritis; ; Renal diseases such as acute renal failure, or osteoporosis.

In yet another aspect, the immune disease is systemic lupus erythematosus; rheumatoid arthritis; juvenile rheumatoid arthritis; spondyloarthropathy; systemic scleroderma (scleroderma); idiopathic inflammatory myopathy (dermatomyositis, polymyositis) ); Sjogren's syndrome; systemic vasculitis; sarcoidosis; autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria); autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura, immunity) Mediated thrombocytopenia); thyroiditis (Graves' disease, Hashimoto's thyroiditis, juvenile lymphoid thyroiditis, atrophic thyroiditis); diabetes mellitus, immune-mediated renal disease (glomerulonephritis, tubulointerstitial nephritis) Demyelinating diseases of the central and peripheral nervous system, eg multiple sclerosis, idiopathic demyelinating polyneuropathy or Guillain-Barre syndrome, and chronic inflammatory demyelinating polyneuropathy; hepatobiliary disease, eg Infectious hepatitis (A, B, C, D, hepatitis E and other non-hepatotropic viruses), autoimmune chronic active hepatitis, primary biliary cirrhosis, granulomatous hepatitis, and sclerosis Inflammatory bowel disease (ulcerative colitis: Crohn's disease); gluten-sensitive enteropathy and Whipple disease; bullous skin disease, polymorphic erythema and contact dermatitis, autoimmunity or immunity including psoriasis Allergic diseases such as asthma, allergic rhinitis, atopic dermatitis, food hypersensitivity and urticaria; lung immune diseases such as eosinophilic pneumonia, idiopathic pulmonary fibrosis and hypersensitivity pneumonia; Or consistent with transplant-related diseases including graft rejection and graft-versus-host disease.
In yet another aspect, the bone metabolism disorder or disease is arthritis, osteoporosis, osteopenia or marble bone disease.

  In other embodiments, the non-human transgenic animals have the following physiological properties compared to gender-matched wild-type littermates: increased anxiety-like responses during open field trials; anxiety during open field activity tests Decreased circadian response; abnormal circadian rhythm during home cage activity test, including decreased migration; increased exploratory activity during open field test; increased stress-induced hyperthermia; motor coordination during reverse screen test Impaired movement; Impaired motor coordination during reverse screen test; Increased retinal arterial twist; Retinal degeneration characterized by retinal vascular attenuation; Ophthalmic abnormalities; Increased mean systolic blood pressure; Mean fasting serum Increased blood glucose level; decreased average serum blood glucose level; increased average serum cholesterol level; increased average serum triglyceride level; decreased average serum cholesterol level; average Reduced clear triglyceride levels; increased glucose tolerance; impaired glucose tolerance; increased mean serum insulin levels; decreased mean serum insulin levels; increased uric acid levels; decreased serum phosphate levels; increased alkaline phosphatase levels and alanine Increased aminotransferase levels; liver disease; increased average percentage of CD25 + in both spleen and lymph nodes; decreased average percentage of natural killer cells; decreased average percentage of CD21HiCD23Med cells in spleen and lymph nodes; Increase in mean percentage and decrease in mean percentage of B cells; Increase in mean percentage of CD8 + cells; Increase in mean percentage of eosinophils; Decrease in mean serum IgG1 response to ovalbumin challenge; Mean serum IgG2a to ovalbumin challenge Decreased response; ovalbumin challenge Decreased mean serum IgG1 response to; increased mean serum IgG2a response to ovalbumin challenge; increased mean serum MCP-1 response to LPS challenge; increased mean serum TNF-α response to LPS challenge; to LPS challenge Decreased mean serum MCP-1 response; decreased mean serum IL-6 response to LPS challenge; decreased TNF-α response to LPS challenge; increased mean serum IL6 response to LPS challenge; increased mean platelet count; Decrease in mean total white blood cell (WBC) count; decrease in absolute lymphocyte count; decrease in absolute monocyte count; decrease in skin fibroblast proliferation; increase in skin fibroblast proliferation; average percentage of total fat and total fat mass Increase; increase in average body weight; increase in average physical condition; increase in organ weight; increase in total tissue mass (TTM); lean body mass (LBM) Increased bone density (BMD) of whole body, femur and vertebra; increased bone mineral density (BMC) of whole body, femur and vertebra; increased volumetric bone density (vBMD) of whole body, femur and vertebra Increase in mean mid-femoral cortical thickness and cross-sectional area; increase in mean vertebral trabecular volume, number and connectivity density; increase in total fat and average percentage of total body fat; decrease in average body weight; decrease in average body length; Decrease in total tissue mass (TTM); decrease in lean body mass (LBM); decrease in bone mineral density (BMD) in femur and vertebra; decrease in bone mineral density (BMC) in whole body, femur and vertebra; whole body, femur Reduced volumetric bone density (vBMD) of bones and vertebrae; reduced mean femoral cortical thickness and cross-sectional area; reduced mean vertebral trabecular volume, number and connectivity density; severe abdominal and subcutaneous fat deposition Depletion; decrease in organ weight; growth retardation; hydrocephalus; sebaceous gland Formation and growth retardation; apoptosis of olfactory neuroepithelial cells; lymphoid hyperplasia and tissue inflammation; developmental abnormalities; male infertility; growth retardation accompanied by a decrease viability; and embryonic mortality, indicating at least one.

The present invention also includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 Provided is an isolated cell derived from a non-human transgenic animal whose genome comprises a disruption of a gene encoding PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide. In one aspect, the isolated cell is a mouse cell. In yet other embodiments, the mouse cell is an embryonic stem cell. In yet other embodiments, the isolated cells have the following phenotype compared to gender-matched wild-type littermates: neuropathy; cardiovascular, endothelial or angiogenic disease; ocular abnormality; immune disease; oncology Derived from a non-human transgenic animal exhibiting at least one of: genetic disease; bone metabolism disorder or disease; lipid metabolism disorder; or developmental abnormality. The present invention also includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 Providing a method of identifying an agent that modulates a phenotype associated with disruption of a gene encoding a PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, the method comprising:
(A) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1270 PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709, or a non-human transgenic animal whose genome contains a disruption of a gene encoding a PRO779 polypeptide;
(B) measuring the physiological properties of the non-human transgenic animal;
(C) comparing the measured physiological properties with those of wild-type animals of matched gender, wherein the physiological properties of the non-human transgenic animal differ from the physiological properties of the wild-type animal. Identified as a phenotype resulting from a gene disruption in
(D) administering a test agent to the non-human transgenic animal of (a);
(E) determining whether the test agent modulates the identified phenotype associated with gene disruption in the non-human transgenic animal.

In one aspect, the phenotype associated with gene disruption is neuropathy; cardiovascular, endothelial or angiogenic diseases; eye disorders; immune disorders; oncological disorders; bone metabolism disorders or disorders; lipid metabolism disorders; including.
In yet another aspect, the neurological disorder is an increased anxiety-like response during an open field activity test. In yet another aspect, the neurological disorder is a reduced anxiety-like response during an open field activity test. In yet another aspect, the neurological disorder is an abnormal circadian rhythm during a home cage activity test. In yet another aspect, the neurological disorder is increased motor coordination during an inverted screen test. In yet another aspect, the neurological disorder is impaired motor coordination during an inverted screen test. In yet another aspect, the neurological disorder includes depression, generalized anxiety disorder, attention deficit disorder, sleep disorder, hyperactivity disorder, obsessive compulsive disorder, schizophrenia, cognitive dysfunction, hyperalgesia and sensory organ disorder. Such neurological disorders include, but are not limited to, those in the category defined as “anxiety disorders”: mild to moderate anxiety, anxiety disorders due to general medical conditions, and Unspecified anxiety disorder, generalized anxiety disorder, panic attack, panic disorder with agoraphobia, panic disorder without agoraphobia, post-traumatic stress syndrome, social phobia, social anxiety, autism , Specific phobia, substance-induced anxiety disorder, acute alcohol withdrawal, obsessive compulsive disorder, agoraphobia, monopolar disorder, bipolar disorder I or II, bipolar disorder not otherwise specified, circulatory temperament disease, depression Cognitive impairment, major depressive disorder, mood disorder, substance-induced mood disorder, increased cognitive function, but not limited, loss of cognitive function due to Alzheimer's disease, cerebral infarction or trauma to the brain, not limited Not Cans, learning disorders / learning impotence, diseases or stroke resulting from damage including cerebral palsy. In addition, anxiety disorders may be applied to personality disorders including, but not limited to, the following types: paranoia, social dislike, avoidance behavior, borderline personality disorder, addiction, narcotics, self-loving, obsessive Neurosis, schizophrenia and schizophrenic personality.

In other embodiments, the eye abnormality is a retinal abnormality. In yet another aspect, the eye abnormality is visual impairment or blindness. In yet another aspect, the retinal abnormality is consistent with retinitis pigmentosa or is characterized by retinal degeneration or retinal dysplasia.
In other embodiments, retinal abnormalities include retinal dysplasia, various retinopathy including retinopathy of prematurity, post-lens fibroplasia, neovascular glaucoma, age-related macular degeneration, diabetic macular edema, corneal neovascularization, corneal transplantation Angiogenesis, corneal transplant rejection, retinal / choroidal neovascularization, angle angiogenesis (rubeosis), ocular neovascular disease, vascular restenosis, arteriovenous malformation (AVM), meningioma, hemangioma, angiofibroma, thyroid hyperplasia Formation (including Graves' disease), transplantation of cornea and other tissues, retinal artery injury or obstruction; retinal degeneration causing secondary atrophy of the retinal vasculature, retinitis pigmentosa, macular atrophy, Stargardt disease, congenital Stationary night blindness, congenital choroidal deficiency, brain atrophy, Leber's congenital cataract, retinal sequestration, Wagner syndrome, Usher syndrome, Zellweger syndrome, Sardino-Mainser syndrome Senior-Loken Syndrome, Valday-Beedle Syndrome, Alport Syndrome, Alstrem Syndrome, Cocaine Syndrome, Congenital Spondylodysplasia, Flynn-Eyed Syndrome, Friedreich Ataxia, Hullgren Syndrome, Marshall Syndrome, Albers-Schonberg Disease , Lefsum disease, Keynes-Saire syndrome, Wardenburg syndrome, Alagille syndrome, myotonic dystrophy, Olive Bridge cerebellar atrophy, Pierre-Marie syndrome, Stickler syndrome, carotinemeia, cystinosis, Wolfram Consistent with syndrome, Bassen-Kornzweig syndrome, abetalipoproteinemia, dystaxia, Batten disease, mucopolysaccharidosis, homocystinuria, or mannosidosis.

In yet another aspect, the eye abnormality is cataract. In still other embodiments, the cataract is a systemic disease such as human Down syndrome, Hallerman-Streff syndrome, Rho syndrome, galactosemia, Marfan syndrome, trisomy 13-15 disease, Alport syndrome, myotonic dystrophy, Fabry disease , Hypoparathyroidism or Conradi syndrome.
In yet another aspect, the developmental abnormality includes embryonic lethality or reduced survival.
In yet another aspect, the cardiovascular, endothelial or angiogenic disease is an arterial disease such as diabetes mellitus; congestive nipple; optic nerve atrophy; atherosclerosis; angina; myocardial infarction such as acute myocardial infarction; And heart failure, such as congestive heart failure; hypertension; inflammatory vasculitis; Raynaud's disease and Raynaud's phenomenon; aneurysms and arterial restenosis; venous and lymphatic diseases such as thrombophlebitis, lymphangitis, and lymphedema; Vascular diseases; Cancers such as vascular tumors such as hemangiomas (capillary and spongy), glomus tumors, peripheral vasodilation, bacterial hemangiomas, vascular endothelial tumors, angiosarcomas, angioderma, Kaposi's sarcoma, lymphatic vessels Tumors and angiogenesis; tumors angiogenesis; wounds such as wounds, burns, and other damaged tissues, graft fixation, scars; ischemic reperfusion injury; rheumatoid arthritis; ; Renal diseases such as acute renal failure, or osteoporosis.

In yet another aspect, the immune disease is systemic lupus erythematosus; rheumatoid arthritis; juvenile rheumatoid arthritis; spondyloarthropathy; systemic scleroderma (scleroderma); idiopathic inflammatory myopathy (dermatomyositis, polymyositis) ); Sjogren's syndrome; systemic vasculitis; sarcoidosis; autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria); autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura, immunity) Mediated thrombocytopenia); thyroiditis (Graves' disease, Hashimoto's thyroiditis, juvenile lymphoid thyroiditis, atrophic thyroiditis); diabetes mellitus, immune-mediated renal disease (glomerulonephritis, tubulointerstitial nephritis) Demyelinating diseases of the central and peripheral nervous system, eg multiple sclerosis, idiopathic demyelinating polyneuropathy or Guillain-Barre syndrome, and chronic inflammatory demyelinating polyneuropathy; hepatobiliary disease, eg Infectious hepatitis (A, B, C, D, hepatitis E and other non-hepatotropic viruses), autoimmune chronic active hepatitis, primary biliary cirrhosis, granulomatous hepatitis, and sclerosis Inflammatory bowel disease (ulcerative colitis: Crohn's disease); gluten-sensitive enteropathy and Whipple disease; bullous skin disease, polymorphic erythema and contact dermatitis, autoimmunity or immunity including psoriasis Allergic diseases such as asthma, allergic rhinitis, atopic dermatitis, food hypersensitivity and urticaria; lung immune diseases such as eosinophilic pneumonia, idiopathic pulmonary fibrosis and hypersensitivity pneumonia; Or consistent with transplant-related diseases including graft rejection and graft-versus-host disease.
In yet another aspect, the bone metabolism disorder or disease is arthritis, osteoporosis, osteopenia or marble bone disease.

  In other embodiments, the non-human transgenic animals have the following physiological properties compared to gender-matched wild-type littermates: increased anxiety-like responses during open field trials; anxiety during open field activity tests Decreased circadian response; abnormal circadian rhythm during home cage activity test, including decreased migration; increased exploratory activity during open field test; increased stress-induced hyperthermia; motor coordination during reverse screen test Impaired movement; Impaired motor coordination during reverse screen test; Increased retinal arterial twist; Retinal degeneration characterized by retinal vascular attenuation; Ophthalmic abnormalities; Increased mean systolic blood pressure; Mean fasting serum Increased blood glucose level; decreased average serum blood glucose level; increased average serum cholesterol level; increased average serum triglyceride level; decreased average serum cholesterol level; average Reduced clear triglyceride levels; increased glucose tolerance; impaired glucose tolerance; increased mean serum insulin levels; decreased mean serum insulin levels; increased uric acid levels; decreased serum phosphate levels; increased alkaline phosphatase levels and alanine Increased aminotransferase levels; liver disease; increased average percentage of CD25 + in both spleen and lymph nodes; decreased average percentage of natural killer cells; decreased average percentage of CD21HiCD23Med cells in spleen and lymph nodes; Increase in mean percentage and decrease in mean percentage of B cells; Increase in mean percentage of CD8 + cells; Increase in mean percentage of eosinophils; Decrease in mean serum IgG1 response to ovalbumin challenge; Mean serum IgG2a to ovalbumin challenge Decreased response; ovalbumin challenge Decreased mean serum IgG1 response to; increased mean serum IgG2a response to ovalbumin challenge; increased mean serum MCP-1 response to LPS challenge; increased mean serum TNF-α response to LPS challenge; to LPS challenge Reduced mean serum MCP-1 response; decreased mean serum IL-6 response to LPS challenge; decreased TNFα response to LPS challenge; increased mean serum IL6 response to LPS challenge; increased mean platelet count; Decrease in white blood cell (WBC) count; decrease in absolute lymphocyte count; decrease in absolute monocyte count; decrease in skin fibroblast proliferation; increase in skin fibroblast proliferation; increase in average percentage of total fat and total fat mass; Increased average body weight; increased average physical condition; increased organ weight; increased total tissue mass (TTM); lean body mass (LBM) Increased bone density (BMD) of whole body, femur and vertebra; increased bone mineral density (BMC) of whole body, femur and vertebra; increased volumetric bone density (vBMD) of whole body, femur and vertebra Increase in mean mid-femoral cortical thickness and cross-sectional area; increase in mean vertebral trabecular volume, number and connectivity density; increase in total fat and average percentage of total body fat; decrease in average body weight; decrease in average body length; Decrease in total tissue mass (TTM); decrease in lean body mass (LBM); decrease in bone mineral density (BMD) in femur and vertebra; decrease in bone mineral density (BMC) in whole body, femur and vertebra; whole body, femur Bone and vertebra volumetric bone density (vBMD) reduction; mean femoral mid-cortical thickness and cross-sectional area reduction; mean vertebral trabecular volume, number and connectivity density reduction; severe abdominal and subcutaneous body fat deposition Depletion; organ weight loss; growth retardation; hydrocephalus; sebaceous hyperplasia It shows at least one of: formation and growth delay; apoptosis of olfactory neuroepithelial cells; lymphoid hyperplasia and tissue inflammation; developmental abnormality; male infertility; growth delay with reduced survival; and embryonic mortality.

The invention also provides an agent that modulates a phenotype associated with gene disruption. In one aspect, the drug is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1413, PRO11513, PRO11513, PRO11513 , PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides. In yet another aspect, the agonist agent is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO7331. , Anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO10425, anti-PRO10425, anti-PRO10425, anti-PRO10425 PRO10282, anti-PRO61709 or anti-PRO779 polypeptide. In yet another aspect, the antagonist agent is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO10425, anti-PRO10425, anti-PRO10425, anti-PRO10425 Anti-PRO10282, anti-PRO61709 or anti-PRO779 antibody.
The present invention also includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 Providing a method of identifying an agent that modulates a physiological property associated with disruption of a gene encoding a PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, the method comprising:
(A) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1270 PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709, or a non-human transgenic animal whose genome contains a disruption of a gene encoding a PRO779 polypeptide;
(B) measuring the physiological properties of the non-human transgenic animal of (a);
(C) comparing the measured physiological properties of (b) with those of wild-type animals of matched gender, wherein the physiological properties exhibited by the non-human transgenic animal differ from those exhibited by the wild-type animals. Has been identified as a physiological property associated with gene disruption;
(D) administering a test agent to the non-human transgenic animal of (a);
(E) determining whether the physiological properties associated with gene disruption are modulated.

In one aspect, the non-human transgenic animal exhibits at least one of the following physiological properties compared to gender-matched wild-type littermates:
In another aspect, the non-human transgenic animal has the following physiological properties compared to gender-matched wild-type littermates: increased anxiety-like response during the open field test; anxiety during the open field activity test Decreased circadian response; abnormal circadian rhythm during home cage activity test, including decreased migration; increased exploratory activity during open field test; increased stress-induced hyperthermia; motor coordination during reverse screen test Impaired movement; Impaired motor coordination during reverse screen test; Increased retinal arterial twist; Retinal degeneration characterized by retinal vascular attenuation; Ophthalmic abnormalities; Increased mean systolic blood pressure; Mean fasting serum Increased blood glucose level; decreased average serum blood glucose level; increased average serum cholesterol level; increased average serum triglyceride level; decreased average serum cholesterol level; average Reduced clear triglyceride levels; increased glucose tolerance; impaired glucose tolerance; increased mean serum insulin levels; decreased mean serum insulin levels; increased uric acid levels; decreased serum phosphate levels; increased alkaline phosphatase levels and alanine Increased transaminase levels; liver disease; increased average proportion of CD25 + in both spleen and lymph nodes; decreased average proportion of natural killer cells; decreased average proportion of CD21HiCD23Med cells in spleen and lymph nodes; Increase in mean percentage and decrease in mean percentage of B cells; Increase in mean percentage of CD8 + cells; Increase in mean percentage of eosinophils; Decrease in mean serum IgG1 response to ovalbumin challenge; Mean serum IgG2a to ovalbumin challenge Decreased response; ovalbumin challenge Decreased mean serum IgG1 response to; increased mean serum IgG2a response to ovalbumin challenge; increased mean serum MCP-1 response to LPS challenge; increased mean serum TNF-α response to LPS challenge; to LPS challenge Reduced mean serum MCP-1 response; decreased mean serum IL-6 response to LPS challenge; decreased TNFα response to LPS challenge; increased mean serum IL6 response to LPS challenge; increased mean platelet count; Decrease in white blood cell (WBC) count; decrease in absolute lymphocyte count; decrease in absolute monocyte count; decrease in skin fibroblast proliferation; increase in skin fibroblast proliferation; increase in average percentage of total fat and total fat mass; Increased average body weight; increased average physical condition; increased organ weight; increased total tissue mass (TTM); lean body mass (LBM) Increase in whole body, femur and vertebra bone density (BMD); increase in bone mineral density (BMC) in whole body, femur and vertebra; increase in volumetric bone density (vBMD) in whole body, femur and vertebra Increase in mean mid-femoral cortical thickness and cross-sectional area; increase in mean vertebral trabecular volume, number and connectivity density; increase in total fat and average percentage of total body fat; decrease in average body weight; decrease in average body length; Decrease in total tissue mass (TTM); decrease in lean body mass (LBM); decrease in bone mineral density (BMD) in femur and vertebra; decrease in bone mineral density (BMC) in whole body, femur and vertebra; whole body, femur Bone and vertebra volumetric bone density (vBMD) reduction; mean femoral mid-cortical thickness and cross-sectional area reduction; mean vertebral trabecular volume, number and connectivity density reduction; severe abdominal and subcutaneous body fat deposition Depletion; organ weight loss; growth retardation; hydrocephalus; sebaceous hyperplasia It shows at least one of: formation and growth delay; apoptosis of olfactory neuroepithelial cells; lymphoid hyperplasia and tissue inflammation; developmental abnormality; male infertility; growth delay with reduced survival; and embryonic mortality.

  The present invention also provides agents that modulate physiological properties associated with gene disruption. In one aspect, the drug is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1413, PRO11513, PRO11513, PRO11513 A phenotypic agonist or antagonist associated with the disruption of the gene encoding, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide. In yet another aspect, the drug is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1104, PRO1213, PRO1213, PRO1213 , PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides. In yet a further aspect, the agonist agent is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO724. PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO10425, anti-PRO10425, anti-PRO10425, anti-PRO10425 Anti-PRO10282, anti-PRO61709 or anti-PRO779 antibody. In yet another aspect, the antagonist agent is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO10425, anti-PRO10425, anti-PRO10425, anti-PRO10425 Anti-PRO10282, anti-PRO61709 or anti-PRO779 antibody.

The present invention also includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or a method that identifies an agent that modulates a behavior associated with disruption of a gene encoding a PRO779 polypeptide, the method comprising:
(A) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1270 PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709, or a non-human transgenic animal whose genome contains a disruption of a gene encoding a PRO779 polypeptide;
(B) observe the behavior exhibited by the non-human transgenic animal of (a);
(C) comparing the observed behavior of (b) with that of a wild-type animal of matched gender, where the observed behavior exhibited by a non-human transgenic animal different from the observed behavior exhibited by the wild-type animal Identified as a behavior associated with gene disruption;
(D) administering a test agent to the non-human transgenic animal of (a);
(E) determining whether the agent modulates a behavior associated with gene disruption.

  In one aspect, the observed behavior is an increased anxiety-like response during an open field activity test. In yet another aspect, the observed behavior is a reduced anxiety-like response during the open field activity test. In yet another aspect, the observed behavior is an abnormal circadian rhythm during a home cage activity test. In yet another aspect, the observed behavior is increased motor coordination during an inverted screen test. In yet another aspect, the observed behavior is impaired motor coordination during an inverted screen test. In yet another aspect, the observed behavior includes depression, generalized anxiety disorder, attention deficit disorder, sleep disorder, hyperactivity disorder, obsessive compulsive disorder, schizophrenia, cognitive dysfunction, hyperalgesia and sensory organ disorder. Including. Such neurological disorders include, but are not limited to, those in the category defined as “anxiety disorders”: mild to moderate anxiety, anxiety disorders due to general medical conditions, and Unspecified anxiety disorder, generalized anxiety disorder, panic attack, panic disorder with agoraphobia, panic disorder without agoraphobia, post-traumatic stress syndrome, social phobia, social anxiety, autism , Specific phobia, substance-induced anxiety disorder, acute alcohol withdrawal, obsessive compulsive disorder, agoraphobia, monopolar disorder, bipolar disorder I or II, bipolar disorder not otherwise specified, circulatory temperament disease, depression Cognitive impairment, major depressive disorder, mood disorder, substance-induced mood disorder, increased cognitive function, but not limited, loss of cognitive function due to Alzheimer's disease, cerebral infarction or trauma to the brain, not limited Not Cans, learning disorders / learning impotence, diseases or stroke resulting from damage including cerebral palsy. In addition, anxiety disorders may be applied to personality disorders including, but not limited to, the following types: paranoia, social dislike, avoidance behavior, borderline personality disorder, addiction, narcotics, self-loving, obsessive Neurosis, schizophrenia and schizophrenic personality.

  The present invention also provides agents that modulate the behavior associated with gene disruption. In one aspect, the drug is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1413, PRO11513 PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or a phenotypic agonist or antagonist associated with the disruption of the gene encoding the PRO779 polypeptide. In yet another aspect, the drug is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1104, PRO1213, PRO1213, PRO1213 , PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides. In yet a further aspect, the agonist agent is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO724. PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO10425, anti-PRO10425, anti-PRO10425, anti-PRO10425 Anti-PRO10282, anti-PRO61709 or anti-PRO779 antibody. In yet another aspect, the antagonist agent is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO10425, anti-PRO10425, anti-PRO10425, anti-PRO10425 Anti-PRO10282, anti-PRO61709 or anti-PRO779 antibody.

The present invention also includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 Neuropathy associated with disruption of the gene encoding PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide; cardiovascular, endothelial or angiogenic disease; eye abnormality; immune disease; tumor Bone disease or disorder; lipid metabolism disorder Or developmental abnormalities and provides a method for identifying a remission or modulate drug, the method comprising,
(A) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1270 PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709, or a non-human transgenic animal whose genome contains a disruption of a gene encoding a PRO779 polypeptide;
(B) administering a test agent to the non-human transgenic animal;
(C) Neuropathy associated with gene disruption in non-human transgenic animals; cardiovascular, endothelial or angiogenic diseases; eye disorders; immune disorders; oncological disorders; bone metabolism disorders or disorders; lipid metabolism Determining whether to ameliorate or modulate a disease; or developmental abnormality.

  In yet another aspect, the neurological disorder is an increased anxiety-like response during an open field activity test. In yet another aspect, the neurological disorder is a reduced anxiety-like response during an open field activity test. In yet another aspect, the neurological disorder is an abnormal circadian rhythm during a home cage activity test. In yet another aspect, the neurological disorder is increased motor coordination during an inverted screen test. In yet another aspect, the neurological disorder is impaired motor coordination during an inverted screen test. In yet another aspect, the neurological disorder includes depression, generalized anxiety disorder, attention deficit disorder, sleep disorder, hyperactivity disorder, obsessive compulsive disorder, schizophrenia, cognitive dysfunction, hyperalgesia and sensory organ disorder. Such neurological disorders include, but are not limited to, those in the category defined as “anxiety disorders”: mild to moderate anxiety, anxiety disorders due to general medical conditions, and Unspecified anxiety disorder, generalized anxiety disorder, panic attack, panic disorder with agoraphobia, panic disorder without agoraphobia, post-traumatic stress syndrome, social phobia, social anxiety, autism , Specific phobia, substance-induced anxiety disorder, acute alcohol withdrawal, obsessive compulsive disorder, agoraphobia, monopolar disorder, bipolar disorder I or II, bipolar disorder not otherwise specified, circulatory temperament disease, depression Cognitive impairment, major depressive disorder, mood disorder, substance-induced mood disorder, increased cognitive function, but not limited, loss of cognitive function due to Alzheimer's disease, cerebral infarction or trauma to the brain, not limited Not Cans, learning disorders / learning impotence, diseases or stroke resulting from damage including cerebral palsy. In addition, anxiety disorders may be applied to personality disorders including, but not limited to, the following types: paranoia, social dislike, avoidance behavior, borderline personality disorder, addiction, narcotics, self-loving, obsessive Neurosis, schizophrenia and schizophrenic personality.

In other embodiments, the eye abnormality is a retinal abnormality. In yet another aspect, the eye abnormality is visual impairment or blindness. In yet another aspect, the retinal abnormality is consistent with retinitis pigmentosa or is characterized by retinal degeneration or retinal dysplasia.
In other embodiments, retinal abnormalities include retinal dysplasia, various retinopathy including retinopathy of prematurity, post-lens fibroplasia, neovascular glaucoma, age-related macular degeneration, diabetic macular edema, corneal neovascularization, corneal transplantation Angiogenesis, corneal transplant rejection, retinal / choroidal neovascularization, angle angiogenesis (rubeosis), ocular neovascular disease, vascular restenosis, arteriovenous malformation (AVM), meningioma, hemangioma, angiofibroma, thyroid hyperplasia Formation (including Graves' disease), transplantation of cornea and other tissues, retinal artery injury or obstruction; retinal degeneration causing secondary atrophy of the retinal vasculature, retinitis pigmentosa, macular atrophy, Stargardt disease, congenital Stationary night blindness, congenital choroidal deficiency, brain atrophy, Leber's congenital cataract, retinal sequestration, Wagner syndrome, Usher syndrome, Zellweger syndrome, Sardino-Mainser syndrome Senior Loken Syndrome, Bardez-Bedre Syndrome, Alport Syndrome, Alstrem Syndrome, Cocaine Syndrome, Congenital Spondylodysplasia, Flynn-Eyed Syndrome, Friedreich Ataxia, Hullgren Syndrome, Marshall Syndrome, Albers-Schonberg Disease, Refsum Disease, Keynes・ Seier syndrome, Waardenburg syndrome, Alagille syndrome, myotonic dystrophy, Olive bridge cerebellar atrophy, Pierre-Marie syndrome, Stickler syndrome, carotinemeia, cystinosis, Wolfram syndrome, Bassen Korn Consistent with Zweig syndrome, abetalipoproteinemia, dystaxia, Batten's disease, mucopolysaccharidosis, homocystinuria, or mannosidosis.

In yet another aspect, the eye abnormality is cataract. In still other embodiments, the cataract is a systemic disease such as human Down syndrome, Hallerman-Streff syndrome, Rho syndrome, galactosemia, Marfan syndrome, trisomy 13-15 disease, Alport syndrome, myotonic dystrophy, Fabry disease , Hypoparathyroidism or Conradi syndrome.
In yet another aspect, the developmental abnormality includes embryonic lethality or reduced survival.
In yet another aspect, the cardiovascular, endothelial or angiogenic disease is an arterial disease such as diabetes mellitus; congestive nipple; optic nerve atrophy; atherosclerosis; angina; myocardial infarction such as acute myocardial infarction; And heart failure, such as congestive heart failure; hypertension; inflammatory vasculitis; Raynaud's disease and Raynaud's phenomenon; aneurysms and arterial restenosis; venous and lymphatic diseases such as thrombophlebitis, lymphangitis, and lymphedema; Vascular diseases; Cancers such as vascular tumors such as hemangiomas (capillary and spongy), glomus tumors, peripheral vasodilatation, bacterial hemangiomas, vascular endothelial tumors, angiosarcomas, angioderma, Kaposi's sarcoma, lymphatic vessels And trauma such as wounds, burns and other damaged tissues, graft fixation, scars; kidney disease such as acute renal failure, or osteoporosis.

In yet another aspect, the immune disease is systemic lupus erythematosus; rheumatoid arthritis; juvenile rheumatoid arthritis; spondyloarthropathy; systemic scleroderma (scleroderma); idiopathic inflammatory myopathy (dermatomyositis, polymyositis) ); Sjogren's syndrome; systemic vasculitis; sarcoidosis; autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria); autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura, immunity) Mediated thrombocytopenia); thyroiditis (Graves' disease, Hashimoto's thyroiditis, juvenile lymphoid thyroiditis, atrophic thyroiditis); diabetes mellitus, immune-mediated renal disease (glomerulonephritis, tubulointerstitial nephritis) Demyelinating diseases of the central and peripheral nervous system, eg multiple sclerosis, idiopathic demyelinating polyneuropathy or Guillain-Barre syndrome, and chronic inflammatory demyelinating polyneuropathy; hepatobiliary disease, eg Infectious hepatitis (A, B, C, D, hepatitis E and other non-hepatotropic viruses), autoimmune chronic active hepatitis, primary biliary cirrhosis, granulomatous hepatitis, and sclerosis Inflammatory bowel disease (ulcerative colitis: Crohn's disease); gluten-sensitive enteropathy and Whipple disease; bullous skin disease, polymorphic erythema and contact dermatitis, autoimmunity or immunity including psoriasis Allergic diseases such as asthma, allergic rhinitis, atopic dermatitis, food hypersensitivity and urticaria; lung immune diseases such as eosinophilic pneumonia, idiopathic pulmonary fibrosis and hypersensitivity pneumonia; Or consistent with transplant-related diseases including graft rejection and graft-versus-host disease.
In yet another aspect, the bone metabolism disorder or disease is arthritis, osteoporosis or marble bone disease.

  In yet another aspect, the non-human transgenic animal has the following physiological properties compared to gender-matched wild-type littermates: increased anxiety-like response during the open field test; Reduced anxiety-like response; Abnormal circadian rhythm during home-cage activity test including decreased migration; Increased exploratory activity during open field test; Increased stress-induced hyperthermia; Exercise during reverse screen test Increased coordination; Impaired motor coordination during reverse screen test; Increased retinal arterial twist; Retinal degeneration characterized by retinal vascular attenuation; Ophthalmic abnormalities; Increased mean systolic blood pressure; Increased serum blood glucose level; decreased average serum blood glucose level; increased average serum cholesterol level; increased average serum triglyceride level; decreased average serum cholesterol level; Decreased serum triglyceride levels; increased glucose tolerance; impaired glucose tolerance; increased mean serum insulin levels; decreased mean serum insulin levels; increased uric acid levels; decreased serum phosphate levels; increased alkaline phosphatase levels and Increased alanine aminotransferase levels; liver disease; increased average percentage of CD25 + in both spleen and lymph nodes; decreased average percentage of natural killer cells; decreased average percentage of CD21HiCD23Med cells in spleen and lymph nodes; CD4 cells Mean percentage increase and B cell mean percentage increase; CD8 + cell mean percentage increase; eosinophil mean percentage increase; mean serum IgG1 response to ovalbumin challenge; mean serum to ovalbumin challenge Reduced IgG2a response; ovalbumin antigen Decreased mean serum IgG1 response to ovine; increased mean serum IgG2a response to ovalbumin challenge; increased mean serum MCP-1 response to LPS challenge; increased mean serum TNF-α response to LPS challenge; LPS challenge Decreased mean serum MCP-1 response to LPS; decreased mean serum IL-6 response to LPS challenge; decreased TNF-α response to LPS challenge; increased mean serum IL6 response to LPS challenge; increased mean platelet count Decreased average total white blood cell (WBC); decreased absolute lymphocyte count; decreased absolute monocyte count; decreased skin fibroblast proliferation; increased skin fibroblast proliferation; average percentage of total fat and total body fat mass Increase in average body weight; increase in average physical condition; increase in organ weight; increase in total tissue mass (TTM); lean body mass (L M) increase; increase in whole body, femur and vertebra bone density (BMC); increase in whole body, femur and vertebra bone mineral density (BMC); whole body, femur and vertebra volumetric bone density (vBMD) Increase in mean femoral cortical thickness and cross-sectional area; increase in average vertebral trabecular volume, number and connectivity density; increase in average body fat and total body fat percentage; decrease in average body weight; Decrease; Decrease in total tissue mass (TTM); Decrease in lean body mass (LBM); Decrease in bone mineral density (BMD) in femur and vertebrae; Decrease in bone mineral density (BMC) in whole body, femur and vertebrae; Decreased volumetric bone density (vBMD) of femur and vertebra; decreased average femoral cortical thickness and cross-sectional area; decreased average vertebral trabecular volume, number and connectivity density; abdominal and subcutaneous fat deposition Severe depletion; organ weight reduction; growth retardation; hydrocephalus; skin Glandular hyperplasia and growth retardation; apoptosis of olfactory neuroepithelial cells; lymphoid hyperplasia and tissue inflammation; developmental abnormalities; male infertility; growth retardation accompanied by a decrease viability; and embryonic mortality, indicating at least one.

The present invention also ameliorates neurological disorders associated with gene disruption; cardiovascular, endothelial or angiogenic diseases; eye disorders; immune disorders; oncological disorders; bone metabolic disorders or disorders; lipid metabolism disorders; Provides drugs to regulate. In one aspect, the drug is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1413, PRO11513 PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or a phenotypic agonist or antagonist associated with the disruption of the gene encoding the PRO779 polypeptide. In yet another aspect, the drug is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1104, PRO1213, PRO1213, PRO1213 , PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides. In yet a further aspect, the agonist agent is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO724. PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO10425, anti-PRO10425, anti-PRO10425, anti-PRO10425 Anti-PRO10282, anti-PRO61709 or anti-PRO779 antibody 2. In yet another aspect, the antagonist agent is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO10425, anti-PRO10425, anti-PRO10425, anti-PRO10425 Anti-PRO10282, anti-PRO61709 or anti-PRO779 antibody.
The present invention also provides therapeutic agents for the treatment of neurological disorders; cardiovascular, endothelial or angiogenic diseases; eye abnormalities; immune disorders; oncological disorders; bone metabolic disorders or disorders; lipid metabolic disorders; To do.
The present invention also includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 Providing a method of identifying an agent that modulates the expression of a PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, the method comprising:
(A) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1270 Contacting a test agent with a host cell expressing a PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide;
(B) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1104, RO1213, PRO1413, PRO1413, PRO1213, PRO1413 Determining whether to modulate expression of a PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.

  The present invention also includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 Agents that modulate the expression of PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides are provided. In one aspect, the drug is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1413, PRO11513 PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or a phenotypic agonist or antagonist associated with the disruption of the gene encoding the PRO779 polypeptide. In yet another aspect, the drug is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1104, PRO1213, PRO1213, PRO1213 , PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides. In yet a further aspect, the agonist agent is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO724. PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO10425, anti-PRO10425, anti-PRO10425, anti-PRO10425 Anti-PRO10282, anti-PRO61709 or anti-PRO779 antibody. In yet another aspect, the antagonist agent is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO10425, anti-PRO10425, anti-PRO10425, anti-PRO10425 Anti-PRO10282, anti-PRO61709 or anti-PRO779 antibody.

The present invention also includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 Provided is a method for evaluating a therapeutic agent capable of affecting symptoms associated with disruption of a gene encoding PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, The method is
(A) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1270 PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709, or a non-human transgenic animal whose genome contains a disruption of a gene encoding a PRO779 polypeptide;
(B) measuring the physiological properties of the non-human transgenic animal of (a);
(C) comparing the measured physiological properties of (b) with those of wild-type animals of matched gender, where the physiological properties of the non-human transgenic animal differ from those of the wild-type animals. Identified as a symptom resulting from gene disruption in a human transgenic animal;
(D) administering a test agent to the non-human transgenic animal of (a);
(E) evaluating the effect of the test agent on the identified symptoms associated with gene disruption in the non-human transgenic animal.
In one aspect, the symptom is neuropathy; cardiovascular, endothelial or angiogenic disease; ocular abnormality; immune disease; oncological disease; bone metabolism disorder or disease; lipid metabolism disease;

  The present invention also provides therapeutic agents that can affect symptoms associated with gene disruption. In one aspect, the drug is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1413, PRO11513 PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or a phenotypic agonist or antagonist associated with the disruption of the gene encoding the PRO779 polypeptide. In yet another aspect, the drug is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1104, PRO1213, PRO1213, PRO1213 , PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides. In yet a further aspect, the agonist agent is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO724. PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO10425, anti-PRO10425, anti-PRO10425, anti-PRO10425 Anti-PRO10282, anti-PRO61709 or anti-PRO779 antibody. In yet another aspect, the antagonist agent is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO10425, anti-PRO10425, anti-PRO10425, anti-PRO10425 Anti-PRO10282, anti-PRO61709 or anti-PRO779 antibody.

The present invention also provides pharmaceutical compositions containing therapeutic agents that can affect symptoms associated with gene disruption.
The present invention also includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or a neuropathy associated with disruption of a gene encoding a polypeptide, cardiovascular, endothelial or angiogenic disease; immune disease; oncological disease; Bone metabolism disorder or disease; or treating embryonic lethality or A method of preventing or ameliorating a therapeutically effective amount for a patient who already has the disease, or who is suspected of having the disease or in need of treatment for which the disease is prevented, is provided. Or an agonist or antagonist thereof, thereby effectively treating or preventing or ameliorating the disease or illness.

  In yet another aspect, the neurological disorder is an increased anxiety-like response during an open field activity test. In yet another aspect, the neurological disorder is a reduced anxiety-like response during an open field activity test. In yet another aspect, the neurological disorder is an abnormal circadian rhythm during a home cage activity test. In yet another aspect, the neurological disorder is increased motor coordination during an inverted screen test. In yet another aspect, the neurological disorder is impaired motor coordination during an inverted screen test. In yet another aspect, the neurological disorder includes depression, generalized anxiety disorder, attention deficit disorder, sleep disorder, hyperactivity disorder, obsessive compulsive disorder, schizophrenia, cognitive dysfunction, hyperalgesia and sensory organ disorder. Such neurological disorders include, but are not limited to, those in the category defined as “anxiety disorders”: mild to moderate anxiety, anxiety disorders due to general medical conditions, and Unspecified anxiety disorder, generalized anxiety disorder, panic attack, panic disorder with agoraphobia, panic disorder without agoraphobia, post-traumatic stress syndrome, social phobia, social anxiety, autism , Specific phobia, substance-induced anxiety disorder, acute alcohol withdrawal, obsessive compulsive disorder, agoraphobia, monopolar disorder, bipolar disorder I or II, bipolar disorder not otherwise specified, circulatory temperament disease, depression Cognitive impairment, major depressive disorder, mood disorder, substance-induced mood disorder, increased cognitive function, but not limited, loss of cognitive function due to Alzheimer's disease, cerebral infarction or trauma to the brain, not limited Not Cans, learning disorders / learning impotence, diseases or stroke resulting from damage including cerebral palsy. In addition, anxiety disorders may be applied to personality disorders including, but not limited to, the following types: paranoia, social dislike, avoidance behavior, borderline personality disorder, addiction, narcotics, self-loving, obsessive Neurosis, schizophrenia and schizophrenic personality.

In other embodiments, the eye abnormality is a retinal abnormality. In yet another aspect, the eye abnormality is visual impairment or blindness. In yet another aspect, the retinal abnormality is consistent with retinitis pigmentosa or is characterized by retinal degeneration or retinal dysplasia.
In other embodiments, retinal abnormalities include retinal dysplasia, various retinopathy including retinopathy of prematurity, post-lens fibroplasia, neovascular glaucoma, age-related macular degeneration, diabetic macular edema, corneal neovascularization, corneal transplantation Angiogenesis, corneal transplant rejection, retinal / choroidal neovascularization, angle angiogenesis (rubeosis), ocular neovascular disease, vascular restenosis, arteriovenous malformation (AVM), meningioma, hemangioma, angiofibroma, thyroid hyperplasia Formation (including Graves' disease), transplantation of cornea and other tissues, retinal artery injury or obstruction; retinal degeneration causing secondary atrophy of the retinal vasculature, retinitis pigmentosa, macular atrophy, Stargardt disease, congenital Stationary night blindness, congenital choroidal deficiency, brain atrophy, Leber's congenital cataract, retinal sequestration, Wagner syndrome, Usher syndrome, Zellweger syndrome, Sardino-Mainser syndrome Senior-Loken Syndrome, Valday-Beedle Syndrome, Alport Syndrome, Alstrem Syndrome, Cocaine Syndrome, Congenital Spondylodysplasia, Flynn-Eyed Syndrome, Friedreich Ataxia, Hullgren Syndrome, Marshall Syndrome, Albers-Schonberg Disease , Lefsum disease, Keynes-Saire syndrome, Wardenburg syndrome, Alagille syndrome, myotonic dystrophy, Olive Bridge cerebellar atrophy, Pierre-Marie syndrome, Stickler syndrome, carotinemeia, cystinosis, Wolfram Consistent with syndrome, Bassen-Kornzweig syndrome, abetalipoproteinemia, dystaxia, Batten disease, mucopolysaccharidosis, homocystinuria, or mannosidosis.

In yet another aspect, the eye abnormality is cataract. In still other embodiments, the cataract is a systemic disease such as human Down syndrome, Hallerman-Streff syndrome, Rho syndrome, galactosemia, Marfan syndrome, trisomy 13-15 disease, Alport syndrome, myotonic dystrophy, Fabry disease , Hypoparathyroidism or Conradi syndrome.
In yet another aspect, the developmental abnormality includes embryonic lethality or reduced survival.
In yet another aspect, the cardiovascular, endothelial or angiogenic disease is an arterial disease such as diabetes mellitus; congestive nipple; optic nerve atrophy; atherosclerosis; angina; myocardial infarction such as acute myocardial infarction; And heart failure, such as congestive heart failure; hypertension; inflammatory vasculitis; Raynaud's disease and Raynaud's phenomenon; aneurysms and arterial restenosis; venous and lymphatic diseases such as thrombophlebitis, lymphangitis, and lymphedema; Vascular diseases; Cancers such as vascular tumors such as hemangiomas (capillary and spongy), glomus tumors, peripheral vasodilation, bacterial hemangiomas, vascular endothelial tumors, angiosarcomas, angioderma, Kaposi's sarcoma, lymphatic vessels Tumors and angiogenesis; tumors angiogenesis; wounds such as wounds, burns, and other damaged tissues, graft fixation, scars; ischemic reperfusion injury; rheumatoid arthritis; ; Renal diseases such as acute renal failure, or osteoporosis.

In yet another aspect, the immune disease is systemic lupus erythematosus; rheumatoid arthritis; juvenile rheumatoid arthritis; spondyloarthropathy; systemic scleroderma (scleroderma); idiopathic inflammatory myopathy (dermatomyositis, polymyositis) ); Sjogren's syndrome; systemic vasculitis; sarcoidosis; autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria); autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura, immunity) Mediated thrombocytopenia); thyroiditis (Graves' disease, Hashimoto's thyroiditis, juvenile lymphoid thyroiditis, atrophic thyroiditis); diabetes mellitus, immune-mediated renal disease (glomerulonephritis, tubulointerstitial nephritis) Demyelinating diseases of the central and peripheral nervous system, eg multiple sclerosis, idiopathic demyelinating polyneuropathy or Guillain-Barre syndrome, and chronic inflammatory demyelinating polyneuropathy; hepatobiliary disease, eg Infectious hepatitis (A, B, C, D, hepatitis E and other non-hepatotropic viruses), autoimmune chronic active hepatitis, primary biliary cirrhosis, granulomatous hepatitis, and sclerosis Inflammatory bowel disease (ulcerative colitis: Crohn's disease); gluten-sensitive enteropathy and Whipple disease; bullous skin disease, polymorphic erythema and contact dermatitis, autoimmunity or immunity including psoriasis Allergic diseases such as asthma, allergic rhinitis, atopic dermatitis, food hypersensitivity and urticaria; lung immune diseases such as eosinophilic pneumonia, idiopathic pulmonary fibrosis and hypersensitivity pneumonia; Or consistent with transplant-related diseases including graft rejection and graft-versus-host disease.
In yet another aspect, the bone metabolism disorder or disease is arthritis, osteoporosis, osteopenia or marble bone disease.

  In other embodiments, the therapeutic agent is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1413, PRO1213, PRO1213, PRO1213 PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or a PRO779 polypeptide phenotype agonist or antagonist associated with the disruption of the gene. In yet another aspect, the drug is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1104, PRO1213, PRO1213, PRO1213 , PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides. In yet a further aspect, the agonist agent is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO724. PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO10425, anti-PRO10425, anti-PRO10425, anti-PRO10425 Anti-PRO10282, anti-PRO61709 or anti-PRO779 antibody. In yet another aspect, the antagonist agent is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO10425, anti-PRO10425, anti-PRO10425, anti-PRO10425 Anti-PRO10282, anti-PRO61709 or anti-PRO779 antibody.

The present invention also includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 Neuropathy associated with disruption of the gene encoding PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide; cardiovascular, endothelial or angiogenic disease; eye abnormality; immune disease; tumor Bone disease or disorder; lipid metabolism disorder Or developmental abnormalities and provides a method for identifying a remission or modulate drug, the method comprising,
(A) providing a non-human transgenic animal cell culture, each cell of which is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or the PR0179 polypeptide
(B) administering a test agent to the cell culture;
(C) the test drug is neuropathy in the cell culture; cardiovascular, endothelial or angiogenic disease; ocular abnormality; immune disease; oncological disease; bone metabolism abnormality or disease; lipid metabolism disease; Determining whether to remit or regulate. In yet another aspect, the neurological disorder is an increased anxiety-like response during an open field activity test. In yet another aspect, the neurological disorder is a reduced anxiety-like response during an open field activity test. In yet another aspect, the neurological disorder is an abnormal circadian rhythm during a home cage activity test.

  In yet another aspect, the neurological disorder is increased motor coordination during an inverted screen test. In yet another aspect, the neurological disorder is impaired motor coordination during an inverted screen test. In yet other aspects, the neurological disorders include depression, generalized anxiety disorder, attention deficit disorder, sleep disorder, hyperactivity disorder, obsessive compulsive disorder, schizophrenia, cognitive dysfunction, hyperalgesia and sensory organ disorder. Such neurological disorders include, but are not limited to, those in the category defined as “anxiety disorders”: mild to moderate anxiety, anxiety disorders due to general medical conditions, and Unspecified anxiety disorder, generalized anxiety disorder, panic attack, panic disorder with agoraphobia, panic disorder without agoraphobia, post-traumatic stress syndrome, social phobia, social anxiety, autism , Specific phobia, substance-induced anxiety disorder, acute alcohol withdrawal, obsessive compulsive disorder, agoraphobia, monopolar disorder, bipolar disorder I or II, bipolar disorder not otherwise specified, circulatory temperament disease, depression Cognitive impairment, major depressive disorder, mood disorder, substance-induced mood disorder, increased cognitive function, but not limited, loss of cognitive function due to Alzheimer's disease, cerebral infarction or trauma to the brain, not limited Not Cans, learning disorders / learning impotence, diseases or stroke resulting from damage including cerebral palsy. In addition, anxiety disorders may be applied to personality disorders including, but not limited to, the following types: paranoia, social dislike, avoidance behavior, borderline personality disorder, addiction, narcotics, self-loving, obsessive Neurosis, schizophrenia and schizophrenic personality.

In other embodiments, the eye abnormality is a retinal abnormality. In yet another aspect, the eye abnormality is visual impairment or blindness. In yet another aspect, the retinal abnormality is consistent with retinitis pigmentosa or is characterized by retinal degeneration or retinal dysplasia.
In other embodiments, retinal abnormalities include retinal dysplasia, various retinopathy including retinopathy of prematurity, post-lens fibroplasia, neovascular glaucoma, age-related macular degeneration, diabetic macular edema, corneal neovascularization, corneal transplantation Angiogenesis, corneal transplant rejection, retinal / choroidal neovascularization, angle angiogenesis (rubeosis), ocular neovascular disease, vascular restenosis, arteriovenous malformation (AVM), meningioma, hemangioma, angiofibroma, thyroid hyperplasia Formation (including Graves' disease), transplantation of cornea and other tissues, retinal artery injury or obstruction; retinal degeneration causing secondary atrophy of the retinal vasculature, retinitis pigmentosa, macular atrophy, Stargardt disease, congenital Stationary night blindness, congenital choroidal deficiency, brain atrophy, Leber's congenital cataract, retinal sequestration, Wagner syndrome, Usher syndrome, Zellweger syndrome, Sardino-Mainser syndrome Senior-Loken Syndrome, Valday-Beedle Syndrome, Alport Syndrome, Alstrem Syndrome, Cocaine Syndrome, Congenital Spondylodysplasia, Flynn-Eyed Syndrome, Friedreich Ataxia, Hullgren Syndrome, Marshall Syndrome, Albers-Schonberg Disease , Lefsum disease, Keynes-Saire syndrome, Wardenburg syndrome, Alagille syndrome, myotonic dystrophy, Olive Bridge cerebellar atrophy, Pierre-Marie syndrome, Stickler syndrome, carotinemeia, cystinosis, Wolfram Consistent with syndrome, Bassen-Kornzweig syndrome, abetalipoproteinemia, dystaxia, Batten disease, mucopolysaccharidosis, homocystinuria, or mannosidosis.

In yet another aspect, the eye abnormality is cataract. In still other embodiments, the cataract is a systemic disease such as human Down syndrome, Hallerman-Streff syndrome, Rho syndrome, galactosemia, Marfan syndrome, trisomy 13-15 disease, Alport syndrome, myotonic dystrophy, Fabry disease , Hypoparathyroidism or Conradi syndrome.
In yet another aspect, the developmental abnormality includes embryonic lethality or reduced survival.
In yet another aspect, the cardiovascular, endothelial or angiogenic disease is an arterial disease such as diabetes mellitus; congestive nipple; optic nerve atrophy; atherosclerosis; angina; myocardial infarction such as acute myocardial infarction; And heart failure, such as congestive heart failure; hypertension; inflammatory vasculitis; Raynaud's disease and Raynaud's phenomenon; aneurysms and arterial restenosis; venous and lymphatic diseases such as thrombophlebitis, lymphangitis, and lymphedema; Vascular diseases; Cancers such as vascular tumors such as hemangiomas (capillary and spongy), glomus tumors, peripheral vasodilation, bacterial hemangiomas, vascular endothelial tumors, angiosarcomas, angioderma, Kaposi's sarcoma, lymphatic vessels Tumors and angiogenesis; tumors angiogenesis; wounds such as wounds, burns, and other damaged tissues, graft fixation, scars; ischemic reperfusion injury; rheumatoid arthritis; ; Renal diseases such as acute renal failure, or osteoporosis.

In yet another aspect, the immune disease is systemic lupus erythematosus; rheumatoid arthritis; juvenile rheumatoid arthritis; spondyloarthropathy; systemic scleroderma (scleroderma); idiopathic inflammatory myopathy (dermatomyositis, polymyositis) ); Sjogren's syndrome; systemic vasculitis; sarcoidosis; autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria); autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura, immunity) Mediated thrombocytopenia); thyroiditis (Graves' disease, Hashimoto's thyroiditis, juvenile lymphoid thyroiditis, atrophic thyroiditis); diabetes mellitus, immune-mediated renal disease (glomerulonephritis, tubulointerstitial nephritis) Demyelinating diseases of the central and peripheral nervous system, eg multiple sclerosis, idiopathic demyelinating polyneuropathy or Guillain-Barre syndrome, and chronic inflammatory demyelinating polyneuropathy; hepatobiliary disease, eg Infectious hepatitis (A, B, C, D, hepatitis E and other non-hepatotropic viruses), autoimmune chronic active hepatitis, primary biliary cirrhosis, granulomatous hepatitis, and sclerosis Inflammatory bowel disease (ulcerative colitis: Crohn's disease); gluten-sensitive enteropathy and Whipple disease; bullous skin disease, polymorphic erythema and contact dermatitis, autoimmunity or immunity including psoriasis Allergic diseases such as asthma, allergic rhinitis, atopic dermatitis, food hypersensitivity and urticaria; lung immune diseases such as eosinophilic pneumonia, idiopathic pulmonary fibrosis and hypersensitivity pneumonia; Or consistent with transplant-related diseases including graft rejection and graft-versus-host disease.
In yet another aspect, the bone metabolism disorder or disease is arthritis, osteoporosis, osteopenia or marble bone disease.

  The invention also relates to neurological disorders associated with gene disruption in said culture; cardiovascular, endothelial or angiogenic diseases; eye disorders; immune disorders; oncological disorders; bone metabolism disorders or disorders; lipid metabolism disorders; Provided are drugs that ameliorate or regulate developmental abnormalities. In one aspect, the drug is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1413, PRO11513 PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or a phenotypic agonist or antagonist associated with the disruption of the gene encoding the PRO779 polypeptide. In yet another aspect, the drug is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1104, PRO1213, PRO1213, PRO1213 , PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides. In yet a further aspect, the agonist agent is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO724. PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO10425, anti-PRO10425, anti-PRO10425, anti-PRO10425 Anti-PRO10282, anti-PRO61709 or anti-PRO779 antibody. In yet another aspect, the antagonist agent is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO10425, anti-PRO10425, anti-PRO10425, anti-PRO10425 Anti-PRO10282, anti-PRO61709 or anti-PRO779 antibody.

The present invention also includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or a method that modulates a phenotype associated with disruption of a gene encoding a PRO779 polypeptide, said method already having a phenotype Or tend to have a phenotype or table In patients mold is prevented, the effective amount of the agent is identified as modulating the phenotype, or administering the agonist or antagonist, thereby comprising modulating phenotypic effectively.
The present invention also includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or a method that modulates a physiological property associated with the disruption of a gene encoding a PRO779 polypeptide, said method already comprising a physiological property Have or have physiological properties Administering an effective amount of an agent identified as modulating the physiological property, or an agonist or antagonist thereof, to the patient who is apt or whose physiological property is prevented, thereby effectively modulating the physiological property Including that.

The present invention also includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or a method that modulates the behavior associated with the disruption of a gene encoding a PRO779 polypeptide, does the method already have an action? Or have a tendency to have behavior or The patient being includes agents identified to modulate the action of an effective amount, or administering the agonist or antagonist, to adjust thereby the action effectively.
The present invention also includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or a method of modulating the expression of a PRO779 polypeptide, the method comprising the above-mentioned PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, RO4409, RO4594, RO4 Administering to a host cell expressing the PRO779 polypeptide an effective amount of an agent identified as modulating the expression, or an agonist or antagonist thereof, thereby effectively modulating the expression of the polypeptide.

The present invention also includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 Providing a method of modulating a symptom associated with disruption of a gene encoding a PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, having or having symptoms To patients who are prone to or have symptoms prevented Therapeutically effective amount of a therapeutic agent identified as modulating the symptoms, or the agonist or antagonist is administered, thereby comprising modulating the symptoms effectively.
The present invention also includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or a neuropathy associated with disruption of a gene encoding a polypeptide, cardiovascular, endothelial or angiogenic disease; immune disease; oncological disease; Bone metabolism disorder or disease; or treating embryonic lethality or A method of preventing or ameliorating is provided, said method comprising a non-human transgenic animal cell culture, ie PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731 , PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO7409 A therapeutically effective amount of each cell Serial diseases administered prophylactically or drug identified as ameliorate, or an agonist or antagonist, thereby effectively treating or preventing or ameliorating the disease.

B. Further embodiments
In yet a further embodiment, the present invention is directed to the following claims which are potential claims of this application:
1. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 A method for identifying a phenotype associated with disruption of a gene encoding a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide comprising:
(A) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1270 Providing a non-human transgenic animal whose genome comprises a disruption of a gene encoding a PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide;
(B) measuring the physiological properties of the non-human transgenic animal;
(C) comparing the measured physiological properties with those of wild-type animals of matched gender, wherein the physiological properties of the non-human transgenic animal differ from the physiological properties of the wild-type animal. Identified as a phenotype resulting from a gene disruption in
2. Non-human transgenic animals are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1413, PRO11513PRO1 2. The method of claim 1, wherein the method is heterozygous for disruption of a gene encoding a PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.
3. The following phenotypes are exhibited by non-human transgenic animals compared to gender-matched littermates: neuropathy; cardiovascular, endothelial or angiogenic disease; eye abnormalities; immune disease; oncological disease; bone The method according to claim 1, wherein the method is at least one of metabolic abnormality or disease; lipid metabolism disease; or developmental abnormality.
4). 4. The method of claim 3, wherein the neurological disorder is an increased anxiety-like response during an open field activity test.
5. 4. The method of claim 3, wherein the neurological disorder is a reduced anxiety-like response during an open field activity test.
6). 4. The method of claim 3, wherein the neurological disorder is an abnormal circadian rhythm during a home cage activity test.
7). 4. The method of claim 3, wherein the neurological disorder is increased motor coordination during an inverted screen test.
8). 4. The method of claim 3, wherein the neurological disorder is impaired motor coordination during an inverted screen test.
9. The neurological disorder is depression, generalized anxiety disorder, attention deficit disorder, sleep disorder, hyperactivity disorder, obsessive compulsive disorder, schizophrenia, cognitive dysfunction, hyperalgesia or sensory organ disorder. Method.
10. 4. The method of claim 3, wherein the eye abnormality is a retinal abnormality.
11. 4. The method of claim 3, wherein the eye abnormality is visual impairment or blindness.
12 11. The method of claim 10, wherein the retinal abnormality is consistent with retinitis pigmentosa.
13. 11. The method of claim 10, wherein the retinal abnormality is characterized by retinal degeneration or retinal dysplasia.
14 Retinal abnormalities are retinal dysplasia, various retinopathy including retinopathy of prematurity, post lens fibroproliferation, neovascular glaucoma, age-related macular degeneration, diabetic macular edema, corneal neovascularization, corneal transplant angiogenesis, corneal transplant rejection , Retinal / choroidal neovascularization, angle angiogenesis (rubeosis), ocular neovascular disease, vascular restenosis, arteriovenous malformation (AVM), meningioma, hemangioma, hemangiofibroma, thyroid hyperplasia (including Graves' disease) ), Transplantation of cornea and other tissues, retinal artery injury or occlusion; retinal degeneration causing secondary atrophy of retinal vasculature, retinitis pigmentosa, macular atrophy, Stargardt disease, congenital static night blindness, congenital Choroidal deficiency, rotational atrophy of the brain, Labor congenital cataract, retinal segregation, Wagner syndrome, Usher syndrome, Zerweger syndrome, Sardino-Mainser syndrome, senior loken Symptoms, Bardeaux-Biddle syndrome, Alport syndrome, Alstrem syndrome, Cocaine syndrome, congenital spinal dysplasia, Flynn-Eyed syndrome, Friedreich ataxia, Hullgren's syndrome, Marshall syndrome, Albers-Schonberg disease, Refsum disease, Keynes Saier Syndrome, Wardenburg Syndrome, Alagille Syndrome, Myotonic Dystrophy, Olive Bridge Cerebellar Atrophy, Pierre-Marie Syndrome, Stickler Syndrome, Carotinemia, Cystine Accumulation, Wolfram Syndrome, Bassen-Kornzweig Syndrome, No β 11. A method according to claim 10, consistent with lipoproteinemia, dyschromia, Batten's disease, mucopolysaccharidosis, homocystinuria or mannosidosis.
15. 4. The method of claim 3, wherein the eye abnormality is cataract.
16. Cataract is a systemic disease such as human Down syndrome, Hallerman-Streff syndrome, Rho syndrome, galactosemia, Marfan syndrome, trisomy 13-15, Alport syndrome, myotonic dystrophy, Fabry disease, hypoparathyroidism or 16. A method according to claim 15, consistent with Conradi syndrome.
17. 4. The method of claim 3, wherein the developmental abnormality comprises embryonic lethality or reduced survival.
18. Cardiovascular, endothelial or angiogenic diseases are arterial diseases such as diabetes mellitus; congestive nipple; optic nerve atrophy; atherosclerosis; angina; myocardial infarction such as acute myocardial infarction, cardiac hypertrophy, and heart failure such as congestive heart failure Hypertension; inflammatory vasculitis; Raynaud's disease and Raynaud's phenomenon; aneurysms and arterial restenosis; venous and lymphatic diseases such as thrombophlebitis, lymphangitis, and lymphedema; peripheral vascular disease; cancer such as blood vessels Tumors such as hemangiomas (capillary and spongy), glomus tumors, peripheral vasodilatation, bacterial hemangiomatosis, hemangioendothelioma, hemangiosarcoma, angioderma, Kaposi's sarcoma, lymphangioma, and lymphangiosarcoma Tumor angiogenesis; trauma such as wounds, burns and other damaged tissues, graft fixation, scars; ischemic reperfusion injury; rheumatoid arthritis; cerebrovascular disease; Failure, or osteoporosis, The method of claim 3.
19. Immune diseases are systemic lupus erythematosus; rheumatoid arthritis; juvenile rheumatoid arthritis; spondyloarthropathy; systemic scleroderma (scleroderma); idiopathic inflammatory myopathy (dermatomyositis, polymyositis); Sjogren's syndrome; Sarcoidosis; autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria); autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura, immune-mediated thrombocytopenia) Thyroiditis (Graves' disease, Hashimoto's thyroiditis, juvenile lymphoid thyroiditis, atrophic thyroiditis); diabetes mellitus, immune-mediated kidney disease (glomerulonephritis, tubulointerstitial nephritis); central and peripheral nervous system Demyelinating diseases such as multiple sclerosis, idiopathic demyelinating polyneuropathy or Guillain-Barre syndrome, and chronic inflammatory demyelinating polyneuropathy; hepatobiliary diseases such as infectious hepatitis (type A B, C, D, hepatitis E and other non-hepatotropic viruses), autoimmune chronic active hepatitis, primary biliary cirrhosis, granulomatous hepatitis, and sclerosing cholangitis; inflammatory bowel Diseases (ulcerative colitis: Crohn's disease); gluten-sensitive enteropathy and Whipple disease; bullous skin disease, erythema multiforme and contact dermatitis, autoimmune or immune-mediated skin diseases including psoriasis; allergic Diseases such as asthma, allergic rhinitis, atopic dermatitis, food hypersensitivity and urticaria; lung immune diseases such as eosinophilic pneumonia, idiopathic pulmonary fibrosis and hypersensitivity pneumonia; or graft rejection and graft The method according to claim 3, which is a transplantation-related disease including anti-host disease.
20. 4. The method according to claim 3, wherein the bone metabolism disorder or disease is arthritis, osteoporosis or marble bone disease.
21. Non-human transgenic animals have physiological characteristics compared to gender-matched wild-type littermates: increased anxiety-like responses during open field trials; decreased anxiety-like responses during open field activity trials; Abnormal circadian rhythms during home cage activity tests, including a decrease in brain; increased exploratory activity during open field tests; increased stress-induced hyperthermia; increased motor coordination during reverse screen tests; reverse screen test Impaired motor coordination during exercise; increased retinal arterial twist; retinal degeneration characterized by diminished retinal blood vessels; ophthalmic abnormalities; increased mean systolic blood pressure; increased mean fasting serum blood glucose; Decreased blood glucose level; increased average serum cholesterol level; increased average serum triglyceride level; decreased average serum cholesterol level; average serum triglyceride level Increased glucose tolerance; impaired glucose tolerance; increased mean serum insulin levels; decreased mean serum insulin levels; increased uric acid levels; decreased serum phosphate levels; increased alkaline phosphatase levels and alanine amino groups Increased transferase levels; liver disease; increased average percentage of CD25 + in both spleen and lymph nodes; decreased average percentage of natural killer cells; decreased average percentage of CD21HiCD23Med cells in spleen and lymph nodes; average percentage of CD4 cells And increase in mean percentage of B cells; increase in mean percentage of CD8 + cells; increase in mean percentage of eosinophils; decrease in mean serum IgG1 response to ovalbumin antigen administration; mean serum IgG2a response to ovalbumin antigen administration Decrease; mean serum Ig to ovalbumin challenge 1 decreased response; increased mean serum IgG2a response to ovalbumin challenge; increased mean serum MCP-1 response to LPS challenge; increased mean serum TNF-α response to LPS challenge; mean serum MCP to LPS challenge -1 decreased response; decreased mean serum IL-6 response to LPS challenge; decreased TNFα response to LPS challenge; increased mean serum IL6 response to LPS challenge; increased mean platelet count; mean total white blood cell (WBC) ) Decrease in number; Decrease in absolute lymphocyte count; Decrease in absolute monocyte count; Decrease in dermal fibroblast proliferation; Increase in dermal fibroblast proliferation; Increase in total fat and average percentage of total fat mass; Increased; increased average physical condition; increased organ weight; increased total tissue mass (TTM); increased lean body mass (LBM); whole body, thigh And increased bone mineral density (BMD) of the vertebrae; increased bone mineral density (BMC) of the whole body, femur and vertebrae; increased volumetric bone density (vBMD) of the whole body, femur and vertebrae; Increased thickness and cross-sectional area; increased average vertebral trabecular volume, number and connectivity density; increased average fat and average percentage of total fat mass; decreased average body weight; decreased average body length; total tissue mass (TTM) Decrease; Decrease of lean body mass (LBM); Decrease of bone density (BMD) of femur and vertebra; Decrease of bone mineral density (BMC) of whole body, femur and vertebra; Volumetric bone of whole body, femur and vertebra Decreased density (vBMD); decreased average femoral cortical thickness and cross-sectional area; decreased average vertebral trabecular volume, number and connectivity density; severe depletion of abdominal and subcutaneous body fat deposition; decreased organ weight; Growth retardation; hydrocephalus; sebaceous hyperplasia and growth retardation; The method of claim 1, wherein the method exhibits at least one of apoptosis of optic nerve epithelial cells; lymphoid hyperplasia and tissue inflammation; developmental abnormality; male infertility; growth retardation with reduced survival; and embryonic mortality.
22. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 An isolated cell derived from a non-human transgenic animal whose genome contains a disruption of a gene encoding a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.
23. 23. The isolated cell of claim 22, which is a mouse cell.
24. 24. The isolated cell of claim 23, wherein the mouse cell is an embryonic stem cell.
25. Non-human transgenic animals have the following phenotypes compared to gender-matched littermates: neuropathy; cardiovascular, endothelial or angiogenic diseases; eye abnormalities; immune disorders; oncological disorders; 23. The isolated cell according to claim 22, which exhibits a disease; a lipid metabolism disease; or an abnormal development.
26. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 A method of identifying an agent that modulates a phenotype associated with disruption of a gene encoding a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide comprising:
(A) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1270 Providing a non-human transgenic animal whose genome comprises a disruption of a gene encoding a PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide;
(B) measuring the physiological properties of the non-human transgenic animal;
(C) comparing the measured physiological properties of (b) with those of wild-type animals of matched gender, wherein the physiological properties of the non-human transgenic animal differ from those of the wild-type animals. Identified as a phenotype resulting from gene disruption in a human transgenic animal;
(D) administering a test agent to the non-human transgenic animal of (a);
(E) determining whether the test agent modulates the identified phenotype associated with gene disruption in the non-human transgenic animal.
27. The phenotype associated with gene disruption includes neuropathy; cardiovascular, endothelial or angiogenic disease; ocular abnormality; immune disease; oncological disease; bone metabolism disorder or disease; lipid metabolism disease; 26. The method according to 26.
28. 28. The method of claim 27, wherein the neurological disorder is an increased anxiety-like response during an open field activity test.
29. 28. The method of claim 27, wherein the neurological disorder is a reduced anxiety-like response during an open field activity test.
30. 28. The method of claim 27, wherein the neurological disorder is an abnormal circadian rhythm during a home cage activity test.
31. 28. The method of claim 27, wherein the neurological disorder is increased motor coordination during an inverted screen test.
32. 28. The method of claim 27, wherein the neurological disorder is impaired motor coordination during an inverted screen test.
33. 28. The neurological disorder according to claim 27, wherein the neuropathy is depression, generalized anxiety disorder, attention deficit disorder, sleep disorder, hyperactivity disorder, obsessive compulsive disorder, schizophrenia, cognitive dysfunction, hyperalgesia or sensory organ disorder. Method.
34. 28. The method of claim 27, wherein the eye abnormality is a retinal abnormality.
35. 28. The method of claim 27, wherein the eye abnormality is visual impairment or blindness.
36. 35. The method of claim 34, wherein the retinal abnormality is consistent with retinitis pigmentosa.
37. 35. The method of claim 34, wherein the retinal abnormality is characterized by retinal degeneration or retinal dysplasia.
38. Retinal abnormalities are retinal dysplasia, various retinopathy including retinopathy of prematurity, post lens fibroproliferation, neovascular glaucoma, age-related macular degeneration, diabetic macular edema, corneal neovascularization, corneal transplant angiogenesis, corneal transplant rejection , Retinal / choroidal neovascularization, angle angiogenesis (rubeosis), ocular neovascular disease, vascular restenosis, arteriovenous malformation (AVM), meningioma, hemangioma, hemangiofibroma, thyroid hyperplasia (including Graves' disease) ), Transplantation of cornea and other tissues, retinal artery injury or occlusion; retinal degeneration causing secondary atrophy of retinal vasculature, retinitis pigmentosa, macular atrophy, Stargardt disease, congenital static night blindness, congenital Choroidal deficiency, rotational atrophy of the brain, Labor congenital cataract, retinal segregation, Wagner syndrome, Usher syndrome, Zerweger syndrome, Sardino-Mainser syndrome, senior loken Symptoms, Bardeaux-Biddle syndrome, Alport syndrome, Alstrem syndrome, Cocaine syndrome, congenital spinal dysplasia, Flynn-Eyed syndrome, Friedreich ataxia, Hullgren's syndrome, Marshall syndrome, Albers-Schonberg disease, Refsum disease, Keynes Saier Syndrome, Wardenburg Syndrome, Alagille Syndrome, Myotonic Dystrophy, Olive Bridge Cerebellar Atrophy, Pierre-Marie Syndrome, Stickler Syndrome, Carotinemia, Cystine Accumulation, Wolfram Syndrome, Bassen-Kornzweig Syndrome, No β 35. The method of claim 34, consistent with lipoproteinemia, dystaxia, Batten's disease, mucopolysaccharidosis, homocystinuria, or mannosidosis.
39. 28. The method of claim 27, wherein the eye abnormality is cataract.
40. Cataract is a systemic disease such as human Down syndrome, Hallerman-Streff syndrome, Rho syndrome, galactosemia, Marfan syndrome, trisomy 13-15, Alport syndrome, myotonic dystrophy, Fabry disease, hypoparathyroidism or 40. The method of claim 39, consistent with Conradi syndrome.
41. 28. The method of claim 27, wherein the developmental abnormality comprises embryonic lethality or reduced survival.
42. Cardiovascular, endothelial or angiogenic disease is an arterial disease such as diabetes mellitus; congestive nipple; optic nerve atrophy; atherosclerosis; angina; myocardial infarction such as acute myocardial infarction, cardiac hypertrophy, and heart failure such as congestive heart failure Hypertension; inflammatory vasculitis; Raynaud's disease and Raynaud's phenomenon; aneurysms and arterial restenosis; venous and lymphatic diseases such as thrombophlebitis, lymphangitis, and lymphedema; peripheral vascular disease; cancer such as blood vessels Tumors such as hemangiomas (capillary and spongy), glomus tumors, peripheral vasodilation, bacterial hemangiomatosis, vascular endothelial tumors, hemangiosarcomas, angioderma, Kaposi's sarcoma, lymphangioma, and lymphangiosarcoma Tumor angiogenesis; trauma such as wounds, burns and other damaged tissues, graft fixation, scars; ischemic reperfusion injury; rheumatoid arthritis; cerebrovascular disease; Failure, or osteoporosis, The method of claim 27.
43. Immune diseases are systemic lupus erythematosus; rheumatoid arthritis; juvenile rheumatoid arthritis; spondyloarthropathy; systemic scleroderma (scleroderma); idiopathic inflammatory myopathy (dermatomyositis, polymyositis); Sjogren's syndrome; Sarcoidosis; autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria); autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura, immune-mediated thrombocytopenia) Thyroiditis (Graves' disease, Hashimoto's thyroiditis, juvenile lymphoid thyroiditis, atrophic thyroiditis); diabetes mellitus, immune-mediated kidney disease (glomerulonephritis, tubulointerstitial nephritis); central and peripheral nervous system Demyelinating diseases such as multiple sclerosis, idiopathic demyelinating polyneuropathy or Guillain-Barre syndrome, and chronic inflammatory demyelinating polyneuropathy; hepatobiliary diseases such as infectious hepatitis (type A B, C, D, hepatitis E and other non-hepatotropic viruses), autoimmune chronic active hepatitis, primary biliary cirrhosis, granulomatous hepatitis, and sclerosing cholangitis; inflammatory bowel Diseases (ulcerative colitis: Crohn's disease); gluten-sensitive enteropathy and Whipple disease; bullous skin disease, erythema multiforme and contact dermatitis, autoimmune or immune-mediated skin diseases including psoriasis; allergic Diseases such as asthma, allergic rhinitis, atopic dermatitis, food hypersensitivity and urticaria; lung immune diseases such as eosinophilic pneumonia, idiopathic pulmonary fibrosis and hypersensitivity pneumonia; or graft rejection and graft 28. The method of claim 27, wherein the method is a transplant-related disease including host disease.
44. 28. The method of claim 27, wherein the bone metabolism disorder or disease is arthritis, osteoporosis or marble bone disease.
45. Non-human transgenic animals have physiological characteristics: increased anxiety-like response during open field trials; reduced anxiety-like response during open field activity trials; migration compared to gender-matched wild-type littermates Abnormal circadian rhythms during home cage activity tests, including decreased numbers; increased exploratory activity during open field tests; increased stress-induced hyperthermia; increased motor coordination during reverse screen test; reverse screen Impaired motor coordination during the trial; increased retinal artery twist; retinal degeneration characterized by retinal vascular attenuation; ophthalmic abnormalities; increased mean systolic blood pressure; increased average fasting serum blood glucose; average Decrease in serum blood glucose level; increase in average serum cholesterol level; increase in average serum triglyceride level; decrease in average serum cholesterol level; average serum triglyceride Increased glucose tolerance; Impaired glucose tolerance; Increased mean serum insulin levels; Decrease in average serum insulin levels; Increase in uric acid levels; Decrease in serum phosphate levels; Increase in alkaline phosphatase levels and alanine amino groups Increased transferase levels; liver disease; increased average percentage of CD25 + in both spleen and lymph nodes; decreased average percentage of natural killer cells; decreased average percentage of CD21HiCD23Med cells in spleen and lymph nodes; average percentage of CD4 cells And increase in mean percentage of B cells; increase in mean percentage of CD8 + cells; increase in mean percentage of eosinophils; decrease in mean serum IgG1 response to ovalbumin antigen administration; mean serum IgG2a response to ovalbumin antigen administration Decrease; mean serum I for ovalbumin challenge Decreased G1 response; increased mean serum IgG2a response to ovalbumin challenge; increased mean serum MCP-1 response to LPS challenge; increased mean serum TNF-α response to LPS challenge; mean serum MCP to LPS challenge -1 decreased response; decreased mean serum IL-6 response to LPS challenge; decreased TNFα response to LPS challenge; increased mean serum IL6 response to LPS challenge; increased mean platelet count; mean total white blood cell (WBC) ) Decrease in number; Decrease in absolute lymphocyte count; Decrease in absolute monocyte count; Decrease in dermal fibroblast proliferation; Increase in dermal fibroblast proliferation; Increase in total fat and average percentage of total fat mass; Increased; increased average physical condition; increased organ weight; increased total tissue mass (TTM); increased lean body mass (LBM); systemic, large Increased bone and vertebra bone density (BMD); Increased bone mineral density (BMC) of whole body, femur and vertebra; Increased volumetric bone density (vBMD) of whole body, femur and vertebra; Average mid-femur Increased cortical thickness and cross-sectional area; increased average vertebral trabecular volume, number and connectivity density; increased average body fat and average percentage of total body fat; decreased average body weight; decreased average body length; total tissue mass (TTM) Reduction of lean body mass (LBM); reduction of femur and vertebra bone density (BMD); reduction of whole body, femur and vertebra bone mineral density (BMC); whole body, femur and vertebra volume measurement Reduced bone density (vBMD); reduced mean femoral cortical thickness and cross-sectional area; reduced mean vertebral trabecular volume, number and connectivity density; severe depletion of abdominal and subcutaneous body fat deposition; reduced organ weight Growth retardation; hydrocephalus; sebaceous hyperplasia and growth retardation; 27. The method of claim 26, wherein the method exhibits at least one of apoptosis of olfactory neuroepithelial cells; lymphoid hyperplasia and tissue inflammation; developmental abnormality; male infertility; growth delay with reduced survival; and embryonic mortality.
46. 27. An agent identified by the method of claim 26.
47. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 47. The agent of claim 46, wherein the agent is an agonist or antagonist of a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.
48. Agonist is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 48. A drug according to claim 47 which is an antibody.
49. The antagonists are anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 48. A drug according to claim 47 which is an antibody.
50. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 A method of identifying an agent that modulates a physiological property associated with disruption of a gene encoding a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide comprising:
(A) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1270 Providing a non-human transgenic animal whose genome comprises a disruption of a gene encoding a PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide;
(B) measuring the physiological properties of the non-human transgenic animal of (a);
(C) comparing the measured physiological properties of (b) with those of wild-type animals of matched gender, wherein the physiological properties exhibited by the non-human transgenic animal differ from those exhibited by the wild-type animals. Has been identified as a physiological property associated with gene disruption;
(D) administering a test agent to the non-human transgenic animal of (a);
(E) determining whether a physiological property associated with gene disruption is modulated.
51. Non-human transgenic animals have physiological characteristics: increased anxiety-like response during open field trials; reduced anxiety-like response during open field activity trials; migration compared to gender-matched wild-type littermates Abnormal circadian rhythms during home cage activity tests, including decreased numbers; increased exploratory activity during open field tests; increased stress-induced hyperthermia; increased motor coordination during reverse screen test; reverse screen Impaired motor coordination during the trial; increased retinal artery twist; retinal degeneration characterized by retinal vascular attenuation; ophthalmic abnormalities; increased mean systolic blood pressure; increased average fasting serum blood glucose; average Decrease in serum blood glucose level; increase in average serum cholesterol level; increase in average serum triglyceride level; decrease in average serum cholesterol level; average serum triglyceride Increased glucose tolerance; Impaired glucose tolerance; Increased mean serum insulin levels; Decrease in average serum insulin levels; Increase in uric acid levels; Decrease in serum phosphate levels; Increase in alkaline phosphatase levels and alanine amino groups Increased transferase levels; liver disease; increased average percentage of CD25 + in both spleen and lymph nodes; decreased average percentage of natural killer cells; decreased average percentage of CD21HiCD23Med cells in spleen and lymph nodes; average percentage of CD4 cells And increase in mean percentage of B cells; increase in mean percentage of CD8 + cells; increase in mean percentage of eosinophils; decrease in mean serum IgG1 response to ovalbumin antigen administration; mean serum IgG2a response to ovalbumin antigen administration Decrease; mean serum I for ovalbumin challenge Decreased G1 response; increased mean serum IgG2a response to ovalbumin challenge; increased mean serum MCP-1 response to LPS challenge; increased mean serum TNF-α response to LPS challenge; mean serum MCP to LPS challenge -1 decreased response; decreased mean serum IL-6 response to LPS challenge; decreased TNFα response to LPS challenge; increased mean serum IL6 response to LPS challenge; increased mean platelet count; mean total white blood cell (WBC) ) Decrease in number; Decrease in absolute lymphocyte count; Decrease in absolute monocyte count; Decrease in dermal fibroblast proliferation; Increase in dermal fibroblast proliferation; Increase in total fat and average percentage of total fat mass; Increased; increased average physical condition; increased organ weight; increased total tissue mass (TTM); increased lean body mass (LBM); systemic, large Increased bone and vertebra bone density (BMD); Increased bone mineral density (BMC) of whole body, femur and vertebra; Increased volumetric bone density (vBMD) of whole body, femur and vertebra; Average mid-femur Increased cortical thickness and cross-sectional area; increased average vertebral trabecular volume, number and connectivity density; increased average body fat and average percentage of total body fat; decreased average body weight; decreased average body length; total tissue mass (TTM) Reduction of lean body mass (LBM); reduction of femur and vertebra bone density (BMD); reduction of whole body, femur and vertebra bone mineral density (BMC); whole body, femur and vertebra volume measurement Reduced bone density (vBMD); reduced mean femoral cortical thickness and cross-sectional area; reduced mean vertebral trabecular volume, number and connectivity density; severe depletion of abdominal and subcutaneous body fat deposition; reduced organ weight Growth retardation; hydrocephalus; sebaceous hyperplasia and growth retardation; 51. The method of claim 50, showing at least one of apoptosis of olfactory neuroepithelial cells; lymphoid hyperplasia and tissue inflammation; developmental abnormalities; male infertility; growth delay with reduced survival; and embryonic mortality.
52. 51. An agent identified by the method of claim 50.
53. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 53. The agent of claim 52, wherein the agent is an agonist or antagonist of a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.
54. Agonist is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 54. The agent according to claim 53, which is an antibody.
55. The antagonists are anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 54. The agent according to claim 53, which is an antibody.
56. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 A method of identifying an agent that modulates a behavior associated with disruption of a gene encoding a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide comprising:
(A) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1270 Providing a non-human transgenic animal whose genome comprises a disruption of a gene encoding a PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide;
(B) observe the behavior exhibited by the non-human transgenic animal of (a);
(C) comparing the observed behavior of (b) with that of a wild-type animal of matched gender, where the observed behavior exhibited by a non-human transgenic animal different from the observed behavior exhibited by the wild-type animal Identified as a behavior associated with gene disruption;
(D) administering a test agent to the non-human transgenic animal of (a);
(E) determining whether the agent modulates a behavior associated with gene disruption.
57. 57. The method of claim 56, wherein the behavior is an increased anxiety-like response during an open field activity test.
58. 57. The method of claim 56, wherein the behavior is a reduced anxiety-like response during an open field activity test.
59. 57. The method of claim 56, wherein the behavior is an abnormal circadian rhythm during a home cage activity test.
60. 57. The method of claim 56, wherein the behavior is increased motor coordination during an inverted screen test.
61. 57. The method of claim 56, wherein the behavior is impaired motor coordination during an inverted screen test.
62. 57. The method of claim 56, wherein the behavior is depression, generalized anxiety disorder, attention deficit disorder, sleep disorder, hyperactivity disorder, obsessive compulsive disorder, schizophrenia, cognitive impairment, hyperalgesia or sensory organ disorder. .
63. 57. An agent identified by the method of claim 56.
64. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 64. The agent of claim 63, wherein the agent is an agonist or antagonist of a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.
65. Agonist is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 The drug according to claim 64, which is an antibody.
66. The antagonists are anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 The drug according to claim 64, which is an antibody.
67. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide-related neurological disorders; cardiovascular, endothelial or angiogenic diseases; ocular abnormalities; immune disorders; oncological disorders; Bone metabolism disorder or disease; lipid metabolism disorder; or developmental disorder A method of identifying a remission or modulate drug,
(A) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1270 Providing a non-human transgenic animal whose genome comprises a disruption of a gene encoding a PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide;
(B) administering a test agent to the non-human transgenic animal;
(C) The test drug is a neuropathy in a non-human transgenic animal; cardiovascular, endothelial or angiogenic disease; ocular abnormality; immune disease; oncological disease; bone metabolism abnormality or disease; lipid metabolism disease; Determining whether to ameliorate or regulate.
68. 68. The method of claim 67, wherein the neurological disorder is an increased anxiety-like response during an open field activity test.
69. 68. The method of claim 67, wherein the neurological disorder is a reduced anxiety-like response during an open field activity test.
70. 68. The method of claim 67, wherein the neurological disorder is an abnormal circadian rhythm during a home cage activity test.
71. 68. The method of claim 67, wherein the neurological disorder is increased motor coordination during an inverted screen test.
72. 68. The method of claim 67, wherein the neurological disorder is impaired motor coordination during an inverted screen test.
73. 68. The neurological disorder is depression, generalized anxiety disorder, attention deficit disorder, sleep disorder, hyperactivity disorder, obsessive compulsive disorder, schizophrenia, cognitive impairment, hyperalgesia or sensory organ disorder Method.
74. 68. The method of claim 67, wherein the eye abnormality is a retinal abnormality.
75. 68. The method of claim 67, wherein the eye abnormality is visual impairment or blindness.
76. 75. The method of claim 74, wherein the retinal abnormality is consistent with retinitis pigmentosa.
77. 75. The method of claim 74, wherein the retinal abnormality is characterized by retinal degeneration or retinal dysplasia.
78. Retinal abnormalities are retinal dysplasia, various retinopathy including retinopathy of prematurity, post lens fibroproliferation, neovascular glaucoma, age-related macular degeneration, diabetic macular edema, corneal neovascularization, corneal transplant angiogenesis, corneal transplant rejection , Retinal / choroidal neovascularization, angle angiogenesis (rubeosis), ocular neovascular disease, vascular restenosis, arteriovenous malformation (AVM), meningioma, hemangioma, hemangiofibroma, thyroid hyperplasia (including Graves' disease) ), Transplantation of cornea and other tissues, retinal artery injury or occlusion; retinal degeneration causing secondary atrophy of retinal vasculature, retinitis pigmentosa, macular atrophy, Stargardt disease, congenital static night blindness, congenital Choroidal deficiency, rotational atrophy of the brain, Labor congenital cataract, retinal segregation, Wagner syndrome, Usher syndrome, Zerweger syndrome, Sardino-Mainser syndrome, senior loken Symptoms, Bardeaux-Biddle syndrome, Alport syndrome, Alstrem syndrome, Cocaine syndrome, congenital spinal dysplasia, Flynn-Eyed syndrome, Friedreich ataxia, Hullgren's syndrome, Marshall syndrome, Albers-Schonberg disease, Refsum disease, Keynes Saier Syndrome, Wardenburg Syndrome, Alagille Syndrome, Myotonic Dystrophy, Olive Bridge Cerebellar Atrophy, Pierre-Marie Syndrome, Stickler Syndrome, Carotinemia, Cystine Accumulation, Wolfram Syndrome, Bassen-Kornzweig Syndrome, No β 75. The method of claim 74, consistent with lipoproteinemia, dyschromia, Batten's disease, mucopolysaccharidosis, homocystinuria, or mannosidosis.
79. 68. The method of claim 67, wherein the eye abnormality is cataract.
80. Cataract is a systemic disease such as human Down syndrome, Hallerman-Streff syndrome, Rho syndrome, galactosemia, Marfan syndrome, trisomy 13-15, Alport syndrome, myotonic dystrophy, Fabry disease, hypoparathyroidism or 80. The method of claim 79, consistent with Conradi syndrome.
81. 68. The method of claim 67, wherein the developmental abnormality comprises embryonic lethality or reduced survival.
82. Cardiovascular, endothelial or angiogenic disease is an arterial disease such as diabetes mellitus; congestive nipple; optic nerve atrophy; atherosclerosis; angina; myocardial infarction such as acute myocardial infarction, cardiac hypertrophy, and heart failure such as congestive heart failure Hypertension; inflammatory vasculitis; Raynaud's disease and Raynaud's phenomenon; aneurysms and arterial restenosis; venous and lymphatic diseases such as thrombophlebitis, lymphangitis, and lymphedema; peripheral vascular disease; cancer such as blood vessels Tumors such as hemangiomas (capillary and spongy), glomus tumors, peripheral vasodilation, bacterial hemangiomatosis, vascular endothelial tumors, hemangiosarcomas, angioderma, Kaposi's sarcoma, lymphangioma, and lymphangiosarcoma Tumor angiogenesis; trauma such as wounds, burns and other damaged tissues, graft fixation, scars; ischemic reperfusion injury; rheumatoid arthritis; cerebrovascular disease; Failure, or osteoporosis, The method of claim 67.
83. Immune diseases are systemic lupus erythematosus; rheumatoid arthritis; juvenile rheumatoid arthritis; spondyloarthropathy; systemic scleroderma (scleroderma); idiopathic inflammatory myopathy (dermatomyositis, polymyositis); Sjogren's syndrome; Sarcoidosis; autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria); autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura, immune-mediated thrombocytopenia) Thyroiditis (Graves' disease, Hashimoto's thyroiditis, juvenile lymphoid thyroiditis, atrophic thyroiditis); diabetes mellitus, immune-mediated kidney disease (glomerulonephritis, tubulointerstitial nephritis); central and peripheral nervous system Demyelinating diseases such as multiple sclerosis, idiopathic demyelinating polyneuropathy or Guillain-Barre syndrome, and chronic inflammatory demyelinating polyneuropathy; hepatobiliary diseases such as infectious hepatitis (type A B, C, D, hepatitis E and other non-hepatotropic viruses), autoimmune chronic active hepatitis, primary biliary cirrhosis, granulomatous hepatitis, and sclerosing cholangitis; inflammatory bowel Diseases (ulcerative colitis: Crohn's disease); gluten-sensitive enteropathy and Whipple disease; bullous skin disease, erythema multiforme and contact dermatitis, autoimmune or immune-mediated skin diseases including psoriasis; allergic Diseases such as asthma, allergic rhinitis, atopic dermatitis, food hypersensitivity and urticaria; lung immune diseases such as eosinophilic pneumonia, idiopathic pulmonary fibrosis and hypersensitivity pneumonia; or graft rejection and graft 68. The method of claim 67, wherein the method is a transplant-related disease including host disease.
84. 68. The method of claim 67, wherein the bone metabolism disorder or disease is arthritis, osteoporosis, or marble bone disease.
85. Physiological characteristics of non-human transgenic animals compared to gender-matched wild-type littermates: increased anxiety-like response during open field test; decreased anxiety-like response during open field activity test; Abnormal circadian rhythm during home cage activity test, including decrease; increased exploratory activity during open field test; increased stress-induced hyperthermia; increased motor coordination during reverse screen test; Impairment of motor coordination between; increased retinal arterial twist; retinal degeneration characterized by retinal vascular attenuation; ophthalmic abnormalities; increased mean systolic blood pressure; increased mean fasting serum blood glucose; Decreased value; increased average serum cholesterol level; increased average serum triglyceride level; decreased average serum cholesterol level; average serum triglyceride level Increased glucose tolerance; impaired glucose tolerance; increased mean serum insulin levels; decreased mean serum insulin levels; increased uric acid levels; decreased serum phosphate levels; increased alkaline phosphatase levels and alanine amino groups Increased transferase levels; liver disease; increased average percentage of CD25 + in both spleen and lymph nodes; decreased average percentage of natural killer cells; decreased average percentage of CD21HiCD23Med cells in spleen and lymph nodes; average percentage of CD4 cells And increase in mean percentage of B cells; increase in mean percentage of CD8 + cells; increase in mean percentage of eosinophils; decrease in mean serum IgG1 response to ovalbumin antigen administration; mean serum IgG2a response to ovalbumin antigen administration Decrease; mean serum Ig to ovalbumin challenge 1 decreased response; increased mean serum IgG2a response to ovalbumin challenge; increased mean serum MCP-1 response to LPS challenge; increased mean serum TNF-α response to LPS challenge; mean serum MCP to LPS challenge -1 decreased response; decreased mean serum IL-6 response to LPS challenge; decreased TNFα response to LPS challenge; increased mean serum IL6 response to LPS challenge; increased mean platelet count; mean total white blood cell (WBC) ) Decrease in number; Decrease in absolute lymphocyte count; Decrease in absolute monocyte count; Decrease in dermal fibroblast proliferation; Increase in dermal fibroblast proliferation; Increase in total fat and average percentage of total fat mass; Increased; increased average physical condition; increased organ weight; increased total tissue mass (TTM); increased lean body mass (LBM); whole body, thigh And increased bone mineral density (BMD) of the vertebrae; increased bone mineral density (BMC) of the whole body, femur and vertebrae; increased volumetric bone density (vBMD) of the whole body, femur and vertebrae; Increased thickness and cross-sectional area; increased average vertebral trabecular volume, number and connectivity density; increased average fat and average percentage of total fat mass; decreased average body weight; decreased average body length; total tissue mass (TTM) Decrease; Decrease of lean body mass (LBM); Decrease of bone density (BMD) of femur and vertebra; Decrease of bone mineral density (BMC) of whole body, femur and vertebra; Volumetric bone of whole body, femur and vertebra Decreased density (vBMD); decreased average femoral cortical thickness and cross-sectional area; decreased average vertebral trabecular volume, number and connectivity density; severe depletion of abdominal and subcutaneous body fat deposition; decreased organ weight; Growth retardation; hydrocephalus; sebaceous hyperplasia and growth retardation; 68. The method of claim 67, wherein the method exhibits at least one of apoptosis of optic neuroepithelial cells; lymphoid hyperplasia and tissue inflammation; developmental abnormality; male infertility; growth delay with reduced survival; and embryonic mortality.
86. 68. An agent identified by the method of claim 67.
87. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 90. The agent of claim 86, wherein the agent is an agonist or antagonist of a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.
88. Agonist is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 90. The agent according to claim 87, which is an antibody.
89. The antagonists are anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 90. The agent according to claim 87, which is an antibody.
90. 68. A therapeutic agent identified by the method of claim 67.
91. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 A method of identifying an agent that modulates expression of a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, comprising:
(A) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1270 Contacting a test agent with a host cell expressing a PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide;
(B) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1103, PRO10013, PRO1413, RO1213, PRO1413, PRO1413 , Determining whether to modulate expression of a PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.
92. 92. A drug identified by the method of claim 91.
93. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 94. The agent of claim 92, wherein the agent is an agonist or antagonist of a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.
94. Agonist is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10282, anti-PRO6779 94. The agent according to claim 93, which is an antibody.
95. The antagonists are anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 94. The agent according to claim 93, which is an antibody.
96. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 A method of evaluating a therapeutic agent capable of affecting symptoms associated with disruption of a gene encoding a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide comprising:
(A) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1270 Providing a non-human transgenic animal whose genome comprises a disruption of a gene encoding a PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide;
(B) measuring the physiological properties of the non-human transgenic animal of (a);
(C) comparing the measured physiological properties of (b) with those of wild-type animals of matched gender, where the physiological properties of the non-human transgenic animal differ from those of the wild-type animals. Identified as a symptom resulting from gene disruption in a human transgenic animal;
(D) administering a test agent to the non-human transgenic animal of (a);
(E) assessing the effect of the test agent on the identified symptoms associated with gene disruption in the non-human transgenic animal.
97. 99. The method of claim 96, wherein the symptom is neuropathy; cardiovascular, endothelial or angiogenic disease; ocular abnormality; immune disease; oncological disease; bone metabolism disorder or disease; lipid metabolism disease; .
98. 99. A therapeutic agent identified by the method of claim 96.
99. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 99. The therapeutic agent of claim 98, wherein the therapeutic agent is an agonist or antagonist of a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.
100. Agonist is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 The therapeutic agent according to claim 99, which is an antibody.
101. The antagonists are anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 The therapeutic agent according to claim 99, which is an antibody.
102. 99. A pharmaceutical composition comprising the therapeutic agent according to claim 98.
103. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 Neuropathy associated with disruption of the gene encoding PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide; cardiovascular, endothelial or angiogenic disease; immune disease; oncological disease; Treat or prevent or ameliorate disease or embryonic lethality 95. The method of claim 94, wherein the method is a therapeutically effective amount for a patient who already has or is prone to have the disease or in need of treatment for which the disease is prevented. A method comprising administering an agent, or an agonist or antagonist thereof, thereby effectively treating or preventing or ameliorating the disease.
104. 104. The method of claim 103, wherein the neurological disorder is an increased anxiety-like response during an open field activity test.
105. 104. The method of claim 103, wherein the neurological disorder is a reduced anxiety-like response during an open field activity test.
106. 104. The method of claim 103, wherein the neurological disorder is an abnormal circadian rhythm during a home cage activity test.
107. 104. The method of claim 103, wherein the neurological disorder is increased motor coordination during an inverted screen test.
108. 104. The method of claim 103, wherein the neurological disorder is impaired motor coordination during an inverted screen test.
109. The neurological disorder is depression, generalized anxiety disorder, attention deficit disorder, sleep disorder, hyperactivity disorder, obsessive compulsive disorder, schizophrenia, cognitive dysfunction, hyperalgesia or sensory organ disorder. Method.
110. 104. The method of claim 103, wherein the eye abnormality is a retinal abnormality.
111. 104. The method of claim 103, wherein the eye abnormality is visual impairment or blindness.
112. 111. The method of claim 110, wherein the retinal abnormality is consistent with retinitis pigmentosa.
113. 111. The method of claim 110, wherein the retinal abnormality is characterized by retinal degeneration or retinal dysplasia.
114. Retinal abnormalities are retinal dysplasia, various retinopathy including retinopathy of prematurity, post lens fibroproliferation, neovascular glaucoma, age-related macular degeneration, diabetic macular edema, corneal neovascularization, corneal transplant angiogenesis, corneal transplant rejection , Retinal / choroidal neovascularization, angle angiogenesis (rubeosis), ocular neovascular disease, vascular restenosis, arteriovenous malformation (AVM), meningioma, hemangioma, hemangiofibroma, thyroid hyperplasia (including Graves' disease) ), Transplantation of cornea and other tissues, retinal artery injury or occlusion; retinal degeneration causing secondary atrophy of retinal vasculature, retinitis pigmentosa, macular atrophy, Stargardt disease, congenital static night blindness, congenital Choroidal deficiency, rotational atrophy of the brain, Labor congenital cataract, retinal segregation, Wagner syndrome, Usher syndrome, Zerweger syndrome, Sardino-Mainser syndrome, senior loken Symptoms, Bardeaux-Biddle syndrome, Alport syndrome, Alstrem syndrome, Cocaine syndrome, congenital spinal dysplasia, Flynn-Eyed syndrome, Friedreich ataxia, Hullgren's syndrome, Marshall syndrome, Albers-Schonberg disease, Refsum disease, Keynes Saier Syndrome, Wardenburg Syndrome, Alagille Syndrome, Myotonic Dystrophy, Olive Bridge Cerebellar Atrophy, Pierre-Marie Syndrome, Stickler Syndrome, Carotinemia, Cystine Accumulation, Wolfram Syndrome, Bassen-Kornzweig Syndrome, No β 111. The method of claim 110, consistent with lipoproteinemia, dystaxia, Batten disease, mucopolysaccharidosis, homocystinuria, or mannosidosis.
115. 104. The method of claim 103, wherein the eye abnormality is cataract.
116. Cataract is a systemic disease such as human Down syndrome, Hallerman-Streff syndrome, Rho syndrome, galactosemia, Marfan syndrome, trisomy 13-15, Alport syndrome, myotonic dystrophy, Fabry disease, hypoparathyroidism or 116. The method of claim 115, consistent with Conradi syndrome.
117. 104. The method of claim 103, wherein the developmental abnormality comprises embryonic lethality or reduced survival.
118. Cardiovascular, endothelial or angiogenic diseases are arterial diseases such as diabetes mellitus; congestive nipple; optic nerve atrophy; atherosclerosis; angina; myocardial infarction such as acute myocardial infarction, cardiac hypertrophy, and heart failure such as congestive heart failure Hypertension; inflammatory vasculitis; Raynaud's disease and Raynaud's phenomenon; aneurysms and arterial restenosis; venous and lymphatic diseases such as thrombophlebitis, lymphangitis, and lymphedema; peripheral vascular disease; cancer such as blood vessels Tumors such as hemangiomas (capillary and spongy), glomus tumors, peripheral vasodilatation, bacterial hemangiomatosis, hemangioendothelioma, hemangiosarcoma, angioderma, Kaposi's sarcoma, lymphangioma, and lymphangiosarcoma Tumor angiogenesis; trauma such as wounds, burns and other damaged tissues, graft fixation, scars; ischemic reperfusion injury; rheumatoid arthritis; cerebrovascular disease; Failure, or osteoporosis, The method of claim 103.
119. Immune diseases are systemic lupus erythematosus; rheumatoid arthritis; juvenile rheumatoid arthritis; spondyloarthropathy; systemic scleroderma (scleroderma); idiopathic inflammatory myopathy (dermatomyositis, polymyositis); Sjogren's syndrome; Sarcoidosis; autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria); autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura, immune-mediated thrombocytopenia) Thyroiditis (Graves' disease, Hashimoto's thyroiditis, juvenile lymphoid thyroiditis, atrophic thyroiditis); diabetes mellitus, immune-mediated kidney disease (glomerulonephritis, tubulointerstitial nephritis); central and peripheral nervous system Demyelinating diseases such as multiple sclerosis, idiopathic demyelinating polyneuropathy or Guillain-Barre syndrome, and chronic inflammatory demyelinating polyneuropathy; hepatobiliary diseases such as infectious hepatitis (type A B, C, D, hepatitis E and other non-hepatotropic viruses), autoimmune chronic active hepatitis, primary biliary cirrhosis, granulomatous hepatitis, and sclerosing cholangitis; inflammatory bowel Diseases (ulcerative colitis: Crohn's disease); gluten-sensitive enteropathy and Whipple disease; bullous skin disease, erythema multiforme and contact dermatitis, autoimmune or immune-mediated skin diseases including psoriasis; allergic Diseases such as asthma, allergic rhinitis, atopic dermatitis, food hypersensitivity and urticaria; lung immune diseases such as eosinophilic pneumonia, idiopathic pulmonary fibrosis and hypersensitivity pneumonia; or graft rejection and graft 104. The method of claim 103, wherein the method is a transplantation-related disease including host disease.
120. 104. The method of claim 103, wherein the bone metabolism disorder or disease is arthritis, osteoporosis or marble bone disease.
121. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide-related neurological disorders; cardiovascular, endothelial or angiogenic diseases; ocular abnormalities; immune disorders; oncological disorders; Bone metabolism disorder or disease; lipid metabolism disorder; or developmental disorder A method of identifying a remission or modulate drug,
(A) providing a non-human transgenic animal cell culture, each cell of which is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or the PR0179 polypeptide
(B) administering a test agent to the cell culture;
(C) the test drug is neuropathy in the cell culture; cardiovascular, endothelial or angiogenic disease; ocular abnormality; immune disease; oncological disease; bone metabolism abnormality or disease; lipid metabolism disease; Determining whether to ameliorate or regulate.
122. 122. The method of claim 121, wherein the neurological disorder is an increased anxiety-like response during an open field activity test.
123. 122. The method of claim 121, wherein the neurological disorder is a reduced anxiety-like response during an open field activity test.
124. 122. The method of claim 121, wherein the neurological disorder is an abnormal circadian rhythm during a home cage activity test.
125. 122. The method of claim 121, wherein the neurological disorder is increased motor coordination during an inverted screen test.
126. 122. The method of claim 121, wherein the neurological disorder is impaired motor coordination during an inverted screen test.
127. 122. The neurological disorder is depression, generalized anxiety disorder, attention deficit disorder, sleep disorder, hyperactivity disorder, obsessive compulsive disorder, schizophrenia, cognitive dysfunction, hyperalgesia or sensory organ disorder. Method.
128. 122. The method of claim 121, wherein the eye abnormality is a retinal abnormality.
129. 122. The method of claim 121, wherein the eye abnormality is visual impairment or blindness.
130. 129. The method of claim 128, wherein the retinal abnormality is consistent with retinitis pigmentosa.
131. 129. The method of claim 128, wherein the retinal abnormality is characterized by retinal degeneration or retinal dysplasia.
132. Retinal abnormalities are retinal dysplasia, various retinopathy including retinopathy of prematurity, post lens fibroproliferation, neovascular glaucoma, age-related macular degeneration, diabetic macular edema, corneal neovascularization, corneal transplant angiogenesis, corneal transplant rejection , Retinal / choroidal neovascularization, angle angiogenesis (rubeosis), ocular neovascular disease, vascular restenosis, arteriovenous malformation (AVM), meningioma, hemangioma, hemangiofibroma, thyroid hyperplasia (including Graves' disease) ), Transplantation of cornea and other tissues, retinal artery injury or occlusion; retinal degeneration causing secondary atrophy of retinal vasculature, retinitis pigmentosa, macular atrophy, Stargardt disease, congenital static night blindness, congenital Choroidal deficiency, rotational atrophy of the brain, Labor congenital cataract, retinal segregation, Wagner syndrome, Usher syndrome, Zerweger syndrome, Sardino-Mainser syndrome, senior loken Symptoms, Bardeaux-Biddle syndrome, Alport syndrome, Alstrem syndrome, Cocaine syndrome, congenital spinal dysplasia, Flynn-Eyed syndrome, Friedreich ataxia, Hullgren's syndrome, Marshall syndrome, Albers-Schonberg disease, Refsum disease, Keynes Saier Syndrome, Wardenburg Syndrome, Alagille Syndrome, Myotonic Dystrophy, Olive Bridge Cerebellar Atrophy, Pierre-Marie Syndrome, Stickler Syndrome, Carotinemia, Cystine Accumulation, Wolfram Syndrome, Bassen-Kornzweig Syndrome, No β 129. The method of claim 128, consistent with lipoproteinemia, dyschromia, Batten's disease, mucopolysaccharidosis, homocystinuria, or mannosidosis.
133. 122. The method of claim 121, wherein the eye abnormality is cataract.
134. Cataract is a systemic disease such as human Down syndrome, Hallerman-Streff syndrome, Rho syndrome, galactosemia, Marfan syndrome, trisomy 13-15, Alport syndrome, myotonic dystrophy, Fabry disease, hypoparathyroidism or 143. The method of claim 133, consistent with Conradi syndrome.
135. 122. The method of claim 121, wherein the developmental abnormality comprises embryonic lethality or reduced survival.
136. Cardiovascular, endothelial or angiogenic diseases are arterial diseases such as diabetes mellitus; congestive nipple; optic nerve atrophy; atherosclerosis; angina; myocardial infarction such as acute myocardial infarction, cardiac hypertrophy, and heart failure such as congestive heart failure Hypertension; inflammatory vasculitis; Raynaud's disease and Raynaud's phenomenon; aneurysms and arterial restenosis; venous and lymphatic diseases such as thrombophlebitis, lymphangitis, and lymphedema; peripheral vascular disease; cancer such as blood vessels Tumors such as hemangiomas (capillary and spongy), glomus tumors, peripheral vasodilatation, bacterial hemangiomatosis, hemangioendothelioma, hemangiosarcoma, angioderma, Kaposi's sarcoma, lymphangioma, and lymphangiosarcoma Tumor angiogenesis; trauma such as wounds, burns and other damaged tissues, graft fixation, scars; ischemic reperfusion injury; rheumatoid arthritis; cerebrovascular disease; Failure, or osteoporosis, The method of claim 121.
137. Immune diseases are systemic lupus erythematosus; rheumatoid arthritis; juvenile rheumatoid arthritis; spondyloarthropathy; systemic scleroderma (scleroderma); idiopathic inflammatory myopathy (dermatomyositis, polymyositis); Sjogren's syndrome; Sarcoidosis; autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria); autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura, immune-mediated thrombocytopenia) Thyroiditis (Graves' disease, Hashimoto's thyroiditis, juvenile lymphoid thyroiditis, atrophic thyroiditis); diabetes mellitus, immune-mediated kidney disease (glomerulonephritis, tubulointerstitial nephritis); central and peripheral nervous system Demyelinating diseases such as multiple sclerosis, idiopathic demyelinating polyneuropathy or Guillain-Barre syndrome, and chronic inflammatory demyelinating polyneuropathy; hepatobiliary diseases such as infectious hepatitis (type A B, C, D, hepatitis E and other non-hepatotropic viruses), autoimmune chronic active hepatitis, primary biliary cirrhosis, granulomatous hepatitis, and sclerosing cholangitis; inflammatory bowel Diseases (ulcerative colitis: Crohn's disease); gluten-sensitive enteropathy and Whipple disease; bullous skin disease, erythema multiforme and contact dermatitis, autoimmune or immune-mediated skin diseases including psoriasis; allergic Diseases such as asthma, allergic rhinitis, atopic dermatitis, food hypersensitivity and urticaria; lung immune diseases such as eosinophilic pneumonia, idiopathic pulmonary fibrosis and hypersensitivity pneumonia; or graft rejection and graft 122. The method of claim 121, wherein the method is a transplantation-related disease including host versus host disease.
138. 122. The method of claim 121, wherein the bone metabolism disorder or disease is arthritis, osteoporosis or marble bone disease.
139. 122. A therapeutic agent identified by the method of claim 121.
140. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 140. The therapeutic agent of claim 139, which is an agonist or antagonist of a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.
141. Agonist is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 The therapeutic agent according to claim 140, which is an antibody.
142. The antagonists are anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 The therapeutic agent according to claim 140, which is an antibody.
143. 122. A therapeutic agent identified by the method of claim 121.
144. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 A method of modulating a phenotype associated with disruption of a gene encoding a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, wherein the phenotype already exists or has a phenotype To patients who are prone to phenotype or whose phenotype is prevented Administered drug, or an agonist or antagonist of claim 46 in an effective amount, a method comprising adjusting the phenotypic effectively thereby.
145. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213 A method of modulating a physiological property associated with the disruption of a gene encoding a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, which already has or is physiological Tend to have properties or physiology To a patient nature is prevented, the method comprising administering the agent according, or the agonist or antagonist to claim 52 in an effective amount, to adjust thereby the physiological properties effectively.
146. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 A method of modulating a behavior associated with disruption of a gene encoding a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, which already has or has a behavior Effective doses for patients who are prone or whose behavior is prevented An agent according to claim 63, or a method of administering the agonist or antagonist comprises adjusting thereby the action effectively.
147. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 A method of modulating the expression of a polypeptide of PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779, comprising the above-mentioned PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO 28, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO59725, PRO9725, PRO9725, PRO9725 94. A method comprising administering to a host expressing a peptide an effective amount of the agent of claim 92, or an agonist or antagonist thereof, thereby effectively modulating the expression of said polypeptide.
148. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 A method of modulating symptoms associated with disruption of a gene encoding a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, having or having a symptom Therapeutically effective in patients who have or are symptomatic The therapeutic agent of claim 98, or administering the agonist or antagonist, the method thereby comprising modulating the symptoms effectively.
149. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 Neuropathy associated with disruption of the gene encoding PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide; cardiovascular, endothelial or angiogenic disease; immune disease; oncological disease; Treat or prevent or ameliorate disease or embryonic lethality Non-human transgenic animal cell culture, i.e., PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1100, PRO1 , PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, a disruption of a gene encoding a gene encoding the therapeutic, 95. An effective amount of the agent of claim 94, The method of an agonist or antagonist administered, thereby treating or preventing or ameliorating the disease effectively.

Detailed Description of Preferred Embodiments
I. Definitions As used herein, the terms “PRO polypeptide” and “PRO” refer to various polypeptides when followed by a numerical designation, with the full designation (ie, PRO / number) described herein. Means a specific polypeptide sequence. The term “PRO / number polypeptide” and “PRO / number”, where the term “number” is provided herein as an actual numerical representation, includes native sequence polypeptides, polypeptide variants and native sequence polypeptides. And fragments of polypeptide variants (as defined further herein). PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1213, PRO1213, PRO1213 PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides may be isolated from a variety of sources, such as human tissue types or other sources, or recombinant or synthetic It may be prepared by the method. The term “PRO polypeptide” refers to each individual PRO / number polypeptide described herein. All disclosures in this specification that refer to “PRO polypeptides” refer to each polypeptide individually as well as collectively. For example, the description of preparation, purification, induction, antibody formation, PRO-binding oligopeptide formation, PRO-binding organic molecule formation, administration, containing composition, disease treatment, etc. relates to each polypeptide of the present invention. The term “PRO polypeptide” also includes variants of the PRO / number polypeptides described herein.

  `` Natural sequences PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO12845 , PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide "includes the corresponding naturally occurring PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, 328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, RO5725, PRO59725, PRO9725, PRO9725, PRO A polypeptide having the same amino acid sequence as the peptide is included. Such native sequences PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, RO1244 , PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides can be isolated from nature or can be produced by recombinant or synthetic means. `` Natural sequences PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO12845 , PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide "is specifically referred to as a specific PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO28, PRO28, PRO28, PRO28, PRO28, RO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, RO5759, PRO5925, PRO5925, PRO5925, PRO5925 Included are naturally occurring truncated or secreted forms of peptides (eg, extracellular domain sequences), naturally occurring mutated forms (eg, alternatively spliced forms) and naturally occurring allelic variants of the polypeptide. The present invention includes the native sequences PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, disclosed herein that are mature or full-length native sequence polypeptides comprising the full-length amino acid sequence shown in the accompanying figures. PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5910, RO597 provide. Start and stop codons are shown in bold and underlined in the figure. However, PRO 196, PRO 217, PRO 231, PRO 236, PRO 245, PRO 246, PRO 258, PRO 287, PRO 328, PRO 344, PRO 357, PRO 526, PRO 724, PRO 731, PRO 732, PRO 10013, PRO 1 413, PRO 11513 PRO , PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide are shown to begin with the methionine residue indicated here as amino acid position 1 in the figure, Upstream of amino acid position 1 in the drawing Other downstream methionine residues are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10012, PRO1398, PRO1298 , PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides may be used or possible.

  PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide "extracellular domain" or "ECD" is a PRO196, PRO217, PRO231, PRO236, PRO245, PR with substantially no transmembrane and cytoplasmic domains. 246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891 It refers to the form of PRO10282, PRO61709 or PRO779 polypeptide. Typically, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1 245PRO PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide ECD have less than 1% of their transmembrane and / or cytoplasmic domains, preferably less than 0.5% of such domains Absent. PRO 196, PRO 217, PRO 231, PRO 236, PRO 245, PRO 246, PRO 258, PRO 287, PRO 328, PRO 344, PRO 357, PRO 526, PRO 724, PRO 731, PRO 732, PRO 1003, PRO 1104, PRO 11513, PRO 1 186 PRO Any transmembrane domain identified for a, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide is routinely used in the art to identify that type of hydrophobic domain. It is understood that It will be. Although the exact boundaries of the transmembrane domain can vary, it is likely not to exceed about 5 amino acids from either end of the originally identified domain. In some cases, therefore, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1413, PRO11513, PRO1413, PRO11513 The extracellular domain of a PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide is a transmembrane domain / extracellular domain boundary as identified in the Examples or specification. No more than about 5 amino acids from either side Comprise may, with or without the signal peptide, nucleic acids encoding those polypeptides and them, are contemplated by the present invention.

  Various PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1104, PRO11513 The approximate location of the “signal peptide” of the PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide may be shown herein and / or in the accompanying figures. However, although the C-terminal boundary of the signal peptide can vary, it is most likely less than about 5 amino acids on either side of the signal peptide C-terminal boundary, as defined herein, It is noted that boundaries can be identified according to criteria routinely used to identify such types of amino acid sequence components (eg, Nielsen et al., Prot. Eng. 10: 1-6 (1997) And von Heinje et al., Nucl. Acids. Res. 14: 4683-4690 (1986)). Furthermore, in some cases, it is also recognized that cleavage of the signal sequence from the secreted polypeptide is not completely uniform, resulting in one or more secreted species. These mature polypeptides, and the polynucleotides encoding them, that are cleaved within less than about 5 amino acids on either side of the C-terminal boundary of the signal peptide identified herein are contemplated in the present invention. .

`` PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO11513, PRO1398 , PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide variants "are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344. PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, RO6097, RO6010, RO7410 , Full length native sequences as disclosed herein, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide sequence as described herein, PRO17, RO217 , PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1318, PRO8618PRO18 91, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide sequence, with or without signal peptide as disclosed herein, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO246, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO4409 Extracellular domain of 10102, PRO10282, PRO61709 or PRO779 polypeptide or full length PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258 disclosed herein, PRO287, PRO328, PRO344, PRO357, PRO324, PRO724, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or any other fragment of the full-length polypeptide sequence, eg, PRO779 RO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 Defined herein having at least about 80% amino acid sequence identity with a nucleic acid that represents only a portion of the complete coding sequence of a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide) Active PRO196, P RO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1344, RO13PRO, 8613, RO13PRO Means PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO12483PRO , PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide variants, for example, with one or more amino acid residues added at the N-terminus or C-terminus of the full-length natural amino acid sequence, or Deleted PRO196, PRO21 , PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO13870, , PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides. Typically, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1 238PRO PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide variants are disclosed in the full-length native sequence PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO28 , PRO 328, PRO 344, PRO 357, PRO 526, PRO 724, PRO 731, PRO 732, PRO 1003, PRO 1104, PRO 1151, PRO 1244, PRO 1298, PRO 1313, PRO 1570, PRO 1886, PRO 1891, PRO 4409, PRO 9425, PRO 9409, PRO 9425, PRO PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1 lacking the polypeptide disclosed herein and the signal peptide disclosed herein 03, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 with or without this peptide sequence PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1213, PRO1213, PRO1213 70, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide or the full-length PRO196, PRO217, PRO231, PRO246, RO246, PRO245 , PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO5409, PRO5759 25, at least about 80% amino acid sequence identity, or at least about 81%, 82%, 83%, 84 to any other specifically defined fragment of the PRO10102, PRO10282, PRO61709 or PRO779 polypeptide sequence. %, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% amino acid sequence Have identity. Typically, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1 245PRO PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 variant polypeptides are at least about 10 amino acids in length, or at least about 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 50, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600 amino acids in length or longer. In some cases, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1213, RO1213, PRO1213, PRO1213 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425,
PRO10102, PRO10282, PRO61709 or PRO779 variant polypeptides are native PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO732, PRO732P1 PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 or PRO779 polypeptide sequence, or native PRO O196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1398, PRO1398, PRO1298 Has no more than 2, 3, 4, 5, 6, 7, 8, 9, or 10 conservative amino acid substitutions compared to a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide sequence .

  PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215, PRO1215 “Percent (%) amino acid sequence identity” with respect to a PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide sequence is to align the sequences and obtain maximum percent sequence identity. Introduce a gap if necessary, Specific PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, after not considering conservative substitutions as part of sequence identity PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709, or a PRO779 polypeptide amino acid residue that is the same as the amino acid sequence of the polypeptide sequence Defined as the percentage of amino acid residues. Alignments for the purpose of determining percent amino acid sequence identity are publicly available in various ways within the skill of the art, such as BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software This can be achieved by using simple computer software. One skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms necessary to achieve maximal alignment over the full length of the sequences being compared. However, for purposes herein,% amino acid sequence identity values can be obtained using the sequence comparison computer program ALIGN-2, the complete source code for which is provided in Table 1 below. Obtained by. The ALIGN-2 sequence comparison computer program was created by Genentech, and the source code shown in Table 1 below was submitted to the US Copyright Office, Washington DC, 20559 with user documentation and registered under US copyright registration number TXU510087 Has been. The ALIGN-2 program is publicly available from Genentech, South San Francisco, California and may be compiled from the source code provided in Table 1 below. The ALIGN-2 program is compiled for use on a UNIX operating system, preferably digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.

In situations where ALIGN-2 is used for amino acid sequence comparison, the% amino acid sequence identity of a given amino acid sequence A to, or relative to, a given amino acid sequence B (or a given amino acid sequence B A given amino acid sequence A, which has or contains some% amino acid sequence identity to, to or from it) is calculated as follows:
100 times the fraction X / Y, where X is the number of amino acid residues with a score that is identical by the A and B program alignments of the sequence alignment program ALIGN-2, and Y is the total amino acid residue of B Radix. If the length of amino acid sequence A is different from the length of amino acid sequence B, it will be recognized that the% amino acid sequence identity of A to B is different from the% amino acid sequence identity of B to A. As an example of calculating% amino acid sequence identity, Tables 2 and 3 show how to calculate% amino acid sequence identity for an amino acid sequence called “PRO” of an amino acid sequence called “Comparative Protein” Where “PRO” represents the amino acid sequence of the subject virtual PRO polypeptide and “comparison protein” represents the amino acid sequence of the polypeptide against which the “PRO” polypeptide is compared, and “X”, “Y” And “Z” each represent a different hypothetical amino acid residue. Unless otherwise stated, all% amino acid sequence identity values used herein are obtained as described in the immediately preceding paragraph using the ALIGN-2 computer program.

  "PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO11513, PRO1398 , PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 variant polynucleotide "or" PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO 44, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5925, PRO6985, RO9 As used herein, the term “array” refers to PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1, PRO1, PRO1, PRO1, PRO1, PRO1, PRO1, PRO1, PRO1, PRO1, PRO1, PRO1, PRO1, PRO1, PRO1 51, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779, RO2, PRO2586 , PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725 The full-length native sequence PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO287, PRO354, PRO347, PRO347, PRO347, PRO347, PRO347, PRO347, PRO345, PRO347, PRO347R , PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, RO10298, RO10298 Polypeptide sequences, full length native sequences lacking the signal peptides disclosed herein PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO1003, PRO1003, PRO1003 , PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 with or without RO1 , PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO13870, , PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide or the full-length PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO34 disclosed herein. 4, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5925, PRO9985, RO9 A nucleic acid sequence encoding any other fragment (full length PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO104 PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709, or only part of the complete coding sequence of a PRO779 polypeptide) And a nucleic acid molecule having at least about 80% nucleic acid sequence identity. Typically, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1 245PRO PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 variant polynucleotides are full-length native sequence PRO polypeptide sequences disclosed herein, full-length native sequence PRO196 lacking the signal peptides disclosed herein, PRO217, P O231, PRO236, PRO245, PRO246, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, RO18PRO PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide sequence, disclosed herein with or without signal peptide PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, RO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5910, RO597 Extracellular domain or full length PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO110 disclosed herein 4, a nucleic acid encoding at least any other fragment of the PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide sequences About 80% nucleic acid sequence identity, or at least about 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93% 94%, 95%, 96%, 97%, 98%, or 99% nucleic acid sequence identity. Variants do not contain the native nucleotide sequence.

  Usually, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1 187PRO PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 variant polynucleotides are at least about 5 nucleotides in length, or at least about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 1, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 60, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, or 1000 nucleotides in length, the term “about” in this context adds 10% of the displayed length to the displayed nucleotide sequence length or Means reduced.

  PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 , PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779-encoding nucleic acid sequences align sequences and obtain maximum percent sequence identity In order to introduce the gap if necessary, the target PR 196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1398, PRO1298, PRO1398, PRO1398, PRO1298 Defined as the percentage of nucleotides in the candidate sequence that are identical to the nucleotides of the PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 nucleic acid sequences. Alignments for the purpose of determining percent nucleic acid sequence identity can be obtained from various methods within the purview of those skilled in the art, such as publicly available computers such as BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software. This can be achieved by using software. For purposes herein,% nucleic acid sequence identity values are obtained by using the sequence comparison computer program ALIGN-2, the complete source code for which is provided in Table 1 below. It is done. The ALIGN-2 sequence comparison computer program was created by Genentech, and the source code shown in Table 1 below was submitted to the US Copyright Office, Washington DC, 20559 along with user documentation, under US Copyright Registration Number TXU510087 It is registered with. The ALIGN-2 program is publicly available from Genentech, South San Francisco, California, and may be compiled from the source code provided in Table 1 below. The ALIGN-2 program is compiled for use on a UNIX operating system, preferably digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.

In situations where ALIGN-2 is used for nucleic acid sequence comparison, the% nucleic acid sequence identity of, or relative to, a given nucleic acid sequence C (or a given nucleic acid sequence D, or In contrast, a given nucleic acid sequence C having or containing a certain percentage of nucleic acid sequence identity) may be calculated as follows:
100 times the fraction W / Z, where W is the number of nucleotides with a score matched by C and D alignments of the sequence alignment program ALIGN-2, and Z is the total nucleotides of D. It will be appreciated that if the length of the nucleic acid sequence C is different from the length of the nucleic acid sequence D, then the% nucleic acid sequence identity of C to D is different from the% nucleic acid sequence identity of D to C. As an example of calculating% nucleic acid sequence identity, “PRO-DNA” represents a hypothetical PRO-encoding nucleic acid sequence of interest, and “comparison DNA” of interest is compared to “PRO-DNA” nucleic acid molecules. “PRO-DNA” of nucleic acid sequences representing nucleic acid sequences, and each of “N”, “L” and “V” represents different virtual nucleotides, and Tables 4 and 5 are referred to as “comparison DNA” The calculation method of% nucleic acid sequence identity with respect to the nucleic acid sequence called is shown. Unless otherwise indicated, all% nucleic acid sequence identity values herein are obtained using the ALIGN-2 computer program as set forth in the immediately preceding paragraph.

The present invention also includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, RO1135 A nucleic acid molecule encoding a PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, preferably under full stringent hybridization and wash conditions as described herein. PRO196, PRO2 7, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1259, PRO13598, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO2 capable of hybridizing to nucleotide sequences encoding PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides. 7, PRO 328, PRO 344, PRO 357, PRO 526, PRO 724, PRO 731, PRO 732, PRO 1003, PRO 1104, PRO 1151, PRO 1244, PRO 1298, PRO 1313, PRO 1570, PRO 1886, PRO 1891, PRO 4409, PRO 5725, PR PRO779 variant polypeptides are provided. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 mutant polypeptides are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO344, PRO344, O357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO10225, PRO1082, RO102 It can be what is coded.
PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 The term “full-length coding region” when used in reference to a nucleic acid encoding a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide (often indicated between the start and stop codons in the accompanying figures) The full-length PRO of the present invention 96, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11518, PRO1318, PRO1386, PRO1436 Means a nucleotide sequence encoding a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide. The term “full-length coding region” when used in reference to an ATCC deposited nucleic acid is the PRO196 of a cDNA inserted into a vector deposited with the ATCC (often indicated between the start and stop codons in the accompanying figures), PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1344, RO13PRO, 8613, RO13PRO PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO6 It means 709 or PRO779 polypeptide encoding portion.

  “Isolated” as used to describe the various PRO polypeptides disclosed herein refers to polypeptides that have been identified and separated and / or recovered from components of the natural environment. Contaminant components of the natural environment are substances that typically interfere with the diagnostic or therapeutic use of the polypeptide and include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes. In a preferred embodiment, the polypeptide is (1) sufficient to obtain an N-terminal or internal amino acid sequence of at least 15 residues by using a spinning cup sequenator, or (2) Coomassie blue or Preferably, it is purified to homogeneity by SDS-PAGE under non-reducing or reducing conditions using silver staining. The isolated polypeptides include PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1104, PRO1213, PRO1213 , PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709, or PRO779 polypeptide, in situ within the recombinant cell. It is. Ordinarily, however, isolated polypeptide will be prepared by at least one purification step.

“Isolated” PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1213, PRO1213, PRO1213 Nucleic acids encoding PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides have been identified and become natural sources of nucleic acids encoding polypeptides. At least one contaminating nucleus usually associated It is isolated nucleic acid molecule from molecule. A nucleic acid molecule encoding an isolated polypeptide is other than in the form or setting in which it is found in nature. Thus, a nucleic acid molecule that encodes an isolated polypeptide is distinguished from a nucleic acid molecule that encodes a specific polypeptide present in natural cells. However, an isolated nucleic acid molecule encoding a polypeptide includes, for example, a nucleic acid encoding a polypeptide contained in a cell that normally expresses the polypeptide where the nucleic acid molecule is in a chromosomal location different from that of natural cells. Includes molecules.
The term “control sequence” refers to a DNA sequence necessary to express an operably linked coding sequence in a particular host organism. For example, suitable control sequences for prokaryotes include a promoter, optionally an operator sequence, and a ribosome binding site. Eukaryotic cells are known to utilize promoters, polyadenylation signals and enhancers.

  A nucleic acid is “operably linked” when it is in a functional relationship with another nucleic acid sequence. For example, a presequence or secretory leader DNA, if expressed as a preprotein that participates in polypeptide secretion, is operably linked to the polypeptide DNA; a promoter or enhancer is responsible for transcription of the sequence. If it does, it is operably linked to the coding sequence; or the ribosome binding site is operably linked to the coding sequence if it is in a position that facilitates translation. In general, “operably linked” means that the bound DNA sequences are in close proximity and, in the case of a secretory leader, in close proximity and in the reading phase. However, enhancers do not necessarily have to be close together. Binding is achieved by ligation at convenient restriction sites. If such sites do not exist, synthetic oligonucleotide adapters or linkers are used according to conventional techniques.

  The “stringency” of a hybridization reaction is readily determined by those skilled in the art and is generally an empirical calculation that depends on probe length, wash temperature, and salt concentration. In general, the longer the probe, the higher the temperature required for proper annealing, and the shorter the probe, the lower the required temperature. Hybridization generally depends on the ability of denatured DNA to reanneal when the complementary strand is present in an environment below its melting point. The higher the degree of homology desired between the probe and the hybridization sequence, the higher the relative temperature that can be used. As a result, higher relative temperatures will make the reaction conditions more stringent and lower temperatures will reduce stringency. For further details and explanation of the stringency of hybridization reactions, see Ausubel et al., Current Protocols in Molecular Biology (Wiley Interscience Publishers, 1995).

“Stringent conditions” or “high stringency conditions” as defined herein are (1) using low ionic strength and high temperature for washing, eg, 0.015M sodium chloride / 0.0015M at 50 ° C. Sodium citrate / 0.1% sodium dodecyl sulfate; (2) using denaturing agents such as formamide during hybridization, eg, 50% (v / v) formamide and 0.1% bovine serum at 42 ° C. Albumin / 0.1% Ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer pH 6.5 and 750 mM sodium chloride, 75 mM sodium citrate; or (3) 50% formamide at 42 ° C. 5 × SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM Li Overnight in sodium sulfate (pH 6.8), 0.1% sodium pyrophosphate, 5 × Denhardt's solution, sonicated salmon sperm DNA (50 μg / ml), 0.1% SDS, and 10% dextran sulfate solution Hybridization, wash at 42 ° C. in 0.2 × SSC (sodium chloride / sodium citrate) for 10 minutes, then at 55 ° C. for 10 minutes with high stringency wash of 0.1 × SSC containing EDTA Identified by what is used.
“Medium stringent conditions” were identified as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Press, 1989), Includes the use of hybridization conditions (eg, temperature, ionic strength and% SDS). Medium stringency conditions include 20% formamide, 5 × SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 × Denhardt's solution, 10% dextran sulfate, and 20 mg. Conditions include overnight incubation at 37 ° C. in a solution containing / ml of denatured sheared salmon sperm DNA, followed by washing the filter at about 37-50 ° C. in 1 × SSC. Those skilled in the art will recognize how to adjust temperature, ionic strength, etc. as needed to accommodate factors such as probe length.

The term “epitope tag” as used herein refers to PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, fused to a “tag polypeptide”. , PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, including PRO6097, PRO7425, PRO10102, PRO10282, PRO7709 . A tag polypeptide has sufficient residues to provide an epitope from which the antibody can be produced, and its length is short enough not to inhibit the activity of the fused polypeptide. Also, the tag polypeptide is preferably quite unique so that the antibody does not substantially cross-react with other epitopes. Suitable tag polypeptides generally have at least 6 amino acid residues, usually about 8-50 amino acid residues (preferably about 10-20 residues).
“Active” or “activity” for purposes herein means naturally occurring or naturally occurring PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732. , PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709, or PRO779 PRO196, PRO217, PRO231, PRO236 PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1540, RO1840, RO1540, Means a form of PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, where “biological” activity refers to naturally occurring or naturally occurring PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, RO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, RO6097, RO7410 Other than the ability to induce the production of antibodies to the epitope, naturally occurring or naturally occurring PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10 03, PRO1104, PRO1151, PRO1244, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779. “Immunological” activity refers to naturally occurring or naturally occurring PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10012, PRO1 4 , PRO129 , PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 means the ability to induce the production of an antibody against an antigenic epitope held.

  The term “antagonist” is used in the broadest sense [unless otherwise defined] and is disclosed herein as native PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526. , PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, RO1079 Partially or completely blocked, inhibited or neutralized And it includes any molecule that. Similarly, the term “agonist” is used in its broadest sense (unless otherwise defined) and is disclosed herein as native PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6010, RO6097RO, PRO7425 Any molecule that mimics pharmacological activity is included. Suitable agonist or antagonist molecules include in particular agonist or antagonist antibodies or antibody fragments, fragments, or native PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO6179 polypeptide, PRO7779 Rigo nucleotides, small organic molecules,. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 Methods for identifying agonists or antagonists of PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO 87, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO9740 A PRO779 polypeptide is contacted with a candidate agonist or antagonist molecule and is usually PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731 PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709, or PRO7779 Measuring a detectable change in activity.

“Treat” or “treatment” or “palliative” refers to both therapeutic treatment and prophylactic or protective therapies, the purpose of which is to prevent or diminish the targeted pathological condition or disease ( Small). Those in need of treatment include those susceptible to the disease as well as those already suffering from the disease or those in which the disease is to be prevented.
“Chronic” administration means administration of the drug in a continuous manner as opposed to an acute manner in order to maintain the initial therapeutic effect (activity) over a long period of time. “Intermittent” administration is treatment that is not performed continuously without interruption, but rather is performed essentially cyclically.
By “mammal” for treatment is meant any animal classified as a mammal, humans, livestock and farm animals, zoos, sports or pet animals such as dogs, cats, cows, horses, Includes sheep, pigs, goats, rabbits, etc. Preferably the mammal is a human.
Administration “in combination with” one or more further therapeutic agents includes simultaneous (concurrent) and consecutive administration in any order.

As used herein, a “carrier” includes a pharmaceutically acceptable carrier, excipient, or stabilizer, and is non-toxic to cells or mammals exposed to them at the dosage and concentration used. is there. Often the physiologically acceptable carrier is an aqueous pH buffered solution. Examples of physiologically acceptable carriers include phosphate, citrate, and other organic acid salt buffers; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; Eg serum albumin, gelatin or immunoglobulin; hydrophobic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates including glucose, mannose or dextran; EDTA Chelating agents such as; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or nonionic surfactants such as TWEEN ^™ , polyethylene glycol (PEG), and PLURONICS ^™ .

“Solid phase” means a non-aqueous matrix to which an antibody, PRO-binding oligopeptide or PRO-binding organic molecule of the present invention can adhere. Examples of solid phases encompassed herein include those partially or wholly formed of glass (eg, modified pore glass), polysaccharides (eg, agarose), polyacrylamide, polystyrene, polyvinyl alcohol and silicone. In certain embodiments, depending on the context, the solid phase can include the wells of an assay plate; otherwise, a purification column (eg, an affinity chromatography column). The term also includes a discontinuous solid phase of discrete particles as described in US Pat. No. 4,275,149.
“Liposome” is a drug for mammals (eg, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1104, Lipids, phospholipids and / or surface activity useful for transport of PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides, or antibodies thereto) There are various types of endoplasmic reticulum containing agents. The components of the liposome are usually arranged in a bilayer structure similar to the lipid orientation of the cell membrane.

As defined herein, a “small molecule” is a molecular weight of less than about 500 Daltons.
PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, RO 28, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4091 Anti-PRO5725, Anti-PRO5994, Anti-PRO6097, Anti-PRO7425, Anti-PRO10102, Anti-PRO10282, Anti-PRO61709 or Anti-PRO779 antibody, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO287, PRO287, PRO347P , PRO731, PRO732, PRO1003, P O1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1513, PRO1870, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709, PRO2PRO, 4581 , PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PR An “effective amount” of O5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 binding organic molecule, or an agonist or antagonist thereof, is an amount sufficient to carry out a specifically stated purpose. An “effective amount” can be determined empirically and in a routine manner in connection with the stated purpose.

  The term “therapeutically effective amount” refers to an anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO, effective to “treat” a disease or condition in a patient or mammal. PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1870, anti-PRO1886, anti-PRO1886 Anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10282, anti-PRO61709 or anti-PRO779 antibody, PRO 96, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731 PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO357 O526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, RO7479, PRO10425, PRO10279, PRO10279 , PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO131 3, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 binding organic molecule or other amount of drug. In the case of cancer, a therapeutically effective amount of the drug reduces the number of cancer cells; reduces the size of the tumor; inhibits (ie slows down, preferably stops) cancer cell invasion to peripheral organs; Inhibit metastasis (ie slow down and preferably stop to some extent); inhibit tumor growth to some extent; and / or alleviate one or more symptoms associated with cancer to some extent. See the definition here of “treat”. To the extent that the drug prevents growth and / or kills cancer cells in which it is present, it can be mitotic and / or cytotoxic.

  The terms “cardiovascular, endothelial and angiogenic disorders”, “circulatory, endothelial and angiogenic dysfunction”, “circulatory, endothelial or angiogenic dysfunction” and “circulatory, endothelial or angiogenic dysfunction” are interchangeable Means systemic diseases that partially affect the blood vessels, such as diabetes, and diseases of the blood vessels, such as arteries, capillaries, veins, and / or lymphatic vessels themselves. This includes signs that stimulate angiogenesis and / or cardiovascularization and signs that inhibit angiogenesis and / or cardiovascularization. Such diseases include, for example, arterial diseases such as atherosclerosis, hypertension, inflammatory vasculitis, Lehno's disease and Lehno phenomenon, aneurysms and arterial restenosis; venous and lymphatic diseases such as thrombotic veins Inflammation, lymphangitis, and lymphedema; and other vascular diseases such as peripheral vascular disease, cancer such as vascular tumors such as hemangioma (capillary and spongy), glomus tumor, telangiectasia, bacterial hemangiomatosis, Hemangioendothelioma, angiosarcoma, angiodermocytoma, Kaposi's sarcoma, lymphangioma, and lymphangiosarcoma, tumor angiogenesis, trauma, such as wounds, burns, and other tissue damage, transplantation fixation, scarring, ischemia Perfusion disorders, rheumatoid arthritis, cerebrovascular diseases, kidney diseases such as acute renal failure, and osteoporosis are included. Also included are angina, myocardial infarction, such as acute myocardial infarction, cardiac hypertrophy, and heart failure, such as CHF.

  “Hypertrophy” as used herein is defined as an increase in the size of a tissue or structure regardless of normal growth not involved in tumor formation. Organ or tissue hypertrophy is due to either an increase in the size of individual cells (true hypertrophy), or an increase in the number of cells forming the tissue (hyperplasia), or both. Certain organs, such as the heart, lose their ability to divide shortly after birth. Thus, “cardiac hypertrophy” is defined as an increase in heart size and is characterized by an increase in contractile protein content and myocyte cell size without adult cell division in adults. Characteristics of stress that causes hypertrophy (e.g., increased preload, increased afterload, loss of myocytes as in myocardial infarction, primary decrease in contractility) are important in determining the nature of the response. It is clear that it plays a role. The early stages of cardiac hypertrophy are usually morphologically characterized by increased myofibril and mitochondrial size, as well as mitochondrial and nuclear enlargement. At this stage, myocytes become larger than normal and the organization of the cells is mostly maintained. As the stage of cardiac hypertrophy progresses further, the number and size of certain organelles, such as mitochondria, preferentially increase and new contractile elements are added in an irregular manner to the localized region of the cell. Cells that have been hypertrophied for many years have a highly segmented membrane that replaces adjacent myofibrils and causes disruption of normal Z membrane registration, and is more distinct in cell organization, including a fairly enlarged nucleus Indicates division. The term “cardiac hypertrophy” is used to encompass all stages in the progression of a disease state characterized by varying degrees of structural damage to the myocardium, regardless of the underlying heart disease. Thus, the term also includes physiological conditions in the development of cardiac hypertrophy, such as elevated blood pressure, aortic stenosis, or myocardial infarction.

“Heart failure” refers to an abnormality in cardiac function in which the heart does not pump blood as fast as the demands of the tissue being metabolized. Heart failure can be caused by a variety of factors, including ischemic, congenital, rheumatic or idiopathic forms.
“Congestive heart failure” (CHF) is a progression of the heart that cannot supply enough cardiac output (the volume of blood that is pushed out by the heart over time) to deliver oxygenated blood to peripheral tissues. It is a sexual condition. As CHF progresses, structural and hemodynamic damage occurs. Although these damages have various signs, one characteristic symptom is ventricular hypertrophy. CHF is a common end result of many different heart diseases.
“Myocardial infarction” is commonly referred to as the result of atherosclerosis of the coronary arteries, often accompanied by multiple coronary thrombosis. It is an intramural infarction with myocardial necrosis across the entire thickness of the ventricular wall, and necrosis is in the subendothelium, myocardial wall, or both, without extending all the way through the ventricular wall to the epicardium It can be divided into two types of accessory endocardial (non-mural) infarctions. Myocardial infarction is known to be caused by both changes in hemodynamic effects and structural changes in damaged and healthy areas of the heart. Thus, for example, due to myocardial infarction, the maximum outflow volume of the heart and the heart beating volume are reduced. Also, in connection with myocardial infarction, DNA synthesis occurring in the gap is stimulated, increasing collagen formation in unaffected heart regions.
In long-term hypertension, increased cardiac stress and pressure results in increased total peripheral tolerance, for example, and cardiac hypertrophy becomes associated with long-term “hypertension”. A characteristic of the ventricle that is enlarged as a result of chronic pressure is impaired diastole. Fouad et al., J. Am. Coll. Cardiol., 4: 1500-1506 (1984); Smith et al., J. Am. Coll. Cardiol., 5: 869-874 (1985). In the relaxation of the left ventricle over a long period of time, essential hypertension was detected early regardless of whether the systolic function was normal or abnormal. Hartford et al., Hypertension, 6: 329-338 (1984). However, there is no close parallel relationship between blood pressure level and cardiac hypertrophy. In humans, improvement in left ventricular function is repeated in response to antihypertensive treatment, but patients treated with diuretics (hydrochlorothiazide), beta-blockers (propranolol), or calcium channel blockers (diltiazem) There is a reversion to left ventricular hypertrophy without improvement. Inouye et al., Am. J. Cardiol., 53: 1583-7 (1984).

  Another complex heart disease associated with cardiac hypertrophy is “hypertrophic cardiomyopathy”. The pathology is very diverse in morphological, functional and clinical characteristics (Maron et al., N. Engl. J. Med., 316: 780-789 (1987); Spirito et al., N. Engl. J Med., 320: 749-755 (1989); Louie and Edwards, Prog. Cardiovasc. Dis., 36: 275-308 (1994); Wigle et al., Circulation, 92: 1680-1692 (1995)), all ages Characterized by the heterogeneity highlighted by the fact that bothers patients. Spirito et al., N. Engl. J. Med., 336: 775-785 (1997). In addition, the factors that cause hypertrophic cardiomyopathy are diverse and are hardly understood. In general, mutations in genes encoding sarcomeric proteins are involved in hypertrophic cardiomyopathy. Recent data suggests that β-myosin heavy chain mutations are measured to account for about 30 to 40 percent of the causes of familial hypertrophic cardiomyopathy. Watkins et al., N. Engl. J. Med., 326: 1108-1114 (1992); Schwartz et al., Circulation, 91: 532-540 (1995); Marian and Roberts, Circulation, 92: 1336-1347 (1995); Thierfelder et al., Cell, 77: 701-712 (1994); Watkins et al., Nat. Gen., 11: 434-437 (1995). In addition to β-myosin heavy chain, genetic mutations at other positions include cardiac troponin T, alpha topomyosin, cardiac myosin binding protein C, essential myosin light chain, and regulatory myosin light chain. See Malik and Watkins, Curr. Opin. Cardiol., 12: 295-302 (1997).

The superior valve “aortic stenosis” is an inherited vascular disease characterized by a narrowing of the ascending aorta, but other arteries including the pulmonary arteries may be further affected. In untreated aortic stenosis, intracardiac pressure increases, resulting in cardiac hypertrophy, which actually leads to heart failure and death. Although the etiology of this disease is not well understood, the possibility of hyperplasia of intermediate smooth muscle and hypertrophy are prominent features of the disease. It has been reported in US Pat. No. 5,650,282 published July 22, 1997 that molecular variants of the elastin gene are involved in the pathogenesis of the development of aortic stenosis.
“Heart valve regurgitation” occurs as a result of heart disease as a result of heart valve disease. Various illnesses such as rheumatic fever cause contraction or pulling of the valve orifice, while other illnesses include endocarditis, inflammation of the membrane inside the endocardium or atrial orifice, and cardiac surgery become. Defects such as valve stenosis or close proximity of the valve result in accumulation of blood in the heart chamber or backflow of blood through the valve. Failure to heal valve stenosis or failure for a long period of time results in cardiac hypertrophy and damage associated with the myocardium, eventually requiring valve replacement.

The term “immune related disease” refers to a disease in which a component of the mammalian immune system causes, mediates or otherwise contributes to the morbidity of the mammal. Also encompassed are diseases in which stimulation or intervention of the immune response has a ameliorative effect on disease progression. The term includes immune-mediated inflammatory diseases, non-immune-mediated inflammatory diseases, infectious diseases, immunodeficiency diseases, tumorigenesis and the like.
The term “T cell mediated” disease means a disease in which T cells directly or indirectly mediate or otherwise contribute to morbidity in mammals. T cell mediated diseases are also associated with cell mediated effects, such as m lymphokine mediated effects, and effects associated with B cells if, for example, the B cells are stimulated by lymphokines secreted by T cells.
Examples of diseases that are immune related and inflammatory diseases, some of which are T cell mediated are systemic lupus erythematosus, rheumatoid arthritis, juvenile chronic arthritis, myeloarthritis, systemic sclerosis (scleroderma) ), Idiopathic inflammatory myopathy (dermatomyositis, polymyositis), Sjogren's syndrome, systemic vasculitis, sarcoidosis, autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria), self Immune thrombocytopenia (idiopathic thrombocytopenic purpura, immune-mediated thrombocytopenia), thyroiditis (Graves' disease, Hashimoto's thyroiditis, juvenile lymphocytic thyroiditis, atrophic thyroiditis), diabetes mellitus, immune-mediated kidney Among diseases (glomerulonephritis, tubulointerstitial nephritis), multiple sclerosis, idiopathic demyelinating polyneuropathy or Giant-Barre syndrome and chronic inflammatory demyelinating polyneuropathy And demyelinating diseases of the peripheral nervous system, infectious hepatitis (A, B, C, D, E and other non-hepatotropic viruses), autoimmune chronic active hepatitis, primary biliary cirrhosis, granulomatous hepatitis , And hepatobiliary diseases such as sclerosing cholangitis, inflammatory bowel disease (ulcerative colitis: Crohn's disease), gluten-sensitive enteritis, and Whipple's disease, bullous skin disease, erythema multiforme and contact dermatitis Immune or immune-mediated skin diseases, psoriasis, asthma, allergic rhinitis, atopic dermatitis, food hypersensitivity and urticaria etc., eosinophilic pneumonia, idiopathic pulmonary fibrosis and hypersensitivity pneumonia, etc. Immunity diseases of the lung, or transplantation related diseases including transplant rejection and graft versus host disease. Infectious diseases include AIDS (HIV infection), hepatitis A, B, C, D and E, bacterial infection, fungal infection, protozoal infection and parasitic infection.

  The term “autoimmune disease” as used herein refers to a disease or disorder that occurs in an individual's own tissue and occurs in the individual's own tissue, or a simultaneous separation, sign, or resulting symptom thereof. Examples of autoimmune diseases or disorders include, but are not limited to, arthritis (rheumatoid arthritis, juvenile rheumatoid arthritis, osteoarthritis, psoriatic arthritis and ankylosing spondylitis), skin including psoriasis, atopic dermatitis Chronic idiopathic urticaria, such as chronic autoimmune urticaria, polymyositis / dermatomyositis, epidermal necrosis of addictive epidermis, systemic sclerosis and sclerosis, inflammatory bowel disease (IBD) (Crohn's disease, ulcers) EBD, erythema nodosum, primary sclerosing cholangitis, and / or superior scleritis), adult respiratory distress syndrome (ARDS) Respiratory distress syndrome, including meningitis, IgE-mediated diseases such as anaphylaxis and allergic rhinitis, encephalitis such as Rasmussen encephalitis, uveitis, colitis, such as microscopic colitis and collagenous colitis, membranous GN Any glomerulonephritis (GN), idiopathic membranous GN, membranous proliferative GN (MPGN) including type I and II and rapidly progressive GN, allergic symptoms, eczema, asthma, T cell infiltration are involved Symptoms and chronic inflammatory reaction, atherosclerosis, autoimmune myocarditis, leukocyte adhesion failure, systemic lupus erythematosus (SLE) like cutaneous SLE, lupus (nephritis, encephalitis, pediatrics, non-kidney, discoid, alopecia Immune responses associated with early and late hypersensitivity mediated by cytokines and T lymphocytes, multiple sclerosis (MS), including juvenile diabetes, spinal vision MS, allergic encephalomyelitis, Tuberculosis, sarcoidosis, granulomatosis, including Wegener's granulomatosis, agranulocytosis, vasculitis (including aortic ductitis (including polymyalgia rheumatica and giant cell arteritis), Vasculitis (including Kawasaki disease and polyarteritis nodosa), CNS vasculitis, and vasculitis-related ANCA such as Churg Strauss vasculitis or syndrome (CSS)), aplastic anemia, Coombs positive Anemia, Diamond Blackfan anemia, Immunohemolytic anemia, including autoimmune hemolytic anemia (AIHA), pernicious anemia, pure erythropoiesis (erythroblastoma), factor VIII deficiency, hemophilia Disease A, autoimmune neutropenia, pancytopenia, leukopenia, disease involving leukocyte extravasation, CNS inflammatory disorder, multiple organ injury syndrome, myasthenia gravis, antigen-antibody complex Mediated diseases, antiglomerular basement membrane disease, antiphospholipid antibody syndrome, allergic neuritis, Behcet's disease, Castleman syndrome, Goodpasture syndrome, Lambert Eaton myasthenia syndrome, Inoh's syndrome, Sjogren's syndrome, Stevens-Johnson syndrome, solid organ transplant rejection (high test plate reactivity antibody titer, tissue IgA precipitate and kidney transplant, liver transplant, bowel transplant, heart transplant rejection Including pretreatment for, etc.), graft-versus-host disease (GVHD), pemphigoid blisters, pemphigus (including vulgaris, deciduous and pemphigus mucocele pemphigoid), autoimmune multiglandular endocrine Disorder, Reiter syndrome, stiff man syndrome, immune complex nephritis, IgM polyneuritis or IgM-mediated neuropathy, idiopathic thrombocytopenic purpura (ITP), thrombotic thrombocytopenic purpura (TTP), autoimmunity Thrombocytopenia, including thrombocytopenia (eg, manifested in patients with myocardial infarction), testicular and ovarian autoimmune diseases including autoimmune testitis and ovitis, primary hypothyroidism; Autoimmune endocrine diseases, including thyroiditis, chronic thyroiditis (Hashimoto's thyroiditis), subacute thyroiditis, idiopathic hypothyroidism, Addison's disease, hyperthyroidism, autoimmune polyglandular syndrome (or Multiglandular endocrine disorder syndrome), type I diabetes, also called insulin-dependent diabetes mellitus (IDDM), including pediatric IDDM, and Sheehan syndrome; autoimmune hepatitis, lymphoid interstitial pneumonia (HIV), obstructive bronchiole Inflammation (non-transplant) vs NSIP, Guillain-Barre syndrome, Berger's disease (IgA nephropathy), primary biliary atrophy, steatosis (gluten bowel disease), resistant sprue with simultaneous isolated herpes zosteritis, cryoglobulinemia, Amyl trophic lateral sclerosis (ALS; amyotrophic lateral sclerosis), coronary artery disease, autoimmune inner ear disease (AIED), autoimmune hearing loss, ocular clonus muscle Direct Syndrome (OMS), polychondritis such as resistant polychondritis, alveolar proteinosis, amyloidosis, giant cell hepatitis, scleritis, unknown / unknown serious monoclonal immunoglobulin (MGUS) ), Peripheral neuropathy, paraneoplastic syndrome, channel disease such as epilepsy, migraine, irregularities, muscle disease, hearing loss, blindness, periodic paralysis and CNS channel disease; autism, inflammatory muscle disease and focal segment Glomerular sclerosis (FSGS) is included.

The term “anxiety related disorders” refers to disorders of anxiety, mood and substance abuse, including but not limited to: drowsiness, generalized anxiety disorder, attention deficit disorder, sleep disorder, overactivity Disability, obsessive-compulsive disorder, schizophrenia, cognitive impairment, hyperalgesia and sensory impairment. Such disorders include mild to moderate anxiety, general anxiety disorder, unspecified anxiety disorder, generalized anxiety disorder, panic attacks, panic disorder with agoraphobia, panic without agoraphobia Disability, post-traumatic stress syndrome, social phobia, social anxiety, autism, specific phobia, substance-induced anxiety disorder, acute alcohol withdrawal, obsessive compulsive disorder, agoraphobia, unipolar disorder Bipolar disorder I or II (unspecified bipolar disorder, mood circulatory disorder, depressive disorder, major depressive disorder, mood disorder, substance-induced mood disorder, enhanced cognitive function, but not limited to Alzheimer's disease Loss of cognitive function associated with cerebral infarction or trauma to the brain, seizures resulting from diseases or injuries including but not limited to epilepsy, learning disabilities / disability, cerebral palsy, and anxiety disorders It may be applied to personality disorders, including but not limited to the following types: paranoia, social dislike, avoidance behavior, borderline personality disorder, addiction, narcotics, self-love, obsessive compulsive disorder, schizophrenia And schizophrenic personality.
The term “lipid metabolic disorder” refers to abnormal clinical chemistry levels of cholesterol and triglycerides, where high levels of these lipids are an indication of atherosclerosis. In addition, abnormal serum lipid levels can be a sign of various cardiovascular diseases including hypertension, stroke, coronary artery disease, diabetes and / or obesity.

  The term “eye abnormalities” refers to potential disorders of the eye such that they can be associated with atherosclerosis or various ophthalmic abnormalities. Such disorders include, but are not limited to: retinal dysplasia, various retinopathy, restenosis, retinal artery occlusion or occlusion; retina resulting in secondary atrophy of the retinal vasculature Degeneration, retinitis pigmentosa, macular atrophy, Stargardt disease, congenital static night blindness, congenital choroidal deficiency, brain atrophy, Leber's congenital cataract, retinal sequestration, Wagner syndrome, Usher syndrome, Zellweger syndrome, Sardino-Mainser Syndrome, Senior Loken Syndrome, Bardee-Bedl Syndrome, Alport Syndrome, Alstrem Syndrome, Cocaine Syndrome, Congenital Spondylodysplasia, Flynn Eyde Syndrome, Friedreich Ataxia, Hullgren Syndrome, Marshall Syndrome, Albers Schonberg Disease, Lefsum disease, Keynes-Saire syndrome, whirl Nburg syndrome, Alagille syndrome, myotonic dystrophy, Olive bridge cerebellar atrophy, Pierre-Marie syndrome, Stickler syndrome, carotinemeia, cystine accumulation disease, Wolfram syndrome, Bassen-Kornzweig syndrome, β-free lipo Includes proteinemia, dyschromia, Batten's disease, mucopolysaccharidosis, homocystinuria, or mannosidosis. Cataracts are also considered eye abnormalities and are associated with systemic diseases such as: human Down syndrome, Hallerman-Streff syndrome, Rho syndrome, galactosemia, Marfan syndrome, trisomy 13-15 disease, Alport syndrome , Myotonic dystrophy, Fabry disease, hypoparathyroidism or Conradi syndrome. Other developmental abnormalities of the eye include an iris, anterior segment, and dysplastic syndrome. Cataracts can also occur as a result of intraocular infection or inflammation (uveitis).

  Anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO1003, anti-PRO1003, anti-PRO1003 , Anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10282, anti-PRO67179 or anti-PRO6779 PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO2 8, PRO 287, PRO 328, PRO 344, PRO 357, PRO 526, PRO 724, PRO 731, PRO 732, PRO 1003, PRO 1104, PRO 1151, PRO 1244, PRO 1298, PRO 1313, PRO 1570, PRO 1886, PRO 1891, PRO 10409, PRO 10291, PRO PRO61709 or PRO779 polypeptide, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1400 RO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779, RO2, PRO2 PR2 , PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, A “growth inhibitory amount” of a PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 binding organic molecule is an amount capable of inhibiting the growth of cells, particularly tumors, eg, cancer cells, in vitro or in vivo. Anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724 for the purpose of inhibiting neoplastic cell growth Anti-PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5997, anti-PRO10425, anti-PRO10225 , Anti-PRO10282, anti-PRO61709 or anti-PRO779 antibody, PRO196, PRO217, PRO231, PRO236, P O245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, RO1586, PRO1586, RO1 PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732 PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709, PRO2679, RO2 PR , PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891 The “growth inhibitory amount” of an organic molecule, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709, or PRO779 can be determined empirically and routinely.

  Anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO1003, anti-PRO1003, anti-PRO1003 , Anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10282, anti-PRO67179 or anti-PRO6779 PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO2 8, PRO 287, PRO 328, PRO 344, PRO 357, PRO 526, PRO 724, PRO 731, PRO 732, PRO 1003, PRO 1104, PRO 1151, PRO 1244, PRO 1298, PRO 1313, PRO 1570, PRO 1886, PRO 1891, PRO 10409, PRO 10291, PRO PRO61709 or PRO779 polypeptide, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1400 RO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779, RO2, PRO2 PR2 , PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, A “cytotoxic amount” of a PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 binding organic molecule is an amount capable of destroying cells, particularly tumors, eg, cancer cells, in vitro or in vivo. Anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724 for the purpose of inhibiting neoplastic cell growth Anti-PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5997, anti-PRO10425, anti-PRO10225 , Anti-PRO10282, anti-PRO61709 or anti-PRO779 antibody, PRO196, PRO217, PRO231, PRO236, P O245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, RO1586, PRO1586, RO1 PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732 PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709, PRO2679, RO2 PR , PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891 The “cytotoxic amount” of a PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 binding organic molecule can be determined empirically and routinely.

  The term “antibody” is used in the broadest sense and includes, for example, a single anti-PRO227, anti-PRO233, anti-PRO217, anti-PRO1328, anti-PRO4342, anti-PRO7423, anti-PRO10096, anti-PRO21384, anti-PRO353 or anti-PRO185 monoclonal antibody ( (Including agonists, antagonists, and neutralizing antibodies), anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344 with polyepitopic specificity , Anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO129 8, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10282, anti-PRO61709 or anti-PRO779 antibody composition, polyclonal antibody, single chain Anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO1003, anti-PRO1003, anti-PRO1003 , Anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti RO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10282, anti-PRO61709 or anti-PRO779 antibody, and anti-PRO196, anti-PRO217 as long as they exhibit the desired biological or immunological activity , Anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151 PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5 25 encompasses anti PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10282, anti-PRO61709 or anti PRO779 antibody fragments (see below). The term “immunoglobulin” (Ig) is used interchangeably with antibody herein.

  “Isolated antibody” means one that has been identified and separated and / or recovered from a component of its natural environment. Contaminant components of the natural environment are substances that interfere with the use of antibodies for diagnosis or therapy, and include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes. In a preferred embodiment, the antibody is (1) up to 95% or more, most preferably 99% or more by weight of the antibody as determined by the Lowry method, and (2) by using a spinning cup sequenator, Uniformity by SDS-PAGE under reducing or non-reducing conditions using at least 15 N-terminal or internal amino acid sequence residues or (3) Coomassie blue or preferably silver staining Until purified. Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step.

The basic 4-chain antibody unit is a heterotetrameric glycoprotein composed of two identical light (L) chains and two identical heavy (H) chains. It consists of five additional polypeptides, termed a tetrameric unit and its associated J chain, and thus has 10 antigen binding sites, but the secreted IgA antibody polymerizes into a basic 4-chain A multivalent assembly comprising 2-5 of the unit and its associated J chain can be formed). In the case of IgG, the 4-chain unit is generally about 150,000 daltons. Each L chain is linked to the H chain by one covalent disulfide bond, but the two H chains are linked to each other by one or more disulfide bonds depending on the H chain isotype. Each heavy and light chain also has regularly spaced intrachain disulfide bonds. Each H chain has three constant domains for each of the α and γ chains (C _H) is, N-terminal four of the C _H domains followed by a variable domain (V _H) with respect to μ and ε isotypes Have. Each L chain has at the N-terminus a variable domain (V _L ) followed by a constant domain (C _L ) at the other end. V _L is aligned with V _H and C _L is aligned with the first constant domain (C _H 1) of the heavy chain. Certain amino acid residues are thought to form an interface between the light and heavy chain variable domains. _VL and _VH are paired together to form a single antigen binding site. The structure and properties of different classes of antibodies are described, for example, in Basic and Clinical Immunology, 8th edition, Daniel P. Stites, Abba I. Terr and Tristram G. Parslow (eds.), Appleton & Lange, Norwalk, CT, 1994, page 71 and See Chapter 6.

The light chain from any vertebrate species can be assigned one of two distinct types, called kappa and lambda, based on the amino acid sequence of its constant domain. Different classes or isotypes can be assigned to immunoglobulins depending on the amino acid sequence of the heavy chain constant domain (C _H ). There are five major classes of immunoglobulins, IgA, IgD, IgE, IgG and IgM, with heavy chains called α, δ, ε, γ and μ, respectively. Class addition γ and α are divided into subclasses on the basis of relatively minor differences in _{C H} sequence and function, e.g., the following subclasses in humans: IgG1, IgG2, IgG3, IgG4 , IgA1 and IgA2 are expressed .
The term “variable” means that a portion of the variable domain varies widely in sequence between antibodies. The V domain mediates antigen binding and defines the specificity of a particular antibody for that particular antigen. However, variability is not evenly distributed throughout the 110-amino acid span of variable domains. Instead, the V region is a 15-30 amino acid framework region (FR) separated by shorter regions with extreme variability, referred to as “hypervariable regions”, each 9-12 amino acids long. It consists of a relatively unchanging extension called. Each of the natural heavy and light chain variable domains has a large β-sheet configuration and includes four FR regions connected by three hypervariable regions, which form a loop-like connection and a β-sheet structure It may form part of. The hypervariable region of each chain is held in the immediate vicinity together with the hypervariable regions from other chains by FR, and contributes to the formation of the antigen binding site of the antibody (Kabat et al., Sequences of Proteins of Immunological Interest, 5th ED. Public Health Service, National Institutes of Health, Bethesda, MD. (1991)). The constant domains are not directly related to the binding of the antibody to the antigen, but show the contribution of the antibody in various effector functions, such as antibody-dependent cellular cytotoxicity (ADCC).

As used herein, the term “hypervariable region” refers to the amino acid residues of an antibody that are responsible for antigen binding. Hypervariable regions are amino acid residues from the “complementarity determining region” or “CDR” (ie, in _VL , approximately residues 24-34 (L1), 50-56 (L2) and 89-97 (L3 ) And _VH , approximately 1-35 (H1), 50-65 (H2) and 95-102 (H3); Kabat et al., Sequences of Proteins of Immunological Interest, 5th edition Public Health Service, National Institutes of Health , Bethesda, MD. (1991)) and / or residues from “hypervariable loops” (eg, in _VL , residues 26-32 (L1), 50-52 (L2) and 91-96 ( L3), and in the _{V H,} approximately 26-32 (H1), 53-55 (H2) and 96-101 (H3); Chothia and Lesk J.Mol.Biol 196:. 901-917 (1987)) Comprising.

  The term “monoclonal antibody” as used herein refers to an antibody that is obtained from a substantially homogeneous population of antibodies, ie, the natural occurrence of individual antibodies that may be present in small amounts. Identical except for certain mutations. Monoclonal antibodies are highly specific and are directed against a single antigenic site. Furthermore, each monoclonal antibody is directed against a single determinant on the antigen as compared to polyclonal antibody preparations comprising different antibodies directed against different determinants (epitopes). In addition to its specificity, monoclonal antibodies are advantageous in that they are synthesized uncontaminated by other antibodies. The modifier “monoclonal” does not imply that antibodies must be produced in any particular manner. For example, monoclonal antibodies useful in the present invention can be made by the hybridoma method first described by Kohler et al., Nature 256, 495 (1975), or by recombinant DNA methods to produce bacteria, eukaryotic animals or plants. Can be made from cells (see, eg, US Pat. No. 4,816,567). A “monoclonal antibody” is a phage antibody live using the techniques described in, for example, Clackson et al., Nature 352: 624-628 (1991), and Marks et al., J. Mol. Biol. 222: 581-597 (1991). It can also be isolated from a rally.

Here, a monoclonal antibody has a heavy chain and / or a part of a light chain that are identical or homologous to corresponding sequences of an antibody derived from a specific species or an antibody belonging to a specific antibody class or subclass. A "chimeric" antibody in which the remaining part of the chain is identical or homologous to an antibody from another species, or the corresponding sequence of an antibody belonging to another antibody class or subclass, as well as the desired biological activity Specifically include fragments of such antibodies (US Pat. No. 4,816,567; and Morrison et al., Proc. Natl. Acad. Sci. USA, 81: 6851-6855 (1984)). Here, the subject chimeric antibodies include “primatized” antibodies comprising variable domain antigen-binding sequences derived from non-human primates (eg, Old World monkeys, apes, etc.) and human constant region sequences.
An “intact” antibody is one that includes an antigen-binding site and C _L and at least a heavy chain constant domain, C _H 1, C _H 2 and C _H 3. The constant domain may be a native sequence constant domain (eg, a human native sequence constant domain) or an amino acid sequence variant thereof. Preferably, the intact antibody has one or more effector functions.

“Antibody fragments” comprise a portion of an intact antibody, preferably the antigen binding or variable region of the intact antibody. Examples of antibody fragments include Fab, Fab ′, F (ab ′) ₂ , and Fv fragments; diabodies; linear antibodies (US Pat. No. 5,641,870, Example 2; Zapata et al., Protein Eng. 8 (10): 1057-1062 [1995]); single chain antibody molecules; and multispecific antibodies formed from antibody fragments.
Papain digestion of antibodies produces two identical antibody-binding fragments, called “Fab” fragments, and a residual “Fc” fragment named reflecting its ability to readily crystallize. The Fab fragment consists of a full length L chain and H chain variable region domain (V _H ) and one heavy chain first constant domain (C _H 1). Each Fab fragment is monovalent with respect to antigen binding, ie has a single antigen-binding site. Pepsin treatment of the antibody yields a single large F (ab ′) ₂ fragment that roughly corresponds to two disulfide-linked Fab fragments with a bivalent antigen binding site and can cross-link antigen. It can be done. Fab ′ fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the C _H 1 domain including one or more cysteines from the antibody hinge region. Fab′-SH here represents Fab ′ in which the cysteine residue (s) of the constant domain has a free thiol group. F (ab ′) ₂ antibody fragments are usually produced as pairs of Fab ′ fragments, with a hinge cysteine between them. Other chemical couplings of antibody fragments are also known.

The Fc fragment contains the carboxy-terminal sites of both heavy chains held together by disulfides. The effector function of an antibody is determined by the sequence of the Fc region, which is the site recognized by the Fc receptor (FcR) found in certain types of cells.
“Fv” is the minimum antibody fragment which contains a complete antigen-recognition and -binding site. This fragment consists of a dimer of one heavy chain and one light chain variable region in tight, non-covalent association. The folding of these two domains results in six hypervariable loops (three from the H and L chains, respectively) that contribute to amino acid residues for antigen binding and confer antigen binding specificity to the antibody. However, even a single variable domain (or half of an Fv comprising only three CDRs specific for the antigen) has a lower affinity than the entire binding site, but has the ability to recognize and bind to the antigen. .

“Single-chain Fv”, also abbreviated as “sFv” or “scFv”, is an antibody fragment comprising V _H and V _L antibody domains bound within a single polypeptide chain. Preferably, the sFv polypeptide further comprises a polypeptide linker between the _VH and _VL domains that allows the sFV to form the desired structure for antigen binding. For a review of sFv, see Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore, Springer-Verlag, New York, pp. 269-315 (1994); Borrebaeck 1995, below.
The term “diabodies” refers to V _H so that the V domains are paired within the chain rather than between the chains, resulting in a bivalent fragment, ie a fragment having two antigen-binding sites. Means a small antibody fragment prepared by constructing an sFv fragment (see previous paragraph) with a short linker (approximately 5-10 residues) between the _VL domain and the _VL domain. A bispecific diabody is a heterodimer of two “crossover” sFv fragments, in which the V _H and V _L domains of the two antibodies reside on different polypeptide chains. Diabodies are well described, for example, in European Patent No. 404097; WO 93/11161; and Hollinger et al., Proc. Natl. Acad. Sci. USA, 90: 6444-6448 (1993).

  “Humanized” forms of non-human (eg, rodent) antibodies are chimeric antibodies that contain minimal sequence derived from the non-human antibody. For the most part, humanized antibodies are non-human species in which the recipient's hypervariable region residues have the desired antibody specificity, affinity and ability, such as mouse, rat, rabbit or non-human primate ( It is a human immunoglobulin (recipient antibody) substituted by residues in the hypervariable region of the donor antibody. In some cases, framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized antibodies may comprise residues that are found neither in the recipient antibody nor in the donor antibody. These modifications are made to further refine antibody properties. Generally, a humanized antibody has at least one, typically all or almost all hypervariable loops match that of a non-human immunoglobulin and all or almost all FRs are human immunoglobulin sequences. Contains substantially all of the two variable domains. A humanized antibody optionally comprises at least part of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. For further details, see Jones et al., Nature 321, 522-525 (1986); Riechmann et al., Nature 332, 323-329 (1988); and Presta, Curr. Op. Struct. Biol. 2, 593-596 (1992). See

A “species-dependent antibody”, eg, a mammalian anti-human IgE antibody, is derived from the first mammalian species rather than the binding affinity it has for a homologue of an antigen from a second mammalian species. An antibody having a stronger binding affinity for an antigen. Typically, species-dependent antibodies are human antigens (ie, having a binding affinity (Kd) value of about 1 × 10 ⁻⁷ M or less, preferably about 1 × 10 ⁻⁸ or less, most preferably about 1 × 10 ⁻⁹ M or less) and “ Homologue of an antigen from a second non-human mammalian species that "specifically binds" but is at least about 50-fold, or at least about 500-fold, or at least about 1000-fold weaker than its binding affinity for a human antigen Have binding affinity for. The species-dependent antibody can be any of the various types of antibodies defined above, but is preferably a humanized or human antibody.

  "PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO11513, PRO1398 , PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 binding oligopeptides "described herein are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328. PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO5910, RO597 An oligopeptide that specifically binds is preferable. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 binding oligopeptides can be chemically synthesized using known oligopeptide synthesis methodologies or can be prepared and purified using recombinant techniques. it can. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 binding oligopeptides are usually at least about 5 amino acids in length, or at least about 6, 7, 8, 9, 10, 11, 12, 13, 14 , 15, 16, 17, 18, 19, 20, 21 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 amino acids in length, and such oligopeptides are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO as described herein. 28, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO59725, PRO9725, PRO9725, PRO9725 It is preferably capable of binding specifically to the peptide. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 binding oligopeptides can be identified without undue experimentation using well-known techniques. In this regard, it is noted that techniques for searching oligopeptide libraries of oligopeptides capable of specifically binding to a polypeptide target are well known in the art (eg, US Pat. No. 5,556,762, ibid. No. 5,750,373, No. 4,708,871, No. 48,33092, No. 5,223,409, No. 5,403,484, No. 5,571,689, No. 5,663,143; PCT Publication Nos. WO 84/03506, and WO 84/03564; Geysen et al. Natl. Acad. Sci. USA, 81: 3998-4002 (1984); Geysen et al., Proc. Natl. Acad. Sci. USA, 82: 178-182 (1985); Geysen et al., In Synthetic Peptides as Antigens , 130-149 (1986); Geysen et al., J. Immunol. Meth., 102: 259-274 (1987); Schoofs et al., J. Immunol., 140: 611-616 (1988), Cwirla, SE et al. (1990). Proc. Natl. Acad. Sci. USA, 87: 6378; Lowman, HB et al. (1991) Biochemistry, 30 Clackson, T. et al. (1991) Nature, 352: 624; Marks, JD et al. (1991) J. Mol. Biol., 222: 581; Kang, AS et al. (1991) Proc. Natl. Acad. Sci. USA, 88: 8363, and Smith, GP (1991) Current Opin. Biotechnol., 2: 668).

  "PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO11513, PRO1398 , PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 binding organic molecule "refers to PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO3, as described herein. 8, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO59725, PRO9725, PRO9725, PRO9725 An organic molecule other than an oligopeptide or antibody as defined herein that binds, preferably specifically, to a peptide. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 binding organic molecules can be identified and chemically synthesized using known methods (see, eg, PCT Publication Nos. WO00 / 00823 and WO00 / 39585). . PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 binding organic molecules are typically less than about 2000 daltons, or less than about 1500, 750, 500, 250 or 200 daltons, PRO19 described here , PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11518, PRO1245, PRO1244, Such organic molecules, preferably capable of specifically binding to PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides, without undue experimentation using well-known techniques Can be identified. In this regard, it is noted that techniques for searching an organic molecular library of molecules capable of binding to a polypeptide target are well known in the art (eg, PCT Publication Nos. WO 00/00823 and WO 00/39585). reference).

An antibody, oligopeptide or other organic molecule that "binds" an antigen of interest, eg, a tumor-associated polypeptide antigen target, targets the cell or tissue in which the antibody, oligopeptide or other organic molecule expresses the antigen It is useful as a diagnostic and / or therapeutic agent, and binds to its antigen with sufficient affinity so that it does not significantly cross-react with other proteins. In such embodiments, the extent of binding of antibodies, oligopeptides or other organic molecules to “non-target” proteins is quantified by fluorescence activated cell sorter (FACS) analysis or radioimmunoprecipitation (RIA). Less than about 10% of the binding of an antibody, oligopeptide or other organic molecule to that particular target protein. With respect to the binding of an antibody, oligopeptide or other organic molecule to a target molecule, "specifically binds" or "specifically binds" to or against a specific polypeptide or epitope on a specific polypeptide target The term “specific” means a binding that is measured differently than a non-specific interaction. Specific binding can be measured, for example, by quantifying the binding of the molecule as compared to the binding of a control molecule, which is generally a molecule of similar structure that does not have binding activity. For example, specific binding can be quantified for competition with a control molecule similar to the target, eg, excess unlabeled target. In this case, specific binding is indicated if the binding of the labeled target to the probe is competitively inhibited by excess unlabeled target. As used herein, the term “specifically binds” or “specifically binds” to, or is “specifically bound to” a particular polypeptide or epitope on a particular polypeptide target is, for example, a target At least about 10 ⁻⁴ M, alternatively at least about 10 ⁻⁵ M, alternatively at least about 10 ⁻⁶ M, alternatively at least about 10 ⁻⁷ M, alternatively at least about 10 ⁻⁸ M, alternatively at least about 10 ⁻⁹ M, Alternatively, it may be represented by a molecule having a Kd of at least about 10 ⁻¹⁰ M, alternatively at least about 10 ⁻¹¹ M, alternatively at least about 10 ⁻¹² M, or more. In one embodiment, the term “specifically binds” refers to binding where a molecule binds to a particular polypeptide or epitope of a particular polypeptide without substantially binding to any other polypeptide or polypeptide epitope. Means.

  "PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO11513, PRO1398 , PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides that inhibit the growth of tumor cells ", oligopeptides or other organic molecules, or" growth inhibitory "antibodies, oligopeptides or others The organic molecule of is suitable PRO196, RO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1344, RO13PRO, 8613, RO13PRO It causes measurable growth inhibition of cancer cells that express or overexpress the PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide can be a transmembrane polypeptide expressed on the surface of cancer cells and is a polypeptide produced and secreted by cancer cells obtain. Preferred growth inhibitory anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO1003 , Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10282, anti-PRO10282 PRO779 antibodies, oligopeptides or other organic molecules are generally tested antibodies, oligopeptides Is a control that is a tumor cell that has not been treated with other organic molecules, more than 20%, preferably from about 20% to about 50%, and more preferably more than 50% compared to a suitable control (E.g., about 50% to about 100%) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1104 PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO101 2, PRO10282, inhibiting the growth of PRO61709 or PRO779-expressing tumor cells. Growth inhibition can be measured in cell culture at antibody concentrations from about 0.1 to 30 μg / ml or from about 0.5 nM to 200 nM, and after exposure of tumor cells to the antibody, growth inhibition can be measured in 1-10 days. confirm. Inhibition of tumor cell growth in vivo can be determined in various ways. About 1 μg / kg to about 100 mg / kg body weight of anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, Anti-PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5997, anti-PRO10425, anti-PRO10225 Administration of anti-PRO10282, anti-PRO61709 or anti-PRO779 antibody within about 5 days to 3 months after the first antibody administration. Properly when causing a reduction of about 5 to a size of a tumor or tumor cell growth in the 30 days, the antibody is growth inhibitory in vivo.

An antibody, oligopeptide or other organic molecule that “induces apoptosis” binds to annexin V, DNA fragmentation, cell contraction, endoplasmic reticulum expansion, cell fragmentation, and / or membrane vesicle formation (apoptotic body) Induced programmed cell death as determined by the The cells are usually PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1213, PRO1213, PRO1213, PRO1213 , PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide. Preferably, the cells are tumor cells such as prostate, breast, ovary, stomach, endometrium, lung, kidney, colon, bladder cells. Various methods are available to evaluate cellular events associated with apoptosis. For example, phosphatidylserine (PS) translocation can be measured by annexin binding; DNA fragmentation can be assessed by DNA laddering; cell nucleus / chromatin aggregation associated with DNA fragmentation can be any of the diploid cells Can be evaluated by increase. Preferably, in annexin binding assays, antibodies, oligopeptides or other organic molecules that induce apoptosis are about 2 to 50 times, preferably about 5 to 50 times, most preferably about 10 to 50 times that of untreated cells. The result is that it induces annexin binding.
The “effector function” of an antibody means a biological activity attributable to the Fc region (a native sequence Fc region or amino acid sequence variant Fc region) of the antibody, and varies depending on the antibody isotype. Examples of antibody effector functions include C1q binding and complement dependent cytotoxicity; Fc receptor binding; antibody dependent cell mediated cytotoxicity (ADCC); phagocytosis; cell surface receptors (eg, B cell receptors) Down-regulation; and B cell activation.

  “Antibody-dependent cell-mediated cytotoxicity” or “ADCC” binds to Fc receptors (FcRs) present on certain cytotoxic cells (eg, natural killer (NK) cells, neutrophils and macrophages). By secreted Ig is meant a cytotoxic form that allows these cytotoxic effector cells to specifically bind to antigen-carrying target cells and subsequently kill the target cells with a cytotoxin. Antibodies “comprise” cytotoxic cells, which are absolutely necessary for such killing. The primary cells that mediate ADCC, NK cells, express FcγRIII only, whereas monocytes express FcγRI, FcγRII and FcγRIII. Expression of FcR in hematopoietic cells is summarized in Table 3 on page 464 of Ravetch and Kinet, Annu. Rev. Immunol 9: 457-92 (1991). In order to assay the ADCC activity of the molecule of interest, an in vitro ADCC assay as described in US Pat. No. 5,500,362 or 5,821,337 can be performed. Effector cells useful in such assays include peripheral blood mononuclear cells (PBMC) and natural killer cells (NK cells). Alternatively or additionally, the ADCC activity of the molecule of interest can be assessed in vivo, for example in an animal model as disclosed in Clynes et al. (USA) 95: 652-656 (1998) It is.

  “Fc receptor” or “FcR” describes a receptor that binds to the Fc region of an antibody. A preferred FcR is a native sequence human FcR. Further preferred FcRs are those that bind IgG antibodies (gamma receptors), including receptors of the FcγRI, FcγRII and FcγRIII subclasses, including allelic variants of these receptors, alternatively spliced forms . FcγRIII receptors include FcγRIIA (“active receptor”) and FcγRIIB (“inhibitory receptor”), which differ primarily in their cytoplasmic domains but have similar amino acid sequences. The activated receptor FcγRIIA contains a tyrosine-dependent immunoreceptor activation motif (ITAM) in the cytoplasmic domain. The inhibitory receptor FcγRIIB contains an immunoreceptor tyrosine-based inhibition motif (ITIM) in the cytoplasmic domain (see Daeron, Annu. Rev. immunol. 15: 203-234 (1997)). ). For FcRs, see Ravetch and Kinet, Annu. Rev. Immunol. 9: 457-492 (1991); Capel et al., Immunomethods 4: 25-34 (1994); and de Haas et al., J. Lab. Clin. Med. 126 : 330-41 (1995). Other FcRs, including those identified in the future, are encompassed by the term “FcR” herein. The term also includes the neonatal receptor FcRn (Guyer et al., J. Immunol. 117: 587 (1976) Kim et al., J. Immunol. 24: 249 (1994)), which is a factor that maternal IgGs are inherited by the fetus. ) Is also included.

“Human effector cells” are leukocytes that express one or more FcRs and perform effector functions. Desirably, the cell expresses at least FcγRIII and performs ADCC effector function. Examples of human leukocytes that mediate ADCC include peripheral blood mononuclear cells (PBMC), natural killer (NK) cells, monocytes, cytotoxic T cells and neutrophils, with PBMC and NK cells being preferred. is there. Effector cells may be isolated from natural sources such as blood.
“Complement dependent cytotoxicity” or “CDC” means lysing a target in the presence of complement. Activation of the typical complement pathway is initiated by binding of the first complement of the complement system (Clq) to an antibody (of the appropriate subclass) that has bound the cognate antigen. To assess complement activation, a CDC assay can be performed as described, for example, in Gazzano-Santoro et al., J. Immunol. Methods 202: 163 (1996).

  The terms “cancer” and “cancerous” refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. More specific examples of such cancers include squamous cell carcinoma, lung cancer (including small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, and squamous carcinoma of the lung), peritoneal cancer, hepatocytes. Cancer, gastric or stomach cancer (including gastrointestinal cancer), pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, liver cancer, breast cancer, colon cancer, colorectal Cancer, endometrial or uterine cancer, salivary gland cancer, kidney or renal cancer, liver cancer, prostate cancer, spawning cancer, thyroid cancer, liver cancer and various types of head and neck cancer , As well as B-cell lymphoma (lower / follicular non-Hodgkin lymphoma (NHL); small lymphocyte (SL) NHL; intermediate / follicular NHL; intermediate diffuse NHL; higher immunoblast NHL; higher lymphoblast NHL; High grade small non-dividing cells NHL; bulky disease NHL; mantle cell lymphoma; And including Waldenstrom's macroglobulin disease); chronic lymphocytic leukemia (CLL); acute lymphoblastic leukemia (ALL); hairy cell leukemia; chronic myeloblastic leukemia; and post-transplant lymphoproliferative disease ( PTLD). Preferably, the cancer is a tumor that expresses an IGF receptor, more preferably breast cancer, lung cancer, colorectal cancer, or prostate cancer, and most preferably breast cancer or prostate cancer.

A “chemotherapeutic agent” is a chemical compound useful in the treatment of cancer. Examples of chemotherapeutic agents include alkylating agents such as thiotepa and cyclosphosphamide (CYTOXAN®); alkyl sulfonates such as busulfan, improsulfan and piperosulfan; benzodopa, carbocone Aziridines such as methredopa, meturedopa, and ureedopa; altretamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophospharamide, and trimethylolomelamine Including ethyleneimines and methylamelamines; acetogenins (especially blatatacin and bullatacinone); camptothecins (including the synthetic analogs topotecan); bryostatins; callastatins; CC-1065 ( The Including adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycin (especially cryptophycin 1 and cryptophysin 8); dolastatin; duocarmycin (synthesis) Analogs, including KW-2189 and CBI-TMI); eleutherobin; pancratistatin; sarcodictyin; spongistatin; chlorambucil, chlornaphazine, cholophos Famide (cholophosphamide), estramustine, ifosfamide, mechlorethamine, mechloretamine oxide hydrochloride, melphalan, nobenbitine (novembichin), phenesterine, prednimustine, trofosfamide, uracil mustard Nitrogen mustard of nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, ranimustine; enediyne antibiotics such as Calicheamicins, in particular calicheamicin gamma 1I and calicheamicin omega I1 (see for example Agnew Chem Intl. Ed. Engl., 33: 183-186 (1994)); dynemicins including dynemicin A (dynemicin); esperamicin; and the neocalcinostatin and related chromoproteins enediyne antibiotic luminophore, aclacinomysins, actinomycin, authramycin, azaserine Bleomycins, cactinomycin, Carabicin, carminomycin, carzinophilin, chromomycin, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, ADRIAMYCIN® doxorubicin (Including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxyxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenol Acids (mycophenolic acid), nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, stroleubicin, Antimetabolites such as putonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; methotrexate and 5-fluorouracil (5-FU); denopterin, methotrexate, pteropter Folic acid analogs such as trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiampurine, thioguanine; ancitabine, azacitidine, 6-azauridine, carmofur, Pyrimidine analogues such as cytarabine, dideoxyuridine, doxyfluridine, enocitabine, floxuridine; calusterone, dromostanolone propionate, epithiostanol, mepithiostane Androgens such as testolactone; anti-adrenal drugs such as aminoglutethimide, mitotane and trilostane; folic acid replenishers such as frolinic acid; acegraton; aldophosphamide glycoside Aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edantraxate; defofamine; demecolcine; diaziquone; elfornithine ); Ellipticinium acetate; epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidamine; maytansine and maytansinoids such as ansamitocin (ansamitocin) maytansinoid); mitoguazone mitoxantrone; mopidamol; nitracrine; pentostatin; phennamet; pirarubicin; losoxantrone; podophyllinic acid; podophyllinic acid; 2-ethylhydrazide; procarbazine; Trademark) polysaccharide complex (JHS Natural Products, Eugene, OR); razoxane; rhizoxin; schizophyllan; spirogermanium; tenuazonic acid; triaziquone; 2, 2 ', 2 "-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethane; vindesine; dacarbazine; mannomustine; mitoblonitol ; Mitoractol; pipobroman ( gacytosine; arabinoside ("Ara-C");cyclophosphamide;thiotepa; taxoids such as TAXOL® paclitaxel (Bristol-Myers Squibb Oncology, Princeton, NJ), ABRAXANE ^™ Cremophor of Paclitaxel Non-albumin engineered nanoparticle formulation (American Pharmaceutical Partners, Schaumberg, Illinois) and TAXOTERE® Doxetaxel (Rhone-Poulenc Rorer, Antony, France); Chlorambucil; GEMZAR® Gemcitabine; 6-thioguanine Mercaptopurine; methotrexate; platinum analogues such as cisplatin and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitoxanthone; vincristine; NAVELBINE® vinorelbine; novantrone; Eudatrexate; daunomycin; aminopterin; xeloda; ibandronate; ibandronate; CPT-11; topoisomerase inhibitor RFS2000; difluoromethylolnitine (DMFO); retinoids such as retinoic acid; capecitabine And pharmaceutically acceptable salts, acids or derivatives of those mentioned above.

Also included in this definition are anti-hormonal agents that act to modulate or inhibit hormone action in tumors, such as antiestrogens and selective estrogen receptor modulators (SERMs), such as tamoxifen (NOLVADEX ( Registered trademark) tamoxifen), raloxifene, droloxifene, 4-hydroxy tamoxifen, trioxifene, keoxifene, LY117018, onapristone, and FARESTON toremifene; adrenal estrogens Aromatase inhibitors that inhibit the enzyme aromatase that regulates production, such as 4 (5) -imidazole, aminoglutethimide, MEGASE® megestrol acetate, AROMASIN® exemestane, formestane, fadrozole, RIVISOR ( Registered trademark) borozole, FEMARA® letrozole and ARIMIDEX® anastrozole; and antiandrogens such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin; and troxacitabine (1,3- Dioxolane nucleoside cytosine analogs); antisense oligonucleotides, particularly those that inhibit the expression of genes in signal transduction pathways that lead to proliferation of adherent cells, such as PKC-α, Ralf and H-Ras; ribozymes such as VEGF expression inhibitors ( For example, ANZIOZYME® ribozyme) and HER2 expression inhibitors; vaccines such as gene therapy vaccines such as ALLOVECTIN® vaccine, LEUVECTIN® vaccine, and VAXID® vaccine; PROLEUKIN® rIL-2; LURTOTECAN (registered trademark) Topoi Somerase I inhibitors; ABARELIX® rGnRH; and pharmaceutically acceptable salts, acids or derivatives of the above.
The terms “cell proliferative disorder” and “proliferative disorder” refer to disorders with some degree of abnormal cell proliferation. In one aspect of the invention, the cell proliferative disorder is cancer.
“Tumor” as used herein means all tumorigenic cell growth and proliferation, whether malignant or benign, and all precancerous and cancerous cells and tissues.

  An antibody, oligopeptide or other organic molecule that “induces cell death” is one that renders viable cells nonviable. The cells are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO12845 , PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, preferably compared to normal cells of the same tissue type, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, P O258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, 943, PRO2591, PRO5991, PRO2591 A cell that overexpresses a PRO61709 or PRO779 polypeptide. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide can be a transmembrane polypeptide expressed on the surface of cancer cells and is a polypeptide produced and secreted by cancer cells obtain. Preferably, the cell is a cancer cell, eg, a breast, ovary, stomach, endometrium, salivary gland, lung, kidney, colon, thyroid, pancreas or bladder cell. In vitro cell death may be confirmed in the absence of complement and immune effector cells to distinguish cell death induced by antibody-dependent cell-mediated cytotoxicity (ADCC) or complement-dependent disorder (CDC) . Thus, an assay for cell death may be performed using heat inactivated serum (ie, without complement) and in the absence of immune effector cells. To ascertain whether antibodies, oligopeptides or other organic molecules induce cell death, by incorporation of propidium iodide (PI), trypan blue (Moore et al. Cytotechnology 17: 1-11 (1995)) or 7AAD The assessed loss of membrane integrity can be assessed in connection with untreated cells. Preferred antibodies, oligopeptides or other organic molecules that induce cell death are those that induce PI uptake in a PI uptake assay in BT474 cells.

As used herein, the term “immunoadhesin” refers to an antibody-like molecule that has conferred the binding specificity of a heterologous protein (“adhesin”) having the effector function of an immunoglobulin constant domain. Structurally, an immunoadhesin is a fusion of an amino acid sequence (ie, “heterologous”) with a desired binding specificity other than the antigen recognition and binding site of an antibody with an immunoglobulin constant domain sequence. The adhesin portion of an immunoadhesin molecule typically comprises a contiguous amino acid sequence that includes at least a receptor or ligand binding site. Immunoadhesin immunoglobulin constant domain sequences include IgG-1, IgG-2, IgG-3, or IgG-4 subtypes, including IgA (including IgA-1 and IgA-2), IgE, IgD, or IgM. It can be obtained from any immunoglobulin.
The term “label” as used herein is conjugated directly or indirectly to an antibody, oligopeptide or other organic molecule to produce a “labeled” antibody, oligopeptide or other organic molecule. Detectable compound or composition. The label may be detectable by itself (eg, a radioisotope label or a fluorescent label), or in the case of an enzyme label, it may catalyze chemical conversion of the detectable substrate compound or composition.

`` Anti-replication agent '' refers to any mechanism such as apoptosis, vasostaticity, cytosis, tumor killing, mitotic inhibition, cell cycle progression blocking, cell growth arrest, tumor binding, cell mediator action, etc. An agent in which cell replication, function, and / or growth is inhibited or prevented, or cells are destroyed. Such drugs include chemotherapeutic agents, cytotoxic agents, cytokines, growth inhibitors, or antihormonal agents, for example, antiestrogenic compounds such as tamoxifen, antiprogesterones such as onapriston (see EP616812), or flutamide. Anti-androgens such as, and aromidase inhibitors, and mala include hormones such as androgens.
The term “cytotoxic agent” as used herein refers to a substance that inhibits or prevents the function of cells and / or causes destruction of cells. The term refers to radioisotopes (eg, radioisotopes of At ²¹¹ , I ¹³¹ , I ¹²⁵ , Y ⁹⁰ , Re ¹⁸⁶ , Re ¹⁸⁸ , Sm ¹⁵³ , Bi ²¹² , P ³² and Lu), chemotherapeutic agents such as methotrexate. , Adriamycin, vinca alkaloids (vincristine, vinblastine, etoposide), doxorubicin, melphalan, mitomycin C, chlorambucil, daunorubicin or other intercalating agents, enzymes and fragments thereof such as nucleolytic enzymes, antibiotics and toxins such as It is intended to include small molecule toxins, including fragments and / or variants, or enzymatically active toxins of bacterial, filamentous fungal, plant or animal origin, and various anti-tumor or anti-cancer agents disclosed below. Other cytotoxic drugs are described below. Tumoricides cause destruction of tumor cells.

Preferred cytotoxic agents for use in certain tumor types in combination with antagonists here are:
1. Prostate cancer: androgen, docetaxel, paclitaxel, estramustine, doxorubicin, mitoxantrone, a region within the ErbB2 extracellular region (eg, any one or more residues in the region of residues 22 to 584 of ErbB2) Antibodies against ErbB2 regions such as 2C4 (WO 01/00245; hybridoma ATCC HB 12697), AVASTIN ^™ anti-vascular endothelial growth factor (VEGF), TARCEVA ^™ OSI-774 (erlotinib) (Genentech and OSI Pharmaceuticals) ) Or other epidermal growth factor receptor tyrosine kinase inhibitors (EGFR TKIs).
2. Gastric cancer: 5-fluorouracil (5FU), XELODA ^™ capecitabine, methotrexate, etoposide, cisplatin / carboplatin, paclitaxel (pacliitaxel), docetaxel, gemcitabine, doxorubicin, and CPT-11 (camptothcin CAMP, SAR in the US) (Registered trademark)).
3. Pancreatic cancer: gemcitabine, 5FU, XELODA ^™ capecitabine, CPT-11, docetaxel, paclitaxel, cisplatin, carboplatin, TARCEVA ^™ erlotinib and other EGFR TKIs.
4). Colorectal cancer: 5FU (XELODA ^™ capecitabine, CPT-11, oxaliplatin, AVASTIN ^™ anti-VEGF, TARCEVA ^™ erlotinib and other EGFR TKIs, as well as ability to initiate EGF receptor activation and to tumor ERBITUX® (formerly known as IMC-C225) human: murine-chimerized monoclonal antibody that blocks the signaling ability of
5. Renal cancer: IL-2, interferon alpha, AVASTIN ^™ anti-VEGF, MEGACE ^™ (megestrol acetate) progestin, vinblastine, TARCEVA ^™ erlotinib and other EGFR TKIs.

As used herein, a “growth inhibitor” is a cell, particularly PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1001, PRO1001, PRO1001, PRO1003 PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779-expressing cancer cells either in vitro or in vivo. Means. Therefore, the growth inhibitor is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1103, PRO1104, PRO1104, PRO1104 It significantly reduces the proportion of cells expressing PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779. Examples of growth inhibitory agents include agents that inhibit cell cycle progression (at a place other than S phase), such as agents that induce G1 arrest or M-phase arrest. Classical M-phase blockers include vincas (vincristine and vinblastine), taxanes, and topoisomerase II inhibitors such as doxorubicin, epirubicin, daunorubicin, etoposide, and bleomycin. These agents that arrest G1 also affect S-phase arrest, for example, DNA alkylating agents such as tamoxifen, prednisone, dacarbazine, mechloretamine, cisplatin, methotrexate, 5-fluorouracil, and ara-C. More information can be found in The Molecular Basis of Cancer, Mendelsohn and Israel, ed., Chapter 1, title “Cell cycle regulation, oncogene, and antineoplastic drugs”, Murakami et al. (WB Saunders: Philadelphia, 1995), especially on page 13. be able to. Taxanes (paclitaxel and docetaxel) are both anticancer agents derived from yew. Docetaxel (TAXOTERE®, Lone Pulan Roller) derived from European yew is a semi-synthetic analogue of paclitaxel (TAXOL®, Bristol-Meier Squibb). Paclitaxel and docetaxel promote microtubule assembly from tubulin dimers and stabilize microtubules by preventing depolymerization that results in inhibiting cell mitosis.
“Doxorubicin” is an anthracycline antibiotic. The full chemical name of doxorubicin is (8S-cis) -10-[(3-amino-2,3,6-trideoxy-α-L-lyxo-hexapyranosyl) oxy] -7,8,9,10-tetrahydro -6,8,11-trihydroxy-8- (hydroxyacetyl) -1-methoxy-5,12-naphthacenedione.

The term “cytokine” is a general term for proteins that are released from one cell population and act as intercellular mediators to other cells. Examples of such cytokines are lymphokines, monokines, and traditional polypeptide hormones. Cytokines include growth hormones such as human growth hormone, N-methionyl human growth hormone, and bovine growth hormone; parathyroid hormone; thyroxine; insulin; proinsulin; relaxin; prorelaxin; glycoprotein hormones such as follicle stimulating hormone ( FSH), thyroid stimulating hormone (TSH), and luteinizing hormone (LH); liver growth factor; fibroblast growth factor; prolactin; placental lactogen; tumor necrosis factor-α and -β; Mueller inhibitor; mouse gonadotropin related Inhibin; Activin; Vascular endothelial growth factor; Integrin; Thrombopoietin (TPO); Nerve growth factor such as NGF-β; Platelet growth factor; Transforming growth factors (TGFs) such as TGF-α and TGF-β; Insulin Like growth factor-I and II; erythropoietin (EPO); osteoinductive factor; interferons such as interferon-α, -β, and -γ; colony stimulating factors (CSFs), eg macrophage-CSF (M-CSF); granulocytes -Macrophage-CSF (GM-CSF); and granulocyte-CSF (G-CSF); interleukins (ILs) such as IL-1, IL-1a, IL-2, IL-3, IL-4, IL- 5, IL-6, IL-7, IL-8, IL-9, IL-11, IL-12; tumor necrosis factors such as TNF-α and TNF-β; and others including LIF and kit ligand (KL) The polypeptide factor. As used herein, the term cytokine includes proteins from natural sources or from recombinant cell culture, and biologically active equivalents of native sequence cytokines.
The term “package insert” refers to instructions that customarily include commercial packaging of therapeutic agents, including information about efficacy, use, dosage, administration, contraindications, and / or warnings regarding the use of the therapeutic agent. Point to.

The term “gene” refers to (a) a gene comprising at least one of the DNA sequences disclosed herein; (b) any DNA sequence encoding the amino acid sequence encoded by the DNA sequence disclosed herein; and / or (C) means any DNA sequence that hybridizes to the complementary strand of the coding sequence disclosed herein. Preferably, the term includes coding as well as non-coding regions, preferably including all sequences necessary for normal gene expression.
“Gene targeting” refers to a type of homologous recombination that occurs when a fragment of genomic DNA is introduced into a mammalian cell and the fragment is located with an endogenous homologous sequence and recombination occurs therewith. Gene targeting by homologous recombination uses recombinant DNA methods to replace specific genomic sequences with exogenous DNA of a specific design.
The term “homologous recombination” refers to the exchange of a DNA fragment between two DNA molecules or chromatids at the site of a homologous nucleotide sequence.
The term “target gene” (or “target gene sequence” or “target DNA sequence”) refers to any nucleic acid molecule, polynucleotide, or gene that is to be modified by homologous recombination. Target sequences include intact genes, exons or introns, regulatory genes or any region between genes. The target gene may include a specific gene or part of a locus in the individual's genomic DNA.

PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213 “Disruption” of the PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 gene occurs when a fragment of genomic DNA is located with an endogenous homologous sequence and recombination occurs therewith, where the disruption occurs. Deletion of a natural gene or part thereof, or natural inheritance A mutation in, or destruction is functional inactivation of the native gene. Alternatively, sequence disruption can be performed with a gene trap vector (ie, a non-human transgenic animal that contains and expresses a randomly inserted transgene; see, eg, US Pat. No. 6,436,707 issued Aug. 20, 2002). It can be caused by the nonspecific insertional inactivation used. These sequence disruptions or modifications can include insertions, missenses, frameshifts, deletions or substitutions, or DNA sequence replacements, or any combination thereof. Insertions include insertions of entire genes that can be derived from animals, plants, fungi, insects, prokaryotes, or viruses. Disruption can be modified, for example, by partially or completely inhibiting the production of a normal gene product or by enhancing the activity of a normal gene product. Preferably, the destruction is a null destruction, and is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1 12 There is no significant expression of the PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 genes.
The term “native expression” refers to PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, at the level of expression present in wild-type mice. , PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or the full-length polypeptide encoded by the PRO779 gene. Therefore, endogenous PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1213, PRO1213, PRO1213 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 gene "native expression" disruption is a mammalian single cell, selected cells, or all endogenous PRO196 of a cell, PRO217, PRO231, PRO236, P O245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, RO1586, PRO1586, RO1 By partial or complete reduction of the expression of at least part of the polypeptide encoded by the PRO10102, PRO10282, PRO61709 or PRO779 gene.

The term “knock-out” refers to PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1104, RO1213, PRO1213 , PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 gene, where the disruption is a functional inactivation of a natural gene; a natural gene or part thereof A deletion of or a natural gene mutation.
The term “knock-in” refers to the specific human PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, Mouse ortholog (or other) with human cDNA encoding the PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5925, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or any of its variants Means replacement of mouse gene) That results in the substitution of the native mouse gene with a native human gene disruption).
The term “construct” or “targeting construct” refers to an artificially assembled DNA segment to be transferred into a target tissue, cell line or animal. Typically, the targeting construct comprises a particular gene or nucleic acid sequence of interest, a marker gene and appropriate regulatory sequences. As provided herein, the targeting constructs are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1104 PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 targeting constructs. "PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO11513, PRO1398 , PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 targeting constructs "are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, P O344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, RO5910, RO6097 A DNA sequence partially homologous and contains PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1003, PRO1003, PRO 104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, can cause damage to the PRO10282, PRO61709 or PRO779 gene.

The term “transgenic cell” refers to PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, which has been disrupted, modified, or completely or partially replaced by gene targeting methods. , PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO10297, PRO8297 Means a cell containing.
The term “transgenic animal” refers to a particular gene within its genome that has been disrupted or otherwise modified or mutated by the methods described herein or other methods well known in the art. Means an animal. Preferably, the non-human transgenic animal is a mammal. More preferably, the mammal is a rodent such as a rat or mouse. A “transgenic animal” can also be a heterozygous animal (ie, one defective allele and one wild type allele) or a homozygous animal (ie, two defective alleles). The fetus is considered to fall within the animal definition. Animal donation includes the provision of an in utero fetus or fetus, whether by mating or by other means and whether or not the fetus will give birth.

As used herein, the term “selectable marker” refers to a gene that encodes a product that allows only cells carrying the gene to survive and / or grow under certain conditions. For example, plant and animal cells that express the introduced neomycin resistance (Neo ^r ) gene are resistant to compound G418. Cells that do not have a Neo ^r gene marker are killed by G418. Other positive selectable markers are known to or within the scope of those skilled in the art.
As used herein, the terms “modulate” or “modulation” are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO100, PRO1 PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 gene function, expression, activity, or PRO196PRO2PRO2445 , PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO18960, PRO18991 , Refers to a decrease, inhibition, reduction, improvement, increase or enhancement of the phenotype associated with the PRO61709 or PRO779 gene.

As used herein, the term “ameliorate” or “remission (improvement)” means a reduction, reduction or elimination of symptoms, diseases, disorders, or phenotypes, including abnormalities or signs.
The term “abnormal” includes pathological and behavioral observations, including PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1001, PRO732, PRO1001, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 implicated, meaning any disease, disorder, symptom or phenotype .

II. Compositions and Methods of the Invention Full-length PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO12483PRO PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide The present invention is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO283, PRO283, PRO283 RO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5910, RO5996, RO6097 Newly identified and isolated nucleotide sequences encoding the named polypeptides are provided. In particular, as described in more detail in the examples below, various PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1001, PRO1003, PRO1001, PRO1001, A cDNA encoding the PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides was identified and isolated. Note that proteins produced in separate rounds of expression are given different PRO numbers, but the UNQ numbers are unique to all given DNA and encoded proteins and do not change. However, for simplicity, the proteins encoded by the full-length natural nucleic acid molecules disclosed herein, as well as further natural homologues and variants included in the PRO definition above, are used herein for their origin or preparation. Regardless of format, it is called “PRO / number”.
Various cDNA clones have been deposited with the ATCC as disclosed in the examples below. The exact nucleotide sequence of these clones can be readily determined by sequencing the deposited clones using routine methods in the art. The predicted amino acid sequence can be determined from the nucleotide sequence using routine skill. PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 For PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides and encoding nucleic acids, Applicants consider the reading frame to be the best match to the currently available sequence information. Identified.

B. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide variants The full-length native sequences PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO described herein 328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, RO5725, PRO59725, PRO9725, PRO9725, PRO In addition to peptides, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1154 O1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 variants are also considered to be prepared. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10102, PRO61282, PRO61709 or PRO779 variants are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357 RO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO8225, PRO8225 And / or desired PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1001, PRO1104, PRO1104, PRO1104, PRO1104 51, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, can be prepared by combining the PRO10282, PRO61709 or PRO779 polypeptide. Those skilled in the art will recognize amino acid changes such as changes in the number or position of glycosylation sites or changes in membrane anchoring properties such as PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, RO1079 You will understand.

  Natural full-length sequences PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1213, PRO1213, PRO1213 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 or PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, RO258, PRO287, RO287, PRO287, RO287, PRO287 44, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5925, PRO9985, PRO9985, RO9 Mutations in the various domains can be made using any techniques and guidelines for conservative and non-conservative mutations described, for example, in US Pat. No. 5,364,934. The mutations are the native sequences PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1104, PRO11513 , PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 or PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO287, RO287, PRO287, PRO283, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, RO7497RO, PRO7425 PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151 It may be a substitution, deletion or insertion of one or more codons that encode a PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide. . In some cases, the mutation is at least one of the amino acids PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10012, PRO1104, PRO1104, , PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides with any other amino acid substitution. Guidance on which amino acid residues are inserted, substituted or deleted without adversely affecting the desired activity is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526 , PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, RO1079, High homology compared to that of known protein molecules It found by minimizing the number of amino acid sequence changes made in regions. Amino acid substitutions can be the result of substitution of one amino acid with another amino acid having similar structural and / or chemical properties, eg, substitution of leucine with serine, ie, a conservative amino acid substitution. Insertions and deletions can optionally be in the range of about 1 to 5 amino acids. Permissible mutations are determined by systematically making amino acid insertions, deletions or substitutions in the sequence and testing the activity of the resulting mutant for the full-length or mature native sequence.

PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide fragments are provided herein. Such fragments may be cleaved at the N-terminus or C-terminus, for example, or lack internal residues when compared to a full-length native protein. Some fragments are: PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1413, PRO11513, PRO11513 , PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides lack amino acid residues that are not essential for the desired biological activity.
PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 fragments can be prepared by any of a number of common techniques. Desired peptide fragments may be chemically synthesized. Alternative methods include enzymatic digestion, for example by treating the protein with an enzyme known to cleave the protein at a site defined by a particular amino acid residue, or by digesting the DNA with an appropriate restriction enzyme PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1413, PRO11513, PRO11513, PRO11513, PRO11513 , PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, RO10282, including the generation of PRO61709 or PRO779 fragments. Yet another suitable technique involves isolating and amplifying a DNA fragment encoding the desired polypeptide fragment by polymerase chain reaction (PCR). Oligonucleotides that define the desired ends of the DNA fragments are used in PCR 5 ′ and 3 ′ primers. Preferably, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1286, PRO1187 , PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide fragments are the native PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO287, PRO287, O328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, RO5725, PRO9725, PRO9725, PRO9725, PRO Share at least one biological and / or immunological activity with the peptide.
Conservative substitutions of interest are shown in Table 6 under the heading Preferred substitutions. If such a substitution results in a change in biological activity, a more substantial change is introduced, labeled as an exemplary substitution in Table 6, or as described further below with respect to amino acid classification, and the product To be screened.

PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213 A substantial modification of the function or immunological identity of a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide comprises: (a) the structure of the polypeptide backbone of the replacement region, e.g. a sheet or helical configuration; b) charge or hydrophobicity of the target site molecule, or (c) side chain While maintaining is achieved by selecting a substantially different substituents in their effects. Naturally occurring residues can be grouped based on common side chain properties:
Amino acids can be grouped according to similarities in their side chain properties (AL Lehninger, Biochemistry, 2nd edition, pp. 73-75, Worth Publishers, New York (1975)):
(1) Nonpolar: Ala (A), Val (V), Leu (L), Ile (I), Pro (P), Phe (F), Trp (W), Met (M)
(2) Uncharged polarity: Gly (G), Ser (S), Thr (T), Cys (c), Tyr (Y), Asn (N), Gln (Q)
(3) Acidity: Asp (D), Glu (E)
(4) Basicity: Lys (K), Arg (R), His (H)
Alternatively, naturally occurring residues can be separated based on common side chain properties:
(1) Hydrophobicity: norleucine, met, ala, val, leu, ile;
(2) Neutral hydrophilicity: cys, ser, thr, asn, gln;
(3) Acidity: asp, glu;
(4) Basicity: his, lys, arg;
(5) Residues affecting chain orientation: gly, pro;
(6) Aromatic: trp, tyr, phe.
Non-conservative substitutions will require exchanging one member of these classes for another. Residues so substituted can also be introduced at conservative substitution sites, preferably left (non-conserved) sites.

Mutations can be made using techniques known in the art such as oligonucleotide-mediated (site-specific) mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed mutagenesis [Carter et al., Nucl. Acids Res., 13: 4331 (1986); Zoller et al., Nucl. Acids Res., 10: 6487 (1987)], cassette mutagenesis [Wells et al., Gene, 34: 315 (1985)], restriction enzyme-directed mutagenesis [Wells et al., Philos. Trans. R. Soc. London SerA, 317: 415 (1986)] or other well-known techniques are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, RO1 PRO7425, PRO1 In order to produce 0102, PRO10282, PRO61709 or PRO779 mutant DNA, the cloned DNA can be performed.
Scanning amino acid analysis can also be used to identify one or more amino acids along adjacent sequences. Preferred scanning amino acids are relatively small and neutral amino acids. Such amino acids include alanine, glycine, serine, and cysteine. Alanine is a typically preferred scanning amino acid in this group because it eliminates side chains beyond the beta carbon and is unlikely to change the backbone structure of the mutant [Cuningham and Wells, Science, 244: 1081-1085 (1989)]. Alanine is also typically preferred because it is the most common amino acid. Moreover, it is often found in both buried and exposed positions [Creighton, The Proteins, (WH Freeman & Co., NY); Chothia, J. Mol. Biol., 150: 1 (1976)]. . If alanine substitution does not result in a sufficient amount of mutants, isoteric amino acids can be used.

C. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 Modification of PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10102, PRO61282, PRO61709 or PRO779 polypeptide PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO 357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO10225, PRO1082, RO102 Modifications are included within the scope of the present invention. One type of covalent modification is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1104, PRO1213PRO1, PRO1213 , PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, the target amino acid residues PRO196, PRO217, PRO231, PRO236, PRO246, PRO246 O287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, RO4, RO9, PRO9409, PRO5409 Reacting with an organic derivatization reagent capable of reacting with a selected side chain or N- or C-terminal residue of the PRO779 polypeptide. Derivatization with bifunctional reagents is for example PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1104 , PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides with a water-insoluble support matrix or anti-PRO196, anti-PRO217, anti-PRO231, Anti-P O246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1513 Useful for cross-linking to surfaces for use in anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10282, anti-PRO61709 or anti-PRO779 antibodies or vice versa It is. Commonly used crosslinking agents include, for example, 1,1-bis (diazoacetyl) -2-phenylethane, glutaraldehyde, N-hydroxysuccinimide ester, such as 4-azidosalicylic acid, 3,3′-dithiobis (succinimidyl) Homobifunctional imide esters including disuccinimidyl esters such as propionate), bifunctional maleimides such as bis-N-maleimide-1,8-octane, and methyl-3-[(p-azidophenyl)- Reagents such as dithio] propioimidate.

Other modifications include deamination of glutaminyl and asparaginyl residues to the corresponding glutamyl and aspartyl residues, hydroxylation of proline and lysine, phosphorylation of the hydroxyl group of seryl or threonyl residues, lysine, arginine, and histidine, respectively. Methylation of α-amino groups in side chains [TE Creighton, Proteins: Structure and Molecular Properties, WH Freeman & Co., San Francisco, pp. 79-86 (1983)], acetylation of N-terminal amines, and optional Includes amidation of the C-terminal carboxyl group.
PRO 196, PRO 217, PRO 231, PRO 236, PRO 245, PRO 246, PRO 258, PRO 287, PRO 328, PRO 344, PRO 357, PRO 526, PRO 724, PRO 731, PRO 732, PRO 10013, PRO 1 413, PRO 1213, PRO 1213 Other types of covalent modifications of the PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides include alterations in the native glycosylation pattern of the polypeptide. “Modification of native glycosylation pattern” is intended for this purpose is the native sequence PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or multiple parts of PRO7779 Loss (removal of existing glycosylation sites or chemistry And / or native sequence PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731 , PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO70092 or PRO61709 Means the addition of In addition, this clause includes qualitative changes in glycosylation of natural proteins, including changes in the nature and properties of the various carbohydrate moieties present.

PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 Addition of glycosylation sites to PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides may involve amino acid sequence alterations. This change may be, for example, a native sequence of one or more serine or threonine residues PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1003, PRO1003, PRO1003 PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, added to PRO10102, PRO10282, PRO61709 or PRO779 (O-linked glycosylation site) Also good. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 amino acid sequences, in some cases, changes at the DNA level, in particular PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO258. 87, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO9740 The DNA encoding the PRO779 polypeptide may be altered through mutation at preselected bases to generate a codon that is translated into the desired amino acid.
PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 Another means of increasing the number of carbohydrate moieties on a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide. Such methods are described in the art, for example in WO 87/05330 published September 11, 1987, and in Aplin and Wriston, CRC Crit. Rev. Biochem., Pp. 259-306 (1981). Are listed.

PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 Removal of a carbohydrate moiety present on a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide can be done either chemically or enzymatically, or by a codon encoding an amino acid residue presented as a target for glucosylation By mutational substitution of Can. Chemical deglycosylation techniques are known in the art, for example, by Hakimuddin et al., Arch. Biochem. Biophys., 259: 52 (1987), and Edge et al., Anal. Biochem., 118: 131 (1981 ). Enzymatic cleavage of the carbohydrate moiety on the polypeptide is accomplished by using various endo and exoglycosidases as described in Thotakura et al., Meth. Enzymol. 138: 350 (1987).
PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 Other types of covalent modifications of PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328. PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO5910, RO5 U.S. Pat. Nos. 4,640,835; 4,496,689; 4,670,144; 4,670,417; one of a variety of non-proteinaceous polymers such as polyethylene glycol (PEG), polypropylene glycol, or polyoxyalkylene. Or by the method described in No. 4179337 Includes bonds.
Moreover, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1213, PRO1213, RO1213, PRO1213, PRO1213 , PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides are fused to other heterologous polypeptides or amino acid sequences PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, 258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1091, PRO10291, PRO10291, PRO10291 Modifications may be made by methods that form chimeric molecules comprising PRO61709 or PRO779 polypeptides.

Such a chimeric molecule comprises a tag polypeptide that provides an epitope to which an anti-tag antibody can selectively bind and PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, and PRO61779. Epitope tags are generally PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1104, PRO1213, PRO1213, PRO1213 It is located at the amino or carboxyl terminus of a PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide. Such PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO12483PRO The presence of an epitope-tagged form of a PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide can be detected using an antibody against the tag polypeptide. Also, the provision of epitope tags can be achieved by affinity purification using anti-tag antibodies or other types of affinity matrices that bind to the epitope tag, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344. , PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO9594, PRO6097, RO102PRO102P To be purified . Various tag polypeptides and their respective antibodies are well known in the art. Examples include poly-histidine (poly-his) or poly-histidine-glycine (poly-his-gly) tag; flu HA tag polypeptide and its antibody 12CA5 [Field et al., Mol. Cell. Biol., 8: 2159 -2165 (1988)]; c-myc tag and 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto [Evan et al., Molecular and Cellular Biology, 5: 3610-3616 (1985)]; and herpes simplex virus sugars A protein D (gD) tag and its antibody [Paborsky et al., Protein Engineering, 3 (6): 547-553 (1990)]. Other tag polypeptides include flag peptides [Hopp et al., BioTechnology, 6: 1204-1210 (1988)]; KT3 epitope peptides [Martin et al., Science, 255: 192-194 (1992)]; α-tubulin epitope peptides [Skinner et al., J. Biol. Chem., 266: 15163-15166 (1991)]; and T7 gene 10 protein peptide tag [Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA, 87: 6393-6397 ( 1990)].
The chimeric molecules are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1214, PRO1215 , PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or a fusion of a PRO779 polypeptide with an immunoglobulin or a specific region of an immunoglobulin. For the bivalent form of the chimeric molecule (also referred to as “immunoadhesin”), such a fusion may be the Fc region of an IgG molecule. The Ig fusion preferably replaces at least one variable region in the Ig molecule with PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO732P , PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, non-transmembrane domain, or non-transmembrane domain Includes form. In particularly preferred embodiments, the immunoglobulin fusion comprises the hinge, CH2 and CH3, or hinge, CH1, CH2 and CH3 regions of an IgG1 molecule. See US Pat. No. 5,428,130 issued June 27, 1995 for the production of immunoglobulin fusions.

D. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 Preparation of PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide The following description is primarily directed to PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO32 8, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO59725, PRO9725, PRO9725, PRO9725 PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO 003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, relates PRO6097, PRO7425, PRO10102, PRO10282, a method of producing a PRO61709 or PRO779 polypeptide. Of course, using other methods well known in the art, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO100, PRO1 It is contemplated that PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides may be prepared. For example, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, RO1 183PRO The PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 sequences, or portions thereof, may be produced by direct peptide synthesis using solid phase technology [eg Stewart et al., Solid-Phase Peptide Synthesis, WH Freeman Co., San Francisco, CA (1969); Merrifield, J. Am. C hem. Soc., 85: 2149-2154 (1963)]. In vitro protein synthesis may be performed by manual techniques or by automation. Automated synthesis may be performed, for example, using an Applied Biosystems Peptide Synthesizer (Foster City, CA) according to the manufacturer's instructions. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 The various portions of the PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides are chemically synthesized separately and combined using chemical or enzymatic methods to form full-length PRO196, PRO217, PRO231. , PRO236, PRO245 PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1586, PRO1896, RO4 PRO10282, PRO61709 or PRO779 polypeptides may be produced.

1. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 Isolation of DNA encoding PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, P RO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO5910, RO597 The DNA to be encoded is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, RO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, prepared from tissues that are thought to be expressed at detectable levels. It can be obtained from a cDNA library. Therefore, human PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1284 , PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 DNA can be conveniently obtained from a cDNA library prepared from human tissue, as described in the Examples. Also, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1 183, PRO1 183 , PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779-encoding genes can also be obtained from genomic libraries or by known synthetic methods (eg, automated nucleic acid synthesis).
The library contains probes designed to identify the gene of interest or the protein encoded by that gene (PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724. , PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO6779 base And the like. Screening of cDNA or genomic libraries with selected probes is performed using standard procedures described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989). can do. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 Another method of isolating the gene encoding PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 uses the PCR method [Sambrook et al., Supra; Dieffenbach et al., PCR Primer: A Laboratory. Manual (Cold Spring Harbor Laboratory Press, 1995)].

The following examples describe screening techniques for cDNA libraries. The oligonucleotide sequence selected as the probe must be long enough and clear enough to minimize false positives. The oligonucleotide is preferably labeled such that it can be detected upon hybridization to DNA in the library being screened. Labeling methods are well known in the art and include the use of radiolabels such as ³² P-labeled ATP, biotinylation or enzyme labeling. Hybridization conditions including moderate stringency and high stringency are given by Sambrook et al., Supra.
Sequences identified in such library screening methods can be compared and aligned with well-known sequences deposited in public databases such as Genbank or personal sequence databases and made available to the public. Sequence identity (either at the amino acid or nucleotide level) within a determined region or over the entire length of the molecule can be determined using methods known in the art and described herein. .
Nucleic acids with protein coding sequences use the deduced amino acid sequences disclosed herein for the first time, and if necessary, Sambrook et al., Supra, which detects intermediates and precursors of mRNA that was not reverse transcribed into cDNA. Obtained by screening selected cDNA or genomic libraries using conventional primer extension methods as described.

2. Selection and transformation of host cells Host cells can be selected from PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO1003, PRO1003, PRO1003 , PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO6179, or a promoter, Induce and transform Selection or culturing in a conventional nutrient medium appropriately modified to amplify the gene encoding the desired sequence. Culture conditions, such as medium, temperature, pH, etc. can be selected by one skilled in the art without undue experimentation. In general, principles, protocols, and practical techniques for maximizing cell culture productivity can be found in Mammalian Cell Biotechnology: a Practical Approach, edited by M. Butler (IRL Press, 1991) and Sambrook et al., Supra. it can.
Prokaryotic cell transfection and eukaryotic cell transformation methods such as CaCl ₂ , CaPO ₄ , liposome-mediated and electroporation are known to those skilled in the art. Depending on the host cell used, transformation is done using standard methods appropriate to that cell. Calcium treatment or electroporation with calcium chloride described in Sambrook et al., Supra, is generally used for prokaryotes. Infection with Agrobacterium tumefaciens has been reported in certain plant cells as described in Shaw et al., Gene, 23: 315 (1983) and WO 89/058589 published 29 June 1989. Used for transformation. For mammalian cells without such cell walls, the calcium phosphate precipitation method of Graham and van der Eb, Virology, 52: 456-457 (1978) can be used. General aspects of mammalian cell host system transformations are described in US Pat. No. 4,399,216. Transformation into yeast is typically performed by Van Solingen et al., J. Bact., 130: 946 (1977) and Hsiao et al., Proc. Natl. Acad. Sci. USA, 76: 3829 (1979). Implemented according to the method. However, other methods of introducing DNA into cells, such as nuclear microinjection, electroporation, intact cells, or bacterial protoplast fusion using polycations such as polybrene, polyornithine, etc. can also be used. For various techniques for transforming mammalian cells, see Keown et al., Methods in Enzymology, 185: 527-537 (1990) and Mansour et al., Nature, 336: 348-352 (1988).

Suitable host cells for cloning or expressing the DNA in the vectors described herein are prokaryotic, yeast, or higher eukaryotic cells. Suitable prokaryotes include, but are not limited to, eubacteria such as Gram negative or Gram positive organisms such as Enterobacteriaceae such as E. coli. Various E. coli strains are available to the public, for example, E. coli K12 strain MM294 (ATCC 31,446); E. coli X1776 (ATCC 31,537); E. coli strains W3110 (ATCC 27,325) and K5772 (ATCC 53,635). Other preferred prokaryotic host cells are E. coli, such as E. coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, such as Salmonella typhimurium, Serratia, such as Serratia marcesans ( Serratia marcescans), and Shigella, and Neisseria gonorrhoeae, such as B. subtilis and B. licheniformis (e.g., Bacillicenifol as described in DD 266,710 issued April 12, 1989). Miss 41P), Pseudomonas, including Enterobacteriaceae such as Pseudomonas aeruginosa and Streptomyces. These examples are illustrative rather than limiting. Strain W3110 is one particularly preferred host or parent host because it is a common host strain for the issuance of recombinant DNA production. Preferably, the host cell secretes a minimal amount of proteolytic enzyme. For example, strain W3110 may be modified to have a genetic mutation in a gene encoding a foreign protein in the cell, examples of such hosts include E. coli W3110 strain 1A2 with the complete genotype tonA; E. coli W3110 strain 9E4 with the complete genotype tonA ptr3; E. coli W3110 strain 27C7 (ATCC 55,244) with the complete genotype tonA prt3 phoA E15 (argF-lac) 169 degP ompT kan ^r (ATCC 55,244); algF-lac) 169 degP ompT rbs7ilvGkan ^r E. coli W3110 strain 37D6; 37D6 strain E. coli W3110 strain 40B4 with non-kanamycin-resistant degP deletion mutation; and US Pat. No. 4,946,783 issued Aug. 7, 1990; E. coli strains having the mutated periplasmic protease disclosed in. Alternatively, in vitro methods of cloning such as PCR or other nucleic acid polymerase reactions are preferred.

  In addition to prokaryotes, eukaryotic microorganisms such as filamentous fungi or yeast are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO732, PRO732 , PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709, or a PRO779-encoding vector. Saccharomyces cerevisia is a commonly used lower eukaryotic host microorganism. Others include Schizosaccharomyces prombe (Beach and Nurse, Nature, 290: 140 [1981]; EP 139,383 published May 2, 1985); Kluveromyces hosts (US patent) No. 4,943,529; Fleer et al., Bio / Technology, 9: 968-975 (1991)), e.g. K. lactis (MW98-8C, CBS683, CBS4574; Louvencourt et al., J. Bacteriol. 154 (2) : 737-742 [1983]), K. fragilis (ATCC 12,424), K. bulgaricus (ATCC 16,045), K. wickeramii (ATCC 24,178), K.・ K. waltii (ATCC 56,500), K. drosophilarum (ATCC 36,906; Van den Berg et al., Bio / Technology, 8: 135 (1990)), K. themotolerans And K. marxianus; yarrowia (EP 402,226); Pichia pastoris (EP 183,070; Sheekrishna et al., J. Basic Microbiol, 28: 265-278 [1988]); Nicida; Trichodel malaysia (EP 244,234); Akapan mold (Case et al., Proc. Natl. Acad. Sci. USA, 76: 5259-5263 [1979]); Schwanniomyces, eg, Schwanniomyces Occidentalis (EP 394,538 published October 31, 1990); and filamentous fungi such as Neurospora, Penicillium, Tolypocladium (WO 91/00357 published January 10, 1991) And Koji fungi, such as pseudonogenic Koji fungi (Ballance et al., Biochem. Biophys. Res. Commun., 112: 284-289 [1983]; Tilburn et al., Gene, 26: 205-221 [1983]; Yelton et al., Proc. Natl. Acad. Sci. USA, 81: 1470-1474 [1984]) and black mold (Kelly and Hynes, EMBO J., 4: 475-479 [1985]). Preferred methylotropic yeasts here include, but are not limited to, Hansenula, Candida, Kloeckera, Pichia, Saccharomyces, Torulopsis, and Rhodotorula. Includes yeast that can grow on methanol selected from the genus. A list of specific species that are illustrative of this yeast classification is described in C. Anthony, The Biochemistry of Methylotrophs, 269 (1982).

  Glycosylated PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO12845 Suitable host cells for the expression of PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide are derived from multicellular organisms. Examples of invertebrate cells include insect cells such as Drosophila S2 and Spodospera Sf9, and plant cells. Examples of useful mammalian host cell lines include Chinese hamster ovary (CHO) and COS cells. Many specific examples are the monkey kidney CV1 strain transformed with SV40 (COS-7, ATCC CRL 1651); the human embryonic kidney strain (293 or 293 subcloned for growth in suspension culture). Cell, Graham et al., J. Gen Virol., 36:59 (1977)); Chinese hamster ovary cells / -DHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA, 77: 4216 (1980)) Mouse Sertoli cells (TM4, Mather, Biol. Reprod., 23: 243-251 (1980)); human lung cells (W138, ATCC CCL 75); human hepatocytes (Hep G2, HB 8065); and mouse breast Including tumor (MMT 060562, ATTC CCL51). The selection of an appropriate host cell is within the common general knowledge of this field.

3. Selection and use of replicable vectors PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1413, PRO1213, PRO1213, PRO1213 A nucleic acid (eg, cDNA or genomic DNA) encoding a PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide may be used for cloning (amplification of DNA) or expression. Insert into a replicable vector It is. Various vectors are publicly available. The vector can be, for example, in the form of a plasmid, cosmid, virus particle, or phage. The appropriate nucleic acid sequence is inserted into the vector by a variety of techniques. In general, DNA is inserted into an appropriate restriction endonuclease site using techniques well known in the art. Vector components generally include, but are not limited to, one or more signal sequences, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence. Standard ligation techniques known to those skilled in the art are used to generate suitable vectors containing one or more of these components.

  PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213 PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides are not only directly produced by recombinant techniques, but also contain a specific cleavage site at the signal sequence or at the N-terminus of the mature protein or polypeptide. Having other polypeptide It is also produced as a fusion peptide with a heterologous polypeptide that is a peptide. In general, the signal sequence is a component of the vector or is inserted into the vector, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003 , PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779-encoded DNA. The signal sequence may be, for example, a prokaryotic signal sequence selected from the group of alkaline phosphatase, penicillinase, lpp or a thermostable enterotoxin II leader. For yeast secretion, signal sequences include yeast invertase leaders, alpha factor leaders (including the Saccharomyces and Kluyveromyces alpha factor leaders, the latter described in US Pat. No. 5,010,182). Or an acid phosphatase leader, a C. albicans glucoamylase leader (EP362179 published 4 April 1990), or WO 90/13646 published 15 November 1990 It can be a signal. In mammalian cell expression, mammalian signal sequences may be used for direct secretion of proteins such as signal sequences from the same or related species of secreted polypeptides as well as viral secretory leaders.

Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells. Such sequences are well known for many bacteria, yeasts and viruses. The origin of replication derived from plasmid pBR322 is suitable for most gram-negative bacteria, the 2μ plasmid origin is suitable for yeast, and the various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are suckling. Useful for cloning vectors in animal cells.
Expression and cloning vectors typically contain a selection gene, also termed a selectable marker. Typical selection genes are (a) conferring resistance to antibiotics or other toxins such as ampicillin, neomycin, methotrexate or tetracycline, (b) compensate for auxotrophic defects, or (c) the genetic code for eg Basili It encodes a protein that supplies important nutrients not available from complex media, such as D-alanine racemase.
Examples of suitable selectable markers for mammalian cells are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO732, PRO732, PRO732, PRO732, PRO732, PRO732, PRO732, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or a PRO779-encoding nucleic acid that can encode a nucleic acid It can be done. Suitable host cells when using wild-type DHFR are DHFR activity prepared and expanded as described by Urlaub et al., Proc. Natl. Acad. Sci. USA, 77: 4216 (1980). It is a defective CHO cell line. A suitable selection gene for use in yeast is the trp1 gene present in the yeast plasmid YRp7 [Stinchcomb et al., Nature, 282: 39 (1979); Kingman et al., Gene, 7: 141 (1979); Tschemper et al., Gene, 10: 157 (1980)]. The trp1 gene provides a selectable marker for a mutant strain of yeast lacking the ability to grow in tryptophan, such as, for example, ATCC No. 44076 or PEP4-1 [Jones, Genetics, 85:12 (1977)].

Expression and cloning vectors are usually PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1104, RO1213, PRO1213, PRO1213 PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779--includes a promoter that controls mRNA synthesis. Promoters recognized by a variety of possible host cells are known. Suitable promoters for use in prokaryotic hosts are the β-lactamase and lactose promoter systems [Cahng et al., Nature, 275: 615 (1978); Goeddel et al., Nature, 281: 544 (1979)], alkaline phosphatase, tryptophan (trp ) Promoter system [Goeddel, Nucleic Acids Res., 8: 4057 (1980); EP 36,776], and hybrid promoters such as the tac promoter [deBoer et al., Proc. Natl. Acad. Sci. USA, 80: 21-25 (1983). )]including. Promoters used in bacterial systems are also PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1103, PRO1133, PRO1133 It has a Shine-Dalgarno (SD) sequence operably linked to DNA encoding a PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.
Examples of suitable promoter sequences for use with yeast hosts include 3-phosphoglycerate kinase [Hitzeman et al., J. Biol. Chem., 255: 2073 (1980)] or other glycolytic enzymes [Hess et al., J. Adv. Enzyme Reg., 7: 149 (1968); Holland, Biochemistry, 17: 4900 (1978)], eg enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, Glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, trioselate isomerase, phosphoglucose isomerase, and glucokinase are included.

Other yeast promoters are inducible promoters that have the additional effect that transcription is controlled by growth conditions, such as alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degrading enzymes related to nitrogen metabolism, metallothionein, glycerin There are promoter regions of aldehyde-3-phosphate dehydrogenase and the enzymes that govern the utilization of maltose and galactose. Vectors and promoters that are preferably used for expression in yeast are further described in EP 73657.
PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258 from a vector in a mammalian host cell, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1103, PRO1133 , PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 transcription, for example, polyomavirus, infectious epithelioma virus (UK 2,211,504 published July 5, 1989) , Adenovirus (eg adenovirus 2), c Promoters derived from the genomes of viruses such as papilloma virus, avian sarcoma virus, cytomegalovirus, retrovirus, hepatitis B virus and simian virus 40 (SV40), heterologous mammalian promoters such as actin promoter or immunoglobulin Such promoters are controlled by promoters and promoters obtained from heat shock promoters as long as they are compatible with the host cell system.
PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1103, PRO1103, PRO1103, PRO1133, PRO1133, PRO1113 Transcription of DNA encoding a PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5995, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide can be enhanced by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about 10 to 300 base pairs, that act on a promoter to enhance its transcription. Many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, α-fetoprotein and insulin). Typically, however, one will use an enhancer from a eukaryotic cell virus. Examples include the late SV40 enhancer (100-270 base pairs) of the origin of replication, the cytomegalovirus early promoter enhancer, the polyoma enhancer and the adenovirus enhancer late of the origin of replication. Enhancers are: PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1213, PRO1213, RO1213, PRO1213 , PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or the PRO779 coding sequence may be spliced into the vector, but is preferably located 5 'from the promoter.

Expression vectors used for eukaryotic host cells (nucleated cells derived from yeast, fungi, insects, plants, animals, humans, or other multicellular organisms) are sequences required for termination of transcription and stabilization of mRNA. Including. Such sequences can be obtained from the normally 5 ', sometimes 3' untranslated region of eukaryotic or viral DNA or cDNA. These regions are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1213, RO1213, PRO1213, PRO1213 , PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or the PRO779 polypeptide, includes a nucleotide segment transcribed as a polyadenylation fragment.
PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1104, PRO1213, PRO1213 Other methods, vectors and host cells suitable for adapting to the synthesis of PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides are described in Gething et al., Nature, 293: 620-625 (1981); Mantei et al., Nature, 281: 40-46 (1979); EP 117,060; and EP 117,058.

4). Gene Amplification / Expression Detection Gene amplification and / or expression is based on the sequences provided here, using appropriately labeled probes, eg, general Southern blotting, Northern blotting quantifying mRNA transcription [Thomas, Proc. Natl. Acad. Sci. USA, 77: 5201-5205 (1980)], dot blotting (DNA analysis), or in situ hybridization, can be measured directly in the sample. Alternatively, antibodies capable of recognizing specific double strands, including DNA double strands, RNA duplexes and DNA-RNA hybrid duplexes or DNA-protein duplexes, can also be used. The antibody can then be labeled and an assay can be performed, where the duplex is bound to the surface, so that the antibody bound to the duplex at the time of formation on the surface of the duplex The presence of can be detected.
Alternatively, gene expression can be measured by immunological methods that directly quantify gene product expression, such as immunohistochemical staining of cells or tissue sections and cell culture or body fluid assays. Antibodies useful for immunohistochemical staining and / or assay of sample fluids can be monoclonal or polyclonal and can be prepared in any mammal. Conveniently, the antibody is a native sequence PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1104, RO1213 , PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides, or synthetic peptides based on the DNA sequences provided herein, or PRO196 , PRO217, PRO231, PR 236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1586, PRO1586, PRO1586 It can be prepared against an exogenous sequence that fuses to PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 DNA and encodes a specific antibody epitope.

5. Purification of polypeptides PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1213, PRO1213, PRO1213, PRO1213 Forms of PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide can be recovered from the lysate of the medium or host cell. If membrane-bound, it can be detached from the membrane using an appropriate wash solution (eg Triton-X100) or enzymatic cleavage. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 Cells used for expression of PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides may be of various chemical or physical properties such as freeze-thaw cycles, sonication, mechanical disruption, or cytolytic agents. Can be destroyed by means.
PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 It may be desirable to purify the PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides from recombinant cell proteins or polypeptides. An example of a suitable purification procedure is purified by the following procedure: fractionation on an ion exchange column; ethanol precipitation; reverse phase HPLC; chromatography on silica or a cation exchange resin such as DEAE; chromatofocusing; PAGE; ammonium sulfate precipitation; gel filtration using, for example, Sephadex G-75; protein A sepharose columns to remove contaminants such as IgG; and PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO 570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, a PRO10102, PRO10282, PRO61709 or PRO779 polypeptide metal chelating columns to bind epitope-tagged forms of. A variety of protein purification methods can be used and are described, for example, in Dutcher, Methods in Enzymology, 182 (1990); Scopes, Protein Purification: Principles and Practice, Springer-Verlag, New York (1982). ing. The purification process chosen may be, for example, the production method used and the particular PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO732, PRO1003, and the specific production methods used. , PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.

E. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide use PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO 357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO10425, RO102 Nucleotide sequences (or their complementary strands) have a variety of uses in the field of molecular biology, including use as hybridization probes, in chromosome and gene mapping, and in the production of antisense RNA and DNA. In addition, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO12483PRO PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 nucleic acids are also produced by the recombinant techniques described herein, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO287, 28, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO59725, PRO9725, PRO9725, PRO9725 Useful for the preparation of peptides.

Full length native sequence PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO12144 The PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 gene or part thereof is the full-length PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO32, , PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5910 Isolated or natural PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1 44, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709, or other cDNAs with the desired sequence identity to the PRO779 sequence (eg, PRO17196, PRO2 , PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1318 O5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or naturally occurring variants of PRO779 polypeptide or from other species PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO343, PRO343, PRO343 PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO8225, PRO8225 O779 polypeptides can be used as hybridization probes for a cDNA library for the isolation of those encoding). In some cases, the length of the probe is from about 20 to about 50 bases. Hybridization probes may be derived, at least in part, from novel regions of the full-length native nucleotide sequence, which regions may be used without undue experimentation or the native sequences PRO196, PRO217, PRO231, PRO236. , PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1357, PRO1857, PRO1857, , PRO10102, PRO10282, PRO61709 or PRO7 9 promoter, may be determined from genomic sequences including enhancer elements and introns. For example, screening methods include PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1104, PRO11513 Isolating the coding region of the PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 gene using a known DNA sequence to synthesize a selected probe of about 40 bases Including. Hybridization probes can be labeled with a variety of labels including radioactive nucleotides such as ³² P or ³⁵ S, or enzyme labels such as alkaline phosphatase attached to the probe via an avidin / biotin binding system. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513 Labeled probes having sequences complementary to the PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 genes, and screening a library of human cDNA, genomic DNA or mRNA Any member Can be used to determine whether to hybridize to the lobe. Hybridization techniques are described in further detail in the examples below.

Any EST sequence disclosed in this application can similarly be used as a probe in the methods described herein.
PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213 Other useful fragments of PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 nucleic acids are target PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO34. , PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5925, PRO10426, RO102PRO79P PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PR1244, PR 1298, including PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 DNA (antisense) sequences, including single-stranded nucleic acid sequences (either RNA or DNA) Includes antisense or sense oligonucleotides. Antisense or sense oligonucleotides, according to the present invention, are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10012, PRO1 4 , PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 DNA. Such fragments generally comprise at least about 14 nucleotides, preferably from about 14 to 30 nucleotides. The ability to control antisense or sense oligonucleotides based on a cDNA sequence encoding a given protein is described, for example, by Stein and Cohen (Cancer Res. 48: 2659: 1988) and van der Krol et al. (BioTechniques 6: 958 , 1988).
Binding of the antisense or sense oligonucleotide to the target nucleic acid sequence results in the formation of a duplex, which is one of several methods, including facilitating duplex degradation, termination during transcription or translation, Alternatively, transcription or translation of the target sequence is blocked by other methods. Thus, the antisense oligonucleotides are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1104, PRO1213PRO1, PRO1213 Used to block the expression of PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779. Antisense or sense oligonucleotides further include oligonucleotides having modified sugar-phosphodiester backbones (or other sugar linkages, such as those described in WO 91/06629), where such sugar linkages are endogenous nuclease resistant. . Oligonucleotides with such resistant sugar linkages are stable in vivo (ie, able to withstand enzymatic degradation), but retain sequence specificity that allows them to bind to target nucleotide sequences.

Other examples of sense or antisense oligonucleotides include organic moieties, such as those described in WO 90/10048, and other moieties that improve the affinity of the oligonucleotide for the target nucleic acid sequence, such as poly- (L -Oligonucleotides covalently linked to (lysine). Furthermore, an intercalating agent such as ellipticine, an alkylating agent, or a metal complex may be bound to a sense or antisense oligonucleotide to modify the binding specificity of the antisense or sense oligonucleotide to the target nucleotide sequence.
The antisense or sense oligonucleotide contains the target nucleic acid sequence by any gene conversion method including, for example, CaPO ₄ -mediated DNA transfection, electroporation, or by using a gene conversion vector such as Epstein-Barr virus. Introduced into cells. In a preferred method, the antisense or sense oligonucleotide is inserted into a suitable retroviral vector. A cell containing the target nucleic acid sequence is contacted with the recombinant retroviral vector in vivo or ex vivo. Suitable retroviral vectors include, but are not limited to, those derived from the murine retrovirus M-MuLV, N2 (retrovirus derived from M-MuLV), or double named DCT5A, DCT5B and DCT5C. A copy vector (see WO90 / 13641) is included.
Sense or antisense oligonucleotides may also be introduced into cells containing the target nucleotide sequence by formation of a conjugate with a ligand binding molecule, as described in WO 91/04753. Suitable ligand binding molecules include, but are not limited to, cell surface receptors, growth factors, other cytokines, or other ligands that bind to cell surface receptors. Preferably, the conjugate formation of the ligand binding molecule substantially reduces the ability of the ligand binding molecule to bind to its corresponding molecule or receptor or to prevent entry of a sense or antisense oligonucleotide or complex thereof into the cell. Does not interfere.

Alternatively, sense or antisense oligonucleotides may be introduced into cells containing the target nucleic acid sequence by formation of oligonucleotide-lipid complexes, as described in WO 90/10448. The sense or antisense oligonucleotide-lipid complex is preferably degraded intracellularly by endogenous lipase.
Antisense or sense RNA or DNA molecules are generally at least about 5 bases long, about 10 bases long, about 15 bases long, about 20 bases long, about 25 bases long, about 30 bases long, about 35 bases long, about 40 bases long About 45 bases, about 50 bases, about 55 bases, about 60 bases, about 65 bases, about 70 bases, about 75 bases, about 80 bases, about 85 bases, about 90 bases , About 95 bases long, about 100 bases long or longer.
In addition, the probe is used in PCR technology, closely related to PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1100 , PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 coding sequences can be created.
In addition, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO12483PRO The nucleotide sequence encoding a PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO O328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, RO5725, PRO9725, PRO9725, PRO9725, PRO It can also be used to construct hybridization probes for mapping of genes encoding peptides and for genetic analysis of individuals with genetic disorders. The nucleotide sequences provided herein can be mapped to specific regions of chromosomes and chromosomes using well-known techniques such as in situ hybridization, binding analysis to known chromosomal markers, and hybridization screening in libraries. .

  PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 When the coding sequence of PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 encodes a protein that binds to other proteins (eg, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PR 258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1091, PRO10291, PRO10291, PRO10291 PRO61709 or PRO779 is a receptor), PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003 RO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides are involved in binding interactions or other proteins. Can be used in assays to identify. By such methods, inhibitors of receptor / ligand binding interactions can be identified. Proteins involved in such binding interactions can also be used to screen for peptides or small molecule inhibitors or agonists of binding interactions. In addition, the receptors PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1187 , PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 can also be used to isolate related ligands. Screening assays include: native PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513PRO , PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide or PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO287 28, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO59725, PRO9725, PRO9725, PRO9725 Designed for the discovery of lead compounds that mimic the biological activity of peptide receptors. Such screening assays include assays that can also be used for high-throughput screening of chemical libraries, making them particularly suitable for the identification of small molecule candidate drugs. Small molecules considered include synthetic organic or inorganic compounds. The assays are performed in a variety of formats including protein-protein binding assays, biological screening assays, immunoassays and cell-based assays that are well known and characterized in the art.

  In addition, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO12483PRO A nucleic acid encoding a PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide or a modified form thereof can be used to produce either a transgenic or "knockout" animal, and These are therapeutically useful trials. It is useful in the development and screening. A transgenic animal (eg, a mouse or rat) is an animal having cells containing a transgene introduced into the animal or its ancestors before birth, eg, at the embryonic stage. A transgene is DNA that is integrated into the genome of a cell in which a transgenic animal develops. The present invention includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or cDNA encoding the PRO779 polypeptide is provided, which includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO2 87, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO9740 Based on the genomic sequences and established techniques used to generate transgenic animals containing cells expressing DNA encoding the PRO779 polypeptide, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO3 4, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5925, PRO9985, RO9 It can be used to clone the encoding genomic DNA. Any method known in the art can be used to introduce a transgene of a target gene into an animal to produce the founder line of the transgenic animal. Such techniques include, but are not limited to, pronuclear microinjection (US Pat. Nos. 4,873,191, 4,736,866 and 4,487,0009); retrovirus-mediated gene transfer to the embryonic lineage (Van der Putten et al., Proc. Natl. Acad. Sci. USA 82, 6148-6152 (1985)); Gene targeting in embryonic stem cells (Thompson et al., Cell 56, 313-321 (1989)); Non-specific using gene trap vectors Insertion inactivation (US Pat. No. 6,436,707); electroporation of embryos (Lo, Mol. Cel. Biol. 3, 1803-1814 (1983)); and sperm-mediated gene transfer (Lavitrano et al., Cell 57: 717- 73 (1989)). Typically, specific cells are treated with a tissue specific enhancer, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO732, PRO1001, PRO732 , PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 transgenes. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1104, PRO1104, PRO1104, PRO1104, PRO1104, PRO1104, PRO1104 , PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or a PRO779-encoded transgene copy are PRO196, PRO217, PRO231, PRO2 246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891 It can be used to examine the effect of increased expression of DNA encoding PRO10282, PRO61709 or PRO779. Such animals can be used, for example, as tester animals for reagents that would confer protection against pathological conditions associated with their overexpression. In this aspect of the invention, if an animal is treated with a reagent and the incidence of the pathological condition is low compared to an untreated animal carrying the transgene, then a therapeutic treatment for the pathological condition is indicated. It is.

  Alternatively, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO12413PRO Non-human homologues of PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides are introduced into animal embryonic stem cells, PRO196, PRO217, PRO231, PRO236, PRO245, PRO258, PRO258, PRO258, PRO258, PRO258 RO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, RO4409, PRO4409, PRO4825, RO4 Modified genomic DNA encoding the PRO779 polypeptide and PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1 03, encoding an endogenous gene of the endogenous gene of PRO1102, PRO10282, PRO61709, or PRO779, PRO1298, PRO1298, PRO1313, PRO1313, PRO1570, PRO1870, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1304, PRO1104, PRO1104, PRO1104, PRO1104 1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779-encoding gene PRO196, PRO217, PRO231, PRO236, RO236, RO246, RO246, RO246 PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425 10102, can be used to create a PRO10282, PRO61709 or PRO779 "knock-out" animals. Preferably the knockout animal is a mammal. More preferably, the mammal is a rodent, such as a rat or mouse. For example, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11518, PRO11513, PRO1398 , PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, in accordance with established techniques, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PR O287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, RO4, RO9, PRO9409, PRO5409 It can be used for cloning of genomic DNA encoding PRO779 polypeptide. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 A portion of genomic DNA encoding a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide may be deleted by other genes such as coding genes that can be used to monitor integration. Or replace It is a function. Typically, the vector contains several kilobases of intact flanking DNA (both 5 'and 3' ends) [eg, Thomas and Capecchi, Cell, 51: 503 (1987) for homologous recombination vectors. See]. Vectors are introduced into embryonic stem cells (eg, by electroporation) and cells are selected in which the introduced DNA is homologously recombined with endogenous DNA [eg, Li et al., Cell, 69: 915 (1992) reference]. The selected cells are then injected into the blastocyst of the animal (eg mouse or rat) to form an aggregate chimera [eg Bradley, Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, EJ Robertson, ed. , Oxford, 1987), pp. 113-152]. The chimeric embryo is then transplanted into an appropriate pseudopregnant female nanny to create a “knockout” animal over time. Offspring with DNA homologously recombined into embryonic cells are identified by standard techniques and can be used to breed animals that contain DNA in which all cells of the animal are homologously recombined . Knockout animals are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1413, PRO11513PRO1 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides are characterized by their ability to protect against certain pathological conditions and the progression of that pathological condition.

Knockout mice also provide a great deal of information in the discovery of drug target gene function and pharmaceutical utility, and in determining on-target side effects associated with a given target. There is a case. Gene function and physiology are very well conserved between mice and humans, since both are mammals and contain similar genetic indices, which are highly conserved between species. For example, it has recently been well documented that 98% of the genes on mouse chromosome 16 have human orthologs (Mural et al., Science 296: 1661-71 (2002)).
Gene targeting in embryonic stem (ES) cells has made it possible to create mice with null mutations in many genes associated with human disease, but not all genetic diseases are caused by null mutations . By establishing a method of gene replacement (knock-in) that disrupts the mouse locus and introduces a human counterpart with mutations, a valuable mouse model of human disease can be designed. Subsequently, in vivo drug research targeting human proteins can be performed (Kitamoto et al., Biochemical and Biophysical Res. Commun., 222: 742-47 (1996)).
In addition, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO12483PRO Nucleic acids encoding PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides can also be used for gene therapy. In gene therapy applications, genes are introduced to achieve in vivo synthesis of a therapeutically effective amount of a gene product, eg, to replace a defective gene. “Gene therapy” includes both conventional gene therapy in which a continuous effect is achieved by a single treatment and administration of a gene therapy drug including single or repeated administration of therapeutically effective DNA or mRNA. . Antisense RNA and DNA can be used as therapeutic agents to block in vivo expression of certain genes. It has already been shown that short antisense oligonucleotides can be transferred into cells that act as inhibitors, despite low intracellular concentrations due to limited uptake by the cell membrane (Zamecnik et al., Proc. Natl Acad. Sci. USA 83: 4143-4146 [1986]). Oligonucleotides may be modified to facilitate uptake by replacing their negatively charged phosphodiester groups with uncharged groups.

  There are a variety of techniques for introducing nucleic acids into viable cells. These techniques vary depending on whether the nucleic acid is transferred to the cultured cells in vitro or in vivo in the intended host cell. Suitable methods for transferring nucleic acids into mammalian cells in vitro include liposomes, electroporation, microinjection, cell fusion, DEAE-dextran, calcium phosphate precipitation, and the like. Currently preferred in vivo gene transfer techniques are transfection with viral (typically retroviral) vectors and viral coat protein-liposome mediated transfection (Dzau et al., Trends in Biotechnology 11, 205-210 [1993]). In some situations, it may be desirable to provide a source of nucleic acid with an agent that targets the target cell, such as a cell surface membrane protein or an antibody specific for the target cell, a ligand for a receptor on the target cell. When using liposomes, proteins that bind to cell surface membrane proteins with endocytosis, such as capsid proteins or fragments thereof that are specific for cell types, antibodies to proteins that undergo internalization in the cycle, intracellular localization Proteins that target and improve the intracellular half-life are used to promote targeting and / or uptake. Receptor-mediated endocytosis is described, for example, by Wu et al., J. Biol. Chem. 262, 4429-4432 (1987); and Wagner et al., Proc. Natl. Acad. Sci. USA 87, 3410-3414 (1990). Has been. For a review of gene generation and gene therapy protocols, see Anderson et al., Science 256, 808-813 (1992).

PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide may be used as molecular weight markers for protein electrophoresis purposes.
PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 Nucleic acid molecules encoding PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides or fragments thereof are useful for chromosome identification. In this respect, identification of a new chromosomal marker is necessary because chromosomal marking reagents based on actual sequence data are hardly available. Each PRO196, PRO217, PRO231, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 nucleic acid molecules can be used as chromosome markers.
Moreover, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1213, PRO1213, RO1213, PRO1213, PRO1213 , PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides and nucleic acid molecules can be used for tissue typing, and PRO196, PRO217, PRO231, PRO236, PRO246, PRO246, PRO246, PRO246 58, PRO 287, PRO 328, PRO 344, PRO 357, PRO 526, PRO 724, PRO 731, PRO 732, PRO 1003, PRO 1104, PRO 1151, PRO 1244, PRO 1298, PRO 1313, PRO 1570, PRO 1886, PRO 1091, PRO 10291, PRO 10291, PRO The PRO61709 or PRO779 polypeptide preferably has a different expression in one tissue compared to the other in diseased tissue compared to normal tissue of the same tissue type. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 nucleic acid molecules will find use for generating probes for PCR, Northern analysis, Southern analysis and Western analysis.

  PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1214 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides may be used as therapeutic agents. PRO 196, PRO 217, PRO 231, PRO 236, PRO 245, PRO 246, PRO 258, PRO 287, PRO 328, PRO 344, PRO 357, PRO 526, PRO 724, PRO 731, PRO 732, PRO 1003, PRO 1104, PRO 11513, PRO 1 186 PRO , PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides are formulated according to known methods for preparing pharmaceutically useful compositions, whereby the PRO196, PRO217, PRO231, PRO236, PR 245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1586, PRO1586, PRO1586, PRO1598 The PRO10102, PRO10282, PRO61709 or PRO779 product is mixed with a pharmaceutically acceptable carrier medium. The therapeutic formulation is in the form of a lyophilized formulation or an aqueous solution by mixing an optional pharmaceutically acceptable carrier, excipient or stabilizer with an active ingredient having the desired degree of purification ( Remington's Pharmaceutical Sciences, 16th edition, Osol, A. Ed., (1980)), prepared and stored. Acceptable carriers, excipients or stabilizers are nontoxic to recipients at the dosages and concentrations used and are buffers such as phosphate, citrate and other organic acids; antioxidants including ascorbic acid Agent; low molecular weight (less than 10 residues) polypeptide; protein such as serum albumin, gelatin or immunoglobulin; hydrophilic polymer such as polyvinylpyrrolidone; amino acid such as glycine, glutamine, asparagine, arginine or lysine; glucose; Monosaccharides, disaccharides or other carbohydrates such as mannose or dextrin; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or TWEEN®, PLURONICS® ) Or a nonionic surfactant such as PEG.

The formulation used for in vivo administration must be sterile. This is easily accomplished by filtration through sterile filter membranes before or after lyophilization and reconstitution.
The therapeutic composition herein is generally placed in a container with a sterile access port, such as an intravenous bag or vial having a stopper pierceable by a hypodermic needle.
The route of administration is by well-known methods such as injection or infusion such as local administration by intravenous, intraperitoneal, intracerebral, intramuscular, intraocular, intraarterial or intralesional route, or a sustained release system.
The dosage of the pharmaceutical composition of the present invention and the desired drug concentration will vary depending on the particular application intended. The determination of an appropriate dose or route of administration is within the ordinary skill of a physician. Animal experiments provide reliable guidance for determining effective doses for human therapy. Effective species interspecific scaling is described in Toxicokinetics and New Drug Development, Yacobi et al., Pergamon Press, New York 1989, pp. 42-96, Mordenti, J. and Chappell, W. “The use of interspecies scaling in toxicokinetics”. It can be carried out according to the principles described.
PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213 When in vivo administration of PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides or agonists or antagonists thereof is used, the normal dosage is one day per body weight of the mammal, depending on the route of administration. About 10 ng / kg to 10 Until mg / kg, preferably of from about 1 [mu] g / kg / day 10 mg / kg / day. Specific dosage and delivery method guidelines are given in the literature; see, eg, US Pat. Nos. 4,657,760, 5,206,344, or 5,225,212. It is expected that different formulations will be effective for different therapeutic compounds and different diseases, for example, administration targeting one organ or tissue will require transport in a different manner than other organs or tissues Is done.

PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, with release characteristics suitable for the treatment of any disease or condition requiring administration of PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide. PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, RO18910, RO18409, RO4409P If sustained release of the PRO61709 or PRO779 polypeptide is desired, then PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732 PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 microencapsulation polypeptide is contemplated. Microencapsulation of recombinant proteins for sustained release has been successfully performed with human growth hormone (rhGH), interferon- (rhIFN-), interleukin-2, and MN rgp120. Johnson et al., Nat. Med., 2: 795-799 (1996); Yasuda, Biomed. Ther., 27: 1221-1223 (1993); Hora et al., Bio / Technology, 8: 755-758 (1990); Cleland , “Design and Production of Single Immunization Vaccines Using Polylactide Polyglycolide Microsphere Systems” Vaccine Design: The Subunit and Adjuvant Approach, Powell and Newman, (Plenum Press: New York, 1995), p.439-462; WO97 / 03692, WO96 / 40072, WO 96/07399; and US Pat. No. 5,654,010.
Sustained release formulations of these proteins have been developed based on their biocompatibility and a wide range of biodegradation properties using poly-lactic acid-glycolic acid (PLGA) copolymers. The degradation products of PLGA, lactic acid and glycolic acid, are cleared immediately in the human body. Furthermore, the degradability of the polymer can be adjusted from months to years depending on the molecular weight and composition. Lewis, “Controlled release of bioactive agents from lactide / glycolide polymer”: M. Chasin and R. Langer (eds.), Biodegradable Polymers as Drug Delivery Systems (Marcel Dekker: New York, 1990), pp. 1-41.

The present invention includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or those mimicking PRO779 polypeptide (agonist) or PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, RO258, PRO258 PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, RO5759, PRO5925, PRO5925, PRO59710, RO5 Also included are methods for screening compounds to identify those that inhibit the effects of peptides (antagonists). PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 Agonists that mimic PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides are those whose genomes are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PR 328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, RO5725, PRO59725, PRO9725, PRO9725, PRO It will be of particular therapeutic value when a negative phenotype is observed based on findings in non-human transgenic animals including disruption of the gene encoding the peptide. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 Antagonists that interfere with the effects of PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides are particularly therapeutically valuable when a positive phenotype is observed when observed in non-human transgenic knockout animals. It will be. Screening assays for candidate antagonist drugs include PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1003, PRO1003, PRO1003 , PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides, or other coding compounds Other cells It is designed to identify compounds that inhibit the interaction between proteins. Such screening assays include those applicable to high-throughput screening of chemical libraries that make it particularly suitable for the identification of small molecule drug candidates.
The assay is performed in a variety of formats, including protein-protein binding assays, biochemical screening assays, immunoassays, and cell-based assays, known in the art.
All assays for antagonists are based on PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, which are encoded by the nucleic acids identified herein as candidate drugs. , PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO71709 or PRO7709 Under sufficient conditions and time Common to the the need for letting touch.

  In binding assays, the interaction is binding and the complex formed can be isolated or detected in the reaction mixture. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO1121, PRO12PRO, PRO12104, PRO12PRO1, PRO12PRO1, PRO12PRO PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide or candidate drug is immobilized on a solid phase, eg, a microtiter plate, by covalent or non-covalent binding. . Non-covalent bonds generally include solid surfaces such as PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1100, PRO1104, PRO1100 , PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide and dried. Alternatively, immobilized PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1213, PRO1213, PRO1213, PRO1213 An immobilized antibody, such as a monoclonal antibody, specific for a PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide can be used to anchor it to a solid surface. The assay is performed by adding a non-immobilized component, which may be labeled with a detectable label, to a coated surface containing an immobilized component, such as an anchoring component. When the reaction is completed, unreacted components are removed, for example, by washing, and the complex adhered to the solid surface is detected. If the first non-immobilized component has a detectable label, detection of the label immobilized on the surface indicates that complex formation has occurred. If the initial non-immobilized component does not have a label, complex formation can be detected, for example, by a labeled antibody that specifically binds to the immobilized complex.

Specific PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO1003, PRO1003, encoded by the gene identified here PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, if they do not interact with the polypeptide, Detect protein interactions It can be assayed by methods well known for. Such assays include traditional techniques such as cross-linking, co-immunoprecipitation, and co-purification through a gradient or chromatographic column. In addition, protein-protein interactions have been described by Fields and co-workers [Fiels and Song, Nature (as disclosed in Chevray and Nathans, Proc. Natl. Acad. Sci. USA 89, 5789-5793 (1991). London) 340, 245-246 (1989); Chien et al., Proc. Natl. Acad. Sci. USA 88, 9578-9582 (1991)]. . Many transcriptional activators such as yeast GAL4 consist of two physically distinct modular domains, one that acts as a DNA binding domain and the other that functions as a transcriptional activation domain. The yeast expression system described in the previous literature (commonly referred to as the “2-hybrid system”) takes advantage of this property and uses two hybrid proteins while the target protein is the DNA binding domain of GAL4. On the other hand, a candidate activation protein is fused to the activation domain. Expression of the GAL1-lacZ reporter gene under the control of a GAL4-activated promoter depends on reconstitution of GAL4 activity through protein-protein interactions. Colonies containing interacting polypeptides are detected with a chromogenic substance for β-galactosidase. A complete kit (MATCHMAKER ^™ ) for identifying protein-protein interactions between two specific proteins using two-hybrid technology is commercially available from Clontech. This system can also be extended to the mapping of protein domains involved in specific protein interactions as well as the identification of amino acid residues important for these interactions.

  PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1104, PRO1213, PRO1213, PRO1213, PRO1213 , PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides can be tested for compounds that inhibit the interaction of intracellular or extracellular components with: : Usually the reaction mixture is gene product and extracellular The intracellular components are prepared to include over under conditions and for a time capable of interaction and binding of the two products. In order to test the ability of a candidate compound to inhibit binding, the reaction is performed in the absence and presence of the test compound. In addition, a placebo may be added to the third reaction mixture to provide a positive control. Binding (complex formation) between the test compound present in the mixture and the intracellular or extracellular component is monitored as described above. Formation of the complex in the control reaction, but not the reaction mixture containing the test compound, indicates that the test compound inhibits the interaction between the test compound and its reaction partner.

  To assay for antagonists, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1001, PRO1003, PRO1003, PRO1003, PRO1001, PRO1003 , PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide may be added to the cell, , PRO 236, PRO 245, PRO 246, PRO 258, PRO 287, PRO 328, PRO 344, PRO 357, PRO 526, PRO 724, PRO 731, PRO 732, PRO 1003, PRO 1104, PRO 1151, PRO 1244, PRO 1298, PRO 913 PRO, PRO 185 PRO , PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, the ability of a compound to inhibit a subject activity is determined by the compound's ability to inhibit PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO3. 4, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5925, PRO9985, RO9 Indicates an antagonist. Alternatively, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO12413PRO PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide and membrane-bound PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO328 4, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO59425, PRO9985, PRO6985, RO102PRO7 Alternatively, antagonists may be detected by binding potential antagonists with recombinant receptors under conditions suitable for competitive inhibition assays. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1213, PRO1213, PRO1213, PRO1213 , PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, and bound to the receptor to determine the effectiveness of potential antagonists, PRO196, PRO217, PRO231, PRO 36, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1359, PRO1586, PRO1586, PRO1586, PRO1586 The number of PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides can be utilized. The gene encoding the receptor can be identified by a number of methods known to those skilled in the art, such as ligand panning and FACS sorting. Coligan et al., Current Protocols in Immun., 1 (2): Chapter 5 (1991). Preferably, expression cloning is used and the polyadenylated RNA is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1001, PRO732, PRO1001 , PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides and cDNA libraries generated from this RNA Distributed to COS cells or PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1213, PRO1213, PRO1213 , PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or other cells that are not reactive with the polypeptide. Transfected cells grown on glass slides were labeled PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1 4 , PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide. This PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1 183, PRO1398 The PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides can be labeled by a variety of means including iodination or inclusion of a recognition site for a site-specific protein kinase. After fixation and incubation, the slides are subjected to autoradiographic analysis. Positive pools are identified, and subpools are prepared and re-transfected using an interactive subpooling and rescreening process, ultimately generating a single clone encoding the putative receptor.

As an alternative method of receptor identification, labeled PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10012, PRO1298, PRO1298 , PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides can be photoaffinity linked to cell membranes or extract preparations that express receptor molecules. The cross-linked material is dissolved by PAGE and exposed to X-ray film. The labeled complex containing the receptor can be excited, broken down into peptide fragments, and subjected to protein microsequencing. The amino acid sequence obtained from microsequencing is used in the design of a set of degenerate oligonucleotide probes that screen cDNA libraries that identify genes encoding putative receptors.
PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 Other approaches in assessing the effects of antagonists on PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides include the use of PRO196, PRO217, wild-type mice to mimic known knockout phenotypes. PRO2 1, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1857, A PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 antagonist will be administered. Therefore, first, the target PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513PRO, PRO11513PRO PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 gene is knocked out, and PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, RO258, PRO258, PRO258, PRO28 8, PRO344, PRO357, PRO526, PRO724, PRO732, PRO732, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5925, PRO9725, PRO9725, PRO9725 Observe the phenotype that results from knocking out or destroying. Subsequently, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1104, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 , PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709, or PRO779 by administering antagonists of the polypeptide, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PR 258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1091, PRO10291, PRO10291, PRO10291 The effect of antagonists on PRO61709 or PRO779 polypeptide is evaluated. Effective antagonists are expected to mimic the phenotype initially observed in knockout animals.

  Similarly, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO12413PRO The effects of antagonists on the PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides can be compared to PRO196, PRO217, P0 on non-human transgenic mice to improve the known negative knockout phenotype. O231, PRO236, PRO245, PRO246, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, RO18PRO It may be possible to evaluate by administering a PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 agonist. Therefore, first, the target PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513PRO PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 genes are knocked out, and PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, RO258, PRO258, PRO258, PRO28 8, PRO344, PRO357, PRO526, PRO724, PRO732, PRO732, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5925, PRO9725, PRO9725, PRO9725 Observe the phenotype that results from knocking out or destroying. Subsequently, non-human transgenic mice were treated with PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1103, PRO1104 , PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide by administering an agonist of PRO196, PRO217, PRO231, PRO236, PR0245, PRO245, 246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891 The effect of the agonist on PRO10282, PRO61709 or PRO779 polypeptide is evaluated. Effective agonists are expected to improve the negative phenotypic effect initially observed in knockout animals.

In other assays for antagonists, mammalian cells or membrane preparations that express the receptor are labeled PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526 in the presence of the candidate compound. , PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, RO1079 The ability of the compound to promote or block this interaction is then measured.
More specific examples of potential antagonists include immunoglobulins and PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1 An oligonucleotide that binds to a fusion with PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, but not limited to poly Peptide- and monoclonal antibodies And antibody fragments, single chain antibodies, anti-idiotype antibodies, and chimeric or humanized forms of these antibodies or fragments, as well as antibodies, including human antibodies and antibody fragments. Alternatively, potential antagonists recognize closely related proteins, such as receptors, but have no effect, and thus PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, RO1079 PRO196, PR to do 217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1259, PRO1318, It may be a variant of PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.

  Other potential PRO196, PRO217, PRO231, PRO236, PRO245, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1270 , PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide antagonists are antisense RNA or DNA constructs prepared using antisense technology, eg, antisense RNA or DNA molecules It acts to block directly the translation of mRNA by interfering with the hybridizing of protein translation in mRNA being targeted. Antisense technology can be used to control gene expression through triple helix formation or antisense DNA or RNA, both methods based on binding of the polynucleotide to DNA or RNA. For example, here mature PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1413, PRO11513 About 10 to 40 base pair long antisense RNA using the 5 'coding portion of the polynucleotide sequence encoding PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide Design oligonucleotides. DNA oligonucleotides are designed to be complementary to regions of genes involved in transcription (Triple Helix-Lee et al., Nucl. Acids Res., 6: 3073 (1979); Cooney et al., Science, 241: 456 (1988) Dervan et al., Science, 251: 1360 (1991)), thus PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO1003, PRO732, PRO100 PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO6 709 or PRO779 preventing transcription and the production of polypeptides. Antisense RNA oligonucleotides hybridize to mRNA in vivo, and include PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1 Blocks translation of mRNA molecules into PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide (Antisense-Okano, Neurochem. 56 : 560 (1991); Okigodeox ynucleotides as Antisense Inhibitors of Gene Expression (CRC Oress: Boca Raton, FL, 1988) The oligonucleotides described above can also be transferred to cells and antisense RNA or DNA expressed in vivo to produce PRO196, PRO217, PRO231. , PRO 236, PRO 245, PRO 246, PRO 258, PRO 287, PRO 328, PRO 344, PRO 357, PRO 526, PRO 724, PRO 731, PRO 732, PRO 1003, PRO 1104, PRO 1151, PRO 1244, PRO 1298, PRO 913 PRO, PRO 185 PRO , PRO7425, PRO10102, PRO10282, PRO61709 or PRO7 9 To inhibit production of the polypeptide. The antisense DNA is used, the translation initiation site, e.g., about -10 position and oligodeoxyribonucleotides taken out from between +10 positions of the target gene nucleotide sequence, it is preferred.

Potential antagonists are: PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513RO, PRO11513 , PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, thereby binding to the active site, receptor binding site, or growth factor or other relevant binding site, thereby PRO196, PRO217, PRO231 , P O236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, RO18PRO86 Includes small molecules that block the normal biological activity of a PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide. Examples of small molecules include, but are not limited to, small peptides or peptide-like molecules, preferably soluble peptides, and synthetic non-peptide organic or inorganic compounds.
Ribozymes are enzymatic RNA molecules that can catalyze the specific cleavage of RNA. Ribozymes act by sequence-specific hybridization to complementary target RNA, followed by nucleotide strand breaks. Specific ribozyme cleavage sites within a potential RNA target can be identified by known techniques. For further details see, for example, Rossi, Current Biology 4: 469-471 (1994) and PCT Publication No. WO 97/33551 (published 18 September 1997).

The nucleic acid molecule in triple helix formation used to inhibit transcription should be single stranded and consists of deoxynucleotides. The basic composition of these oligonucleotides is designed to promote triple helix formation via Hoogstin base pairing rules, which generally requires a resizable extension of purine or pyrimidine on one strand of the duplex . For further details, see, for example, the above-mentioned PCT publication WO 97/33551.
These small molecules can be identified by any one or more of the screening assays discussed above and / or by any other screening technique well known to those skilled in the art.
Also, the diagnostic and therapeutic uses of the molecules disclosed herein are based on the positive function assay hits disclosed and described below.

F. Anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO1003, anti-PRO1003, anti-PRO1003 , Anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10282, anti-PRO67179 or anti-PRO6779 The invention relates here to anti-PRO196, anti-PRO217, which may find use as therapeutic and / or diagnostic agents. Anti-PRO231, Anti-PRO236, Anti-PRO245, Anti-PRO246, Anti-PRO258, Anti-PRO287, Anti-PRO328, Anti-PRO344, Anti-PRO357, Anti-PRO526, Anti-PRO724, Anti-PRO731, Anti-PRO732, Anti-PRO1003, Anti-PRO1441, Anti-PRO11544 , Anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10282, anti-PRO61709 or anti-PRO779 antibody. Exemplary antibodies include polyclonal, monoclonal, humanized, bispecific and heteroconjugate antibodies.

1. Polyclonal antibodies Polyclonal antibodies are preferably produced in animals by multiple subcutaneous (sc) or intraperitoneal (ip) injections of the relevant antigen and an adjuvant. It is useful for binding relevant antigens (especially when synthetic peptides are used) to proteins that are immunogenic in the species to be immunized. For example, this antigen can be converted to keyhole limpet hemocyanin (KLH), serum albumin, bovine thyroglobulin, or soybean trypsin inhibitor, bifunctional or derivatizing agents such as maleimidobenzoylsulfosuccinimide ester (conjugation via cysteine residues). , N-hydroxysuccinimide (conjugation via a lysine residue), glutaraldehyde, and succinic anhydride, SOCl ₂ , or R ¹ and R ¹ may be combined using different alkyl groups R ¹ N═C═NR it can.
The animal is combined with 3 volumes of complete Freund's adjuvant, eg, 100 μg or 5 μg of protein or conjugate (for rabbits or mice, respectively), and this solution is injected intradermally at multiple sites to produce antigens, immunogenic conjugates, or Immunize against derivatives. One month later, the animals are boosted by subcutaneous injection at multiple sites with an initial amount of 1/5 to 1/10 peptide or conjugate in complete Freund's adjuvant. After 7 to 14 days, animals are bled and the serum is assayed for antibody titer. Animals are boosted until the titer reaches a plateau. Conjugates can also be prepared in recombinant cell culture as protein fusions. In addition, an aggregating agent such as alum is preferably used to enhance the immune response.

2. Monoclonal antibodies Monoclonal antibodies can be made by the hybridoma method first described by Kohler et al., Nature, 256: 495 (1975), or by the recombinant DNA method (US Pat. No. 4,816,567).
In the hybridoma method, a mouse or other suitable host animal, such as a hamster, is immunized as described above, and an antibody that specifically binds to the protein used for immunization is produced or can be produced. To derive. Alternatively, lymphocytes can be immunized in vitro. After immunization, lymphocytes are isolated and fused with myeloma cells using a suitable fusing agent such as polyethylene glycol to form hybridoma cells (Goding, Monoclonal Antibodies: Principles and Practice, pages 59-103 ( Academic Press, 1986)).
The hybridoma cells thus prepared are seeded in a suitable medium preferably containing one or more substances that inhibit the growth or survival of unfused parent myeloma cells (also called fusion partners). Let For example, if the parent myeloma cells lack the enzyme hypoxanthine guanine phosphoribosyltransferase (HGPRT or HPRT), the medium for the hybridoma is typically a substance that prevents the growth of HGPRT-deficient cells. It will contain some hypoxanthine, aminopterin, and thymidine (HAT medium).

Myeloma cells, a preferred fusion partner, efficiently fuse, support stable high level expression of antibodies by selected antibody-producing cells, and select media that select against unfused parent cells. It is a sensitive cell. Among these, preferred myeloma cell lines are mouse myeloma lines such as the MOPC-21 and MPC-11 mouse tumors available from the Souk Institute Cell Distribution Center, San Diego, California, USA, and , Derived from SP-2 or X63-Ag8-653 cells available from the American Type Culture Collection, Manassas, Virginia, USA. Human myeloma and mouse-human heteromyeloma cell lines have also been disclosed for the production of human monoclonal antibodies (Kozbor, J. Immunol., 133: 3001 (1984); Brodeur et al., Monoclonal Antibody Production Techniques and Applications 51-63, (Marcel Dekker, Inc., New York, 1987)).
Culture medium in which hybridoma cells are growing is assayed for production of monoclonal antibodies directed against the antigen. Preferably, the binding specificity of monoclonal antibodies produced by hybridoma cells is measured by immunoprecipitation or in vitro binding assays, such as radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELISA).

For example, the binding affinity of a monoclonal antibody can be measured by Scatchard analysis of Munson et al., Anal. Biochem., 107: 220 (1980).
Once hybridoma cells producing antibodies of the desired specificity, affinity, and / or activity are identified, the clones can be subcloned by limiting dilution and grown by standard methods (Goding, Monoclonal Antibodies : Principles and Practice, 59-103 (Academic Press, 1986)). Suitable culture media for this purpose include, for example, D-MEM or RPMI-1640 medium. The hybridoma cells can also be grown in vivo as animal ascites tumors, for example, by intraperitoneal injection of cells into mice.
Monoclonal antibodies secreted by subclones are conventional antibodies such as affinity chromatography (eg using protein A or protein G-sepharose) or ion exchange chromatography, hydroxyapatite chromatography, gel electrophoresis, dialysis, etc. It is successfully separated from the culture medium, ascites or serum by purification methods.
The DNA encoding the monoclonal antibody is immediately isolated using conventional methods (e.g., by using oligonucleotide probes that can specifically bind to the genes encoding the heavy and light chains of the murine antibody) To be sequenced. Hybridoma cells are a preferred source of such DNA. Once isolated, the DNA is placed in an expression vector, which is then added to an E. coli cell, monkey COS cell, Chinese hamster ovary (CHO) cell, or myeloma cell that does not produce antibody protein otherwise. It can be transfected into a host cell to obtain monoclonal antibody synthesis in a recombinant host cell. Review articles on recombinant expression in bacteria of DNA encoding the antibody include Skerra et al., Curr. Opinion in Immunol., 5: 256-262 (1993) and Pluckthun, Immunol. Revs. 130: 151-188 (1992). Is included.

Monoclonal antibodies or antibody fragments can be isolated from antibody phage libraries produced using the techniques described in McCafferty et al., Nature, 348: 552-554 (1990). Clackson et al., Nature, 352: 624-628 (1991) and Marks et al., J. Mol. Biol., 222: 581-597 (1991) describe the separation of mouse and human antibodies using phage libraries. Yes. Subsequent publications to generate high affinity (nM range) human antibodies by chain shuffling (Marks et al., Bio / Technology, 10: 779-783 [1992]), as well as to construct very large phage libraries Describes combinatorial infection and in vivo recombination (Waterhouse et al., Nuc. Acids. Res., 21: 2265-2266 [1993]). These techniques are therefore viable alternatives to traditional monoclonal antibody hybridoma methods for the separation of monoclonal antibodies.
DNA encoding the antibody can be obtained, for example, by substituting the sequences of human heavy and light chain constant domains (C _H and C _L ) for homologous mouse sequences (US Pat. No. 4,816,567; Morrison et al., Proc. Nat. Acad. Sci., USA, 81: 6851 (1984)), or covalently linking all or part of the coding sequence of a non-immunoglobulin polypeptide (heterologous polypeptide) to an immunoglobulin coding sequence. Can be modified to produce chimeric or fusion antibody polypeptides. The non-immunoglobulin polypeptide sequence can replace the constant domain of an antibody, or a variable domain of one antigen-binding site of an antibody can be replaced to differ from one antigen-binding site with specificity for an antigen. A chimeric bivalent antibody is produced comprising another antigen binding site with specificity for.

3. Human and humanized antibodies Anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, of the present invention Anti-PRO732, Anti-PRO1003, Anti-PRO1104, Anti-PRO1151, Anti-PRO1244, Anti-PRO1298, Anti-PRO1313, Anti-PRO1570, Anti-PRO1886, Anti-PRO1891, Anti-PRO4409, Anti-PRO5725, Anti-PRO5994, Anti-PRO6097, Anti-PRO1022, Anti-PRO1022 The anti-PRO61709 or anti-PRO779 antibody further comprises a humanized antibody or a human antibody. A humanized form of a non-human (eg mouse) antibody is a chimeric immunoglobulin, immunoglobulin chain or fragment thereof (eg Fv, Fab, Fab ′, F (ab ′) ₂ or other antigen binding subsequence of the antibody). And contains the minimum sequence derived from non-human immunoglobulin. Humanized antibodies are those in which the complementarity-determining region (CDR) of the recipient contains the CDRs of a non-human species (donor antibody) that has the desired specificity, affinity and ability, such as mouse, rat or rabbit. Includes human immunoglobulins (recipient antibodies) substituted by groups. In some examples, human immunoglobulin Fv framework residues are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues that are found neither in the recipient antibody nor in the imported CDR or framework sequences. Generally, a humanized antibody has at least one, typically all, or almost all CDR regions that match those of a non-human immunoglobulin, and all or almost all FR regions are human immunoglobulin consensus sequences. Includes substantially all of the two variable domains. Humanized antibodies optimally comprise an immunoglobulin constant region (Fc), typically at least part of the constant region of a human immunoglobulin [Jones et al., Nature, 321: 522-525 (1986); Riechmann et al. , Nature, 332: 323-329 (1988); and Presta, Curr. Op Struct. Biol., 2: 593-596 (1992)].

Methods for humanizing non-human antibodies are well known in the art. Generally, one or more amino acid residues derived from non-human are introduced into a humanized antibody. These non-human amino acid residues are often referred to as “import” residues, which are typically taken from an “import” variable domain. Humanization is basically performed by Winter and co-workers [Jones et al., Nature, 321: 522-525 (1986); Riechmann et al., Nature, 332: 323-327 (1988); Verhoeyen et al., Science, 239: 1534-1536 (1988)] by replacing the rodent CDR or CDR sequence with the corresponding sequence of a human antibody. Accordingly, such “humanized” antibodies are chimeric antibodies (US Pat. No. 4,816,567) wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
If the antibody is intended for human therapeutic use, to reduce antigenicity and HAMA response (human anti-mouse antibody), both human light and heavy human variable domains used in generating humanized antibodies The choice is very important. In the so-called “best fit method”, the sequence of the variable domain of a rodent antibody is screened against the entire library of known human variable domain sequences. The human V domain sequence closest to that of the rodent is then identified and the human framework (FR) therein is accepted for the humanized antibody (Sims et al., J. Immunol., 151: 2296 (1993) Chothia et al., J. Mol. Biol., 196: 901 (1987)). Another method uses a particular framework region derived from the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains. The same framework can be used for several different humanized antibodies (Carter et al., Proc. Natl. Acad. Sci. USA, 89: 4285 (1992); Presta et al., J. Immunol., 151: 2623 (1993)) .

It is further important that antibodies be humanized with retention of high binding affinity for the antigen and other favorable biological properties. To achieve this goal, a preferred method uses a three-dimensional model of the parent and humanized sequences to prepare the humanized antibody through an analysis step of the parent sequence and various conceptual humanized products. Three-dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art. Computer programs that illustrate and display putative three-dimensional conformational structures of selected candidate immunoglobulin sequences are commercially available. Viewing these representations allows analysis of the likely role of residues in the function of the candidate immunoglobulin sequence, ie, analysis of residues that affect the ability of the candidate immunoglobulin to bind antigen. In this way, FR residues can be selected and combined from the recipient and import sequences so that the desired antibody characteristic, such as increased affinity for the target antigen (s), is achieved. In general, hypervariable region residues directly and most substantially affect antigen binding.
Humanized anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10282, anti-PRO6779 Various forms of the antibody are contemplated. For example, a humanized antibody may be an antibody fragment, such as a Fab, that may be conjugated to one or more cytotoxic agent (s) depending on the situation to produce an immunoconjugate. The humanized antibody may also be an intact antibody, such as an intact IgG1 antibody.

As an alternative to humanization, human antibodies can be generated. For example, it is now possible to create transgenic animals (eg, mice) that can produce the entire repertoire of human antibodies without the production of endogenous immunoglobulin by immunization. For example, it has been described that homozygous deletion of the antibody heavy chain joining region (J _H ) gene in chimeric and germ-line mutant mice results in complete inhibition of endogenous antibody production. Transfer of human germline immunoglobulin gene sequences to such germline mutant mice results in the production of human antibodies upon antigen administration. Jakobovits et al., Proc. Natl. Acad. Sci. USA, 90: 2551 (1993); Jakobovits et al., Nature 362: 255-258 (1993); Bruggeman et al., Year in Immuno., 7:33 (1993); US Patent Nos. 5,545,806, 5,569,825, 5,591,669 (all GenPharm); 5,545,807; and WO 97/17852.
Alternatively, human antibodies and antibody fragments can be obtained in vitro from the immunoglobulin variable (V) domain gene repertoire of non-immunized donors using phage display technology (McCafferty et al., Nature 348: 552-553 [1990]). Can be produced. According to this technique, antibody V domain genes are cloned frame-wise with filamentous bacteriophages, eg, either M13 or fd large or small coat protein genes, and displayed as functional antibody fragments on the surface of phage particles. Let Since the filamentous particle contains a single-stranded DNA copy of the phage genome, the selection of a gene encoding an antibody exhibiting these properties results as a result even based on selection based on the functional properties of the antibody. Thus, this phage mimics some properties of B cells. Phage display can be performed in a variety of formats; see, eg, Johnson, Kevin S. and Chiswell, David J., Current Opinion in Structural Biology 3: 564-571 (1993). Several sources of V-gene segments can be used for phage display. Clackson et al., Nature, 352: 624-628 (1991) isolated a large variety of anti-oxazolone antibodies from a small random combinatorial library of V genes derived from the spleens of immunized mice. The V gene repertoire of non-immunized human donors is configurable, and antibodies against a wide variety of antigens (including self-antigens) are described in Marks et al., J. Mol. Biol. 222: 581-597 (1991), or Griffith. Et al., EMBO J. 12: 725-734 (1993). See also U.S. Pat. Nos. 5,565,332 and 5,573,905.
As mentioned above, human antibodies can be produced by in vitro activated B cells (US Pat. Nos. 5,567,610 and 5,229,275).

4). Antibody Fragments Under certain circumstances, it may be advantageous to use antibody fragments rather than whole antibodies. Smaller sized pieces allow for rapid clearance and can lead to improved access to solid tumors.
Various techniques have been developed to produce antibody fragments. Traditionally, these fragments were derived by proteolytic digestion of intact antibodies (e.g. Morimoto et al., Journal of Biochemical and Biophysical Methods 24: 107-117 (1992) and Brennan et al., Science, 229: 81 (1985)). However, these fragments can now be produced directly by recombinant host cells. Fab, Fv and ScFv antibody fragments could all be expressed and secreted in E. coli, thus facilitating the production of large amounts of these fragments. Antibody fragments can be isolated from the antibody phage libraries discussed above. Alternatively, Fab′-SH fragments can be recovered directly from E. coli and chemically coupled to form F (ab ′) ₂ fragments (Carter et al., Bio / Technology 10: 163-167 (1992)). In another approach, F (ab ′) ₂ fragments can be isolated directly from recombinant host cell culture. Fab and F (ab ′) ₂ containing salvage receptor binding epitope residues with increased in vivo half-life are described in US Pat. No. 5,869,046. Other methods for generating antibody fragments will be apparent to those skilled in the art. In other embodiments, the antibody of choice is a single chain Fv fragment (scFv). See WO 93/16185; US Pat. No. 5,571,894; and US Pat. No. 5,587,458. Fv and sFv are the only species that have an intact ligation site that lacks a constant region; thus, they are suitable for reduced non-specific binding during in vivo use. The sFv fusion protein may be configured to produce a fusion of effector proteins at either the amino or carboxy terminus of the sFv. See the above-mentioned edition of Antibody Engineering, Borrebaeck. The antibody fragment may also be a “linear antibody” as described in, for example, US Pat. No. 5,641,870. Such linear antibody fragments may be monospecific or bispecific.

5. Bispecific antibodies Bispecific antibodies are antibodies that have binding specificities for at least two different epitopes. Exemplary bispecific antibodies are: PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO12PRO1, PRO112PRO It can bind to two different epitopes of the PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 proteins. Other such antibodies include binding sites for other proteins and PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1, 104 PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 binding sites may bind. Alternatively, anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO1003, Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 The antibody arms are PRO196, PRO217, PRO231, PRO236, PRO245, PR 246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891 Fc receptors for IgG (FcγR), such as FcγRI (CD64), FcγRII (CD32) and FcγRIII (CD16), or T cell receptor molecules (such as FcγRI (CD64), FcγRIII (CD16)), so as to concentrate and localize cytoprotective mechanisms in PRO10282, PRO61709 or PRO779 expressing cells Binds to trigger molecules on leukocytes such as CD3) Capable of binding to the arm. Also, bispecific antibodies are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1413, PRO11513, PRO1413, PRO11513 It can also be used to localize cytotoxic agents to cells expressing PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779. These antibodies are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1244, PRO1213 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 binding arms and cytotoxic agents (eg, saporin, anti-interferon-α, vinca alkaloid, ricin A chain, methotrexate or radioisotope) Hapten) and bond That has the arm. Bispecific antibodies can be prepared as full length antibodies or antibody fragments (eg F (ab ′) 2 bispecific antibodies).

WO 96/16673 describes a bispecific anti-ErbB2 / anti-FcγRIII antibody and US Pat. No. 5,837,234 discloses a bispecific anti-ErbB2 / anti-FcγRI antibody. Has been. Bispecific anti-ErbB2 / Fcα antibodies are shown in WO 98/02463. US Pat. No. 5,821,337 teaches bispecific anti-ErbB2 / anti-CD3 antibodies.
Methods for making bispecific antibodies are known in the art. Traditional production of full-length bispecific antibodies is based on the co-expression of two immunoglobulin heavy chain-light chain pairs, where the two chains have different specificities (Millstein et al., Nature, 305: 537-539 (1983)). Because of the random selection of immunoglobulin heavy and light chains, these hybridomas (four-part hybrids) produce a possible mixture of 10 different antibody molecules, only one of which is the correct bispecific structure. Have Usually, the purification of the correct molecule performed by the affinity chromatography step is quite cumbersome and the product yield is low. Similar methods are disclosed in WO 93/08829 and Traunecker et al., EMBO J. 10: 3655-3659 (1991).
In a different approach, antibody variable domains with the desired binding specificities (antigen-antibody combining sites) are fused to immunoglobulin constant domain sequences. The fusion is preferably an Ig heavy chain constant domain comprising at least part of the hinge, C _H 2 and C _H 3 regions. It is desirable to have a first heavy chain constant region (C _H 1) containing the site necessary for light chain binding, present in at least one of the fusions. DNA encoding an immunoglobulin heavy chain fusion, if desired, an immunoglobulin light chain, is inserted into a separate expression vector and cotransfected into a suitable host organism. This allows great flexibility in adjusting the mutual proportions of the three polypeptide fragments in an embodiment where unequal proportions of the three polypeptide chains used in the assembly result in optimal yield of the desired bispecific antibody. Is given. However, if expression at an equal ratio of at least two polypeptide chains yields a high yield, or if the ratio does not significantly affect the binding of the desired chain, then all 2 or 3 polypeptide chains Can be inserted into one expression vector.

The invention comprises two arms consisting of a hybrid immunoglobulin heavy chain of one arm having a first binding specificity and a hybrid immunoglobulin heavy chain-light chain pair (providing a second binding specificity) of the other arm. Bispecific antibodies are provided. This asymmetric structure separates the desired bispecific compound from unwanted immunoglobulin chain combinations, since only half of the bispecific molecule has an immunoglobulin light chain, providing an easy separation method. It turns out that it makes it easier. This approach is disclosed in WO 94/04690. For further details of generating bispecific antibodies see, for example, Suresh et al., Methods in Enzymology, 121: 210 (1986).
According to another approach described in US Pat. No. 5,731,168, the interface between a pair of antibody molecules can be manipulated to maximize the percentage of heterodimer recovered from recombinant cell culture. A preferred interface includes at least a portion of the C _H 3 domain. In this method, one or more small amino acid side chains from the interface of the first antibody molecule are replaced with larger side chains (eg tyrosine or tryptophan). A complementary “cavity” of the same or similar size as the large side chain is created at the interface of the second antibody molecule by replacing the large amino acid side chain with a small one (eg, alanine or threonine). This provides a mechanism to increase the yield of heterodimers over other unwanted end products such as homodimers.

Bispecific antibodies also include cross-linked or “heteroconjugate” antibodies. For example, one of the heteroconjugate antibodies can be bound to avidin and the other bound to biotin. Such antibodies have been proposed, for example, to target immune system cells against unwanted cells (US Pat. No. 4,676,980) and for the treatment of HIV infection (WO 91/00360, 92/92). No. 23033 and European Patent No. 03089). Heteroconjugate antibodies can be made using any convenient cross-linking method. Suitable crosslinkers are well known in the art and are disclosed in US Pat. No. 4,676,980, along with several crosslinking techniques.
Techniques for producing bispecific antibodies from antibody fragments have also been described in the literature. For example, bispecific antibodies can be prepared using chemical linkage. Brennan et al., Science, 229: 81 (1985) describes a procedure in which intact antibodies are proteolytically cleaved to produce F (ab ′) ₂ fragments. These fragments are reduced in the presence of the dithiol complexing agent, sodium arsenite, to stabilize vicinal dithiols and prevent intermolecular disulfide formation. The produced Fab ′ fragment is then converted to a thionitrobenzoate (TNB) derivative. One of the Fab′-TNB derivatives is then reconverted to Fab′-thiol by reduction with mercaptoethylamine and mixed with equimolar amounts of other Fab′-TNB derivatives to form bispecific antibodies. The produced bispecific antibody can be used as a drug for selective immobilization of an enzyme.

Recent progress has facilitated the direct recovery of Fab′-SH fragments from E. coli, which can be chemically coupled to form bispecific antibodies. Shalaby et al., J. Exp. Med., 175: 217-225 (1992) describes the preparation of _two fully humanized bispecific antibody F (ab ') molecules. Each Fab ′ fragment is secreted separately from E. coli and undergoes directed chemical coupling in vitro to form bispecific antibodies. The bispecific antibody thus formed is capable of binding to normal human T cells and cells overexpressing the ErbB2 receptor and triggers the cytolytic activity of human cytotoxic lymphocytes against human breast tumor targets. It becomes. Various techniques for making and isolating bispecific antibody fragments directly from recombinant cell culture have also been described. For example, bispecific antibodies have been produced using leucine zippers. Kostelny et al., J. Immunol. 148 (5): 1547-1553 (1992). Leucine zipper peptides from Fos and Jun proteins are linked to the Fab ′ portions of two different antibodies by gene fusion. Antibody homodimers are reduced at the hinge region to form monomers and then reoxidized to form antibody heterodimers. This method can also be used for the production of antibody homodimers. The “diabody” technique described by Hollinger et al., Proc. Natl. Acad. Sci. USA, 90: 6444-6448 (1993) provided an alternative mechanism for generating bispecific antibody fragments. The fragment consists of V _H attached to V _L with a linker that is short enough to allow pairing between two domains on the same strand. Thus, the V _H and V _L domains of one fragment are forced to pair with the complementary V _L and V _H domains of the other fragment, thus forming two antigen binding sites. Other strategies for producing bispecific antibody fragments by the use of single chain Fv (sFv) dimers have also been reported. See Gruber et al., J. Immunol. 152: 5368 (1994).
More than bivalent antibodies are also contemplated. For example, trispecific antibodies can be prepared. Tutt et al. J. Immunol. 147: 60 (1991).

6). Heteroconjugate antibodies Heteroconjugate antibodies are also within the scope of the present invention. Heteroconjugate antibodies consist of two covalently bound antibodies. Such antibodies can be used, for example, to target immune system cells to unwanted cells [US Pat. No. 4,676,980] and for the treatment of HIV infection [WO 91/00360; WO 92/200373. European Patent No. 03089] has been proposed. This antibody could be prepared in vitro using known methods in synthetic protein chemistry, including those related to crosslinkers. For example, immunotoxins can be made using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate and those disclosed, for example, in US Pat. No. 4,676,980.

7). Multivalent antibodies Multivalent antibodies can be internalized (and / or catabolized) earlier than bivalent antibodies by cells expressing the antigen to which the antibody binds. The antibody of the present invention may be a multivalent antibody (other than the IgM class) having 3 or more binding sites (eg, a tetravalent antibody), and is easily obtained by recombinant expression of a nucleic acid encoding the antibody polypeptide chain. Can be generated. Multivalent antibodies have a dimerization domain and three or more antigen binding sites. Preferred dimerization domains have (or consist of) an Fc region or a hinge region. In this scenario, the antibody will have an Fc region and three or more antigen binding sites at the amino terminus of the Fc region. Preferred multivalent antibodies here have (or consist of) 3 to 8, preferably 4 antigen binding sites. A multivalent antibody has at least one polypeptide chain (preferably two polypeptide chains), and the polypeptide chain (s) has two or more variable domains. For example, the polypeptide chain (s) has VD1- (X1) n-VD2- (X2) n-Fc, where VD1 is the first variable domain and VD2 is the second variable domain; Fc is one of the polypeptide chains of the Fc region, X1 and X2 represent amino acids or polypeptides, and n is 0 or 1. For example, the polypeptide chain (s) may have: VH-CH1-flexible linker-VH-CH1-Fc region chain; or VH-CH1-VH-CH1-Fc region chain. Here, the multivalent antibody preferably further comprises at least two (preferably four) light chain variable domain polypeptides. The multivalent antibody herein has, for example, from about 2 to about 8 light chain variable domain polypeptides. The light chain variable domain polypeptides discussed herein have a light chain variable domain, and optionally further a CL domain.

8). Processing of Effector Function It is desirable to modify the antibodies of the present invention for effector function, for example to improve the antigen-dependent cell-mediated cytotoxicity (ADCC) and / or complement dependent cytotoxicity (CDC) of the antibody. This can be done by inducing one or more amino acid substitutions in the Fc region of the antibody. Alternatively or additionally, cysteine residues may be introduced into the Fc region, thereby forming an interchain disulfide bond in this region. Allogeneic dimeric antibodies so produced may have improved internalization capabilities and / or increased complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC). See Caron et al., J. Exp. Med. 176: 1191-1195 (1992) and Shopes, BJ Immunol. 148: 2918-2922 (1992). In addition, homodimeric antibodies with improved antitumor activity can be prepared using heterobifunctional cross-linking as described in Wolff et al., Cancer Research 53: 2560-2565 (1993). Alternatively, the antibody can be engineered to have two Fc regions, thereby improving complement lysis and ADCC capabilities. See Stevenson et al., Anti-Cancer Drug Design 3: 219-230 (1989). In order to increase the serum half life of the antibody, one may introduce a salvage receptor binding epitope into the antibody (especially an antibody fragment) as described in US Pat. No. 5,739,277, for example. The term “salvage receptor binding epitope” as used herein refers to the Fc region of an IgG molecule (eg, IgG ₁ , IgG ₂ , IgG ₃ or IgG ₄ ) that is responsible for increasing the in vivo serum half-life of the IgG molecule. Means the epitope.

9. Immunoconjugates The present invention also relates to cytotoxic agents such as chemotherapeutic agents, growth inhibitors, toxins (eg, enzyme-active toxins derived from bacteria, fungi, plants or animals, or fragments thereof), or radioisotopes ( That is, the present invention relates to an immune complex comprising an antibody conjugated with a radioconjugate).
Chemotherapeutic agents useful for the generation of such immune complexes have been described above. Enzyme-active toxins and fragments thereof that can be used include diphtheria A chain, non-binding active fragment of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modeccin A Chain, alpha-sarcin, Aleurites fordii protein, dianthin protein, Phytolaca americana protein (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, Curcin, crotin, sapaonaria officinalis inhibitor, gelonin, mitogellin, restrictocin, phenomycin, enomycin and trichothecene ( tricothecene). A variety of radioactive nucleotides are available for the production of radioconjugated antibodies. Examples include ²¹² Bi, ¹³¹ I, ¹³¹ In, ⁹⁰ Y, and ¹⁸⁶ Re. The conjugates of antibodies and cytotoxic agents are various bifunctional protein coupling agents such as N-succinimidyl-3- (2-pyridyldithiol) propionate (SPDP), iminothiolane (IT), imidoester bifunctional Derivatives (such as dimethyl adipimidate HCL), active esters (such as disuccinimidyl suberate), aldehydes (such as glutaraldehyde), bis-azide compounds (such as bis (p-azidobenzoyl) hexanediamine), bis- Using diazonium derivatives (such as bis- (p-diazonium benzoyl) -ethylenediamine), diisocyanates (such as triene 2,6-diisocyanate), and bis-active fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene) Can be created. For example, a ricin immunotoxin can be prepared as described in Vitetta et al., Science 238: 1098 (1987). Carbon-14-labeled 1-isothiocyanatobenzyl-3-methyldiethylenetriaminepentaacetic acid (MX-DTPA) is an example of a chelating agent for conjugation of radionucleotide to an antibody. See WO94 / 11026.
Conjugates of antibodies and one or more small molecule toxins such as calicheamicin, maytansinoids, trichothene and CC1065, and derivatives of these toxins with toxic activity are discussed herein.

Maytansine and maytansinoid Anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, of the present invention Anti-PRO732, Anti-PRO1003, Anti-PRO1104, Anti-PRO1151, Anti-PRO1244, Anti-PRO1298, Anti-PRO1313, Anti-PRO1570, Anti-PRO1886, Anti-PRO1891, Anti-PRO4409, Anti-PRO5725, Anti-PRO5994, Anti-PRO6097, Anti-PRO1022, Anti-PRO1022 The anti-PRO61709 or anti-PRO779 antibody (full length or fragment) binds to one or more maytansinoid molecules. It is.
Maytansinoids are mitotic inhibitors that act to inhibit tubulin polymerization. Maytansine was first isolated from the East African shrub Maytenus serrata (US Pat. No. 3,896,111). It was subsequently discovered that certain microorganisms produce maytansinoids such as maytansinol and C-3 maytansinol esters (US Pat. No. 4,115,042). Synthetic maytansinol and its derivatives and analogs are described, for example, in U.S. Pat. Nos. 4,137,230; 4,248,870; 4,256,746; 4,260,608; 4,265,814; 4,294,776; 4309428; 43313946; 4331529; 4317821; 43322348; 43331598; 43361650; 43364866; 44424219; 44362653; 43621663; and 43671533 The disclosure of which is expressly incorporated herein by reference.

Maytansinoid-antibody conjugates In an attempt to improve the therapeutic index, maytansin and maytansinoids are bound to antibodies that specifically bind to tumor cell antigens. Immunoconjugates containing maytansinoids and their therapeutic uses are disclosed, for example, in US Pat. Nos. 5,208,020, 5,416,064, EP 0425235B1, the disclosure of which is Is explicitly included here. Liu et al., Proc. Natl. Acad. Sci. USA 93: 8618-8623 (1996) describes an immunoconjugate containing a maytansinoid designated DM1 that binds to the monoclonal antibody C242 against human colorectal cancer. Has been. The conjugate has been found to be highly cytotoxic to cultured colon cancer cells and exhibits antitumor activity in an in vivo tumor growth assay. Chari et al., Cancer Research, 52: 127-131 (1992), describes a mouse antibody A7 in which maytansinoids bind to an antigen of a human colon cancer cell line via a disulfide bond, or a HER-2 / neu oncogene. Immunoconjugates have been described that bind to another mouse monoclonal antibody TA.1 that binds to. The cytotoxicity of the TA.1-maytansinoid conjugate was tested in vitro in the human breast cancer cell line SK-BR-3 and expressed 3 × 10 ⁵ HER-2 surface antigen per cell. Drug conjugates achieve a degree of cytotoxicity similar to that of the free maytansinoid agent, which is increased by increasing the number of maytansinoid molecules per antibody molecule. The A7-maytansinoid conjugate showed low systemic cytotoxicity in mice.

Anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO1003, anti-PRO1003, anti-PRO1003 , Anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10282, anti-PRO67179 or anti-PRO6779 Maytansinoid conjugate (immunoconjugate)
Anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO1003, anti-PRO1003, anti-PRO1003 , Anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10282, anti-PRO67179 or anti-PRO6779 Maytansinoid conjugates are anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO23. 6, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO1003, anti-PRO1104, anti-PRO1152, anti-PRO1298, anti-PRO1298 Any biological of anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10282, anti-PRO61709 or anti-PRO779 antibody or maytansinoid molecule It is prepared by chemically linking an anti-PRO antibody to a maytansinoid molecule with little reduction in activity. A single molecule of toxin / antibody is expected to increase cytotoxicity in the use of naked antibodies, but an average of 3-4 maytansinoid molecules bound per antibody molecule is the function or lysis of the antibody. It exhibits the effect of improving cytotoxicity against target cells without adversely affecting sex. Maytansinoids are well known in the art and can be synthesized by known techniques or isolated from natural sources. Suitable maytansinoids are disclosed, for example, in US Pat. No. 5,208,020 and other patents and publications that are not the aforementioned patents. Preferred maytansinoids are maytansinol analogs, such as maytansinol, and various maytansinol esters modified at the aromatic ring or other positions of the maytansinol molecule.
For example, to make antibody-maytansinoid conjugates, including those disclosed in US Pat. No. 5,208,020 or EP 0425235B1, and those disclosed in Chari et al., Cancer Research, 52: 127-131 (1992). There are many linking groups known in the art. The linking group includes disulfide groups, thioether groups, acid labile groups, photolabile groups, peptidase labile groups, or esterase labile groups as disclosed in the above-mentioned patents, but disulfide and thioether groups. Is preferred.

Conjugates of antibodies and maytansinoids have various bifunctional protein coupling agents such as N-succinimidyl-3- (2-pyridyldithio) propionate (SPDP), succinimidyl-4- (N-maleimidomethyl) cyclohexane -1-carboxylate, iminothiolane (IT), bifunctional derivatives of imide esters (eg dimethyl adipimidate HCL), active esters (eg disuccinimidyl suberate), aldehydes (eg glutaraldehyde) ), Bisazide compounds (eg, bis (p-azidobenzoyl) hexanediamine), bis-diazonium derivatives (eg, bis- (p-diazoniumbenzoyl) ethylenediamine), diisocyanates (eg, toluene-2,6-diisocyanate), and Diactive fluorine compounds (eg, 1,5-difluoro -2,4-dinitrobenzene). Particularly preferred coupling agents include N-succinimidyl-4- (2-pyridylthio) pentanoate (SPP) and N-succinimidyl-3- (2-pyridyldithio) propionate (SPDP) (Carlsson) provided by disulfide bonds. Et al., Biochem. J. 173: 723-737 [1978]).
The linker can be attached to the maytansinoid molecule at various positions depending on the type of linkage. For example, ester linkages can be formed by reacting with hydroxyl groups using conventional coupling techniques. The reaction occurs at the C-3 position with a hydroxyl group, the C-14 position modified with hydroxymethyl, the C-15 position modified with a hydroxyl group, and the C-20 position with a hydroxyl group. In a preferred embodiment, the bond is formed at the C-3 position of maytansinol or an analogue of maytansinol.

Calicheamicin Other immunoconjugates of interest include anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328 conjugated to one or more calicheamicin molecules. Anti-PRO344, Anti-PRO357, Anti-PRO526, Anti-PRO724, Anti-PRO731, Anti-PRO732, Anti-PRO1003, Anti-PRO1104, Anti-PRO1151, Anti-PRO1244, Anti-PRO1298, Anti-PRO1313, Anti-PRO1570, Anti-PRO1886, Anti-PRO1891, Anti-PRO4091 PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10282, anti-PRO61709 or anti-PRO779 antibody included. The calicheamicin family of antibiotics can cause double-stranded DNA breakage at sub-picomolar concentrations. For the preparation of conjugates of the calicheamicin family, U.S. Pat. See Company). The calicheamicin structural analogs that can be used include, but are not limited to, γ ₁ ^I , α ₂ ^I , α ₃ ^I , N-acetyl-γ ₁ ^I , PSAG, and θ ^I ₁ (Hinman et al., Cancer Research, 53: 3336-3342 (1993), Lode et al. Cancer Research, 58: 2925-2928 (1998) and the aforementioned American Cyanamid US patent). Another anti-tumor agent to which the antibody can bind is QFA, an antifolate. Both calicheamicin and QFA have a site of action within the cell and do not easily cross the plasma membrane. Thus, the uptake of these drugs into cells by antibody-mediated internalization greatly improves the cytotoxic effect.

Other cytotoxic agents Anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, of the present invention Anti-PRO732, Anti-PRO1003, Anti-PRO1104, Anti-PRO1151, Anti-PRO1244, Anti-PRO1298, Anti-PRO1313, Anti-PRO1570, Anti-PRO1886, Anti-PRO1891, Anti-PRO4409, Anti-PRO5725, Anti-PRO5994, Anti-PRO6097, Anti-PRO1022, Anti-PRO1022 Other anti-tumor agents capable of binding to anti-PRO61709 or anti-PRO779 antibody include BCNU, streptozocin, vincristine And 5-fluorouracil, U.S. Pat. Nos. 5,053,394 and 5,770,710, a family of drugs collectively known as LL-E33288 conjugates, and esperamicin (US Pat. No. 5,877,296). Is included.
Usable enzyme active toxins and fragments thereof include diphtheria A chain, non-binding active fragment of diphtheria toxin, exotoxin A chain (Pseudomonas aeruginosa), ricin A chain, abrin A chain, modecin ) A chain, alpha-sarcin, Aleurites fordii protein, dianthin protein, Phytolaca americana protein (PAPI, PAPII and PAP-S), momordica momordica Included are charantia inhibitors, curcin, crotin, sapaonaria officinalis inhibitors, gelonin, mitogellin, restrictocin, phenomycin, enomycin and trichothecenes. See, for example, International Publication No. 93/21232 published October 28, 1993.
The present invention further contemplates immunoconjugates formed between an antibody and a compound having nucleolytic activity (eg, a ribonuclease or DNA endonuclease such as deoxyribonuclease; DNase).

In order to selectively destroy the tumor, the antibody may contain highly radioactive atoms. Radioconjugated anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO732, anti-PRO732, anti-PRO732, PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10282, anti-PRO10282, anti-PRO10282, anti-PRO10282 A variety of radioisotopes are utilized to generate anti-PRO779 antibodies. Examples include the radioisotopes of At ²¹¹ , I ¹³¹ , I ¹²⁵ , Y ⁹⁰ , Re ¹⁸⁶ , Re ¹⁸⁸ , Sm ¹⁵³ , Bi ²¹² , P ³² , Pb ²¹² and Lu. If the conjugate is used for diagnostic purposes, it may be a radioactive atom for scintigraphic studies, such as tc ^99m or I ¹²³ , or a spin label for nuclear magnetic resonance (NMR) imaging (magnetic resonance imaging, also known as mri), For example, iodine-123, iodine-131, indium-111, fluorine-19, carbon-13, nitrogen-15, oxygen-17, gadolinium, manganese or iron may be contained.
Radioactive or other label is introduced into the conjugate in a known manner. For example, peptides are biosynthesized or synthesized by chemical amino acid synthesis using a suitable amino acid precursor containing fluorine-19 instead of hydrogen. Labels such as tc ^99m or I ¹²³ , Re ¹⁸⁶ , Re ¹⁸⁸ and In ¹¹¹ can be attached via the cysteine residue of the peptide. Yttrium-90 can be attached via a lysine residue. The IODOGEN method (Fraker et al. (1978) Biochem. Biophys. Res. Commun. 80: 49-57) can be used to introduce iodine-123. Details of other methods are described in “Monoclonal Antibodies in Immunoscintigraphy” (Chatal, CRC Press 1989).

  Conjugates of antibodies and cytotoxic agents are available for various bifunctional protein coupling agents such as N-succinimidyl-3- (2-pyridyldithio) propionate (SPDP), succinimidyl-4- (N-maleimidomethyl) cyclohexane- 1-carboxylate, iminothiolane (IT), bifunctional derivatives of imide esters (eg dimethyl adipimidate HCL), active esters (eg disuccinimidyl suberate), aldehydes (eg glutaraldehyde) Bisazide compounds (eg bis (p-azidobenzoyl) hexanediamine), bis-diazonium derivatives (eg bis- (p-diazoniumbenzoyl) ethylenediamine), diisocyanates (eg triene-2,6-diisocyanate), and Active fluorine compounds (eg, 1,5-difluoro-2,4-di- Nitrobenzene) can be used. For example, a ricin immunotoxin can be prepared as described in Vitetta et al., Science 238: 1098 (1987). Carbon-14 labeled 1-isothiocyanatobenzyl-3-methyldiethylene-triaminepentaacetic acid (MX-DTPA) is an example of a chelating agent for conjugating radionucleotide to an antibody. See WO94 / 11026. The linker may be a “cleavable linker” to facilitate release of the cytotoxic agent in the cell. For example, acid labile linkers, peptidase-sensitive linkers, photolabile linkers, dimethyl linkers or disulfide-containing linkers can be used (Chari et al., Cancer Research, 52: 127-131 (1992); US Pat. No. 5,208,020).

Alternatively, anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, PRO1003, anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10282, anti-PRO10282, anti-PRO10282, anti-PRO10282 Fusion proteins containing anti-PRO779 antibodies and cytotoxic agents can be made, for example, by recombinant techniques or peptide synthesis. It is. The length of the DNA contains regions encoding the two portions of the conjugate that are separated by regions that encode linker peptides that do not destroy the desired properties of the conjugate or are adjacent to each other.
The present invention provides that an antibody can be conjugated to a “receptor” (eg, streptavidin) for use in tumor pre-targeting, wherein the antibody-receptor conjugate is administered to a patient followed by clarification. The agent is used to remove unbound conjugate from the circulation and administer a “ligand” (eg, avidin) that is conjugated to a cytotoxic agent (eg, a radionucleotide).

10. Immunoliposomes disclosed herein: anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, Anti-PRO732, Anti-PRO1003, Anti-PRO1104, Anti-PRO1151, Anti-PRO1244, Anti-PRO1298, Anti-PRO1313, Anti-PRO1570, Anti-PRO1886, Anti-PRO1891, Anti-PRO4409, Anti-PRO5725, Anti-PRO5994, Anti-PRO6097, Anti-PRO1022, Anti-PRO1022 The anti-PRO61709 or anti-PRO779 antibody can also be formulated as an immunoliposome. “Liposomes” are various types of endoplasmic reticulum containing lipids, phospholipids and / or surfactants that are useful for drug delivery to mammals. The components of the liposome are usually arranged in a bilayer structure similar to the lipid orientation of a biofilm. Liposomes containing antibodies are described, for example, in Epstein et al., Proc. Natl. Acad. Sci. USA 82: 3688 (1985); Hwang et al., Proc. Natl. Acad. Sci. USA 77: 4030 (1980); 4448545 and 45454545; and WO 97/38731 published Oct. 23, 1997 by methods known in the art. Liposomes with increased circulation time are disclosed in US Pat. No. 5,013,556.
Particularly useful liposomes can be made by the reverse phase evaporation method with a lipid composition containing phosphatidylcholine, cholesterol and PEG-derivatized phosphatidylethanolamine (PEG-PE). Liposomes are extruded through a filter with a defined pore size to obtain liposomes having a desired diameter. Fab ′ fragments of antibodies of the invention can be conjugated to liposomes via a disulfide exchange reaction as described by Martin et al., J. Biol. Chem. 257: 286-288 (1982). . In some cases, the chemotherapeutic agent is included within the liposome. See Gabizon et al., J. National Cancer Inst. 81 (19) 1484 (1989).

11. Pharmaceutical compositions of antibodies identified here PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1104, PRO1104, PRO1104 Antibodies specifically binding to PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides, as well as other molecules identified in the screening assays disclosed above, include For the treatment of various diseases, pharmaceuticals It can be administered in the form of a composition.
PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213 Internalized antibodies are preferred when the PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide is intracellular and all antibodies are used as inhibitors. However, lipofection or liposomes can also be used to introduce antibodies, or antibody fragments, into cells. Where antibody fragments are used, the smallest inhibitory fragment that specifically binds to the binding domain of the target protein is preferred. For example, peptide molecules that retain the ability to bind to a target protein sequence can be designed based on the variable region sequence of the antibody. Such peptides can be synthesized chemically or can be produced by recombinant DNA techniques. See, for example, Marasco et al., Proc. Natl. Acad. Sci. USA 90, 7889-7893 (1993). The formulations herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. Alternatively, or in addition, the composition may comprise a cytotoxic agent, cytokine or growth inhibitor. These molecules are suitably present in combination in amounts that are effective for the purpose intended.

The active ingredient can also be used in colloidal drug delivery systems (eg , Liposomes, albumin globules, microemulsions, nanoparticles and nanocapsules) or in microemulsions. These techniques are disclosed in Remington's Pharmaceutical Science, supra.
The formulation used for in vivo administration must be sterile. This is easily accomplished by filtration through sterile filtration membranes.
Sustained release formulations may be prepared. Suitable examples of sustained release formulations include a semi-permeable matrix of solid hydrophobic polymer containing antibodies, which matrix is in the form of a molded article, such as a film or microcapsule. Examples of sustained release matrices are polyester hydrogels (eg poly (2-hydroxyethyl-methacrylate) or poly (vinyl alcohol)), polyactides (US Pat. No. 3,773,919), L-glutamic acid and γ-ethyl-L-glutamate. , Non-degradable ethylene-vinyl acetate, LUPRON DEPOT (trade name) (injectable globules of lactic acid-glycolic acid copolymer and leuprolide acetate), poly-D-(-)-3 -Contains hydroxybutyric acid. While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid can release molecules for over 100 days, certain hydrogels release proteins in a shorter time. When encapsulated antibodies remain in the body for a long time, they denature or aggregate upon exposure to moisture at 37 ° C, resulting in reduced biological activity and possible changes in immunogenicity. . Reasonable methods can be devised for stabilization depending on the mechanism involved. For example, if the aggregation mechanism is found to be intermolecular S—S bond formation through thio-disulfide exchange, stabilization may include modification of sulfhydryl residues, lyophilization from acidic solutions, control of water content, appropriate Addition of various additives and the development of specific polymer matrix compositions.

G. Anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO1003, anti-PRO1003, anti-PRO1003 , Anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10282, anti-PRO67179 or anti-PRO6779 Applications Anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245 of the present invention Anti-PRO246, Anti-PRO258, Anti-PRO287, Anti-PRO328, Anti-PRO344, Anti-PRO357, Anti-PRO526, Anti-PRO724, Anti-PRO731, Anti-PRO732, Anti-PRO1003, Anti-PRO1104, Anti-PRO1151, Anti-PRO1244, Anti-PRO1270, Anti-PRO1513 , Anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10282, anti-PRO61709 or anti-PRO779 antibodies are neuropathies; cardiovascular, endothelial or angiogenic diseases; It has various therapeutic and / or diagnostic utilities for abnormalities; immune disorders; oncological disorders; embryonic developmental disorders or death, or metabolic disorders. For example, anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO1003, Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10282, anti-PRO6779 Antibodies are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246. PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, RO18910, RO18409, RO4409P It is used to detect PRO61709 or PRO779 diagnostic assays, for example, its expression in specific cells, tissues, or serum (and in some cases differential expression). Competitive binding assays, direct or indirect sandwich assays, and immunoprecipitation assays performed in heterogeneous or homogeneous phases [Zola, Monoclonal Antibodies: A Manual of Techniques, CRC Press, Inc. (1987) pp. 147-158] Various diagnostic assay techniques known in the art are used. Antibodies used in diagnostic assays can be labeled with a detectable moiety. The detectable site must generate a detectable signal, either directly or indirectly. For example, the detectable site may be a radioisotope such as ³ H, ¹⁴ C, ³² P, ³⁵ S or ¹²⁵ I, a fluorescent or chemiluminescent compound such as fluorescein isothiocyanate, rhodamine or luciferin, or alkaline phosphatase, beta-galactosidase Or it may be an enzyme such as horseradish peroxidase. Any method known in the art can be used to conjugate the detectable site to the antibody, including Hunter et al. Nature, 144: 945 (1962); David et al., Biochemistry, 13: 1014 (1974); Pain Et al., J. Immunol. Meth., 40: 219 (1981); and Nygren, J. Histochem. And Cytochem., 30: 407 (1982).

Also, anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO1003, Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 Antibodies can be produced from recombinant cell culture or PRO196, PRO217, PRO231, PRO23 from natural sources. , PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1357, PRO1857, PRO1857, , PRO10102, PRO10282, PRO61709 or PRO779 are also useful for affinity purification. In this method, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 Antibodies against PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides using suitable methods such as Sephadex resin or filter paper using methods well known in the art. Immobilize on the support. Next, the immobilized antibodies are purified by PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1104, PRO1104, PRO1104 After contacting with a sample containing PRO1298, PRO1313, PRO1570, PRO1870, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, PRO176, PRO2, bound to the immobilized antibody PRO231, PRO236, PRO24 , PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1586, PRO1586, PRO1586, PRO1586 The support is washed with a suitable solvent that removes substantially all of the material in the sample other than the PRO10282, PRO61709 or PRO779 polypeptide. Finally, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO12845 , PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or other suitable solvent that will release the polypeptide from the antibody.
The following examples are provided for purposes of illustration only and are not intended to limit the scope of the invention in any way.
All patents and references cited herein are hereby incorporated by reference.

  Commercially available reagents referred to in the examples were used according to manufacturer's instructions unless otherwise indicated. The source of these cells identified by the ATCC accession numbers in the examples below, as well as herein, is the American Type Culture Collection (Manassas, VA).

Example 1
Extracellular domain homology screening to identify novel polypeptides and cDNAs encoding them
Extracellular domain (ECD) sequences (including secreted signal sequences, if any) from about 950 known secreted proteins from the Swiss-Prot public database were used to search the EST database. EST databases include public databases (eg, Dayhof, GenBank) and corporate databases (eg, LIFESEQ ^™ , Incyte Pharmaceuticals, Palo Alto, CA). The search was performed using the computer program BLAST or BLAST-2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)) as a comparison between the ECD protein sequence and the 6-frame translation of the EST sequence. Using the program “phrap” (Phil Green, Seattle, Washington, University of Washington), comparisons with a BLAST score of 70 (possibly 90) that do not encode known proteins were clustered and assembled into a consensus DNA sequence. .
This extracellular domain homology screen was used to assemble consensus DNA sequences against other identified EST sequences using phrap. Furthermore, the resulting consensus DNA sequence is often extended using repeated (but not always) BLAST or BLAST-2 and phrap cycles, and the consensus sequence is as long as possible using the sources of EST sequences discussed above. Elongated.
Based on the consensus sequence obtained as described above, oligonucleotides are then synthesized, and a cDNA library containing the sequence of interest is identified by PCR, and a clone of the full-length coding sequence of the PRO polypeptide is cloned. Used as a probe to release. Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give PCR products that are about 100-1000 bp long. The probe sequence is typically 40-55 bp long. In some cases, additional oligonucleotides were synthesized when the consensus sequence was greater than about 1-1.5 kbp. To screen several libraries for full-length clones, DNA from the libraries was screened by PCR with PCR primer pairs as in Ausubel et al., Current Protocols in Molecular Biology. The positive library was then used to isolate a clone encoding the gene of interest using one of the probe oligonucleotide and primer pair.
The cDNA library used to isolate the cDNA clones was made by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA is primed with oligo dT containing a NotI site, ligated to a SalI hemikinase adapter with blunt ends, cut with NotI, roughly sized by gel electrophoresis, and an appropriate cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain an SfiI site (see Holmes et al., Science, 253: 1278-1280 (1991)) and was cloned into the unique XhoI and NotI sites in a defined orientation.

Example 2: Isolation of cDNA clones by amylase screening Preparation of oligo dT primed cDNA library mRNA was isolated from human tissues of interest using reagents and protocols from Invitrogen, San Diego, CA (Fast Track 2). This RNA was used to generate oligo dT primed cDNA in vector pRK5D using reagents and protocols from Life Technologies, Gaithersburg, MD (Super Script Plasmid System). In this method, double-stranded cDNA was classified into a size exceeding 1000 bp, and SalI / NotI binding cDNA was cloned into an XhoI / NotI digested vector. pRK5D was cloned into a vector with an sp6 transcription initiation site followed by an SfiI restriction enzyme site, followed by a XhiI / NotI cDNA cloning site.
2. Preparation of Random Primed cDNA Library A secondary cDNA library was created to favorably represent the 5 ′ end of the primary cDNA clone. Sp6 RNA was generated from the primary library (described above) and this RNA was ligated into the vector pSST-AMY. Used to generate a randomly primed cDNA library using reagents and protocols from Life Technologies at 0 (Super Script Plasmid System referenced above). In this method, double stranded cDNA was sized to 500-1000 bp, ligated to a NotI adapter with blunt ends, cut at the SfiI site, and cloned into an SfiI / NotI cut vector. pSST-AMY. 0 is a cloning vector having a yeast alcohol dehydrogenase promoter before the cDNA cloning site and a mouse amylase sequence (mature sequence without a secretion signal) after the cloning site followed by an alcohol dehydrogenase transcription termination region. Thus, cDNA cloned into this vector fused in frame to the amylase sequence will lead to secretion of amylase from appropriately transfected yeast colonies.

3. Transformation and detection DNA from the library described in paragraph 2 above was chilled on ice, to which was added electrocompetent DH10B bacteria (Life Technologies, 20 ml). The bacteria and vector mixture was then electroporated as recommended by the manufacturer. SOC medium (Life Technologies, 1 ml) was then added and the mixture was incubated at 37 ° C. for 30 minutes. Transformants were then plated on 20 standard 150 mm LB plates containing ampicillin and incubated for 16 hours (37 ° C.). Positive colonies were discarded from the plates and DNA was isolated from bacterial pellets using standard methods such as the CsCl-gradient method. The purified yeast was then subjected to the following yeast protocol.
Yeast methods can be divided into three categories: (1) transformation with yeast plasmid / cDNA binding vectors; (2) detection and isolation of yeast clones secreting amylase; and (3) direct from yeast colonies. PCR amplification and sequencing of the insert and purification of DNA for further analysis.
The yeast strain used was HD56-5A (ATCC-90785). This strain has the following genotypes: MAT alpha, ura3-52, leu2-3, leu2-112, his3-11, his3-15, MAL ⁺ , SUC ⁺ , GAL ⁺ . Preferably, yeast mutants with incomplete post-translational pathways can be used. Such mutants have transpositional deficient alleles at sec71, sec72, and sec62, with truncated sec71 being most preferred. Alternatively, antagonists (including antisense nucleotides and / or ligands) that interfere with the normal operation of these genes, other proteins involved in this post-translational pathway (eg, SEC61p, SEC72p, SEC62p, SEC63p, TDJ1p, SSA1p − 4p) or complex formation of these proteins is also preferably used in combination with amylase-expressing yeast.

Transformation was performed based on the protocol outlined in Gietz et al., Nucl. Acid. Res., 20: 1425 (1992). The transformed cells were then seeded from agar into YEPD complex medium broth (100 ml) and grown overnight at 30 ° C. YEPD broth was prepared as described in Kaiser et al., Methods in Yeast Genetics, Cold Spring Harbor Press, Cold Spring Harbor, NY, p. 207 (1994). The overnight medium is then diluted to approximately 2 × 10 ⁶ cells / ml (about OD ₆₀₀ = 0.1) in fresh YEPD broth (500 ml) and 1 × 10 ⁷ cells / ml (about OD ₆₀₀ = 0.4-0.0). Re-growth until 5).
The cells are then harvested and prepared for transformation by transferring to a GS3 rotor bottle in a Sorval GS3 rotor for 5 minutes at 5000 rpm, discarding the supernatant and then resuspending in sterile water, in a 50 ml Falcon tube. Centrifuge again at 3500 rpm in a Beckman GS-6KR centrifuge. The supernatant is discarded and the cells are subsequently washed with LiAc / TE (10 ml, 10 mM Tris-HCl, 1 mM EDTA pH 7.5, 100 mM Li ₂ OOCCH ₃ ) and re-introduced in LiAc / TE (2.5 ml). Suspended.
Transformation occurs by mixing the prepared cells (100 μl) with fresh denatured single-stranded salmon sperm DNA (Lofstrand Labs, Gaitherburg, MD) and transforming DNA (1 μg vol. <10 μl) in a microtube. I let you. The mixture was mixed briefly by vortexing, then 40% PEG / TE (600 μl, 40% polyethylene glycol-4000, 10 mM Tris-HCl, 1 mM EDTA, 100 mM Li ₂ OOCCH ₃ , pH 7.5) was added. . The mixture was gently agitated and incubated at 30 ° C. with agitation for 30 minutes. The cells were then heat shocked at 42 ° C. for 15 minutes, and the reaction vessel was centrifuged in a microtube at 12000 rpm for 5-10 seconds, decanted, and made into TE (500 μl, 10 mM Tris-HCl, 1 mM EDTA pH 7.5). After resuspension, it was centrifuged. The cells were then diluted in TE (1 ml) and aliquots (200 μl) were spread on selective media previously prepared in 150 mm growth plates (VWR).

Alternatively, transformation was performed in a single large scale reaction rather than multiple small reactions, but the amount of reagent was scaled up accordingly.
The selection medium used was synthetic complete dextrose agar lacking uracil prepared as described in Kaiser et al., Methods in Yeast Genetics, Cold Spring Harbor Press, Cold Spring Harbor, NY, p. 208-210 (1994). SCD-Ura). Transformants were grown at 30 ° C. for 2-3 days.
Detection of colonies secreting amylase was performed by including red starch in the selective growth medium. Starch was coupled to a red dye (reactive Red-120, Sigma) according to the method described in Biely et al., Anal. Biochem., 172: 176-179 (1988). Bound starch was introduced into SCD-Ura agar plates at a final concentration of 0.15% (w / v) and buffered to pH 7.0 with potassium phosphate (final concentration 50-100 mM).
Positive colonies were picked and streaked on fresh selective medium (150 mm plate) to obtain a well-isolated and identifiable single colony. Well isolated colonies positive for amylase secretion were detected by direct introduction of red starch into buffered SCD-Ura agar. Positive colonies were determined by their ability to degrade starch and produce a visible halo directly around the positive colonies.

4). Isolation of DNA by PCR amplification When positive colonies were isolated, a portion was picked with a toothpick and diluted in sterile water (30 μl) in a 96-well plate. At this point, positive colonies are either frozen and stored for subsequent analysis or are immediately amplified. Aliquots of cells (5 μl) were added to 0.5 μl Klentaq (Clontech, Palo Alto, Calif.); 4.0 μl 10 mM dNTP (Perkin Elmer-Cetus); 2.5 μl Kentaq buffer (Clontech); 0.25 μl positive Direction Oligo 1; 0.25 μl Reverse Oligo 2; used as template for PCR reaction in 25 μl volume containing 12.5 μl distilled water. The sequence of forward oligonucleotide 1 is:
5'-TGTAAAACGACGGCCAGT TAAATAGACCTGCAATTATTAATCT -3 '(SEQ ID NO: 67)
The sequence of reverse oligonucleotide 2 is:
5'-CAGGAAACAGCTATGACC ACCTGCACACCTGCAAATCCATT -3 '(SEQ ID NO: 68)
The PCR was then performed as follows:
a. Denaturation 92 ° C., 5 minutes b. Next 3 cycles Denaturation 92 ° C, 30 seconds
Annealing 59 ° C, 30 seconds
Elongation 72 ° C, 60 seconds c. Next 3 cycles Denaturation 92 ° C, 30 seconds
Annealing 57 ° C, 30 seconds
Elongation 72 ° C, 60 seconds d. Next 25 cycles Denaturation 92 ° C, 30 seconds
Annealing 55 ° C, 30 seconds
Elongation 72 ° C, 60 seconds e. Holding 4 ℃
The underlined regions of the oligonucleotide are annealed to the ADH promoter region and amylase region, respectively, and in the absence of an insert, the vector pSST-AMY. A 307 bp region from 0 was amplified. Typically, the first 18 nucleotides at the 5 ′ end of these oligonucleotides contained the annealing site for the sequence primer. Thus, the total product of the PCR reaction from the empty vector was 343 bp. However, the signal sequence fusion cDNA resulted in a fairly long nucleotide sequence.
Following PCR, an aliquot (5 μl) of the reaction was examined by agarose gel electrophoresis using a Tris-borate-EDTA (TBE) buffer system in a 1% agarose gel as described in Sambrook et al., Supra. . Clones yielding a single strong PCR product greater than 400 bp were further analyzed by DNA sequence after purification on a 96 Qiaquick PCR clean column (Quagen Inc., Chatsworth, Calif.).

Example 3 Isolation of cDNA Clones Using Signal Algorithm Analysis Various polypeptide-encoding nucleic acid sequences were obtained from publicly available signal sequence discovery algorithms developed by Genentech (South San Francisco, Calif.). For example, identified by applying to ESTs and populations and assembled EST fragments from GenBank) and / or private (LIFESEQ®, Incyte Pharmaceuticals, Inc., Palo Alto, Calif.) Databases. The signal sequence algorithm calculates a secretory signal score based on the letters of the DNA nucleotide surrounding the first and optionally the second methionine codon (ATG) at the 5'-end of the sequence or sequence fragment under consideration. The nucleotide following the first ATG must encode at least 35 unambiguous amino acids without a stop codon. If the first ATG has the necessary amino acids, the second is not analyzed. If none of the requirements is met, the candidate sequence is not scored. In order to determine whether an EST sequence contains a genuine signal sequence, a set of seven sensors (evaluation parameters) known to be associated with the secretory signal is used to determine the DNA surrounding the ATG codon and the corresponding amino acid sequence. Use to score. Using this algorithm, a number of polypeptide-encoding nucleic acid sequences have been identified.

  PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, disclosed herein, using the methods described in Examples 1 to 3 above. PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709, or PRO779, which encodes a full-length cDNA encoding a full-length polypeptide. These cDNAs were then deposited in the American Type Culture Collection at University Street 10801, Manassas, Virginia, 20110-2209 in accordance with the Budapest Treaty as shown in Table 7 below. Also, the sequence of DNA98591 encoding the PRO5994 polypeptide was identified from Genbank accession number: AF048700; the sequence of DNA347767 encoding the PRO61709 polypeptide was identified from Genbank accession number AB029000.

Table 7
Material ATCC Deposit Number Date deposited
DNA22779-1130 209280 September 18, 1997 DNA33094-1131 209256 September 16, 1997 DNA34434-1139 209252 September 16, 1997 DNA35599-1168 209373 October 16, 1997 DNA35638-1141 209265 September 16, 1997 DNA35639-1172 209396 October 17, 1997 DNA35918-1174 209402 October 17, 1997 DNA39969-1185 209400 October 17, 1997 DNA40587-1231 209438 November 7, 1997 DNA40592-1242 209492 November 21, 1997 DNA44804-1248 209527 Dec. 10, 1997 D NA44184-1319 209704 March 26, 1998 DNA49631-1328 209806 April 28, 1998 DNA48331-1329 209715 March 31, 1998 DNA48334-1435 209924 June 2, 1998 DNA58846-1409 209957 June 9, 1998 DNA59616-1465 209991 June 16, 1998 DNA44694-1500 203114 August 11, 1998 DNA64888-1526 203253 September 9, 1998 DNA66511-1563 203228 September 15, 1998 DNA64966-1575 203575 1999 January 12 DNA 68885-1678 20311 October 6, 1998 DNA80796-25 23 203555 December 22, 1998 DNA76788-2526 203551 December 22, 1998 DNA88804-2575 203890 March 30, 1999 DNA92265-2669 PTA-256 June 22, 1999 DNA107701-2711 PTA-487 August 1999 3 days DNA 108792-2753 PTA-617 August 31, 1999 DNA129542-2808 PTA-1178 January 11, 2000 DNA148380-2828 PTA-1181 January 11, 2000 DNA58801-1052 55820 September 5, 1996 The deposit was made in accordance with the provisions of the Budapest Treaty and its regulations (Budapest Convention) on the international recognition of the deposit of microorganisms in the patent procedure. This ensures that the viable culture of the deposit is maintained for 30 years from the date of deposit. Deposits may be obtained from the ATCC in accordance with the terms of the Budapest Treaty and in accordance with the agreement between Genentech and ATCC, regardless of which is the first issue of the relevant U.S. patent or any Ensures that the progeny of the deposited culture are made available permanently and unrestricted at the time of publication of a US or foreign patent application, and is subject to 35 USC 122 and the Patent Office Commissioner Regulation (specifically 37 CFR of reference number 886OG638). Guarantees that the offspring will be made available to those who have been determined to have the rights in accordance with (including Section 1.14).
The assignee of this application agrees that if the deposited culture dies or is lost or destroyed when cultured under appropriate conditions, the material will be immediately replaced with the same other upon notification. To do. The availability of deposited materials is not considered a license to practice the present invention in violation of rights granted under any governmental authority in accordance with patent law.

Example 4
Isolation of cDNA clones encoding human PRO196 (NL1) polypeptide (UNQ170) NL1 was identified by screening the GenBank database using the computer program BLAST (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). The NL1 sequence exhibits homology with the known expressed gene sequence fragment (EST) sequences T35448, T11442, and W77823. Among the known EST sequences, it has been identified as a full-length sequence or has a TIE receptor. None are described as bound ligands.
Once identified, NL1 was cloned from a human embryonic lung library prepared from catalog # 65288-1 mRNA purchased from Clontech, Inc. (Palo Alto, Calif.) According to the manufacturer's instructions.
The library was ligated into the pRK5B vector. This vector was a precursor of pRK5D without the SfiI site (see Holmes et al., Science, 253: 1278-1280 (1991)). Therefore, pRK5D is a derivative of pRK5 (published March 15, 1989, EP307247), and the differences in their polylinker sequences are small. Based on ESTs found in the GenBank database, the library was screened by hybridization with synthetic oligonucleotide probes:
NL1.5-1 5'-GCTGACGAACCAAGGCAACTACAAACTCCTGGT SEQ ID NO: 69
NL1.3-1 5'-TGCGGCCGGACCAGTCCTCCATGGTCACCAGGAGTTTGTAG SEQ ID NO: 70
NL1.3-2 5'-GGTGGTGAACTGCTTGCCGTTGTGCCATGTAAA SEQ ID NO: 71
The entire cDNA sequence has been sequenced. The cDNA sequence was sequenced as is.
The nucleotide sequence and amino acid sequence of NL1 are shown in FIG. 1 (SEQ ID NO: 1; DNA22779-1130) and FIG. 2 (SEQ ID NO: 2; PRO196), respectively.
NL1 shows 23% sequence identity to both TIE1 and TIE2 ligands.
A clone of NL1 (designated herein as DNA22779-1130) was incorporated into the American Type Culture Collection (ATCC) (Rockville, Maryland, Park Lane Drive 12301), 1997, based on the Budapest Treaty. It has been deposited on the 18th of March and has been given the deposit number ATCC209280.
NL1 is mapped to chromosome 9, band arm q13-q21.

Example 5: Isolation of cDNA clones encoding human PRO217 polypeptide (UNQ191) The consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Example 1. This consensus sequence was designated herein as DNA28760. Based on the assembled DNA28760 consensus sequence, oligonucleotides can be used as a probe to 1) identify a cDNA library containing the sequence of interest by PCR, and 2) isolate clones of the full length coding sequence of PRO217. Synthesized for use.
A pair of PCR primers (forward and reverse) were synthesized:
Primers for forward PCR:
5'-AAAGACGCATCTGCGAGTGTCC-3 '(SEQ ID NO: 72)
Reverse PCR primers:
5'-TGCTGATTTCACACTGCTCTCCC-3 '(SEQ ID NO: 73)
In addition, a synthetic oligonucleotide hybridization probe was constructed from a DNA28760 consensus sequence having the following nucleotide sequence:
Hybridization probe:
5'-CCCACGATGTATGAATGGTGGACTTTGTGTGACTCCTGGTTTCTGCATC-3 '(SEQ ID NO: 74)

To screen several libraries as a source of full-length clones, DNA from the libraries was screened by PCR amplification using the PCR primer sets identified as described above. A positive library was then used to isolate a clone encoding the PRO217 gene using an oligonucleotide probe and one PCR primer. RNA for construction of the cDNA library was isolated from human fetal lung tissue.
DNA sequencing of the clones isolated as described above yielded the full length DNA sequence of DNA33094-1131 (FIG. 3, SEQ ID NO: 3) and the derived protein sequence of PRO217.
The entire coding sequence of DNA33094-1131 is included in FIG. 3 (SEQ ID NO: 3). Clone DNA33094-1131 contained a single open reading frame, had an apparent translation start site at nucleotide positions 146-148, and had an apparent stop codon at nucleotide positions 1283-1285. The predicted polypeptide precursor is 379 amino acids long, has a molecular weight of approximately 41,528 daltons, and a predicted pi of approximately 7.97. Analysis of the full-length PRO217 sequence shown in FIG. 4 (SEQ ID NO: 4) demonstrated the existence of a wide variety of important polypeptide domains, and the positions of these important polypeptide domains were generally as described above. Analysis of the full length PRO217 polypeptide shown in FIG. 4 (SEQ ID NO: 4) revealed the presence of: A single peptide of approximately amino acids 1-28; an N-glycosylation site of approximately amino acids 88-92 and 245-249; a tyrosine kinase phosphorylation site of approximately amino acids 370-378; approximately amino acids 184-190, 185-191, 189 ~ 195, and 315-321 N myristoylation sites; approximately ATP / GTP binding site motif A (P loop) of amino acids 285-293; approximately amino acids 198-210, 230-242, 262-274, 294-306, and 326-338 EGF-like domain cysteine pattern signature. Clone DNA33094-1131 was deposited with ATCC on September 16, 1997 and was assigned ATCC deposit number 209256.
Based on the BLAST and FastA sequence alignment analysis of the full-length sequence shown in FIG. 4 (SEQ ID NO: 4), PRO217 was considered a novel EGF-like homolog.

Example 6 Isolation of cDNA Clones Encoding Human PRO231 Polypeptide (UNQ205) A consensus DNA sequence was generated against other EST sequences identified as described in Example 1, and this consensus sequence was Here, it was named DNA30933. Based on the DNA30933 consensus sequence, oligonucleotides are used 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO231. Was synthesized.
PCR primers (2 forward primers and 1 reverse primer) were synthesized:
Primer for forward PCR 1 5'-CCAACTACCAAAGCTGCTGGAGCC-3 '(SEQ ID NO: 75)
Primer for forward PCR 2 5'-GCAGCTCTATTACCACGGGAAGGA-3 '(SEQ ID NO: 76)
Reverse PCR primer 5'-TCCTTCCCGTGGTAATAGAGCTGC-3 '(SEQ ID NO: 77)
In addition, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA30933 sequence having the following nucleotide sequence:
Hybridization probe
5'-GGCAGAGAACCAGAGGCCGGAGGAGACTGCCTCTTTACAGCCAGG-3 '(SEQ ID NO: 78)

To screen several libraries as a source of full-length clones, DNA from the libraries was screened by PCR amplification using the PCR primer sets identified as described above. A positive library was then used to isolate a clone encoding the PRO231 gene using an oligonucleotide probe and 1 PCR primer.
RNA for construction of the cDNA library was isolated from human fetal liver tissue.
DNA sequencing of the clones isolated as described above resulted in the full-length DNA sequence of PRO213 (herein named DNA34434-1139) and the derived protein sequence of PRO231.
The complete nucleotide sequence of DNA34434-1139 is shown in FIG. 5 (SEQ ID NO: 5). Clone DNA34434-1139 contains a single open reading frame, has an apparent translation start site at nucleotide positions 173-175, and was terminated at the stop codon at nucleotide positions 1457-1459 (FIG. 5: sequence). Number 5). The predicted polypeptide precursor is 428 amino acids long (Figure 6; SEQ ID NO: 6). Clone DNA34434-1139 has been deposited with ATCC on September 16, 1997 and is assigned ATCC deposit no.
Analysis of the amino acid sequence of full-length PRO231 suggested that it had 30% and 31% amino acid sequence identity to human and rat prostatic acid phosphatase precursor proteins, respectively.

Example 7: Isolation of cDNA clone encoding human PRO236 polypeptide (UNQ210) The consensus DNA sequence was assembled using phrap as described in Example 1 compared to other EST sequences. This consensus sequence was designated herein as DNA30901. Based on the DNA30901 consensus sequence, oligonucleotides are used 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO236. Was synthesized.
Based on the DNA30901 consensus sequence, a pair of PCR primers (forward and reverse) were synthesized:
Primer for forward PCR 5'-TGGCTACTCCAAGACCCTGGCATG-3 '(SEQ ID NO: 79)
Reverse PCR primer 5'-TGGACAAATCCCCTTGCTCAGCCC-3 '(SEQ ID NO: 80)
In addition, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA30901 sequence having the following nucleotide sequence:
Hybridization probe
5'-GGGCTTCACCGAAGCAGTGGACCTTTATTTTGACCACCTGATGTCCAGGG-3 '(SEQ ID NO: 81)

To screen several libraries as a source of full-length clones, DNA from the libraries was screened by PCR amplification using the PCR primer sets identified as described above. A positive library was then used to isolate a clone encoding the PRO236 gene using an oligonucleotide probe and one PCR primer.
RNA for construction of the cDNA library was isolated from human fetal lung tissue of PRO236.
DNA sequencing of the clones isolated as described above resulted in the full-length DNA sequence of PRO236 (herein named DNA35599-1168) (SEQ ID NO: 7), the derived protein sequence of PRO236.
The complete nucleotide sequence of DNA35599-1168 is shown in FIG. 7 (SEQ ID NO: 7). Clone DNA35599-1168 contains a single open reading frame, has an apparent translation start site at nucleotide positions 69-71, and ends with a stop codon at nucleotide positions 1977-1979 (FIG. 7; SEQ ID NO: 7). The predicted polypeptide precursor is 636 amino acids long (Figure 8; SEQ ID NO: 8). Clone DNA35599-1168 has been deposited with ATCC on October 16, 1997 and is assigned ATCC deposit no.
Analysis of the amino acid sequence of the full-length PRO236 polypeptide shows that the site of this polypeptide is significantly homologous to β-galactosidase protein obtained from various sources, which makes PRO236 a novel β-galactosidase homologue. It is suggested that there is.

Example 8 Isolation of cDNA Clones Encoding Human PRO245 Polypeptide (UNQ219) The consensus DNA sequence was assembled relative to other EST sequences identified using phrap as described in Example 1. This consensus sequence was herein designated DNA30954.
Based on the DNA30954 consensus sequence, oligonucleotides were synthesized for use as probes to isolate clones of the full-length coding sequence of PRO245 to identify a cDNA library containing the sequence of interest by PCR.
A pair of PCR primers (forward and reverse) were synthesized:
Primer for forward PCR 5'-ATCGTTGTGAAGTTAGTGCCCC-3 '(SEQ ID NO: 82)
Reverse PCR primer 5'-ACCTGCGATATCCAACAGAATTG-3 '(SEQ ID NO: 83)
In addition, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA30954 sequence having the following nucleotide sequence:
Hybridization probe
5'-GGAAGAGGATACAGTCACTCTGGAAGTATTAGTGGCTCCAGCAGTTCC-3 '(SEQ ID NO: 84)

To screen several libraries as a source of full-length clones, DNA from the libraries was screened by PCR amplification using the PCR primer sets identified as described above. A positive library was then used to isolate a clone encoding the PRO245 gene using an oligonucleotide probe and one PCR primer.
RNA for construction of the cDNA library was isolated from human fetal liver tissue. DNA sequencing of the clones isolated as described above resulted in the PRO245 (herein named DNA35638-1141) full-length DNA sequence and the derived protein sequence of PRO245.
The complete nucleotide sequence of DNA35638-1141 is shown in FIG. 9 (SEQ ID NO: 9). Clone DNA35638-1141 contains a single open reading frame, has an apparent translation start site at nucleotide positions 89-91, and ends with a stop codon at nucleotide positions 1025-1027 (FIG. 9; SEQ ID NO: 9). The predicted polypeptide precursor is 312 amino acids long (Figure 10; SEQ ID NO: 10). Clone DNA35638-1141 was deposited with ATCC on September 16, 1997 and is assigned ATCC deposit number 209265.
Analysis of the amino acid sequence of full-length PRO245 suggests that a portion has 60% amino acid sequence identity to the human c-myb protein and may therefore be a novel member of the transmembrane protein receptor tyrosine kinase family. Is done.

Example 9: Isolation of cDNA clone encoding human PRO246 polypeptide (UNQ220) The consensus DNA sequence was assembled using phrap as described in Example 1 compared to other EST sequences. This consensus sequence was herein designated DNA30955. Based on the DNA30955 consensus sequence, oligonucleotides are used 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO246. Was synthesized.
A pair of PCR primers (forward and reverse) were synthesized:
Primer for forward PCR 5'-AGGGTCTCCAGGAGAAAGACTC-3 '(SEQ ID NO: 85)
Reverse PCR primer 5'-ATTGTGGGCCTTGCAGACATAGAC-3 '(SEQ ID NO: 86)
In addition, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA30955 sequence having the following nucleotide sequence:
Hybridization probe
5'-GGCCACAGCATCAAAACCTTAGAACTCAATGTACTGGTTCCTCCAGCTCC-3 '(SEQ ID NO: 87)

To screen several libraries as a source of full-length clones, DNA from the libraries was screened by PCR amplification using the PCR primer sets identified as described above. A positive library was then used to isolate a clone encoding the PRO246 gene using an oligonucleotide probe and one PCR primer.
RNA for construction of the cDNA library was isolated from human fetal liver tissue. DNA sequencing of the clones isolated as described above resulted in PRO246 (herein named DNA35639-1172) (SEQ ID NO: 11) and the derived protein sequence of PRO246.
The complete nucleotide sequence of DNA35639-1172 is shown in FIG. 11 (SEQ ID NO: 11). Clone DNA35639-1172 contained a single open reading frame, had an apparent translation start site at nucleotide positions 126-128, and ended with a stop codon at nucleotide positions 1296-1298 (FIG. 11). The predicted polypeptide precursor is 390 amino acids long (Figure 12; SEQ ID NO: 12). Clone DNA35639-1172 has been deposited with ATCC on October 17, 1997 and is assigned ATCC deposit no.
Analysis of the amino acid sequence of the full-length PRO246 polypeptide showed that it was significantly homologous to the human cell surface protein HCAR. This suggests that PRO246 may be a novel cell surface viral receptor.

Example 10: Isolation of cDNA clones encoding human PRO258 polypeptide (UNQ225) Consensus DNA sequences were assembled using phrap as described in Example 1 compared to other EST sequences. This consensus sequence was designated herein as DNA28746.
Based on the DNA28746 consensus sequence, oligonucleotides are used 1) to identify cDNA libraries containing the sequence of interest by PCR, and 2) as probes to isolate clones of the full-length coding sequence of PRO258. Was synthesized.
PCR primers (forward and reverse) were synthesized:
Primer for forward PCR 5'-GCTAGGAATTCCACAGAAGCCC-3 '(SEQ ID NO: 88)
Primer for reverse PCR 5'-AACCTGGAATGTCACCGAGCTG-3 '(SEQ ID NO: 89)
Reverse PCR primer 5'-CCTAGCACAGTGACGAGGGACTTGGC-3 '(SEQ ID NO: 90)
In addition, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA28740 sequence having the following nucleotide sequence:
Hybridization probe
5'-AAGACACAGCCACCCTAAACTGTCAGTCTTCTGGGAGCAAGCCTGCAGCC-3 '(SEQ ID NO: 91)
5'-GCCCTGGCAGACGAGGGCGAGTACACCTGCTCAATCTTCACTATGCCTGT-3 '(SEQ ID NO: 92)

To screen several libraries as a source of full-length clones, DNA from the libraries was screened by PCR amplification using the PCR primer sets identified as described above. A positive library was then used to isolate a clone encoding the PRO258 gene using an oligonucleotide probe and one PCR primer.
RNA for construction of the cDNA library was isolated from human fetal lung tissue. DNA sequencing of the clones isolated as described above resulted in PRO258 (designated herein as DNA35918-1174) (SEQ ID NO: 13) and the derived protein sequence of PRO258.
The complete nucleotide sequence of DNA35918-1174 is shown in FIG. 13 (SEQ ID NO: 13). Clone DNA35918-1174 contains a single open reading frame, has an apparent translation start site at nucleotide positions 147-149 of SEQ ID NO: 13, and is after nucleotide position 1340 of SEQ ID NO: 13 (FIG. 13). It ended with a stop codon (FIG. 5). The predicted polypeptide precursor is 398 amino acids long (Figure 14; SEQ ID NO: 14). Clone DNA35918-1174 has been deposited with ATCC on October 17, 1997 and is assigned ATCC deposit number 209402.
Analysis of the amino acid sequence of the full-length PRO258 polypeptide showed that it was significantly homologous to the CRTAM and poliovirus receptors and has an Ig domain. This suggests that PRO258 is a new member of the Ig superfamily.

Example 11: Isolation of cDNA clone encoding human PRO287 polypeptide (UNQ250) The consensus DNA sequence encoding PRO287 was assembled relative to other EST sequences identified as described in Example 1. This consensus sequence was designated herein as DNA28728. Based on the DNA28728 consensus sequence, oligonucleotides were synthesized for use in PCR to identify a cDNA library containing the sequence of interest and as a probe to isolate a clone of the full-length coding sequence of PRO287. .
A pair of PCR primers (forward and reverse) were synthesized:
Primer for forward PCR 5'-CCGATTCATAGACCTCGAGAGT-3 '(SEQ ID NO: 93)
Primer for reverse PCR 5'-GTCAAGGAGTCCTCCACAATAC-3 '(SEQ ID NO: 94)
In addition, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA28728 sequence having the following nucleotide sequence:
Hybridization probe
5'-GTGTACAATGGCCATGCCAATGGCCAGCGCATTGGCCGCTTCTGT-3 '(SEQ ID NO: 95)

To screen several libraries as a source of full-length clones, DNA from the libraries was screened by PCR amplification using the PCR primer sets identified as described above. A positive library was then used to isolate a clone encoding the PRO287 gene using an oligonucleotide probe and one PCR primer.
RNA for construction of the cDNA library was isolated from human fetal kidney tissue.
DNA sequencing of the clones isolated as described above resulted in the full length DNA sequence of PRO287 (herein DNA39969-1185, named SEQ ID NO: 15) and the derived protein sequence of PRO287.
The complete nucleotide sequence of DNA39969-1185 is shown in FIG. 15 (SEQ ID NO: 15). Clone DNA39969-1185 contains a single open reading frame, has an apparent translation start site at nucleotide positions 307-309, and ends with a stop codon at nucleotide positions 1552-1554 (FIG. 15; SEQ ID NO: 15). The predicted polypeptide precursor is 415 amino acids long (Figure 16; SEQ ID NO: 16). Clone DNA39969-1185 was deposited with ATCC on October 17, 1997 and is assigned ATCC deposit no.
Analysis of the amino acid sequence of full-length PRO287 suggests that it has a procollagen C proteinase enhancer protein precursor or procollagen C proteinase enhancer protein-like domain. Analysis of full length BLAST and FastA sequence alignment analysis showed that PRO287 showed nucleic acid sequence identity (47 and 54%, respectively) to procollagen C proteinase enhancer protein precursor and procollagen C proteinase enhancer protein.

Example 12: Isolation of cDNA clones encoding human PRO328 polypeptide (UNQ289) The consensus DNA sequence was assembled using phrap as described in Example 1 in comparison with other EST sequences. This consensus sequence was herein designated DNA35615. Based on the DNA35615 consensus sequence, oligonucleotides are used 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO328. Was synthesized.
Primers for forward and reverse PCR were synthesized:
Primer for forward PCR 1 5'-TCCTGCAGTTTCCTGATGC-3 '(SEQ ID NO: 96)
Reverse PCR primer 5'-CTCATATTGCACACCAGTAATTCG-3 '(SEQ ID NO: 97)
In addition, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA35615 sequence having the following nucleotide sequence:
Hybridization probe
5'-ATGAGGAGAAACGTTTGATGGTGGAGCTGCACAACCTCTACCGGG-3 '(SEQ ID NO: 98)

To screen several libraries as a source of full-length clones, DNA from the libraries was screened by PCR amplification using the PCR primer sets identified as described above. A positive library was then used to isolate a clone encoding the PRO328 gene using an oligonucleotide probe and one PCR primer.
RNA for construction of the cDNA library was isolated from human fetal kidney tissue.
DNA sequencing of the clones isolated as described above resulted in the full length DNA sequence of PRO328 (herein DNA40587-1231 (SEQ ID NO: 17)) and the derived protein sequence of PRO328.
The complete nucleotide sequence of DN40587-1231 is shown in FIG. 17 (SEQ ID NO: 17). Clone DNA40587-1231 contained a single open reading frame, had an apparent translation start site at nucleotide positions 15-17, and ended with a stop codon at nucleotide positions 1404-1406 (FIG. 17). The predicted polypeptide precursor is 463 amino acids long (Figure 18; SEQ ID NO: 18). Clone DNA40587-1231 was deposited with ATCC on November 7, 1997 and is assigned ATCC deposit number 209438.
Analysis of the amino acid sequence of the full-length PRO328 polypeptide showed that it was significantly homologous to human glioblastoma and a secreted protein rich in cysteine. This suggests that PRO328 is a novel glioblastoma protein or a secreted protein rich in cysteine.

Example 13: Isolation of cDNA clones encoding human PRO344 polypeptide (UNQ303) The consensus DNA sequence was assembled as compared to other EST sequences as described in Example 1. This consensus sequence was designated herein as DNA34398. Based on the DNA34398 consensus sequence, oligonucleotides are used 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO344. Was synthesized.
Based on the DNA34398 consensus sequence, forward and reverse PCR primers were synthesized as follows:
Primer for forward PCR (34398.f1) 5'-TACAGGCCCAGTCAGGACCAGGGG-3 '(SEQ ID NO: 99)
Primer for forward PCR (34398.f2) 5'-AGCCAGCCTCGCTCTCGG-3 '(SEQ ID NO: 100)
Primer for forward PCR (34398.f3) 5'-GTCTGCGATCAGGTCTGG-3 '(SEQ ID NO: 101)
Primer for reverse PCR (34398.r1) 5'-GAAAGAGGCAATGGATTCGC-3 '(SEQ ID NO: 102)
Primer for reverse PCR (34398.r2) 5'-GACTTACACTTGCCAGCACAGCAC-3 '(SEQ ID NO: 103)
In addition, a synthetic oligonucleotide hybridization probe was constructed from a DNA34398 consensus sequence having the following nucleotide sequence:
Hybridization probe (34398.p1)
5'-GGAGCACCACCAACTGGAGGGTCCGGAGTAGCGAGCGCCCCGAAG-3 '(SEQ ID NO: 104)

To screen several libraries as a source of full-length clones, DNA from the libraries was screened by PCR amplification using one of the PCR primer sets identified as described above. A positive library was then used to isolate a clone encoding the PRO344 gene using an oligonucleotide probe and one PCR primer.
RNA for construction of the cDNA library was isolated from human fetal kidney tissue.
DNA sequencing of the clone isolated as described above yielded the full-length DNA sequence of PRO344 (herein referred to as DNA40592-1242) (SEQ ID NO: 19) and the derived protein sequence of PRO344.
The complete nucleotide sequence of DNA40592-1242 is shown in FIG. 19 (SEQ ID NO: 19). Clone DNA40592-1242 contained a single open reading frame, had an apparent translation start site at nucleotide positions 227-229, and ended with a stop codon at nucleotide positions 956-958 (FIG. 19). The predicted polypeptide precursor is 243 amino acids long (Figure 20; SEQ ID NO: 20). An important region of the native PRO344 amino acid sequence included a signal peptide, the start of the mature protein and two potential N myristoylation sites, as shown in FIG. Clone DNA40592-1242 has been deposited with ATCC on November 21, 1997 and is assigned ATCC deposit no.
Analysis of the amino acid sequence of full-length PRO344 polypeptide showed that some are significantly homologous to various human and mouse complement proteins. This suggests that PRO344 is a novel complement protein.

Example 14: Isolation of a cDNA clone encoding human PRO357 polypeptide (UNQ314)
A database search was performed using the sequence expression tag clone number “24552972” from Incyte Pharmaceuticals (Palo Alto, Calif.). The extracellular domain (ECD) sequences of about 950 known secreted proteins from the Swiss-Prot public protein database, including the secretory signal sequence, if any, are part of Incyte's EST clone number “24552972” Used to search overlapping gene sequence fragment (EST) database. The EST database included a public EST database (eg, GenBank) and a manufacturer's own EST DNA database (LIFESEQ ^™ , Incyte Pharmaceuticals, Palo Alto, Calif.). The search was performed using the computer program BLAST or BLAST-2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)) as a comparison between the ECD protein sequence and the 6-frame translation of the EST sequence. Using the program “phrap” (Phil Green, Seattle, Washington, University of Washington), comparisons with a BLAST score of 70 (possibly 90) that do not encode known proteins were clustered and assembled into a consensus DNA sequence. .
The phrap was then used to assemble consensus DNA sequences related to other EST sequences. This consensus sequence is herein designated DNA37162. In this case, the consensus DNA sequence was extended using repeated cycles of BLAST and phrap, and the consensus sequence was expanded as much as possible using the sources of EST sequences described above.
Based on the DNA37162 consensus sequence, oligonucleotides are used 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full length coding sequence of PRO357. Was synthesized. Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to obtain PCR products that are approximately 100-1000 bp long. The probe sequence is typically 40-55 bp long. In some cases, additional oligonucleotides were synthesized when the consensus sequence was greater than about 1-1.5 kbp. To screen several libraries for full-length clones, DNA from the libraries was screened by PCR with PCR primer pairs as in Ausubel et al., Current Protocols in Molecular Biology. The positive library was then used to isolate a clone encoding the gene of interest with one of the probe oligonucleotide and primer pair.
PCR primers were synthesized as follows:
Primer for forward PCR 1 5′-CCCTCCACTGCCCCACCGACTG-3 ′ (SEQ ID NO: 105);
Reverse PCR primer 1 5'-CGGTTCTGGGGACGTTAGGGCTCG-3 '(SEQ ID NO: 106); and Reverse PCR primer 2 5'-CTGCCCACCGTCCACCTGCCTCAAT-3' (SEQ ID NO: 107)
In addition, two synthetic oligonucleotide hybridization probes were constructed from the consensus DNA37162 sequence having the following nucleotide sequence:
Hybridization probe 1:
5'-AGGACTGCCCACCGTCCACCTGCCTCAATGGGGGCACATGCCACC-3 '(SEQ ID NO: 108); and hybridization probe 2:
5'-ACGCAAAGCCCTACATCTAAGCCAGAGAGAGACAGGGCAGCTGGG-3 '(SEQ ID NO: 109);

To screen several libraries as a source of full-length clones, DNA from the libraries was screened by PCR amplification using the PCR primer sets identified as described above. A positive library was then used to isolate a clone encoding the PRO357 gene using one of the oligonucleotide probes and PCR primers.
RNA for construction of the cDNA library was isolated from human fetal liver tissue. The cDNA library used to isolate the cDNA clones was constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA is primed with oligo dT containing a NotI site, ligated to a SalI hemiphosphorylated adapter with a blunt end, cleaved with NotI, roughly size-divided by gel electrophoresis, and an appropriate cloning vector ( pRKB or pRKD; pRK5B is a precursor of pRK5D without the SfiI site; cloned at the specific Xhol and NotI sites in Holmes et al., Science, 253: 1278-1280 (1991)).
DNA sequencing of the clones isolated as described above yielded the full-length DNA sequence of PRO357 [herein designated as DNA44804-1248] (SEQ ID NO: 21) and the derived protein sequence of PRO357.
The complete nucleotide sequence of DNA44804-1248 is shown in FIG. 21 (SEQ ID NO: 21). Clone DNA44804-1248 contained a single open reading frame, had an apparent translation start site at nucleotide positions 137-139, and ended with a stop codon at nucleotide positions 1931-1933 (FIG. 21). The predicted polypeptide precursor is 598 amino acids long (Figure 22; SEQ ID NO: 22). Clone DNA44804-1248 has been deposited with ATCC on Dec. 10, 1997 and is assigned ATCC deposit no.
Analysis of the amino acid sequence of the full-length PRO357 polypeptide showed that some of them were significantly homologous to ALS. This suggests that PRO357 is a novel leucine rich protein for ALS.

Example 15: Isolation of cDNA clones encoding human PRO526 polypeptide (UNQ330) Consensus sequences were included in various EST sequences as described in Example 1. This consensus sequence was herein designated DNA39626. Based on the DNA39626 consensus sequence, oligonucleotides are used 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO526. Was synthesized.
A pair of PCR primers (forward and reverse) were synthesized:
Primer for forward PCR 5'-TGGCTGCCCTGCAGTACCTCTACC-3 '(SEQ ID NO: 110)
Reverse PCR primer 5'-CCCTGCAGGTCATTGGCAGCTAGG-3 '(SEQ ID NO: 111)
In addition, a synthetic oligonucleotide hybridization probe was constructed from a DNA39626 consensus sequence having the following nucleotide sequence:
Hybridization probe
5'-AGGCACTGCCTGATGACACCTTCCGCGACCTGGGCAACCTCACAC-3 '(SEQ ID NO: 112)

To screen several libraries as a source of full-length clones, DNA from the libraries was screened by PCR amplification using the PCR primer sets identified as described above. A positive library was then used to isolate a clone encoding the PRO526 gene using an oligonucleotide probe and one PCR primer. RNA for construction of the cDNA library was isolated from human fetal liver tissue (LIB228).
DNA sequencing of the clone isolated as described above yielded the full-length DNA sequence of PRO526 (herein named UNQ330 (DNA44184-1319)) (SEQ ID NO: 23) and the derived protein sequence of PRO526. .
The complete nucleotide sequence of UNQ330 (DNA44184-1319) is shown in FIG. 23 (SEQ ID NO: 23). Clone UNQ330 (DNA44184-1319) contains a single open reading frame, has an apparent translation start site at nucleotide positions 514-516, and ends with a stop codon at nucleotide positions 1933-1935 (FIG. 23). ). The predicted polypeptide precursor is 473 amino acids long (Figure 24; SEQ ID NO: 24). The predicted molecular weight of the full-length PRO526 protein shown in FIG. 24 is about 50,708 daltons and the pI is about 9.28. Clone UNQ330 (DNA44184-1319) has been deposited with the ATCC under ATCC deposit number 209704 on March 26, 1998. Although this clone is believed to contain the actual sequence, the sequences presented here are exemplary based on current sequencing techniques.
Analysis of the amino acid sequence of the full-length PRO526 polypeptide showed that some of it was significantly homologous to leucine repeat-rich proteins including ALS, SLIT, carboxypeptidase and platelet glycoprotein V. This suggests that PRO526 is a novel protein involved in protein-protein interactions.
Further analysis of SEQ ID NO: 24 revealed that the signal peptide sequence was approximately amino acids 1-26. The leucine zipper pattern was approximately amino acids 135-156. Glycosaminoglycan attachment was approximately amino acids 436-439. N glycosylation sites were approximately amino acids 82-85, 179-182, 237-240 and 423-426. A von Willebrand factor (VWF) type C domain was found at about amino acids 411-425. One skilled in the art will know which nucleotides correspond to these amino acids based on the sequences provided herein.

Example 16: Isolation of cDNA clones encoding human PRO724 polypeptide (UNQ389) Consensus DNA sequences were included in various EST sequences as described in Example 1. This consensus sequence was herein designated DNA35603. Based on the DNA35603 consensus sequence, oligonucleotides are used 1) to identify cDNA libraries containing the sequence of interest by PCR, and 2) as probes to isolate clones of the full-length coding sequence of PRO724. Was synthesized.
A pair of PCR primers (forward and reverse) were synthesized:
Primer for forward PCR 1 5'-GGCTGTCACTGTGGAGACAC-3 '(SEQ ID NO: 113)
Primer for forward PCR 2 5'-GCAAGGTCATTACAGCTG-3 '(SEQ ID NO: 114)
Reverse PCR primer 1 5'-AGAACATAGGAGCAGTCCCACTC-3 '(SEQ ID NO: 115)
Reverse PCR primer 2 5'-TGCCTGCTGCTGCACAATCTCAG-3 '(SEQ ID NO: 116)
In addition, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA35603 sequence having the following nucleotide sequence:
Hybridization probe
5'-GGCTATTGCTTGCCTTGGGACAGACCCTGTGGCTTAGGCTCTGGC-3 '(SEQ ID NO: 117)

To screen several libraries as a source of full-length clones, DNA from the libraries was screened by PCR amplification using the PCR primer sets identified as described above. A positive library was then used to isolate a clone encoding the PRO724 gene using an oligonucleotide probe and one PCR primer.
RNA for construction of the cDNA library was isolated from human fetal lung tissue (LIB26).
DNA sequencing of the clone isolated as described above yielded the full-length DNA sequence of PRO724 (herein named UNQ389 (DNA49631-1328)) (SEQ ID NO: 25) and the derived protein sequence of PRO724. .
The complete nucleotide sequence of UNQ389 (DNA49631-1328) is shown in FIG. 25 (SEQ ID NO: 25). The UNQ389 clone (DNA49631-1328) contained a single open reading frame, had an apparent translation start site at nucleotide positions 546-548, and ended with a stop codon at nucleotide positions 2685-2687 (FIG. 25). ). The predicted polypeptide precursor is 713 amino acids long (Figure 26; SEQ ID NO: 26). The predicted molecular weight of the full-length PRO724 protein shown in FIG. 26 is about 76,193 daltons and the pI is about 5.42. Analysis of the full-length PRO724 amino acid sequence shown in FIG. 26 (SEQ ID NO: 26) revealed a signal peptide of approximately amino acids 1-16, a transmembrane domain of approximately amino acids 442-462, and approximately amino acids 152-171, 331-350, 374. The existence of ˜393 and 411˜430 LDL receptor class A domain regions was demonstrated. Clone UNQ389 (DNA49631-1328) has been deposited with the ATCC under ATCC deposit number 209806 on April 28, 1998.
Analysis of the amino acid sequence of the full-length PRO724 polypeptide indicated that it was significantly homologous to the human LDL receptor protein. This suggests that PRO724 is a novel LDL receptor homologue. Specifically, by analyzing the Dayhof database (version 35.45 SwissProt35), the PRO724 amino acid sequence and the following Dayhof sequences, namely P_R48547, MMAM2R_1, LRP2_RAT, P_R60517, P_R47861, P_R05533, A44563_1, A30363, P_R69 and P_R69 Proved to have significant homology.

Example 17: Isolation of cDNA clones encoding human PRO731 polypeptide (UNQ395) The database was used to search the expressed expressed gene sequence fragment (EST) database. The EST database used here was EST DNA database LIFESEQ (registered trademark) owned by Incyte Pharmaceuticals (Palo Alto, Calif.). The Incyte clone 2581326 was identified here and was named DNA42801. Based on the DNA42801 sequence, oligonucleotides can be used as a probe to isolate 1) a cDNA library containing the sequence of interest by PCR and 2) a clone of the full-length coding sequence of PRO731 Synthesized.
A pair of PCR primers (forward and reverse) were synthesized:
Primer for forward PCR 1 5'-GTAAGCACATGCCTCCAGAGGTGC-3 '(SEQ ID NO: 118)
Reverse PCR primer 2 5'-GTGACGTGGATGCTTGGGATGTTG-3 '(SEQ ID NO: 119)
In addition, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA 42801 sequence having the following nucleotide sequence:
Hybridization probe
5'-TGGACACCTTCAGTATTGATGCCAAGACAGGCCAGGTCATTCTGCGTCGA-3 '(SEQ ID NO: 120)

To screen several libraries as a source of full-length clones, DNA from the libraries was screened by PCR amplification using the PCR primer sets identified as described above. Subsequently, a clone encoding the PRO731 gene was isolated using a positive library using an oligonucleotide probe and one PCR primer. RNA for construction of the cDNA library was isolated from human bone marrow tissue (LIB255). The cDNA library used for isolation of the cDNA clones was constructed by standard methods using commercially available reagents such as Invitrogen (San Diego, Calif.). The cDNA is primed with an oligo dT containing a NotI site, ligated to a SalI hemikinase adapter, cut with NotI, approximately sized by gel electrophoresis, and an appropriate cloning vector (such as pRKB or pRKD; pRK5B is SfiI) PRK5D precursor containing no site; see Holmes et al., Science, 253: 1278-1280 (1991)) and cloned into the unique XhoI and NotI sites in the given orientation.
DNA sequencing of the clone isolated as described above yielded the full-length DNA sequence of PRO731 (herein named UNQ395 (DNA48331-1329)) (SEQ ID NO: 27) and the derived protein sequence of PRO731. It was.
The complete nucleotide sequence of UNQ395 (DNA48331-1329) is shown in FIG. 27 (SEQ ID NO: 27). Clone UNQ395 (DNA48331-1329) contains a single open reading frame, has an apparent translation start site at nucleotide positions 329-331, and ends with a stop codon at nucleotide positions 3881-3883 (FIG. 27). ). The predicted polypeptide precursor was 1184 amino acids long (Figure 28; SEQ ID NO: 28). The predicted molecular weight of the full-length PRO731 protein shown in FIG. 28 is about 129,022 daltons and the pI is about 5.2. Clone UNQ395 (DNA48331-1329) has been deposited with the ATCC under ATCC deposit number 209715 on March 31, 1998. With respect to sequences, the deposited clone is considered to contain the correct sequence, and the sequences provided herein are based on known sequencing techniques.
Analysis of the amino acid sequence of the full-length PRO731 polypeptide showed that it has significant identity and similarity to members of the protocadherin family. This suggests that PRO731 may be a novel protocadherin.
Upon further analysis of SEQ ID NO: 28, the putative signal peptide was generally located at amino acids 1-13 of SEQ ID NO: 28. The transmembrane domain was amino acids 719-739 of SEQ ID NO: 28. The N-glycosylation of SEQ ID NO: 28 was 415-418, 582-586, 659-662, 662-665, and 857-860. The cadherin extracellular repeat domain signature was located generally at amino acids 123-133, 232-242, 340-350, 448-458, and 553-563 (SEQ ID NO: 28). Corresponding nucleotides can be determined by routine methods provided that the sequences presented herein are present.

Example 18: Isolation of cDNA clones encoding human PRO723 polypeptide (UNQ396) A yeast screening assay was used to identify cDNA clones encoding potential secreted proteins. By using this yeast screening assay, a single cDNA clone (designated herein as DNA42580) can be identified. The DNA 42580 sequence was then compared with various known EST sequences to identify homologues. EST databases used include public EST databases (eg GenBank) and in-house EST DNA databases (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, Calif.). The search was performed by comparison with 6-frame translation of the EST sequence using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). Using phrap (Phil Green, University of Washington, Seattle, WA), consensus DNA sequences were assembled by clustering comparisons that did not encode known proteins and had a BLAST score of 70 (in some cases 90) or higher.
Using the analysis described above, phraps were used to assemble consensus DNA sequences related to other EST sequences. This consensus sequence is herein designated consen01. For this consensus assembly, Genentech's unique EST sequence was used. Here, they are named DNA20239, DNA38050 and DNA40683.
Based on the consen01 sequence, oligonucleotides can be used 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO732. Synthesized. Forward and reverse PCR primers usually span 20-30 nucleotides and often give PCR products about 100-1000 bp long. The probe sequence is usually 40 to 55 bp long. In some cases, additional oligonucleotides were synthesized when the consensus sequence was greater than about 1-1.5 kbp. To screen multiple libraries for full-length clones, the library DNA was cleaned by PCR amplification using PCR primer pairs according to Ausubel et al., Current Protocols in Molecular Biology. The positive library was then used to isolate a clone encoding the gene of interest using one of the probe oligonucleotide and primer pair.
PCR primers (forward and reverse) were synthesized:
Primer for forward PCR 5'-ATGTTTGTGTGGAAGTGCCCCG-3 '(SEQ ID NO: 121)
Primer for forward PCR 5'-GTCAACATGCTCCTCTGC-3 '(SEQ ID NO: 122)
Primer for reverse PCR 5'-AATCCATTGTGCACTGCAGCTCTAGG-3 '(SEQ ID NO: 123)
Primer for reverse PCR 5'-GAGCATGCCACCACTGGACTGAC-3 '(SEQ ID NO: 124)
In addition, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA44143 sequence having the following nucleotide sequence:
Hybridization probe
5'-GCCGATGCTGTCCTAGTGGAAACAACTCCACTGTAACTAGATTGATCTATGCAC-3 '(SEQ ID NO: 125)

To screen several libraries as a source of full-length clones, DNA from the libraries was screened by PCR amplification using the PCR primer sets identified as described above. A positive library was then used to isolate a clone encoding the PRO732 gene using an oligonucleotide probe and one PCR primer.
RNA for construction of the cDNA library was isolated from human fetal lung tissue (LIB26). The cDNA library used for isolation of the cDNA clones was constructed by standard methods using commercially available reagents such as Invitrogen (San Diego, Calif.). The cDNA is primed with an oligo dT containing a NotI site, ligated to a SalI hemikinase adapter, cut with NotI, sorted to approximate size by gel electrophoresis, and an appropriate cloning vector (such as pRKB or pRKD; pRK5B is PRK5D precursor without SfiI site; see Holmes et al., Science, 253: 1278-1280 (1991)), cloned into the unique XhoI and NotI sites in the given orientation.
Identification of a full-length clone containing a single open reading frame with an apparent translation start site at nucleotide positions 88-90 and ending with the stop codon found at nucleotide positions 1447-1449 (FIG. 29, SEQ ID NO: 29) did. The predicted polypeptide precursor is 453 amino acids long, has a calculated molecular weight of about 50419 daltons, and a predicted pI of about 5.78. Analysis of the full-length PRO732 sequence protein shown in FIG. 30 (SEQ ID NO: 30) reveals a signal peptide located at about amino acids about 1 to about 28, amino acids about 37 to about 57, about 93 to 109, about 126 to about 148, about 151-about 172, about 197-215, about 231-245, about 260-279, about 315-about 333, about 384-about 403, and the transmembrane domain located at about 422-447, amino acids about 33-about 36 N-glycosylation site located at about 34-37, about 179-183, about 298-301, about 337-340, and 406-409, homologous to the MIP family of proteins located at about amino acid 119-about 149 Amino acid block having the property and a DNA / RNA non-specific endonuclease located at about amino acids 279 to about 286 The existence of amino acid blocks having homology to the ase protein has been demonstrated. Clone DNA48334-1435 has been deposited with ATCC on June 2, 1998 and is assigned ATCC deposit no.
Analysis of the amino acid sequence of the full-length PRO732 polypeptide suggested that it has significant sequence similarity to the Diff33 protein. Thus, it is suggested that PRO732 may be a novel Diff33 homolog. Specifically, by analyzing the Dayhof database (version 35.45, SwissProt35), the PRO732 amino acid sequence and the following Dayhof sequences, namely HS179M20_2, MUSTETU_1, CER11H6_2, RATDRP_1, S51256, E69226, AE000869_1, JC4120, CYB_PARTE and P_R50619 The homology with was demonstrated.

Example 19: Isolation of cDNA clone encoding human PRO1003 polypeptide (UNQ487) Identification of a single Incyte EST cluster sequence designated herein as 43055 was performed using the signal sequence algorithm described in Example 3 above. It was. This sequence was then compared to various EST databases, including public EST databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, Calif.) To identify homologies. . Homology searches were performed using the computer program BLAST or BLAST-2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). Using the program “phrap” (Phil Green, Seattle, Washington, University of Washington), comparisons with a BLAST score of 70 (possibly 90) that do not encode known proteins were clustered and assembled into a consensus DNA sequence. . The consensus sequence thus obtained was named consen01.
Given the sequence homology observed between the consensus sequence and the EST sequence contained within Incyte EST clone no. 2849382, Incyte EST clone no. 2849382 was purchased and a cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG.
The entire nucleotide sequence of DNA58846-1409 is shown in FIG. 31 (SEQ ID NO: 31). Clone DNA58846-1409 contained a single open reading frame, had an apparent translation start site at nucleotide positions 41-43, and terminated with a stop codon at nucleotide positions 293-295 (FIG. 31). The predicted polypeptide precursor is 84 amino acids long (Figure 32; SEQ ID NO: 32). The full-length PRO1003 protein shown in FIG. 32 is estimated to have a molecular weight of approximately 9408 daltons and a pI of approximately 9.28. Analysis of the full-length PRO1003 sequence shown in FIG. 32 (SEQ ID NO: 32) shows the presence of a signal peptide located approximately at amino acids 1-24 and cAMP and cGMP-dependent protein kinase phosphorylation sites approximately located at amino acids 58-61. Proved. Analysis of the full-length PRO1003 polypeptide using the Dayhof database (version 35.45, SwissProt35) revealed that the PRO1003 amino acid sequence and the following Dayhof sequences: AOPCZA363_3, SRTX_ATREN, A48298, MHVJHMS_1, VGL2_CVMJH, DHDHTC2_2, CORT_RAT, CORT_RAT, CORT_RAT The homology with P_W14123 and DVUFI_2 was demonstrated.

Example 20: Isolation of cDNA clone encoding human PRO1104 polypeptide (UNQ547) The EST cluster sequence was identified using the signal sequence algorithm described in Example 3 above. This EST cluster is then compared to various EST databases including public EST databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, Calif.) To identify homology. did. Homology searches were performed using the computer program BLAST or BLAST-2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). Using the program “phrap” (Phil Green, Seattle, Washington, University of Washington), comparisons with a BLAST score of 70 (possibly 90) that do not encode known proteins were clustered and assembled into a consensus DNA sequence. . The consensus sequence thus obtained was named DNA56446.
Considering the sequence homology observed between the DNA56446 sequence and the EST sequence contained within Incyte EST clone no. 2837496, Incyte EST clone no. 2837496 was purchased and a cDNA insert was obtained and sequenced. This insert was found to encode the full length protein. The sequence of this cDNA insert is shown in FIG. 33 and is herein designated as DNA59616-1465.
The entire nucleotide sequence of DNA59616-1465 is shown in FIG. 33 (SEQ ID NO: 33). Clone DNA59616-1465 contains a single open reading frame, has an apparent translation start site at nucleotide positions 109-111, and terminates with a stop codon at nucleotide positions 1132-1134 of SEQ ID NO: 33 (FIG. 33). (FIG. 33). The predicted polypeptide precursor is 341 amino acids long (Figure 34; SEQ ID NO: 34). The full-length PRO1104 protein shown in FIG. 34 is estimated to have a molecular weight of approximately 36769 daltons and a pI of approximately 9.03. Clone DNA59616-1465 has been deposited with ATCC under ATCC deposit number 209991 on June 16, 1998. The deposited clone has the actual nucleic acid sequence and the sequences presented here are based on known sequencing techniques.
According to the analysis of FIG. 34, the signal peptide is located at about amino acids 1-22 of SEQ ID NO: 34. N myristoylation sites are located at amino acids 41-46, 110-115, 133-138, 167-172 and 179-184 of SEQ ID NO: 34.

Example 21: Isolation of cDNA clone encoding human PRO1151 polypeptide (UNQ581) The consensus DNA sequence was assembled using phrap as described in Example 1 compared to other EST sequences. This consensus sequence was herein designated DNA40665. Based on the DNA40665 consensus sequence, oligonucleotides are used 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO1151. Was synthesized.
PCR primers (forward and reverse) were synthesized:
Primer for forward PCR 5'-CCAGACGCTGCTCTTCGAAAGGGTC-3 '(SEQ ID NO: 126)
Reverse PCR primer 5'-GGTCCCCGTAGGCCAGGTCCAGC-3 '(SEQ ID NO: 127)
In addition, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA 40665 sequence having the following nucleotide sequence:
Hybridization probe
5'-CTACTTCTTCAGCCTCAATGTGCACAGCTGGAATTACAAGGAGACGTACG-3 '(SEQ ID NO: 128)
To screen several libraries as a source of full-length clones, DNA from the libraries was screened by PCR amplification using the PCR primer sets identified as described above. A positive library was then used to isolate a clone encoding the PRO1151 gene using an oligonucleotide probe and one PCR primer. RNA for construction of the cDNA library was isolated from human fetal kidney tissue.
DNA sequencing of the clones isolated as described above resulted in the full-length DNA sequence of PRO1151 (here named DNA44694-1500 (FIG. 35, SEQ ID NO: 35)) and the derived protein sequence of PRO1151. .
The complete nucleotide sequence of DNA44694-1500 is shown in FIG. 35 (SEQ ID NO: 35). Clone DNA44694-1500 contained a single open reading frame, had an apparent translation start site at nucleotide positions 272-274, and was terminated with a stop codon at nucleotide positions 1049-1051 (FIG. 35). The predicted polypeptide precursor is 259 amino acids long (Figure 36; SEQ ID NO: 36). The predicted molecular weight for the full-length PRO1151 protein shown in FIG. 36 is approximately 28770 daltons and the pI is approximately 6.12. Analysis of the full-length PRO1151 shown in FIG. 36 (SEQ ID NO: 36) revealed that a signal peptide located from about 1 to about 20 amino acids, a potential N glycosylation site located from about amino acids 72 to about 75, and about 144 amino acids. -The existence of amino acid sequence blocks having homology to the C1q domain, including proteins located at about 178, about 78-about 111, and about 84-117 has been demonstrated. Clone UNQ581 (DNA44694-1500) has been deposited with the ATCC under ATCC deposit number 203114 on August 11, 1998.
Analysis of Dayhoff database (version 35.45 SwissProt35) using WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. , HP25_TAMAS, HUMC1QB2_1, P_R99306, CA1F_HUMAN, JX0369, CA24_HUMAN, S32436, P_R28916 and CA54_HUMAN have been demonstrated to have significant homology

Example 22 Isolation of cDNA Clones Encoding Human PRO1244 Polypeptide (UNQ628) Using the signal sequence algorithm described in Example 3 above, a single EST cluster sequence, designated herein as cluster number 7874, was converted to LIFESEQ ( It was identified from the registered trademark database. This EST cluster is then divided into various expression genes, including public EST databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA; Genentech, South San Francisco, CA). Homology was identified by comparison with a sequence fragment (EST) database. One or more ESTs were obtained from a library constructed from cavernous tissue. Homology searches were performed using the computer program BLAST or BLAST-2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). Using the program “phrap” (Phil Green, Seattle, Washington, University of Washington), comparisons with a BLAST score of 70 (possibly 90) that do not encode known proteins were clustered and assembled into a consensus DNA sequence. . The consensus sequence thus obtained was named “DNA56011”.
Considering the sequence homology between the DNA56011 sequence and the EST sequence contained within Incyte EST number 3202349, EST clone number 3202349 was purchased and a cDNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in FIG. 37 (SEQ ID NO: 37) and is herein designated “DNA64888-1526”.
The full-length clone shown in FIG. 37 contained a single open reading frame, had an apparent translation start site at nucleotide positions 9-11, and terminated with a stop codon found at nucleotide positions 1014-1016 ( Figure 37; SEQ ID NO: 37). The predicted polypeptide precursor (Figure 38, SEQ ID NO: 38) is 335 amino acids long. The calculated molecular weight for PRO1244 is about 38037 daltons and the estimated pI is approximately 9.87. Other features include a signal peptide located at about amino acids 1-29; a transmembrane domain located generally at amino acids 183-205, 217-237, 271-287, and 301-321; generally amino acids 71-74, and 215- A potential N-glycosylation site located at 218; and a cell adhesion sequence at about amino acids 150-152. Dayhof using the full-length WU-BLAST2 sequence alignment analysis shown in FIG. 38 (SEQ ID NO: 38) Analysis of the database (version 35.45, SwissProt35) revealed that the homology of the PRO1244 amino acid sequence with the following Dayhof sequences, namely AF008554_1, P_485334, G02297, HUMN33S11_1, HUMN33S10_1, YO13_CAEEL, GEN13255, S49758, E70107, and ERP5_MEDSA It was done.
Clone DNA64888-1526 was deposited with ATCC on September 9, 1998 and is assigned ATCC deposit number 203253.

Example 23: Isolation of cDNA clone encoding human PRO1298 polypeptide (UNQ666) Using the signal sequence algorithm described in Example 3 above, EST cluster sequences were identified from the Incyte database. This EST cluster sequence is then compared to various EST databases, including public EST databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, Calif.). Identified. One or more ESTs were obtained from the prostate affected tissue library. Homology searches were performed using the computer program BLAST or BLAST-2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). Using the program “phrap” (Phil Green, Seattle, Washington, University of Washington), comparisons with a BLAST score of 70 (possibly 90) that do not encode known proteins were clustered and assembled into a consensus DNA sequence. . The consensus sequence thus obtained was named DNA56389.
Given the sequence homology between the DNA56389 sequence and the EST sequence contained in Incyte EST within the assembly from which the consensus sequence was obtained, Incyte clone 3355717 was purchased and a cDNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 39 and is herein designated as DNA66511-1563.
The full-length clone shown in FIG. 39 contains a single open reading frame, has an apparent translation start site at nucleotide positions 94-96, and ends with the stop codon found at nucleotide positions 1063-1065 (FIG. 39). 39; SEQ ID NO: 39). The predicted polypeptide precursor is 323 amino acids long (Figure 40; SEQ ID NO: 40). The signal peptide was located at about amino acids 1-15 of SEQ ID NO: 40. The calculated molecular weight for PRO1298 is approximately 37017 daltons and the predicted pI is approximately 8.83. Clone DNA66511-1563 was deposited with the ATCC on September 15, 1998 and is assigned ATCC deposit number 203228. Use the full-length WU-BLAST2 sequence alignment analysis shown in FIG. 40 (SEQ ID NO: 40). According to the analysis of the Dayhoff database (version 35.45, SwissProt35), the PRO1298 amino acid sequence and the following Dayhoff sequence (data contained therein), namely ALG2_YEAST, CAPM_STAAU, C69098, C69255, SUS2_MAIZE, A69143, S74778, AB009527_13, Homology with AF050103_2 and BBA224769_1 was demonstrated.

Example 24 Isolation of cDNA clone encoding human PRO1313 polypeptide (UNQ679)
Extracellular domain (ECD) sequences (including secreted signal sequences, if any) from about 950 known secreted proteins from the Swiss-Prot public database were used to search the EST database. EST databases include public EST databases (eg, GenBank), corporate databases (eg, LIFESEQ ^™ , Incyte Pharmaceuticals, Palo Alto, Calif.), And Genentech's in-house EST. The search was performed using the computer program BLAST or BLAST-2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)) as a comparison between the ECD protein sequence and the 6-frame translation of the EST sequence. Comparisons that do not encode known proteins and give a BLAST score of 70 (in some cases 90) or higher are grouped by the program “phrap” (Phil Green, University of Washington, Seattle, Washington) and consensus DNA sequences Assembled.
The consensus DNA sequence was assembled relative to other EST sequences using phrap. This consensus sequence was herein designated DNA64876. Based on the DNA64876 consensus sequence and based on a search for sequence homology with the Genentech in-house EST sequence named DNA57711, the Merck / Washington University EST sequence named R80613 is significantly different from DNA64876 and DNA57711. It was found to have similar homology. Accordingly, Merck / Washington University EST clone number R80613 was purchased and the resulting DNA 64966-1575 sequence shown in FIG. 41 was generated from the insert and sequence.
By DNA sequencing of the R80613 insert obtained as described above, the full length DNA sequence of PRO1313 (herein named DNA64966-1575 (FIG. 41, SEQ ID NO: 41)) (UNQ679) and the derived protein sequence of PRO1313 was gotten.
The complete nucleotide sequence of UNQ679 (DNA64966-1575) is shown in FIG. 41 (SEQ ID NO: 41). Clone UNQ679 (DNA64966-1575) contains a single open reading frame, has an apparent translation start site at nucleotide positions 115-117, and ends with a stop codon at nucleotide positions 1036-1038 (FIG. 41). ). The predicted polypeptide precursor is 307 amino acids long (Figure 42; SEQ ID NO: 42). The predicted molecular weight for the full-length PRO1313 protein shown in FIG. 42 was about 35,098 daltons and the pI was about 8.11. Analysis of the full-length PRO1313 shown in FIG. 42 (SEQ ID NO: 42) shows a signal peptide located at about amino acids about 1 to about 15, amino acids about 134 to about 157, about 169 to about 189, about 230 to about 248, and about 272-transmembrane domain located at about 285, amino acid about 34-about 37, amino acid about 135-about 138, N-glycosylation site located at about 203-about 206, and amino acid about 53-about 60 The presence of ATP / GTP binding site motif A was demonstrated. Clone UNQ679 (DNA64966-1575) was deposited with ATCC on January 12, 1999 and is assigned ATCC deposit number 203575.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis of the full-length sequence shown in FIG. , U93688_9, H64896, YDCX_ECOLI and RNU06101_1 were proved to have significant homology.

Example 25 Isolation of cDNA clones encoding human PRO1570 polypeptide (UNQ776) A consensus DNA sequence encoding PRO1570 was generated against other EST sequences using phrap as described in Example 1 and assembled. Formed. This consensus sequence was designated herein as “DNA65415”. Based on the DNA65415 consensus sequence, and based on other discoveries and information presented here, a clone containing Incyte EST 3232285 (from a library of uterine / colon cancer tissues) was purchased and fully sequenced to SEQ ID NO: 43 Got.
The complete nucleotide sequence of PRO1570 is included in FIG. 43 (SEQ ID NO: 43). Clone DNA68888-1678 contains a single open reading frame, has an apparent translation start site at nucleotide positions 210-212, and has an apparent stop codon at nucleotide positions 1506-1508 of SEQ ID NO: 43. It was. The predicted polypeptide precursor is 432 amino acids long. FIG. 44 (SEQ ID NO: 44) shows a number of motifs. Clone DNA68885-1678 has been deposited with ATCC on October 6, 1998 and is assigned ATCC deposit no. The predicted molecular weight for the full-length PRO1570 protein shown in FIG. 44 is about 47644 daltons and the pI is about 5.18.
Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis of the full-length sequence shown in FIG. 44 (SEQ ID NO: 44) revealed that the PRO1570 amino acid sequence and That is, P_W22986, TMS2_HUMAN, HEPS_HUMAN, P_R89435, AB002134_1, KAL_MOUSE, ACRO_HUMAN, GEN12917, AF045649_1, and P_W34285 were revealed.

Example 26 Isolation of a cDNA clone encoding the human PRO1886 polypeptide (UNQ870) In a human aortic endothelial cDNA library, preferably representing the 5 'end of the primary cDNA clone, the yeast DNA was used to determine the initial DNA sequence. Identified. This sequence can be obtained from public databases (eg, GenBank, Merck / Wash U.), in-house EST databases (Altschul et al., Methods in Enzymology, 266: 460-480 (1996)), in-house EST databases ( LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, Calif.) EST. The computer program “phrap” (Phil Green, University of Washington, Seattle, WA; http://bozeman.mbt.washington.edu/phrap.docs/phrap.html) is used to cluster ESTs and consensus DNA sequences Assembled. This consensus sequence is designated herein as “DNA78722”. Other novel sequences were identified in the alignment of the sequences that formed DNA78722. Based on the DNA78722 consensus sequence, oligonucleotides were synthesized and used as probes, and a clone of the full-length coding sequence of PRO1886 was isolated from a human aortic epithelial cell cDNA library.
The full-length DNA80996-2523 clone shown in FIG. 45 has an apparent translation start site at nucleotide positions 73-75 and terminates at the stop codon found at nucleotide positions 1022-1025 (FIG. 45, SEQ ID NO: 45). It contained a single open reading frame. The predicted polypeptide precursor (FIG. 46, SEQ ID NO: 46) was 316 amino acids long. Another feature is shown in FIG. The calculated molecular weight for PRO1886 is about 36045 daltons and the predicted pI is about 8.18. Clone DNA80796-2523 (UNQ870), designated DNA8079-2523, was deposited with ATCC on December 22, 1998 and is assigned ATCC deposit number 203555.
Analysis of the Dayhof database (version 35.45 SwissProt35) using the full-length WU-BLAST2 sequence alignment analysis shown in FIG. 46 reveals sequence identity between the PRO1886 amino acid sequence and the Dayhof sequences CELT26A8_2 and S43230. It was.

Example 27 Isolation of cDNA clone encoding human PRO1891 polypeptide (UNQ873)
Extracellular domain (ECD) sequences (including secreted signal sequences, if any) from about 950 known secreted proteins from the Swiss-Prot public database were used to search the EST database. EST databases include EST databases (eg, GenBank) and corporate EST databases (LIFESEQ ^™ , Incyte Pharmaceuticals, Palo Alto, CA). The search was performed using the computer program BLAST or BLAST-2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)) as a comparison between the ECD protein sequence and the 6-frame translation of the EST sequence. Using the program “phrap” (Phil Green, Seattle, Washington, University of Washington), comparisons with a BLAST score of 70 (possibly 90) that do not encode known proteins were clustered and assembled into a consensus DNA sequence. .
The consensus DNA sequence encoding PRO1891 was assembled relative to other EST sequences using phrap. This consensus sequence is designated herein as “DNA44813”.
Based on the DNA44813 consensus sequence, oligonucleotides can be used 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence of PRO1891 used. Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give PCR products that are approximately 100-1000 bp long. The probe sequence is typically 40-55 bp long. In some cases, additional oligonucleotides were synthesized when the consensus sequence was greater than about 1-1.5 kbp. To screen several libraries for full-length clones, DNA from the libraries was screened by PCR with PCR primer pairs as described by Ausubel et al., Current Protocols in Molecular Biology, supra. The positive library was then used to isolate a clone encoding the gene of interest using one of the probe oligonucleotide and primer pair.

PCR primers (forward and reverse primers) were synthesized:
Primer for forward PCR GCTGCTTTGCTCACAACTGCTCGC (44813.f1; SEQ ID NO: 129),
CATGACACCTTCCTGCTG (44813.f2; SEQ ID NO: 130)
as well as
CAGCCATGGGTGACTGTGACCTCC (44813.f3; SEQ ID NO: 131)
Primer for reverse PCR CTCCTGGGAGTCGGTAGCAACACC (44813.r1; SEQ ID NO: 132),
GGGAGGTCACAGTCACCC (44813.r2; SEQ ID NO: 133)
as well as
GGCTGGGCTTTCCACCCTGGCAC (44813.r3; SEQ ID NO: 134)
In addition, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA44813 sequence having the following nucleotide sequence:
Hybridization probe
CAGCCATGGGTGACTGTGACCTCCCTGAGTTTTGCACGGG (44813.p1; SEQ ID NO: 135)
To screen several libraries as a source of full-length clones, DNA from the libraries was screened by PCR amplification using the PCR primer sets identified as described above. A positive library was then used to isolate a clone encoding the PRO1891 gene using an oligonucleotide probe and one PCR primer.

RNA for construction of the cDNA library was isolated from human bone marrow. The cDNA library used to isolate the cDNA clones was constructed by standard methods using commercially available reagents such as those from Invitrogen (San Diego, Calif.). The cDNA is primed with oligo dT containing a NotI site, ligated to a SalI hemiphosphorylated adapter with a blunt end, cleaved with NotI, roughly size-divided by gel electrophoresis, and an appropriate cloning vector ( pRKB or pRKD; pRK5B is a precursor of pRK5D without the SfiI site; cloned at the specific Xhol and NotI sites in Holmes et al., Science, 253: 1278-1280 (1991)).
DNA sequencing of the clones isolated as described above yielded the full-length DNA sequence of PRO1891 [here designated as DNA76788-2526] (FIG. 47; SEQ ID NO: 47) and the derived protein sequence of PRO1891.
The entire coding sequence of PRO1891 is shown in FIG. 47 (SEQ ID NO: 47). Clone DN76788-2526 contained a single open reading frame, had an apparent translation start site at nucleotide positions 114-116, and had an apparent stop codon at nucleotide positions 2555-2555. The predicted polypeptide precursor is 813 amino acids long. The predicted molecular weight for the full-length PRO1891 protein shown in FIG. 48 (SEQ ID NO: 48) was about 87739 daltons and the pI was about 6.94. Other features include a signal peptide at amino acids about 1-27, a transmembrane domain at amino acids about 702-720, and amino acids at about 109-112, 145-148, 231-234, 276-279, and 448-451. A potential N glycosylation site, a tyrosine kinase phosphorylation site at about amino acids 236-243, amino acids about 29-34, 285-190, 195-200, 308-313, 318-323, 326-331, 338- 343, 370-375, 400-405, 402-407, 454-459, 504-509, 510-515, 517-522, 580-585, 601-606, 661-666, 687-692, 717-722 and 719-724 contains a potential N myristoylation site, about 200 amino acids Amidation site 203, as well as amino acids about 342-351 neutral zinc metallopeptidase cell, and may include zinc binding region signature.
Analysis of the Dayhof database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis of the full-length sequence shown in FIG. , P_W44120, P_R67759, AF029899_1, and P_W14777 were revealed.
Clone DNA76788 (UNQ873) was deposited with the ATCC as DNA76788-2526 on December 22, 1998 and is assigned ATCC deposit number 203551.

Example 28 Isolation of cDNA Clones Encoding Human PRO4409 Polypeptide (UNQ1934) DNA88004-2575 is a proprietary signal sequence discovery algorithm developed by Genentech (South San Francisco, Calif.) That is publicly available (eg, GenBank) and / or private (LIFESEQ®, Incyte Pharmaceuticals, Inc., Palo Alto, Calif.) Databases and identified by applying to clustered and assembled EST fragments. The signal sequence algorithm calculates a secretory signal score based on the letters of the DNA nucleotide surrounding the first and optionally the second methionine codon (ATG) at the 5'-end of the sequence or sequence fragment under consideration. The nucleotide following the first ATG must encode at least 35 unambiguous amino acids without a stop codon. If the first ATG has the necessary amino acids, the second is not analyzed. If none of the requirements is met, the candidate sequence is not scored. In order to determine whether an EST sequence contains a genuine signal sequence, a set of seven sensors (evaluation parameters) known to be associated with the secretory signal is used to determine the DNA surrounding the ATG codon and the corresponding amino acid sequence. Use to score.
Using the signal sequence algorithm described above, the EST cluster sequence from the Incyte database designated Incyte EST cluster SEQ ID NO: 40671 was identified. This EST cluster sequence is then combined with various expressed gene sequence fragment (EST) databases, including public EST databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, Calif.). Homology was identified by comparison. Homology searches were performed using the computer program BLAST or BLAST-2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). Using the program “phrap” (Phil Green, Seattle, Washington, University of Washington), comparisons with a BLAST score of 70 (possibly 90) that do not encode known proteins were clustered and assembled into a consensus DNA sequence. . The consensus sequence thus obtained was designated herein as DNA79305. Considering DNA79305, a human brain library cDNA library was screened with the following two primers to identify DNA88004-2575.
5'GAGCTGAAGTCAGCCTTTGAG3 '(SEQ ID NO: 136, positive direction), and
5'CTCTGCAGAAGTCTCGTTCC3 '(SEQ ID NO: 137, reverse direction)
The full-length clone shown in FIG. 49 contained a single open reading frame, had an apparent translation start site at nucleotide positions 337-339, and had a stop codon at nucleotide positions 1171-1173 (FIG. 49). 49; SEQ ID NO: 49). The predicted polypeptide precursor (Figure 50; SEQ ID NO: 50) is 278 amino acids long. PRO4409 has a calculated molecular weight of approximately 30748 daltons and a predicted pI of approximately 5.47.
Analysis of the Dayhof database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis of the full-length sequence shown in FIG. 50 (SEQ ID NO: 50) revealed that the PRO4409 amino acid sequence and the Dayhof sequence: HGS_RF300, HSU80744_1, CEC11H1_7, Sequence identity with CEVK04G11_2, HGS_RF177, CEF09E8_2, AF0348802_1, P_R51227, I46014 and CYL2_BOVIN (including text related to sequence nad) was revealed.
Clone DNA88004-2575 (UNQ1934) is designated as DNA88004-2575 and was deposited with ATCC on March 30, 1999 and is assigned ATCC deposit number 203890.

Example 29: Isolation of cDNA Clones Encoding Human PRO5725 Polypeptide (UNQ2446) The expressed sequence tag (EST) DNA database (LIFESEQ®, Incyte Pharmaceuticals / Palo Alto, Calif.) Was searched and against Neuronitin ESTs showing homology were identified. EST clone number 3705684 was then purchased from LIFESEQ® (Incyte Pharmaceuticals / Palo Alto, Calif.) To obtain the cDNA insert of the clone and to determine its overall sequence.
The entire nucleotide sequence of this clone is herein designated DNA92265-2669 and is shown in FIG. 51 (SEQ ID NO: 51). The DNA92265-2669 clone had a single open reading frame, the apparent translation start site was located at nucleotide positions 27-29, and the stop signal was located at nucleotide positions 522-524 (FIG. 51, SEQ ID NO: 51). The predicted polypeptide precursor was 165 amino acids long, the calculated molecular weight was about 17786 daltons, and the predicted pi was about 8.43. The analysis of the full-length PRO5725 sequence shown in FIG. 52 (SEQ ID NO: 52) reveals the existence of various important polypeptide domains as shown in FIG. 52, and the positions of these important polypeptide domains are as described above. Clone DNA92265-2669 has been deposited with ATCC on June 22, 1999 and is assigned ATCC deposit no. PTA-256.
Analysis of the Dayhof database (version 35.45 SwissProt35) using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in FIG. 52 (SEQ ID NO: 52) revealed the PRO5725 amino acid sequence and the Dayhof sequence RNU88958_1; P_W37859; P_W37858; Sequence identity with JC6305; HGS_RE778; HGS_RE777; P_W27652; P_W44088; HGS_RE776; and HGS._RE425 was revealed.

Example 30: Isolation of cDNA clone encoding human PRO6097 polypeptide (UNQ2545) Preparation of oligo dT primed cDNA library mRNA was isolated from human SK-Lu-1 adenocarcinoma cell line tissue using reagents and protocols of Invitrogen, San Diego, CA (Fast Track 2). This RNA was used to generate oligo dT primed cDNA in vector pRK5D using reagents and protocols from Life Technologies, Gaithersburg, MD (Super Script Plasmid System). In this method, double-stranded cDNA was classified into a size exceeding 1000 bp, and SalI / NotI binding cDNA was cloned into an XhoI / NotI digested vector. pRK5D was cloned into a vector with an sp6 transcription initiation site followed by an SfiI restriction enzyme site, followed by a XhiI / NotI cDNA cloning site.
2. Preparation of Random Primed cDNA Library A secondary cDNA library was created to favorably represent the 5 ′ end of the primary cDNA clone. Sp6 RNA was generated from the primary library (described above) and this RNA was ligated into the vector pSST-AMY. Used to generate a randomly primed cDNA library using reagents and protocols from Life Technologies at 0 (Super Script Plasmid System referenced above). In this method, double stranded cDNA was sized to 500-1000 bp, ligated to a NotI adapter with blunt ends, cut at the SfiI site, and cloned into an SfiI / NotI cut vector. pSST-AMY. 0 is a cloning vector having a yeast alcohol dehydrogenase promoter before the cDNA cloning site and a mouse amylase sequence (mature sequence without a secretion signal) after the cloning site followed by an alcohol dehydrogenase transcription termination region. Thus, cDNA cloned into this vector fused in frame to the amylase sequence will lead to secretion of amylase from appropriately transfected yeast colonies.

3. Transformation and detection DNA from the library described in paragraph 2 above was chilled on ice, to which was added electrocompetent DH10B bacteria (Life Technologies, 20 ml). The bacteria and vector mixture was then electroporated as recommended by the manufacturer. SOC medium (Life Technologies, 1 ml) was then added and the mixture was incubated at 37 ° C. for 30 minutes. Transformants were then plated on 20 standard 150 mm LB plates containing ampicillin and incubated for 16 hours (37 ° C.). Positive colonies were discarded from the plates and DNA was isolated from bacterial pellets using standard methods such as the CsCl-gradient method. The purified yeast was then subjected to the following yeast protocol.
Yeast methods can be divided into three categories: (1) transformation with yeast plasmid / cDNA binding vectors; (2) detection and isolation of yeast clones secreting amylase; and (3) direct from yeast colonies. PCR amplification and sequencing of the insert and purification of DNA for further analysis.
The yeast strain used was HD56-5A (ATCC-90785). This strain has the following genotypes: MAT alpha, ura3-52, leu2-3, leu2-112, his3-11, his3-15, MAL ⁺ , SUC ⁺ , GAL ⁺ . Preferably, yeast mutants with incomplete post-translational pathways can be used. Such mutants have transpositional deficient alleles at sec71, sec72, and sec62, with truncated sec71 being most preferred. Alternatively, antagonists (including antisense nucleotides and / or ligands) that interfere with the normal operation of these genes, other proteins involved in this post-translational pathway (eg, SEC61p, SEC72p, SEC62p, SEC63p, TDJ1p, SSA1p − 4p) or complex formation of these proteins is also preferably used in combination with amylase-expressing yeast.
Transformation was performed based on the protocol outlined in Gietz et al., Nucl. Acid. Res., 20: 1425 (1992). The transformed cells were then seeded from agar into YEPD complex medium broth (100 ml) and grown overnight at 30 ° C. YEPD broth was prepared as described in Kaiser et al., Methods in Yeast Genetics, Cold Spring Harbor Press, Cold Spring Harbor, NY, p. 207 (1994). The overnight medium is then diluted to approximately 2 × 10 ⁶ cells / ml (about OD ₆₀₀ = 0.1) in fresh YEPD broth (500 ml) and 1 × 10 ⁷ cells / ml (about OD ₆₀₀ = 0.4-0.0). Re-growth until 5).
The cells are then harvested and prepared for transformation by transferring to a GS3 rotor bottle in a Sorval GS3 rotor for 5 minutes at 5000 rpm, discarding the supernatant and then resuspending in sterile water, in a 50 ml Falcon tube. Centrifuge again at 3500 rpm in a Beckman GS-6KR centrifuge. The supernatant is discarded and the cells are subsequently washed with LiAc / TE (10 ml, 10 mM Tris-HCl, 1 mM EDTA pH 7.5, 100 mM Li ₂ OOCCH ₃ ) and re-introduced in LiAc / TE (2.5 ml). Suspended.
Transformation occurs by mixing the prepared cells (100 μl) with fresh denatured single-stranded salmon sperm DNA (Lofstrand Labs, Gaitherburg, MD) and transforming DNA (1 μg vol. <10 μl) in a microtube. I let you. The mixture was mixed briefly by vortexing, then 40% PEG / TE (600 μl, 40% polyethylene glycol-4000, 10 mM Tris-HCl, 1 mM EDTA, 100 mM Li ₂ OOCCH ₃ , pH 7.5) was added. . The mixture was gently agitated and incubated at 30 ° C. with agitation for 30 minutes. The cells were then heat shocked at 42 ° C. for 15 minutes, and the reaction vessel was centrifuged in a microtube at 12000 rpm for 5-10 seconds, decanted, and made into TE (500 μl, 10 mM Tris-HCl, 1 mM EDTA pH 7.5). After resuspension, it was centrifuged. The cells were then diluted in TE (1 ml) and aliquots (200 μl) were spread on selective media previously prepared in 150 mm growth plates (VWR).
Alternatively, transformation was performed in a single large scale reaction rather than multiple small reactions, but the amount of reagent was scaled up accordingly.
The selection medium used was synthetic complete dextrose agar lacking uracil prepared as described in Kaiser et al., Methods in Yeast Genetics, Cold Spring Harbor Press, Cold Spring Harbor, NY, p. 208-210 (1994). SCD-Ura). Transformants were grown at 30 ° C. for 2-3 days.
Detection of colonies secreting amylase was performed by including red starch in the selective growth medium. Starch was coupled to a red dye (reactive Red-120, Sigma) according to the method described in Biely et al., Anal. Biochem., 172: 176-179 (1988). Bound starch was introduced into SCD-Ura agar plates at a final concentration of 0.15% (w / v) and buffered to pH 7.0 with potassium phosphate (final concentration 50-100 mM).
Positive colonies were picked and streaked on fresh selective medium (150 mm plate) to obtain a well-isolated and identifiable single colony. Well isolated colonies positive for amylase secretion were detected by direct introduction of red starch into buffered SCD-Ura agar. Positive colonies were determined by their ability to degrade starch and produce a visible halo directly around the positive colonies.

4). Isolation of DNA by PCR amplification When positive colonies were isolated, a portion was picked with a toothpick and diluted in sterile water (30 μl) in a 96-well plate. At this point, positive colonies are either frozen and stored for subsequent analysis or are immediately amplified. Aliquots of cells (5 μl) were added to 0.5 μl Klentaq (Clontech, Palo Alto, Calif.); 4.0 μl 10 mM dNTP (Perkin Elmer-Cetus); 2.5 μl Kentaq buffer (Clontech); 0.25 μl positive Direction Oligo 1; 0.25 μl Reverse Oligo 2; used as template for PCR reaction in 25 μl volume containing 12.5 μl distilled water. The sequence of forward oligonucleotide 1 is:
5'-TGTAAAACGACGGCCAGT TAAATAGACCTGCAATTATTAATCT -3 '(SEQ ID NO: 67)
The sequence of reverse oligonucleotide 2 is:
5'-CAGGAAACAGCTATGACC ACCTGCACACCTGCAAATCCATT- 3 '(SEQ ID NO: 68)
The PCR was then performed as follows:
a. Denaturation 92 ° C., 5 minutes b. Next 3 cycles Denaturation 92 ° C, 30 seconds
Annealing 59 ° C, 30 seconds
Elongation 72 ° C, 60 seconds c. Next 3 cycles Denaturation 92 ° C, 30 seconds
Annealing 57 ° C, 30 seconds
Elongation 72 ° C, 60 seconds d. Next 25 cycles Denaturation 92 ° C, 30 seconds
Annealing 55 ° C, 30 seconds
Elongation 72 ° C, 60 seconds e. Holding 4 ℃
The underlined regions of the oligonucleotides are annealed to the ADH promoter region and the amylase region, respectively, and in the absence of an insert, the vector pSST-AMY. A 307 bp region from 0 was amplified. Typically, the first 18 nucleotides at the 5 ′ end of these oligonucleotides contained the annealing site for the sequence primer. Thus, the total product of the PCR reaction from the empty vector was 343 bp. However, the signal sequence fusion cDNA resulted in a fairly long nucleotide sequence.
Following PCR, an aliquot (5 μl) of the reaction was examined by agarose gel electrophoresis using a Tris-borate-EDTA (TBE) buffer system in a 1% agarose gel as described in Sambrook et al., Supra. . Clones yielding a single strong PCR product greater than 400 bp were further analyzed by DNA sequence after purification on a 96 Qiaquick PCR clean column (Quagen Inc., Chatsworth, Calif.).

5. Identification of full-length clone The cDNA sequence was isolated by the above search and was herein designated as DNA84712. A probe was then generated from the sequence of the DNA84712 molecule and used to search the human SK-Lu-1 player cell line library (247) prepared as described in 1 above. The cloning vector is pRK5B (pRK5B is a precursor of pRK5D that does not contain an SfiI site; see Holmes et al., Science, 253: 1278-1280 (1991)) and the size of the cleaved cDNA is less than 2800 bp there were. Oligonucleotide probes were synthesized for 1) identifying a cDNA library containing the sequence of interest by PCR and 2) using it as a probe to isolate a clone of the full-length coding sequence of PRO6097. Forward and reverse PCR primers often yield PCR products that are approximately 100-1000 bp long, usually spanning 20-30 oligonucleotides. The probe sequence is usually 40-55 bp long. To screen multiple libraries for full-length clones, PCR primer pairs were used and DNA from the library was screened by PCR amplification according to Ausubel et al., Current Protocols in Molecular Biology, supra. The positive library was then used to isolate clones encoding the gene of interest using probe oligonucleotides and primer pairs.
The oligonucleotide probes used are as follows.
Positive PCR primer 5'-CTGACCGGTCCGCTCATGG-3 '(SEQ ID NO: 138)
Reverse PCR primer 5'-CAGCATGCTTTCCGCGAAGTC-3 '(SEQ ID NO: 139)
Hybridization probe 5'-GGCAGGAAGGCCAGGGGTGCTGAGTTCTTCACCTCCTTTTAGACTG-3 '(SEQ ID NO: 140)
The identified full-length clone contained a single open reading frame and had an apparent translation start site at nucleotide positions 158-160 and a stop signal at nucleotide positions 1727-1729 (FIG. 55; SEQ ID NO: 55). ). The predicted polypeptide precursor was 523 amino acids long and was found to have a calculated molecular weight of approximately 58887 daltons and an estimated pI of approximately 9.57. The analysis of the full-length PRO6097 sequence shown in FIG. 56 (SEQ ID NO: 56) revealed the existence of various important polypeptide domains as shown in FIG. 56, and the positions of these important polypeptide domains were generally as described above. It was. Clone DNA107701-2711, deposited with ATCC on August 3, 1999, and assigned ATCC deposit number PTA-487.
Analysis of the day 60 database (version 35.45 SwissProt 35) using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in FIG. Identity was revealed: YMB8_YEAST; S49759; ATF10N7_5; SPBC405_3; S69718; H69798; D71226; U95370_5; A69780;

Example 31: Isolation of cDNA clone encoding human PRO7425 polypeptide (UNQ2966)
The extracellular domain (ECD) sequences of about 950 known secreted proteins (including secreted signal sequences, if any) obtained from the Swiss-Prot public database were used to search the EST database. The EST database consists of (1) a public EST database (eg Merck / Washington University), (2) a corporate EST database (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA), and (3) a Genentech company. Includes EST database. The search was performed using the computer program BLAST or BLAST-2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)) as a comparison between the ECD protein sequence and the 6-frame translation of the EST sequence. Using the program “phrap” (Phil Green, Seattle, Washington, University of Washington), comparisons with a BLAST score of 70 (possibly 90) that do not encode known proteins were clustered and assembled into a consensus DNA sequence. .
Consensus DNA sequences were assembled as described above compared to other EST sequences using phrap. This consensus sequence was herein designated DNA86620. In some cases, the DNA86620 consensus is derived from an intermediate consensus DNA sequence that is extended as much as possible using a source of EST sequences as described above, using BLAST repetitive cycles and phraps.
Based on the DNA86620 consensus sequence and considering the sequence homology found between the DNA86620 sequence and the EST sequence contained in clone number 4797137 obtained from the LIFESEQ® (Incyte Pharmaceuticals / Palo Alto, Calif.) Database, Clone number 4797137 was purchased and the cDNA insert was obtained and sequenced. Here, it was found that the cDNA insert encodes the full-length protein. The sequence of this cDNA insert is shown in FIG. 57 and is herein designated as DNA108792-2753.
The full-length clone identified above contained a single open reading frame and had an apparent translation start site at nucleotide positions 3-5 and a stop signal at nucleotide positions 708-710 (FIG. 57, sequence). Number 57). The predicted polypeptide precursor is 235 amino acids long, has a calculated molecular weight of about 25989 daltons, and an estimated pI of about 8.32. Analysis of the full-length PRO7425 sequence shown in FIG. 58 (SEQ ID NO: 58) reveals the presence of various important polypeptide domains as shown in FIG. is there. Clone DNA108792-2753 was deposited with ATCC on August 31, 1999 and is assigned ATCC deposit number PTA-617.
Analysis of the Dayhof database (version 35.45 SwissProt35) using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in FIG. 58 (SEQ ID NO: 58) shows a sequence between the PRO7425 amino acid sequence and the next Dayhof sequence. Identity was revealed: P_Y11831; P_Y11619; MYP0_HUMAN; MYP0_MOUSE; HSPMPO2_1; AF087020_1; GEN13751; AF007783_1; P_W14146;

Example 32 Isolation of cDNA Clones Encoding Human PRO10102 Polypeptide (UNQ3103) DNA129542-2808 is a proprietary signal sequence discovery algorithm developed by Genentech, Inc. (South San Francisco, Calif.). GenBank) and / or private (LIFESEQ®, Incyte Pharmaceuticals, Inc., Palo Alto, Calif.) Databases were identified by applying to ESTs and clustered EST fragments. The signal sequence algorithm calculates a secretory signal score based on the letters of the DNA nucleotide surrounding the first and optionally the second methionine codon (ATG) at the 5'-end of the sequence or sequence fragment under consideration. The nucleotide following the first ATG must encode at least 35 unambiguous amino acids without a stop codon. If the first ATG has the necessary amino acids, the second is not analyzed. If none of the requirements is met, the candidate sequence is not scored. In order to determine whether an EST sequence contains a genuine signal sequence, a set of seven sensors (evaluation parameters) known to be associated with the secretory signal is used to determine the DNA surrounding the ATG codon and the corresponding amino acid sequence. Use to score.
Using the signal sequence algorithm described above, it was possible to identify an EST cluster sequence, designated here as 166950H1, from the LIFESEQ® (Incyte Pharmaceuticals, Inc./Palo Alto, Calif.) Database. This EST cluster sequence is then combined with various expressed gene sequence fragment (EST) databases, including public EST databases (eg, GenBank) and proprietary EST DNA databases (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, Calif.). Homology was identified by comparison. Homology searches were performed using the computer program BLAST or BLAST-2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). Using the program “phrap” (Phil Green, Seattle, Washington, University of Washington), comparisons with a BLAST score of 70 (possibly 90) that do not encode known proteins were clustered and assembled into a consensus DNA sequence. . The consensus sequence thus obtained was designated herein as DNA112560.
Considering the sequence homology found between the DNA112560 sequence and the EST sequence contained in clone number 166950 obtained from the LIFESEQ® (Incyte Pharmaceuticals, Palo Alto, Calif.) Database, clone number 166950 was purchased, A cDNA insert was obtained and sequenced. Here, it was found that this cDNA insert encodes the full-length protein. The sequence of this cDNA insert is shown in FIG. 59 and is herein designated as DNA129542-2808.
Clone number 129542-2808 contains a single open reading frame, has an apparent translation start site at nucleotide positions 58-60, and was terminated with a stop codon located at nucleotide positions 1786-1788 (FIG. 59, SEQ ID NO: 59). The predicted polypeptide precursor was 576 amino acids long (Figure 60, SEQ ID NO: 60). The predicted molecular weight for the full-length PRO10102 protein shown in FIG. 60 is approximately 62128 daltons and the estimated pI is approximately 7.41. The analysis of the full-length PRO10102 sequence shown in FIG. 60 (SEQ ID NO: 60) reveals the existence of various important polypeptide domains as shown in FIG. 60. The positions of these important polypeptide domains are generally as described above. is there. Clone DNA129542-2808 has been deposited with ATCC on February 23, 2000 and is assigned ATCC deposit number PTA-1405.
Sequence between the PRO10102 amino acid sequence and the next Dayhof sequence by analysis of the Dayhof database (version 35.45 SwissProt35) using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in FIG. 60 (SEQ ID NO: 60) The identity was revealed: rTNFSF3L_1, P_Y00771, AC007785_2, AF076483_1, P_W23722, P_W37837, P_Y00770 and AB016605_1. The PRO10102 polypeptide is much longer than its homologous sequence. For example, it has 378 amino acid residues at the N-terminus that are not homologous to rTNFSF3L_1 and P_Y00771.

Example 33 Isolation of DNA Clones Encoding Human PRO10282 Polypeptide (UNQ3126) In a human cDNA library that preferentially displays the 5 ′ end of a primary cDNA clone using a yeast screening assay, native human PRO10282 poly A cDNA clone (DNA148380-2827) encoding the peptide was isolated.
Clone DNA148380-2827-1 contains a single open reading frame, has an apparent translation start site at nucleotide positions 49-51, and was terminated by a stop codon at nucleotide positions 2050-2052 (FIG. 61, SEQ ID NO: 61). The predicted polypeptide precursor was 667 amino acids long (Figure 62, SEQ ID NO: 62). The predicted molecular weight for the full-length PRO10282 protein shown in FIG. 62 was approximately 73502 daltons and the pI was approximately 9.26. The analysis of the full-length PRO10282 sequence shown in FIG. 62 (SEQ ID NO: 62) reveals the existence of various important polypeptide domains as shown in FIG. 62, and the positions of these important polypeptide domains are generally as described above. Met. Clone DNA148380-2827 has been deposited with ATCC on January 11, 2000 and is assigned ATCC deposit number PTA-1181.
Analysis of the Dayhof database (version 35.45 SwissProt35) using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in FIG. 62 (SEQ ID NO: 62) revealed that the PRO10282 amino acid sequence and , P_W88559 and HGS_RE259 have been demonstrated homology.

Example 34: Isolation of cDNA clone encoding human PRO779 polypeptide (UNQ455) Human embryonic heart and human embryonic lung lgt10 bacteriophage cDNA libraries (both purchased from Clontech) were based on EST (GenBank locus W71984). Screening by hybridization with synthetic oligonucleotide probes showed a certain degree of homology to the intracellular domain (ICD) of human TNFR1 and CD95. W71984 is a 523 bp EST with 27 identities in one reading frame to a 43 amino acid long sequence within the ICD of human TNFR1. The oligonucleotide probes used for screening are 27 and 25 bp in length, respectively, and have the following sequences:
5'-GGCGCTCTGGTGGCCCTTGCAGAAGCC-3 '(SEQ ID NO: 141)
5'-TTCGGCCGAGAAGTTGAGAAATGTC-3 '(SEQ ID NO: 142)
Hybridization of the two probes 1: 1 was performed using 20% formamide, 5XSSC, 10% dextran sulfate, 0.1% NaPiPO4, 0.05 mg salmon sperm DNA, and 0.1% dodecyl sulfate. Perform overnight at room temperature in a buffer containing sodium (SDS), followed by one continuous 6XSSC wash at room temperature, 2 x 1XSC / 0.1% SDS wash at 37 ° C, 0.5XSSC at 37 ° C. Two washes with /0.1% SDS and two washes with 0.2XSSC / 0.1% SDS at 37 ° C. Positive clones obtained from each of the embryonic heart (FH20A.57) and embryonic lung (FL8A.53) libraries were confirmed to be specific by PCR using the respective hybridization probes as primers. It was. Isolated by limiting the dilution of a single phage plaque containing each positive clone and purified using the Wizardλ preparative DNA purification kit (Promega).
The cDNA insert was excised from the lambda vector arm by digestion with EcoRI, gel purified and subcloned into pRK5 pre-digested with EcoRI. The entire clone was then sequenced.
Clone (FH20A.57) DNA58801-1052 (also referred to as Apo3 clone FH20.57, deposited as ATCC 55820, as described below) contains a single open reading frame, with an apparent translation start site at nucleotide position 103- 105 and terminated at the stop codon found in nucleotides 1354-1356 (FIG. 65, SEQ ID NO: 65). The predicted polypeptide precursor was 417 amino acids long (Figure 66, SEQ ID NO: 66). The predicted molecular weight for the full-length PRO779 protein shown in FIG. 66 was about 45000 daltons and the pI was about 6.40. Analysis of the full-length PRO779 sequence shown in FIG. 66 (SEQ ID NO: 66) revealed the presence of various important polypeptide domains, and the positions of these important polypeptide domains were generally as described above. Analysis of the full-length PRO779 sequence shown in FIG. 66 shows that a signal peptide located at about amino acids 1-24, a transmembrane domain located at about amino acids 199-219, N-glycosyl at about amino acids 67-71 and 106-110 A cAMP- and cGMP-dependent protein kinase phosphorylation site located at amino acids about 157-161, a tyrosine kinase phosphorylation site located at amino acids about 370-377, amino acids about 44-50, about 50-56, about 66 N-myristoylation site located at -72, about 116-122, about 217-223, about 355-361, about 391-397, and about 401-407, and a prokaryotic lipoprotein located at amino acids about 177-188 The presence of lipid attachment sites was revealed. Clone DNA58801-1052 has been deposited with ATCC on September 5, 1996 and is assigned ATCC deposit no.
The ECD contains four cysteine-rich repeats similar to the corresponding regions of human TNFR1 (4 repeats), CD95 (3 repeats) and other known TNFR family members. The ICD contains TNFR1 and CD95 ICDs and death domain sequences similar to those found in cytoplasmic death signaling proteins such as human FADD / MORT1, TRADD, RIP and Drosophila Reaper. Overall and in individual regions, PRO779 (APO3) is more closely related to TNFR1 than CD95, with a total amino acid identity of 29.3% and 22.8%, and 28 for ECD 2% and 24.7%, 31.6% and 18.3% in ICD and 47.5% and 20% in death domain.

Example 35: PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 Production and analysis of mice with PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 gene disruption PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO28 RO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, RO5759, PRO5925, PRO5925, PRO5925, PRO5925 In order to investigate the role of peptides, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, RO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, was produced a disruption in PRO61709 or PRO779 gene. In particular, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO12481PRO Transgenic mice containing disruptions in the PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 genes (ie, knockout mice) were created by gene targeting or gene wrapping. Mutations were confirmed by Southern blot analysis to confirm correct targeting to both the 3 ′ and 5 ′ ends. Gene-specific genotyping was also performed by genomic PCR, confirming the loss of endogenous native transcripts as evidenced by RT-PCR using primers that anneal to exons adjacent to the insertion site. The targeting vector was electroporated into 129 strain ES cells and target clones were identified. Target clones were microinjected into host blastocysts to generate chimeras. Chimeras were crossed with C57 animals to create F1 heterozygotes. Heterozygotes were crossed to produce F2 wild type, heterozygous and homozygous cohorts used for phenotypic analysis. In rare cases when F1 heterozygotes were not fully produced, F1hets were bred to wild type C57 mice to generate sufficient heterozygotes and bred for a cohort of phenotypic analyses. All phenotypic analyzes were performed 12-16 weeks after birth.

Generation and Analysis of Mice with 35.1 DNA22779-1130 (UNQ170) Gene Disruption In these knockout experiments, the gene encoding PRO196 polypeptide (designated as DNA22779-1130 (UNQ170)) was disrupted. The gene-specific information for these studies is as follows: The mutated mouse gene corresponds to: nucleotide reference number: NM_011923 or deposit number: NM_011923 NID: gi 6753119 reference number NM_011923.1 Musmus Cruz Angiopoietin-like 2 (Angptl2); Protein Reference Number: Q9R045 or Deposit Number: Q9R045 NID: Musmus Cruz (mouse). Angiopoietin-related protein 2 precursor (Angiopoietin-like 2). MOUSESPTRNRDB; human gene sequence reference number: NM_012098 or deposit number: NM_012098 NID: gi 6912235 reference number NM_012098.1 homosapiens angiopoietin-like 2 (ANGPTL2); human protein sequence is reference number Q9UKU9 or deposit number: Q9UKU9N ID Human). Angiopoietin-related protein 2 precursor (Angiopoietin-like 2). HUMANSPTRNRDB. Corresponding to
The mouse gene of interest is Angiopoietin-like 2 (Angptl2), an ortholog of human ANGPTL2. Alias names include Angiopoietin-related protein 2 (Arp2), HARP, MGC8889, and the like. Angptl2 is a secreted glycoprotein hormone and is expressed in vascular endothelial cells, vascular smooth muscle, heart, small intestine, spleen, stomach, large intestine, ovary, adrenal gland, skeletal muscle and prostate. The structure of Angptl2 is similar to the hormone angiopoietin, but Angptl2 does not bind to the angiopoietin receptors Tie1 and Tie2. Angptl2 induces budding in endothelial cells, consistent with the role of angiopoietin in angiogenesis (Kim et al., J Biol Chem. 274 (37): 26523-8 (1999)).
Targeted or gene trap mutations were generated in strain 129SvEv ^Brd -derived embryonic stem (ES) cells. Chimeric mice were crossed to C57BL / 6J albino mice to produce F1 heterozygous animals. These progeny were crossed to produce F2 wild type, heterozygous, and homozygous mutant progeny. Very occasionally, for example, when F1 mice are rarely obtained from the chimera, F1 heterozygous mice are crossed with 129SvEv ^Brd / C57 hybrid mice to generate additional heterozygous animals for cross fertilization and F2 mice. Was produced. Level 1 phenotypic analysis was performed on the mice thus produced.
wt het hom Total observation 23 32 23 78
Expected value 19.5 39 19.5 78
Chi-square = 2.51 Significance = 0.28467 (hom / n) = 029 Average number of pups = 8
Mutant: homologous recombination (standard)
Targeted coding exon 1 (NCBI deposit number NM — 01923.1)
Wild-type expression of the target gene was detected in 13 adult tissue samples tested by RT-PCR and in all of the embryonic stem (ES) cells except skeletal muscle, bone, and fat. Southern hybridization analysis confirmed target gene disruption.
Phenotypic analysis was performed on mice from this generation as described below.

35.1.1. Phenotypic analysis (disrupted gene: DNA22779-1130 (UNQ170)
(A) Summary of overall phenotype:
Mutation of the gene encoding the ortholog of human angiopoietin-like 2 (ANGPTL2) decreased the mean serum MCP-1, TNF-α, and IL-6 responses to LPS challenge in (− / −) mice. The (− / −) mice also showed a significant growth retardation characterized by a decrease in total tissue mass, total body fat, a decrease in body weight and length, and a decrease in mean vertebral trabecular measurements. Gene disruption was confirmed by Southern blotting.

(B) Immunological phenotypic analysis Immune-related and inflammatory diseases are in normal physiology, responding to invasion or injury, initiating repair of invasion or injury, and innate and acquired protective power against foreign organisms. Physiological pathways important for the incorporation of are very complex and multiple connected signs or consequences. A disease or condition is a condition in which these normal physiological pathways are subject to additional invasion or injury, either directly as a result of abnormal control or excessive stimulation, as a response to self, or as a combination thereof. It occurs when causing.
The origins of these diseases often involve multiple pathways and often multiple different physiological systems / pathways, and intervening in multiple of these pathways can lead to remission or therapeutic effects. Can be mentioned. Therapeutic intervention can be done by antagonizing harmful processes / pathways or stimulating beneficial processes / pathways.
T lymphocytes (T cells) are an important component of a mammalian immune response. T cells recognize antigens associated with self-molecules encoded by genes within major histocompatibility antigens (MHC). Antigens can be expressed with MHC molecules on the surface of antigen-presenting cells, virus-infected cells, cancer cells, grafts and the like. T cell lines remove degenerative cells that pose a threat to the health of the host mammal. T cells include helper T cells and cytotoxic T cells. Helper T cells proliferate on a large scale when they recognize antigen-MHC complexes on antigen-presenting cells. Helper T cells also secrete various cytokines, lymphokines, which play a central role in the activity of B cells, cytotoxic T cells and various other cells that participate in the immune response.
In many immune responses, inflammatory cells infiltrate the site of injury or infection. Migrating cells are neutrophils, eosinophils, monocytes or lymphocytes, which can be determined by histological examination of the affected tissue. Current Protocols in Immunology, ed John E. Coligan, 1994 John Wiley & Sons, Inc.
Many immune related diseases are known and have been extensively studied. Such diseases include immune-mediated inflammatory diseases (eg rheumatoid arthritis, immune-mediated renal disease, hepatobiliary disease, inflammatory bowel disease (IBD), psoriasis, and asthma), non-immune-mediated inflammatory diseases , Infections, immunodeficiency diseases, tumors, and transplant rejections. In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified.
In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified. Immune related diseases can be treated in one example by suppressing the immune response. The use of neutralizing antibodies that suppress molecules with immunostimulatory activity is beneficial for the treatment of immune-mediated and inflammatory diseases. Molecules that suppress immune responses (proteins directly or using antibody agonists) can be used to suppress immune responses and thus ameliorate immune-related diseases.

The following tests were conducted.
Acute phase response:
Test Description: Bacterial lipopolysaccharide (LPS) is an endotoxin and as such is a potent inducer of the acute phase response and systemic inflammation. Level 1 LPS mice were injected intraperitoneally with a sublethal dose of LPS in 200 μL of sterile saline using a 26 gauge needle. The dose was 1 μg / g body weight 3 hours after injection based on the average body weight of the tested mice. A 100 μl blood sample was then taken and analyzed for the presence of TNFa, MCP-1, and IL-6 with a FACSCalibur instrument.
result:
(− / −) Mice showed a decrease in mean serum MCP-1, IL-6 and TNF-α responses to LPS challenge compared to their pups and background means.
Analyzed wt / het / hom: 6/4/10
In summary, administration of LPS endotoxin antigen has demonstrated that knockout mice lacking the gene encoding PRO196 polypeptide exhibit immunological abnormalities compared to their wild-type pups. In particular, mutant mice showed reduced ability to elicit an immunological response (production of MCP-1, TNF-α and IL-6) when administered LPS endotoxin antigen. This indicates a lack of pro-inflammatory response. IL-6 contributes to the subsequent B cell activation stage. In addition, IL-6 plays an important role in the induction of acute phase responses and systemic inflammation. This indicates that PRO196 polypeptide or an agonist thereof stimulates the immune system and this effect is beneficial to the individual, for example, leukemia and other types of cancer, and used in immunocompromised patients such as AIDS patients I think I can do it. Thus, inhibitors or antagonists of PRO196 polypeptides function to suppress immune responses and are useful candidates for suppressing adverse immune responses, for example in the case of graft rejection or graft-versus-host disease.

(C) Bone metabolism and physical diagnosis (1) Measurement of tissue mass and lean body mass-Dexa
Dexa Analysis-Test Description Procedure: In this assay, a cohort of 4 wild type, 4 heterozygotes and 8 homozygotes was tested. Dual energy X-ray absorption (DEXA) was successfully used to identify changes in total tissue mass (TTM).
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Body measurements (body length and body weight): Body length and body weight were measured at about 16 weeks of age.
result:
(− / −) Mice showed a decrease in average body weight and average body length compared to gender-matched (+ / +) littermates and background means (especially at least two in the first eight (8) weeks). (2) Two standard deviations (SD) were below normal).
Analyzed wt / het / hom: 23/32/23
(2) Bone metabolism: radiological phenotype analysis In the area of bone metabolism, targets are identified here for the treatment of arthritis, osteoporosis, osteopenia and marble bone disease, and targets that promote fracture healing Identified. The exam includes:
DEXA for measuring bone mineral density in the femur and vertebra
• Micro CT for very high resolution and very sensitive measurement of bone mineral content in both trabecular and cortical bone.
Dexa Analysis-Test Method Description Procedure: A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. Dual energy X-ray absorption measurement (DEXA) was successfully used to identify changes in bone. Anesthetized animals were examined and bone mineral density (BMC), BMC / LBM ratio, volumetric bone density (vBMD), whole body BMD, femoral BMD and vertebra BMD were measured.
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Bone micro CT analysis Procedure: Micro CT was also used to perform very sensitive BMD measurements. One vertebra and one thigh were removed from a cohort of 4 wild type and 8 homozygous mice. Measurements were taken of the five vertebral traebecular volumes, traebecular thickness, bond density, and total bone area and cortical thickness of the mid-thigh. A micro CT40 scan provided detailed information on bone mass and structure. Multiple bones were placed in the sample holder and scanned automatically. Instrument software was used to select areas of interest for analysis. Trabecular parameters were analyzed in the 5th lumbar vertebra (LV5) with 16 micrometer resolution, and cortical bone parameters were analyzed in the mid-femoral axis with 20 micrometer resolution.
result:
DEXA: (− / −) mice showed a reduction in mean total tissue volume and total fat when compared to (+ / +) littermates and background averages of matched gender.
Micro-CT analysis: (− / −) mice show a decrease in mean vertebra trabecular volume, thickness, and bond density when compared to gender-matched (+ / +) littermates and background means It was done.
Analytical value wt / het / hom: 4/4/10].
Summary:
These results indicate that knockout mutant mice exhibit abnormal bone metabolism with significant bone loss similar to osteoporosis, characterized by bone loss with reduced density and possibly fragility leading to fractures. found. Therefore, it is thought that PRO196 polypeptide or its agonist functions in maintaining bone homeostasis. In addition, PRO196 or its encoding gene is thought to be useful for bone healing, or for the treatment of osteoarthritis or osteoporosis. On the other hand, an antagonist of PRO196 or its encoding gene is thought to cause abnormal or pathological bone disorders including inflammatory diseases related to abnormal bone metabolism such as arthritis, osteoarthritis and osteoporosis.
(− / −) Mice analyzed by DEXA had a significant growth retardation characterized by a marked decrease in total tissue mass and total fat and a decrease in body weight and body length when compared to their (+ / +) littermates. showed that. These results are likely due to problems associated with the hypothalamic-pituitary axis that can affect bone growth. Combining this with the decrease in bone measurements suggests tissue wasting such as cachexia. Thus, PRO196 polypeptides or agonists thereof are believed to be useful in the treatment of bone disorders, and may be useful in the treatment of growth diseases or the prevention of cachexies or other tissue wasting diseases.

35.2 Generation and analysis of mice with DNA33094-1131 (UNQ191) gene disruption In these knockout experiments, the gene encoding PRO217 polypeptide (designated DNA33094-1131 (UNQ191)) was disrupted. The gene-specific information for these studies is as follows: The mutated mouse gene corresponds to: nucleotide reference number: NM — 011915 or deposit number: NM — 011915 NID: 6755998 (Wif1); protein reference number: Q9WUA1 or deposit number: Q9WUA1 NID: Musmus Cruz (mouse). WNT inhibitory factor 1 precursor (WIF-1). MOUSESPTRNRDB; human gene sequence reference number: NM_007191 or deposit number: NM_007191 NID: 18379354 Homo sapiens homo sapiens WNT inhibitory factor 1 (WIF1); Wnt inhibitory factor 1 precursor (Angiopoietin-like 2). HUMANSPTRNRDB. Corresponding to
The target mouse genes are Wif1 (Wnt inhibitory factor 1), an ortholog of human WIF1. Alias names are WIF-1 and Wnt inhibitory factor 1 and the like. WIF1 is a secreted protein that is expressed during embryonic development, binds to Wnt proteins, and disrupts the activation of their cognate receptors. Wnt protein is an extracellular signaling molecule involved in the developmental stage (Hseih et al., Nature, 398 (6726): 431-6 (1999)). WIF1 is downregulated in prostate, breast, lung, and bladder cancers, but is upregulated in colorectal adenocarcinoma cell lines. This suggests that changes in WIF1 expression are associated with tumorigenesis in those tissues (Wissmann et al., J Pathol, 201 (2): 204-12 (2003); Cebrat et al., Cancer Lett, 206 (1): 107-13 (2004)).
Targeted or gene trap mutations were generated in strain 129SvEv ^Brd -derived embryonic stem (ES) cells. Chimeric mice were crossed to C57BL / 6J albino mice to produce F1 heterozygous animals. These progeny were crossed to produce F2 wild type, heterozygous, and homozygous mutant progeny. Very occasionally, for example, when F1 mice are rarely obtained from the chimera, F1 heterozygous mice are crossed with 129SvEv ^Brd / C57 hybrid mice to generate additional heterozygous animals for cross fertilization and F2 mice. Was produced. Level 1 phenotypic analysis was performed on the mice thus produced.
wt het hom Total observations 24 35 20 79
Expected value 19.75 39.5 19.75 79
Chi-square = 1.43 Significance = 0.48910 (hom / n) = 0.25 Average number of pups = 8
Mutant: homologous recombination (standard)
Targeted encoded exon 1 (NCBI deposit number NM — 01915.1)
Wild-type expression of the target gene was detected in brain, spinal cord, eye and heart among 13 adult tissue samples tested by RT-PCR.
Southern hybridization analysis confirmed target gene disruption.

35.2.1. Phenotypic analysis (disrupted gene: DNA33094-1131 (UNQ191)
(A) Summary of overall phenotype:
Mutation of the gene encoding the ortholog of human Wnt inhibitory factor 1 (WIF1) caused growth retardation with decreased bone measurements in (− / −) mice. Mutant (− / −) mice also showed an increased IgG2a response to ovalbumin challenge. Gene disruption was confirmed by Southern blotting.

(B) Immunological phenotypic analysis Immune-related and inflammatory diseases are in normal physiology, responding to invasion or injury, initiating repair of invasion or injury, and innate and acquired protective power against foreign organisms. Physiological pathways important for the incorporation of are very complex and multiple connected signs or consequences. A disease or condition is a condition in which these normal physiological pathways are subject to additional invasion or injury, either directly as a result of abnormal control or excessive stimulation, as a response to self, or as a combination thereof. It occurs when causing.
The origins of these diseases often involve multiple pathways and often multiple different physiological systems / pathways, and intervening in multiple of these pathways can lead to remission or therapeutic effects. Can be mentioned. Therapeutic intervention can be done by antagonizing harmful processes / pathways or stimulating beneficial processes / pathways.
T lymphocytes (T cells) are an important component of a mammalian immune response. T cells recognize antigens associated with self-molecules encoded by genes within major histocompatibility antigens (MHC). Antigens can be expressed with MHC molecules on the surface of antigen-presenting cells, virus-infected cells, cancer cells, grafts and the like. T cell lines remove degenerative cells that pose a threat to the health of the host mammal. T cells include helper T cells and cytotoxic T cells. Helper T cells proliferate on a large scale when they recognize antigen-MHC complexes on antigen-presenting cells. Helper T cells also secrete various cytokines, lymphokines, which play a central role in the activity of B cells, cytotoxic T cells and various other cells that participate in the immune response.
In many immune responses, inflammatory cells infiltrate the site of injury or infection. Migrating cells are neutrophils, eosinophils, monocytes or lymphocytes, which can be determined by histological examination of the affected tissue. Current Protocols in Immunology, ed John E. Coligan, 1994 John Wiley & Sons, Inc.
Many immune related diseases are known and have been extensively studied. Such diseases include immune-mediated inflammatory diseases (eg rheumatoid arthritis, immune-mediated renal disease, hepatobiliary disease, inflammatory bowel disease (IBD), psoriasis, and asthma), non-immune-mediated inflammatory diseases , Infections, immunodeficiency diseases, tumors, and transplant rejections. In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified.
In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified. Immune related diseases can be treated in one example by suppressing the immune response. The use of neutralizing antibodies that suppress molecules with immunostimulatory activity is beneficial for the treatment of immune-mediated and inflammatory diseases. Molecules that suppress immune responses (proteins directly or using antibody agonists) can be used to suppress immune responses and thus ameliorate immune-related diseases.

The following tests were conducted.
Ovalbumin challenge:
Procedure: The assay was performed on 7 wild type and 8 homozygotes. Chicken ovalbumin (OVA) is a T cell-dependent antigen and is a model protein widely used for studying antigen-specific immune responses in mice. OVA is non-toxic and inert and therefore does not harm animals if an immune response is not elicited. The characteristics of the mouse immune response to OVA are already largely elucidated, and immunodominant peptides have been identified that elicit T cell responses. Anti-OVA antibodies can be detected 8-10 days after immunization using an enzyme-linked immunosorbent assay (ELIZA), and the determination of the different isotypes of the antibody results in a complex process that leads to poor response in genetically modified mice New information can be obtained.
As described above, this protocol evaluates the ability of mice to raise an antigen-specific immune response. The animals were injected intraperitoneally with 50 mg chicken ovalbumin emulsified in Freund's complete adjuvant, and the serum titer of anti-ovalbumin antibodies (IgM, IgG1 and IgG2 subclass) was measured 14 days later. The amount of OVA-specific antibody contained in the serum sample was proportional to the absorbance (OD) value generated by the instrument scanning the 96-well sample plate. Data was collected for each set of serum samples with varying degrees of dilution.
Analyzed wt / het / hom: 8/4/9
Results of this antigen administration:
(− / −) Mice showed an increase in mean serum IgG2a response to ovalbumin challenge compared to their pups and background means. That is, these knockout mice showed an increased ability of OVA-specific antibodies to elicit a response to a T cell-dependent OVA antigen or a positive immunological phenotype (a pro-inflammatory response). Thus, the gene encoding the PRO217 polypeptide appears to suppress pro-inflammatory responses caused by Th, B or plasma cell defects.
In summary, studies of ovalbumin antigens have demonstrated that knockout mice lacking the gene encoding PRO217 polypeptide exhibit immunological abnormalities compared to their wild-type pups. In particular, mutant mice showed an increased ability to elicit an immunological response when administered a T cell-dependent OVA antigen. Accordingly, inhibitors or antagonists of PRO217 polypeptides are useful for stimulating the immune system (eg, T cell proliferation), and this effect is effective in leukemia and other types of cancer, and immunocompromised patients such as AIDS patients. It seems that it can be used when Accordingly, PRO217 polypeptides or agonists thereof are useful for suppressing immune responses and are therefore valuable candidates for suppressing adverse immune responses, for example in the case of graft rejection or graft-versus-host disease.

(C) Bone metabolism and physical diagnosis (1) Measurement of tissue mass and lean body mass-Dexa
Dexa Analysis-Test Description Procedure: In this assay, a cohort of 4 wild type, 4 heterozygotes and 8 homozygotes was tested. Dual energy X-ray absorption (DEXA) was successfully used to identify changes in total tissue mass (TTM).
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Body measurements (body length and body weight): Body length and body weight were measured at about 16 weeks of age.
result:
(− / −) Mice showed a decrease in average body weight and average body length compared to (+ / +) litters and background averages of matched gender (one (1) standard deviation (SD)) The body weight was below the background average, and the standard deviation of two (2) (SD) was below the background average in body length).
Heart rate: In both male and female knockout (− / −) mice, heart rate was reduced by 1-2 in standard deviation (SD) relative to background control.
Fertility: One male (-/-) mouse (M-151) used for analysis was infertile.
(2) Bone metabolism: radiological phenotype analysis In the area of bone metabolism, targets are identified here for the treatment of arthritis, osteoporosis, osteopenia and marble bone disease, and targets that promote fracture healing Identified. The exam includes:
DEXA for measuring bone mineral density in the femur and vertebra
• Micro CT for very high resolution and very sensitive measurement of bone mineral content in both trabecular and cortical bone.
Dexa Analysis-Test Method Description Procedure: A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. Dual energy X-ray absorption measurement (DEXA) was successfully used to identify changes in bone. Anesthetized animals were examined and bone mineral density (BMC), BMC / LBM ratio, volumetric bone density (vBMD), whole body BMD, femoral BMD and vertebra BMD were measured.
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
result:
In (− / −) mice, when compared to (+ / +) littermates with matched gender and background average, average total tissue volume and lean body mass decrease, average bone mineral content and bone mineral content decrease It has been shown. Analytical value wt / het / hom: 4/4/8.
Summary:
(− / −) Mice analyzed by DEXA showed a significant decrease in total tissue mass and lean body mass and a decrease in bone measurements compared to (+ / +) littermates, thereby reducing these variants. The growth delay was suggested. In addition to this result, a decrease in body weight and length was observed, suggesting tissue wasting conditions such as cachexia or other growth-related disorders. That is, the PRO217 polypeptide or an agonist thereof is considered useful for the treatment or prevention of cachexia or other tissue wasting diseases.

35.3 Generation and Analysis of Mice with DNA34434-1139 (UNQ205) Gene Disruption In these knockout experiments, the gene encoding PRO231 polypeptide (designated DNA34434-1139 (UNQ205)) was disrupted. The gene specific information for these studies is as follows: The mutated mouse gene corresponds to the following: nucleotide reference number: NM — 019800 or deposit number: NM — 019800 NID: 9790058 6, (Acp6); Protein Reference Number: Q9JMG5 or Deposit Number: Q9JMG5 NID: Musmus Cruz (mouse). MPACPL1. MOUSESPTRNRDB; human gene sequence reference number: NM — 016361 or deposit number: NM — 016361 NID: LPSAP of sapiens homosapiens lysophosphatidic acid phosphatase (LOC51205); human protein sequence is reference number Q9NPHO or deposit number: Q9NPHONID ). HPACPL1 (CDNA FLJ20650FIS, clone KAT01962) (LPAP of lysophosphatidic acid phosphatase) (precursor of lysophosphatidic acid phosphatase). HUMANSPTRNRDB. Corresponding to
The target mouse gene is Acp6 (lysophosphatidic acid phosphatase 6), which is an ortholog of human ACP6. Other names include orthologs of ACPL1; mPACPL1; 5730559A09Rik; acid phosphatase-like 1; LPAP; PACPL1; and mouse lysophosphatidic acid phosphatase 6. ACP6 is a cytoplasmic and mitochondrial enzyme that mediates hydrolysis of lysophosphatidic acid to monoacylglycerol and phosphate. ACP6 expression is detected in various tissues, but is highly expressed especially in the kidney, heart, small intestine, muscle and liver. This enzyme has also been detected in cytoplasmic fractions of brain homogenates and in Cajal stromal cells and functions as a pacemaker and mediator of motor neurotransmission in gastrointestinal smooth muscle. ACP6 appears to be involved in lipid metabolism (Hiroyama and Takenawa, Biochem J, 336 (Pt2): 483-9 (1998); Hiroyama and Takenawa, J Biol Chem, 274 (41): 29172-80 (1999) Takayama et al., Gut 50 (6): 790-6 (2002)).
wt het hom Total observation 19 39 23 81
Expected value 20.25 40.5 20.25 81
Chi-square = 0.51 Significance = 0.777640 (hom / n) = 0.28 Average number of pups = 8
Mutant: Retrovirus insertion (OST)
A retrovirus was inserted into the intron between encoded exons 1 and 2. (Deposit number: NM_019800.1)
Wild type expression of the target gene was detected in all 13 adult tissue samples tested by RT-PCR except skeletal muscle, bone, and fat.
RT-PCR analysis revealed that the analyzed (− / −) mice (M-46) had no transcription. The destruction of the target gene was confirmed by inverse PCR.

35.3.1. Phenotypic analysis (disrupted gene: DNA34434-1139 (UNQ205)
(A) Summary of overall phenotype:
An increase in mean platelet count was observed in (− / −) mice compared to wild-type (+ / +) littermates due to mutations in the gene encoding the ortholog of human lysophosphatidic acid phosphatase 6 (ACP6). It was. In addition, the (− / −) mutant mice were thought to have reduced total body fat (% and gram) and total tissue mass, and showed tissue wasting disease. There was no transcription by RT-PCR.

(B) Immunological phenotypic analysis Immune-related and inflammatory diseases are in normal physiology, responding to invasion or injury, initiating repair of invasion or injury, and innate and acquired protective power against foreign organisms. Physiological pathways important for the incorporation of are very complex and multiple connected signs or consequences. A disease or condition is a condition in which these normal physiological pathways are subject to additional invasion or injury, either directly as a result of abnormal control or excessive stimulation, as a response to self, or as a combination thereof. It occurs when causing.
The origins of these diseases often involve multiple pathways and often multiple different physiological systems / pathways, and intervening in multiple of these pathways can lead to remission or therapeutic effects. Can be mentioned. Therapeutic intervention can be done by antagonizing harmful processes / pathways or stimulating beneficial processes / pathways.
T lymphocytes (T cells) are an important component of a mammalian immune response. T cells recognize antigens associated with self-molecules encoded by genes within major histocompatibility antigens (MHC). Antigens can be expressed with MHC molecules on the surface of antigen-presenting cells, virus-infected cells, cancer cells, grafts and the like. T cell lines remove degenerative cells that pose a threat to the health of the host mammal. T cells include helper T cells and cytotoxic T cells. Helper T cells proliferate on a large scale when they recognize antigen-MHC complexes on antigen-presenting cells. Helper T cells also secrete various cytokines, lymphokines, which play a central role in the activity of B cells, cytotoxic T cells and various other cells that participate in the immune response.
In many immune responses, inflammatory cells infiltrate the site of injury or infection. Migrating cells are neutrophils, eosinophils, monocytes or lymphocytes, which can be determined by histological examination of the affected tissue. Current Protocols in Immunology, ed John E. Coligan, 1994 John Wiley & Sons, Inc.
Many immune related diseases are known and have been extensively studied. Such diseases include immune-mediated inflammatory diseases (eg rheumatoid arthritis, immune-mediated renal disease, hepatobiliary disease, inflammatory bowel disease (IBD), psoriasis, and asthma), non-immune-mediated inflammatory diseases , Infections, immunodeficiency diseases, tumors, and transplant rejections. In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified.
In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified. Immune related diseases can be treated in one example by suppressing the immune response. The use of neutralizing antibodies that suppress molecules with immunostimulatory activity is beneficial for the treatment of immune-mediated and inflammatory diseases. Molecules that suppress immune responses (proteins directly or using antibody agonists) can be used to suppress immune responses and thus ameliorate immune-related diseases.

The following tests were conducted.
Hematological analysis Test description: A blood test was performed with Abbott Cell-Dyn 3500R (automatic hematology analyzer). Part of the feature includes a differential of white blood cells consisting of five parts. The patient report can cover over 22 parameters in total.
result:
(− / −) Mice showed an increase in mean platelet count compared to their (+ / +) littermates and background means. Analyzed wt / het / hom: 7/5/8
Thus, mutant mice lacking the DNA34434-1139 gene will have a phenotype associated with coagulopathy. In this regard, inhibitors or antagonists of PRO231 polypeptide may be useful in the treatment of disorders related to abnormal blood coagulation such as hemophilia.

(C) Bone metabolism and physical diagnostics: radiological phenotype analysis In the area of bone metabolism, targets are identified here for the treatment of arthritis, osteoporosis, osteopenia and marble bone disease, and fracture healing. Promoting targets are identified. The exam includes:
DEXA for measuring bone mineral density in the femur and vertebra
• Micro CT for very high resolution and very sensitive measurement of bone mineral content in both trabecular and cortical bone.
Dexa Analysis-Test Method Description Procedure: A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. Dual energy X-ray absorption measurement (DEXA) was successfully used to identify changes in bone. Anesthetized animals were examined and bone mineral density (BMC), BMC / LBM ratio, volumetric bone density (vBMD), whole body BMD, femoral BMD and vertebra BMD were measured.
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
result:
DEXA: (− / −) mice showed a reduction in total fat (% and grams) and total tissue mass when compared to (+ / +) littermates with matched gender and background means.
Summary:
From the above results, it was found that knockout mutant mice show abnormal body measurements with a significant decrease in body fat and mass suggesting tissue wasting disease. (− / −) Mice analyzed by DEXA showed a significant decrease in total tissue mass and lean body mass when compared to their (+ / +) littermates. These results suggest growth retardation in these mutants. Thus, PRO231 polypeptides or agonists thereof may be useful for the treatment of growth diseases, the prevention of cachexia, or the prevention of other tissue debilitating diseases.

Generation and Analysis of Mice with 35.4 DNA35599-1168 (UNQ210) Gene Disruption In these knockout experiments, the gene encoding PRO236 polypeptide (designated DNA35599-1168 (UNQ210)) was disrupted. The gene-specific information for these studies is as follows: The mutated mouse gene corresponds to: nucleotide reference number: NM_153803 or deposit number: NM_153803 NID: gi 24418924 reference number NM_1533803.1 Musmus Cruz Hypothetical protein MGC47419 (MGC47419); protein reference number: Q8CFT1 or deposit number: Q8CFT1 NID: Musmus Cruz (mouse). Similar to RIKEN cDNA 492509F24 gene; human gene sequence reference number: NM_138342 or deposit number: NM_138342 NID: gi 24308391 reference number NM_138342.1 homosapiens hypothesis protein BC008326 (LOC89944); human protein sequence is reference number Q8IW92 : Homo sapiens (human). Corresponds to hypothetical protein BC008326.
The mouse genes of interest are orthologs of “cDNA sequence BC034879” (BC038479), human “hypothesis protein BC008326”. Another name is hypothetical protein MGC47419 and the like.
BC038479 is a putative lysosomal enzyme containing the glucosyl hydrolase family 35 domain. Proteins with this domain include β-galactosidase and lysosomal enzymes that mediate cleavage of terminal galactose from gangliosides, glycoproteins, and glycosaminoglycans (Pfam accession number PF01301).
Targeted or gene trap mutations were generated in strain 129SvEv ^Brd -derived embryonic stem (ES) cells. Chimeric mice were crossed to C57BL / 6J albino mice to produce F1 heterozygous animals. These progeny were crossed to produce F2 wild type, heterozygous, and homozygous mutant progeny. Very occasionally, for example, when F1 mice are rarely obtained from the chimera, F1 heterozygous mice are crossed with 129SvEv ^Brd / C57 hybrid mice to generate additional heterozygous animals for cross fertilization and F2 mice. Was produced. Level 1 phenotypic analysis was performed on the mice thus produced.
wt het hom Total observation 22 25 26 73
Expected value 18.25 36.5 18.25 73
Chi-square = 7.68 Significance = 0.02144 (hom / n) = 0.36 Average number of pups = 7
Mutant: homologous recombination (standard)
Targeted coding exon 1 (NCBI deposit number NM_1533803.1)
Wild-type expression of the target gene was detected in 13 adult tissue samples tested by RT-PCR as well as embryonic stem (ES) cells. Southern hybridization analysis confirmed target gene disruption.

35.4.1. Phenotypic analysis (disrupted gene: DNA35599-1168 (UNQ210)
(A) Summary of overall phenotype:
Mutation of the gene encoding the ortholog of the hypothesized human protein (BC008326) reduced the mean white blood cell count (WBC) lymphocyte count and the average proportion of natural killer cells in (− / −) mice. In addition, (− / −) mice showed impaired glucose tolerance. In addition, (− / −) mutant mice suggesting osteoporosis showed abnormal bone measurements. Gene disruption was confirmed by Southern blotting.

(B) Immunological phenotypic analysis Immune-related and inflammatory diseases are in normal physiology, responding to invasion or injury, initiating repair of invasion or injury, and innate and acquired protective power against foreign organisms. Physiological pathways important for the incorporation of are very complex and multiple connected signs or consequences. A disease or condition is a condition in which these normal physiological pathways are subject to additional invasion or injury, either directly as a result of abnormal control or excessive stimulation, as a response to self, or as a combination thereof. It occurs when causing.
The origins of these diseases often involve multiple pathways and often multiple different physiological systems / pathways, and intervening in multiple of these pathways can lead to remission or therapeutic effects. Can be mentioned. Therapeutic intervention can be done by antagonizing harmful processes / pathways or stimulating beneficial processes / pathways.
T lymphocytes (T cells) are an important component of a mammalian immune response. T cells recognize antigens associated with self-molecules encoded by genes within major histocompatibility antigens (MHC). Antigens can be expressed with MHC molecules on the surface of antigen-presenting cells, virus-infected cells, cancer cells, grafts and the like. T cell lines remove degenerative cells that pose a threat to the health of the host mammal. T cells include helper T cells and cytotoxic T cells. Helper T cells proliferate on a large scale when they recognize antigen-MHC complexes on antigen-presenting cells. Helper T cells also secrete various cytokines, lymphokines, which play a central role in the activity of B cells, cytotoxic T cells and various other cells that participate in the immune response.
In many immune responses, inflammatory cells infiltrate the site of injury or infection. Migrating cells are neutrophils, eosinophils, monocytes or lymphocytes, which can be determined by histological examination of the affected tissue. Current Protocols in Immunology, ed John E. Coligan, 1994 John Wiley & Sons, Inc.
Many immune related diseases are known and have been extensively studied. Such diseases include immune-mediated inflammatory diseases (eg rheumatoid arthritis, immune-mediated renal disease, hepatobiliary disease, inflammatory bowel disease (IBD), psoriasis, and asthma), non-immune-mediated inflammatory diseases , Infections, immunodeficiency diseases, tumors, and transplant rejections. In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified.
In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified. Immune related diseases can be treated in one example by suppressing the immune response. The use of neutralizing antibodies that suppress molecules with immunostimulatory activity is beneficial for the treatment of immune-mediated and inflammatory diseases. Molecules that suppress immune responses (proteins directly or using antibody agonists) can be used to suppress immune responses and thus ameliorate immune-related diseases.

The following tests were conducted.
(1) Fluorescence activated cell sorting (FACS) analysis Procedure:
FACS analysis of peripheral blood immune cell composition containing CD4, CD8 and T cell receptors was performed to evaluate natural killer cell leukocyte markers and TNK as panNK, CD19 and CD45 of B lymphocytes. FACS analysis was performed on 2 wild type mice and 6 homozygous mice, including cells obtained from thymus, spleen, bone marrow and lymph nodes.
In these studies, cells to be analyzed were isolated from thymus, peripheral blood, spleen, bone marrow and lymph nodes. Flow cytometry was designed to determine the relative proportion of CD4 and CD8 positive T cells, B cells, NK cells and monocytes in the mononuclear cell population. Immune status was assessed using a Becton-Dickinson FACSCalibur 3-laser FACS machine. For phenotypic analysis and screening, this machine records the number of CD4 + / CD8-, CD8 + / CD4-, NK, B cells and monocytes in addition to the CD4 + / CD8 + ratio. Mononuclear cell profiles were obtained by staining a single sample of lysed peripheral blood from each mouse with a set of 6 lineage specific antibodies: CD45 PerCP, anti-TCRb APC, CD4 PE, CD8 FITC , Pan-NK PE, and CD19 FITC. Two antibodies labeled with FITC and PE stained mutually exclusive cell types. The samples were analyzed with CellQuest software using a Becton Dickinson FACSCalibur flow cytometer.
(2) Hematological analysis Test description: A blood test was conducted with Abbott Cell-Dyn 3500R (automatic blood analyzer). Part of the feature includes a differential of white blood cells consisting of five parts. The patient report can cover over 22 parameters in total.
result:
(− / −) Mice showed a decrease in mean total leukocyte count and absolute lymphocyte count compared to their (+ / +) littermates and background means.
FACS analysis revealed that (− / −) mice showed a decrease in the average percentage of natural killer cells compared to their (+ / +) littermates and background means.
Analyzed wt / het / hom: 7/5/8
In summary, hematological analysis and FACS results showed that homozygous mutant mice have impaired immune system, particularly in that the total number of leukocytes and the absolute number of lymphocytes are reduced. In addition, a decrease in the average percentage of natural killer cells is also indicative of a negative phenotype associated with the knockout of the DNA35599-1168 gene encoding the PRO236 polypeptide. Natural killer cells are the first line of defense against viral infections because they are involved in viral immunity and tumor defense. Natural killer cells or NK cells function as antibody-dependent cell-mediated cytotoxic effectors and have been identified by their ability to kill specific lymphoid tumor cell lines in vivo without prior immunization or activation . However, its known function in host defense works early in infection by multiple intracellular pathogens, particularly herpes viruses. Thus, PRO236 polypeptides and agonists thereof are important for a healthy immune system and appear to be useful for stimulating the immune system, particularly against viral infections.

(C) Bone metabolism and physical diagnostics: bone metabolism: radiological phenotype analysis In the area of bone metabolism, targets are identified here for the treatment of arthritis, osteoporosis, osteopenia and marble bone disease, and Targets that promote fracture healing are identified. The exam includes:
DEXA for measuring bone mineral density in the femur and vertebra
• Micro CT for very high resolution and very sensitive measurement of bone mineral content in both trabecular and cortical bone.
Dexa Analysis-Test Method Description Procedure: A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. Dual energy X-ray absorption measurement (DEXA) was successfully used to identify changes in bone. Anesthetized animals were examined and bone mineral density (BMC), BMC / LBM ratio, volumetric bone density (vBMD), whole body BMD, femoral BMD and vertebra BMD were measured.
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Bone micro CT analysis Procedure: Micro CT was also used to perform very sensitive BMD measurements. One vertebra and one thigh were removed from a cohort of 4 wild type and 8 homozygous mice. Measurements were taken of the five vertebral traebecular volumes, traebecular thickness, bond density, and total bone area and cortical thickness of the mid-thigh. A micro CT40 scan provided detailed information on bone mass and structure. Multiple bones were placed in the sample holder and scanned automatically. Instrument software was used to select areas of interest for analysis. Trabecular parameters were analyzed in the 5th lumbar vertebra (LV5) with 16 micrometer resolution, and cortical bone parameters were analyzed in the mid-femoral axis with 20 micrometer resolution.
result:
Micro-CT: (− / −) mice showed a decrease in bone measurements in the fifth lumbar vertebrae (the amount of vertebra trabeculae and Decrease in the average thickness).
Summary:
From the above results, knockout mutant mice show abnormal bone metabolism with significant bone loss similar to osteoporosis, characterized by bone loss, bone density reduction and, in some cases, fragility leading to fractures It has been found. Therefore, P} RO236 polypeptide or an agonist thereof is considered to be involved in maintaining bone homeostasis. In addition, PRO236 or its encoding gene appears to be useful for bone healing or may be useful for the treatment of arthritis or osteoporosis. On the other hand, antagonists to PRO236 or their encoding genes are likely to cause abnormal or pathological bone disorders including inflammatory diseases associated with abnormal bone metabolism such as arthritis, osteoporosis, and osteopenia.

(D) Phenotypic analysis: Metabolism-Blood chemistry / Glucose tolerance In the field of metabolism, the treatment of diabetes can be targeted. Blood chemistry phenotype analysis includes blood glucose measurements. Blood chemistry tests were performed on mice using a COBAS Integra 400 (manufacturer: Roche). In the field of metabolism, the treatment of diabetes can be targeted. Blood chemistry phenotype analysis includes a glucose tolerance test that measures changes in insulin sensitivity and glucose metabolism. Abnormal glucose tolerance test results may indicate the following disorders or conditions, but are not limited to: Type 1 and Type 2 diabetes, Syndrome X, various cardiovascular diseases and / or obesity.
Procedure: This assay used a cohort of 2 wild type mice and 4 homozygotes. The glucose tolerance test is a standard method for defining a loss of sugar homeostasis in mammals. The corresponding test was carried out using a Lifescan glucometer. Animals were injected intraperitoneally with a 20% solution of D-glucose at 2 g / kg and blood glucose levels were measured 0, 30, 60 and 90 minutes after injection. Analyzed wt / het / hom: 4/4/8
result:
During the glucose tolerance test, (− / −) mice showed impaired glucose tolerance compared to gender-matched (+ / +) littermates and background means.
From the above results, (− / −) mice showed glucose tolerance in the presence of normal fasting blood glucose at all three time points when compared to their (+ / +) littermates of matching gender. It was found to show a decrease in. In other words, the knockout mice showed a pattern of expression of glucose homeostasis failure. From this observation, the PRO236 polypeptide (or agonist thereof) or its encoded gene appears to be useful for the treatment of glucose homeostasis and / or various cardiovascular diseases, including the treatment of diabetes.

Generation and analysis of mice with 35.5 DNA35638-1141 (UNQ219) gene disruption In these knockout experiments, the gene encoding PRO245 polypeptide (designated DNA35638-1141 (UNQ219)) was disrupted. The gene-specific information for these studies is as follows: the mutated mouse gene corresponds to: nucleotide reference number: NM — 023844 or Musmus Cruz RIKEN cDNA 1110002N23 gene (1110002N23Rik); protein reference number: Q9JI59 or Vascular Endothelial Junction Related Molecules (Junction Adhesion Molecule-3) (24103030G21RIK Protein) Human Gene Sequence Reference Number: NM_021219 or Deposit Number: NM_021219 NID: gi 21704284 Reference Number NM_021219.2 Homo Sapiens Junction Adhesion Molecule 2 (JAM2); The human protein sequence has the reference number P57087 or the deposit number: P57087 NID: homosapiens (human). Junction Adhesion Molecule 2 Precursor (Vascular Endothelial Junction Related Molecule) (VE-JAM) HUMANSPTRNRDB. Corresponding to
The disrupted mouse gene is Jam2 (junction adhesion molecule 2), an ortholog of human JAM2. Other names are VEJAM, VE-JAM, JAM-2, Jcam2, C21 or f43, chromosome 21 open reading frame 43, vascular endothelial junction-related molecule, junction cell adhesion molecule 2, and the like.
JAM2 is a member of the Ig superfamily and is a membrane-tethered extracellular protein. JAM2 is particularly localized at the junctions of lymphatic endothelial cells, lymph nodes and high endothelial venules within Peyer's patches (Johnson-Leger et al., Blood, 100 (7): 2479-86 (2002)). JAM2 binds to T cells, NK cells, and dendritic cells through the interaction between α4-β1 integrin and JAM3 (Liang et al., J Immunol, 168 (4): 1618-26 (2002)). It is clear that JAM2 plays a central role in tight junction formation, transendothelial and lymphocyte migration, and establishment of endothelial tissue cell polarity (Ebnet et al., J Cell Sci, 116 (Pt 19): 3879. -91 (2003), Aurrand-Lions et al., Cells Tissues Organs, 172 (3): 152-60 (2002)).
Genetics information:
wt het hom Total observation 18 32 22 72
Expected value 18 36 18 72
Chi-square = 1.33 Significance = 0.51342 (hom / n) = 0.31 Average number of pups = 7
Mutant: Retrovirus insertion (OST)
A retrovirus was inserted between encoded exons 3 and 4 (deposit number: NM — 023844.)
Wild-type expression of the target gene was detected in 13 adult tissue samples tested by RT-PCR, as well as in all of the embryonic stem (ES) cells except fat.
RT-PCR analysis revealed that the analyzed (− / −) mouse (F-58) had no transcription.

35.5.1. Phenotypic analysis (disrupted gene: DNA35638-1141 (UNQ219)
(A) Summary of overall phenotype:
Mutations in the gene encoding the ortholog of human junction adhesion molecule 2 (JAM2) increased anxiety-related responses in (− / −) mice. In addition, mutant (− / −) mice showed a decrease in ovalbumin response compared to their (+ / +) wild-type littermates. The (− / −) mice also showed ophthalmic abnormalities associated with increased retinal artery twist. No transcription was seen by RT-PCR.

(B) Immunological phenotypic analysis Immune-related and inflammatory diseases are in normal physiology, responding to invasion or injury, initiating repair of invasion or injury, and innate and acquired protective power against foreign organisms. Physiological pathways important for the incorporation of are very complex and multiple connected signs or consequences. A disease or condition is a condition in which these normal physiological pathways are subject to additional invasion or injury, either directly as a result of abnormal control or excessive stimulation, as a response to self, or as a combination thereof. It occurs when causing.
The origins of these diseases often involve multiple pathways and often multiple different physiological systems / pathways, and intervening in multiple of these pathways can lead to remission or therapeutic effects. Can be mentioned. Therapeutic intervention can be done by antagonizing harmful processes / pathways or stimulating beneficial processes / pathways.
T lymphocytes (T cells) are an important component of a mammalian immune response. T cells recognize antigens associated with self-molecules encoded by genes within major histocompatibility antigens (MHC). Antigens can be expressed with MHC molecules on the surface of antigen-presenting cells, virus-infected cells, cancer cells, grafts and the like. T cell lines remove degenerative cells that pose a threat to the health of the host mammal. T cells include helper T cells and cytotoxic T cells. Helper T cells proliferate on a large scale when they recognize antigen-MHC complexes on antigen-presenting cells. Helper T cells also secrete various cytokines, lymphokines, which play a central role in the activity of B cells, cytotoxic T cells and various other cells that participate in the immune response.
In many immune responses, inflammatory cells infiltrate the site of injury or infection. Migrating cells are neutrophils, eosinophils, monocytes or lymphocytes, which can be determined by histological examination of the affected tissue. Current Protocols in Immunology, ed John E. Coligan, 1994 John Wiley & Sons, Inc.
Many immune related diseases are known and have been extensively studied. Such diseases include immune-mediated inflammatory diseases (eg rheumatoid arthritis, immune-mediated renal disease, hepatobiliary disease, inflammatory bowel disease (IBD), psoriasis, and asthma), non-immune-mediated inflammatory diseases , Infections, immunodeficiency diseases, tumors, and transplant rejections. In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified.
In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified. Immune related diseases can be treated in one example by suppressing the immune response. The use of neutralizing antibodies that suppress molecules with immunostimulatory activity is beneficial for the treatment of immune-mediated and inflammatory diseases. Molecules that suppress immune responses (proteins directly or using antibody agonists) can be used to suppress immune responses and thus ameliorate immune-related diseases.

The following tests were conducted.
Ovalbumin challenge:
Procedure: The assay was performed on 7 wild type and 8 homozygotes. Chicken ovalbumin (OVA) is a T cell-dependent antigen and is a model protein widely used for studying antigen-specific immune responses in mice. OVA is non-toxic and inert and therefore does not harm animals if an immune response is not elicited. The characteristics of the mouse immune response to OVA are already largely elucidated, and immunodominant peptides have been identified that elicit T cell responses. Anti-OVA antibodies can be detected 8-10 days after immunization using an enzyme-linked immunosorbent assay (ELIZA), and the determination of the different isotypes of the antibody results in a complex process that leads to poor response in genetically modified mice New information can be obtained.
As described above, this protocol evaluates the ability of mice to raise an antigen-specific immune response. The animals were injected intraperitoneally with 50 mg chicken ovalbumin emulsified in Freund's complete adjuvant, and the serum titer of anti-ovalbumin antibodies (IgM, IgG1 and IgG2 subclass) was measured 14 days later. The amount of OVA-specific antibody contained in the serum sample was proportional to the absorbance (OD) value generated by the instrument scanning the 96-well sample plate. Data was collected for each set of serum samples with varying degrees of dilution.
Analyzed wt / het / hom: 8/4/9
Results of this antigen administration:
(− / −) Mice showed a decrease in mean serum IgG2a response to ovalbumin challenge compared to their (+ / +) pups and background means. That is, these knockout mice showed a reduced ability of OVA-specific antibodies to elicit responses to T cell-dependent OVA antigens.
In summary, studies of ovalbumin antigens demonstrated that knockout mice lacking the gene encoding PRO245 polypeptide exhibit immunological abnormalities compared to their wild-type pups. In particular, mutant mice showed reduced ability to elicit an immunological response when administered a T cell-dependent OVA antigen. Accordingly, PRO245 polypeptides or agonists thereof are useful for stimulating the immune system (eg, T cell proliferation), and this action is effective in leukemia and other types of cancer, and immunocompromised patients such as AIDS patients. It seems that it can be used in some cases. Thus, PRO245 polypeptide inhibitors (antagonists) are useful in suppressing immune responses and are therefore valuable candidates for suppressing adverse immune responses in the case of, for example, graft rejection or graft-versus-host disease. .

(C) Phenotypic analysis: CNS / neurology In the field of neurology, the analysis here is depression, generalized anxiety disorder, attention deficit hyperactivity disorder, obsessive compulsive disorder, schizophrenia, cognitive impairment, hyperalgesia And focused on identifying targets that have been validated in vivo for the treatment of neurological and psychiatric disorders, including sensory organ disorders. Neurological disorders include a category defined as “anxiety disorders” including, but not limited to, mild to moderate anxiety, anxiety disorders due to general medical conditions, and unspecified anxiety disorders Generalized anxiety disorder, panic attack, panic disorder with agoraphobia, panic disorder without agoraphobia, post-traumatic stress syndrome, social phobia, specific phobias, substance-induced anxiety disorder, acute alcohol withdrawal , Obsessive-compulsive disorder, agoraphobia, bipolar disorder I or II, bipolar disorder not otherwise specified, circulatory temperament disease, depressive disorder, major depressive disorder, mood disorder, substance-induced mood disorder . In addition, anxiety disorders can be applied to personality disorders including, but not limited to, the following types: paranoid, antisocial, avoidance behavior, borderline personality disorder, addiction, acting, self-loving , Obsessive, schizophrenic, and schizophrenic.
procedure:
Behavioral screening was performed on a cohort consisting of 4 wild type, 4 heterozygotes and 8 homozygous mutant mice. All behavioral tests were performed between 12 and 16 weeks of age unless the time of testing had to be accelerated due to reduced viability. These trials included open field trials to measure anxiety, activity level and exploration.
Open field test:
Some targets of known drugs showed phenotype in open field tests. These include seratonin transporters, dopamine transporters (Giros et al., Nature. 1996 Feb 15; 379 (6566): 606-12), and GABA receptors (Homanics et al., Proc Natl Acad Sci US A. 1997 Apr 15; 94 ( 8): Including 4143-8) knockout. An automated open field assay was customized to handle changes in emotional state and changes in search patterns for learning. First, the field (40 × 40 cm) was selected to be relatively large relative to the mouse, thus taking up changes in locomotion associated with the search. There are also four holes in the floor that allow you to poke your nose, an activity that is particularly relevant to exploration. Several factors were also designed to enhance the emotional state associated with this trial. The open field test was the first experimental procedure in which mice were tested, and the measurements made were the first experience with the subject's chambers. The open field was brightly lit. All of these factors increase the natural anxiety associated with new and open spaces. The pattern and degree of exploration activity, in particular the total distance traveled from the center, can then identify changes in susceptibility to anxiety or depression. A large active area (40 cm × 40 cm, AccuScan Instruments VersaMax animal activity monitor system) using infrared beams at three different levels was used to record standing, nasal pricking into the hole, and locomotor activity. The animal was placed in the center and its activity was measured for 20 minutes. Data from this test was analyzed 5 times at 4 minute intervals. The total distance traveled (cm), the number of vertical movements (rise), the number of hole penetrations, and the total distance traveled from the center were recorded.
The tendency of mice to show a normal habituation response to the new environment was assessed by determining the total change in their horizontal locomotor activity over 5 time intervals. This calculated slope of change in activity over time was determined using the total travel distance normalized to the absolute value. The slope was determined from a regression line through normalized activity in each of the five time intervals. Normal habit effects are represented by negative slope values. Analyzed wt / het / hom: 5/4/8
result:
(− / −) Mice showed a decrease in median total time in the central area during the open field test when compared to (+ / +) littermates whose gender matched. This indicates an increased anxiety-like response in the variant. As noted above, significant differences were observed during the open field test. (− / −) Mice showed a decrease in median total time in the central region when compared to (+ / +) littermates of matching gender. This type of behavior is consistent with an increased anxiety-like response. Thus, knockout mice have mild to moderate anxiety, generalized medical anxiety and / or bipolar disorder; hyperactivity; sensory disturbances; obsessive compulsive disorder, schizophrenia or paranoid personality Showed a phenotype consistent with. Thus, PRO245 polypeptides or agonists thereof may be useful for treating such neurological disorders or ameliorating symptoms associated with anxiety disorders.

(D) Cardiovascular phenotype analysis In the area of cardiovascular biology, phenotypic tests were performed to identify potential targets for treating cardiovascular, endothelial or angiogenic diseases. Such phenotypic tests are fundus imaging and angiography to flag various eye abnormalities by determining the retinal arteriovenous rate (A / V rate). Abnormal A / V ratio corresponds to a systemic disease or disorder (and any disease caused by hypertension, such as atherosclerosis), diabetes, or ophthalmic diseases, such as those associated with vascular disease due to hypertension Represents other signs of eye disease. Such eye abnormalities may include, but are not limited to: retinal abnormalities include retinal dysplasia, various retinopathy, restenosis, retinal artery occlusion or occlusion; Retinal degeneration causing secondary atrophy of the vasculature, retinitis pigmentosa, macular atrophy, Stargardt disease, congenital stationary night blindness, lack of whole choroid, rotational atrophy, Leber's congenital cataract, retinoschisis, Wagner syndrome , Usher syndrome, Zellweger syndrome, Sardino-Mainser syndrome, Senior Loken syndrome, Bardee-Bedle syndrome, Alport syndrome, Alstrem syndrome, Cocaine syndrome, congenital spinal dysplasia, Flynn-Eyed syndrome, Friedreich ataxia, Hullgren's syndrome, Marshall syndrome, Albers-Schonberg disease, Lefsum disease, Keynes Ahr Syndrome, Wardenburg Syndrome, Alagille Syndrome, Myotonic Dystrophy, Olive Bridge Cerebellar Atrophy, Pierre-Marie Syndrome, Stickler Syndrome, Carotine Memories, Cystine Accumulation, Wolfram Syndrome, Bassen Kornzweig Syndrome, abetalipoproteinemia, dyschromia, Batten's disease, mucopolysaccharidosis, homocystinuria, or mannosidosis.
Procedure: In this assay, a cohort consisting of 4 wild type, 4 heterozygotes and 8 homozygous mutant mice was tested. Fundus imaging was performed on conscious animals using a Kowa Genesis small fundus camera modified by Hawes and co-authors (Hawes et al., 1999 Molecular Vision 1999; 5:22). Fluorescein intraperitoneal injection enabled the acquisition of fluorescence algorithms and direct fundus images for each examination. In addition to direct ophthalmic changes, this test can detect retinal changes associated with systemic diseases such as diabetes and atherosclerosis or other retinal abnormalities. A fundus picture under normal light was provided. Angiographic photographs have made it possible to examine the arteries and veins of the eye. In addition, the vein-to-artery ratio (A / V) of the eye was determined.
An ophthalmic analysis was performed on the F2 wild type, heterozygous and homozygous mutant progeny produced using the protocol described above. Specifically, the A / V ratio was measured and calculated according to the fundus image using Kowa COMIT + software. This test is a color photograph taken through a dilated pupil: the images help detect and classify many diseases. The ratio of artery to vein (A / V) is the ratio of the diameter of the artery to the vein diameter (measured before branching the vessel). Many diseases, such as diabetes, cardiovascular disease, papillary edema, optic nerve atrophy or other eye abnormalities such as retinal degeneration (also known as retinitis pigmentosa), or retinal dysplasia, visual impairment or blindness This ratio will be affected. Thus, compared to wild-type (+ / +) littermates, phenotypic observations showed increased arterial to vein ratios in homozygous (-/-) and heterozygous (+/-) mutant offspring The results show such a pathological condition.
result:
Microscopic pathological observations showed increased retinal artery twist in the analyzed (− / −) mice. Corneal inflammation and ulcers were found in (− / −) mutant mice. Analyzed wt / het / hom: 0/4
In summary, (− / −) mice in this study showed ophthalmic abnormalities that caused retinal vascular weakening and possibly retinal degeneration compared to their (+ / +) littermates. That is, by knocking out the gene identified as DNA35638-1141 encoding the PRO245 polypeptide, homozygous mutant progeny exhibit a phenotype associated with abnormalities in the retinal artery. Such detected retinal changes include systemic diseases or disorders of the circulatory system associated with vascular diseases due to hypertension (and any disease that causes hypertension, such as atherosclerosis), diabetes or retinal degeneration, etc. It is most commonly associated with other eye diseases that correspond to ophthalmic diseases. Thus, antagonists of the gene encoding PRO245 produce similar pathological retinal changes, while agonists are hypertension, atherosclerosis, or other ophthalmology including retinal degeneration and diseases associated with this condition. It would be useful as a therapeutic agent in the treatment of diseases (as described above).

Generation and Analysis of Mice with 35.6 DNA35639-1172 (UNQ220) Gene Disruption In these knockout experiments, a gene encoding PRO246 polypeptide (designated DNA35639-1172 (UNQ220)) was disrupted. The gene specific information for these studies is as follows: The mutated mouse gene corresponds to: nucleotide reference number: NM — 0270102 or deposit number: NM — 0270102 NID: 22094994 Adhesion molecule; protein reference number: Q925F2 or deposit number: Q925F2 NID: Musmus Cruz (mouse). Endothelial cell selective adhesion molecule. MOUSESPTRNRDB; human gene sequence reference number: NM_138916 or deposit number: NM_138916 NID: 20454633 homosapiens homosapiens similar to endothelial cell selective adhesion molecule; human protein sequence is reference number Q96AP7 or deposit number: Q96AP7 NID: homosapiens (human ). Corresponds to the virtual protein PLACE1000456.
The disrupted mouse gene is Esam1 (endothelial cell specific adhesion molecule), an ortholog of human ESAM. Alias names include W117m, 2310008D05Rik, and a HUEL (C4orf1) interaction protein.
ESAM is an immunoglobulin receptor family adhesion molecule that is expressed in tight junctions on endothelial cells. ESAM is thought to participate in internal endothelial cell adhesion (Hirata et al., J Biol Chem. 276 (19): 16223-31 (2001); Nasdala et al., J Biol Chem, 277 (18): 16294 -303 (2002)). J biol Chem. 278 (36): 34598-604 (2003) by Ishida and collaborators showed that ESAM homozygous null mice were significantly smaller than the same wild type mice. Ishida and co-workers also showed that the angiogenesis in ESAM homozygous null mice was significantly slower than in wild-type mice by the Matrigel plug assay. They conclude that ESAM participates in pathological angiogenic processes such as tumor growth.
Targeted or gene trap mutations were generated in strain 129SvEv ^Brd -derived embryonic stem (ES) cells. Chimeric mice were crossed to C57BL / 6J albino mice to produce F1 heterozygous animals. These progeny were crossed to produce F2 wild type, heterozygous, and homozygous mutant progeny. Very occasionally, for example, when F1 mice are rarely obtained from the chimera, F1 heterozygous mice are crossed with 129SvEv ^Brd / C57 hybrid mice to generate additional heterozygous animals for cross fertilization and F2 mice. Was produced. Level 1 phenotypic analysis was performed on the mice thus produced.
wt het hom Total observation 18 26 15 59
Expected value 14.75 29.5 14.75 59
Chi-square = 1.14 Significance = 0.56677 (hom / n) = 0.25 Average number of pups = 7
Mutant: Retrovirus insertion (OST)
A retrovirus was inserted into the intron between encoded exons 2 and 3 (I deposit number NM — 0272.1)
Wild-type expression of the target gene was detected in 13 adult tissue samples tested by RT-PCR, as well as in all of the embryonic stem (ES) cells except fat.
As a result of RT-PCR analysis, the analyzed (− / −) mouse (M-156) had no transcription. The destruction of the target gene was confirmed by inverse PCR.

35.6.1. Phenotype analysis (disrupted gene: DNA35639-1172 (UNQ220)
(A) Summary of overall phenotype:
Mutations in the gene encoding the ortholog of human endothelial cell specific adhesion molecule (ESAM) increased mean serum glucose and decreased or lacked glucose tolerance. Also, the heart rate decreased in (− / −) mice (standard deviation of 1 was below background average). No transcription was seen by RT-PCR.

(B) Phenotypic analysis: Metabolism-Blood chemistry / Glucose tolerance In the field of metabolism, the treatment of diabetes can be targeted. Blood chemistry phenotype analysis includes blood glucose measurements. Blood chemistry tests were performed on mice using a COBAS Integra 400 (manufacturer: Roche). In the field of metabolism, the treatment of diabetes can be targeted. Blood chemistry phenotype analysis includes a glucose tolerance test that measures changes in insulin sensitivity and glucose metabolism. Abnormal glucose tolerance test results may indicate the following disorders or conditions, but are not limited to: Type 1 and Type 2 diabetes, Syndrome X, various cardiovascular diseases and / or obesity.
Procedure: This assay used a cohort of 2 wild type mice and 4 homozygotes. The glucose tolerance test is a standard method for defining a loss of sugar homeostasis in mammals. The corresponding test was carried out using a Lifescan glucometer. Animals were injected intraperitoneally with a 20% solution of D-glucose at 2 g / kg and blood glucose levels were measured 0, 30, 60 and 90 minutes after injection.
result:
(-/-) Mice showed an increase in mean serum glucose levels compared to gender-matched (+ / +) littermates and background means [two (2) standard deviations (SD) background Exceeded the average]. In addition, (− / −) mice showed impaired glucose tolerance compared to gender-matched (+ / +) littermates and background means. Analyzed wt / het / hom: 4/4/8
From the above results, (− / −) mice were compared with their (+ / +) littermates with matching gender in the presence of normal fasting blood glucose at all three time points. It was found to show a decrease in sex. In other words, the knockout mice showed a pattern of expression of glucose homeostasis failure. From this observation, the PRO246 polypeptide (or agonist thereof) or its encoding gene appears to be useful for the treatment of glucose homeostasis and / or various cardiovascular diseases, including the treatment of diabetes.

Generation and Analysis of Mice with 35.7 DNA35918-1174 (UNQ225) Gene Disruption In these knockout experiments, the gene encoding PRO258 polypeptide (designated DNA35918-1174 (UNQ225)) was disrupted. The gene specific information for these studies is as follows: The mutated mouse gene corresponds to the following: Nucleotide reference number: NM_053199 or Musmus Cruz immunoglobulin superfamily, member 4B (Igsf4b); protein reference Number: Q99N28 or deposit number: Q99N28 NID: Musmus Cruz (mouse). Nectin-like protein MOUSESPTRNRDB; human gene sequence reference number: NM — 021189 or homosapiens immunoglobulin superfamily, member 4B (IGSF4B); human protein sequence is reference number Q9UJP1 or deposit number: Q9UJP1 NID: homosapiens (human). BK134P22.1 (a novel protein similar to mouse immunosuperfamily protein BL2) (Nectin-like protein 1). HUMANSPTRNRDB. Corresponding to
The mouse genes of interest are Igsf4b (immunoglobulin superfamily, member 4B), an ortholog of human IGSF4B. Other names are BIgR, Necl1, Tsll1 FLJ10698, Nectin-like 1, TSLC1-like 1, Nectin-like protein, and brain immunoglobulin receptor precursor.
IGSF4B is a type 1 plasma membrane protein that is mainly expressed in neurogenic cells that appear to function as cell adhesion molecules. This protein contains a signal peptide, three immunoglobulin-like domains (Pfam accession number PF00047), a transmembrane region, and a short cytoplasmic C-terminus. The structure of IGSF4B is similar to TSLC1 (a tumor suppressor of human non-small cell lung carcinoma), and the expression of IGSF4B is defective or markedly decreased in many glioma cell lines. This suggests that IGSF4B also functions as a tumor suppressor (Fukuhara et al., Oncogene, 20 (38): 5401-7 (2001); Shingai et al., J Biol Chem. 278 (37): 35421- 7 (2003); Fukami et al., Gene, 323: 11-8 (2003)).
Targeted or gene trap mutations were generated in strain 129SvEv ^Brd -derived embryonic stem (ES) cells. Chimeric mice were crossed to C57BL / 6J albino mice to produce F1 heterozygous animals. These progeny were crossed to produce F2 wild type, heterozygous, and homozygous mutant progeny. Very occasionally, for example, when F1 mice are rarely obtained from the chimera, F1 heterozygous mice are crossed with 129SvEv ^Brd / C57 hybrid mice to generate additional heterozygous animals for cross fertilization and F2 mice. Was produced. Level 1 phenotypic analysis was performed on the mice thus produced.
wt het hom Total observation 17 30 22 69
Expected value 17.25 34.5 17.25 69
Chi-square = 1.90 Significance = 0.38702 (hom / n) = 0.32 Average number of pups = 7
Mutant: homologous recombination (standard)
Targeted to encoded exon 1 (NCBI deposit number NM_05319.2)
Wild-type expression of the target gene was detected in all 13 adult tissue samples tested by RT-PCR, as well as in embryonic stem (ES) cells, except for the brain and eyes.
Southern hybridization analysis confirmed target gene disruption.

35.7.1. Phenotypic analysis (broken gene: DNA35918-1174 (UNQ225)
(A) Summary of overall phenotype:
Mutations in the gene encoding the ortholog of the human immunoglobulin superfamily, member 4B (IGSF4B) resulted in numerous immunological abnormalities in (− / −) mice. In addition, motor coordination of (− / −) mice was enhanced. However, the circadian rhythm test showed a decrease in ectopic movement in (− / −) mice. In addition, mutant (− / −) mice showed an increase in mean serum cholesterol and mean serum glucose levels. Micro CT observation showed a decrease in bone measurements of the fifth lumbar spine. Gene disruption was confirmed by Southern blotting.

(B) Immunological phenotypic analysis Immune-related and inflammatory diseases are in normal physiology, responding to invasion or injury, initiating repair of invasion or injury, and innate and acquired protective power against foreign organisms. Physiological pathways important for the incorporation of are very complex and multiple connected signs or consequences. A disease or condition is a condition in which these normal physiological pathways are subject to additional invasion or injury, either directly as a result of abnormal control or excessive stimulation, as a response to self, or as a combination thereof. It occurs when causing.
The origins of these diseases often involve multiple pathways and often multiple different physiological systems / pathways, and intervening in multiple of these pathways can lead to remission or therapeutic effects. Can be mentioned. Therapeutic intervention can be done by antagonizing harmful processes / pathways or stimulating beneficial processes / pathways.
T lymphocytes (T cells) are an important component of a mammalian immune response. T cells recognize antigens associated with self-molecules encoded by genes within major histocompatibility antigens (MHC). Antigens can be expressed with MHC molecules on the surface of antigen-presenting cells, virus-infected cells, cancer cells, grafts and the like. T cell lines remove degenerative cells that pose a threat to the health of the host mammal. T cells include helper T cells and cytotoxic T cells. Helper T cells proliferate on a large scale when they recognize antigen-MHC complexes on antigen-presenting cells. Helper T cells also secrete various cytokines, lymphokines, which play a central role in the activity of B cells, cytotoxic T cells and various other cells that participate in the immune response.
In many immune responses, inflammatory cells infiltrate the site of injury or infection. Migrating cells are neutrophils, eosinophils, monocytes or lymphocytes, which can be determined by histological examination of the affected tissue. Current Protocols in Immunology, ed John E. Coligan, 1994 John Wiley & Sons, Inc.
Many immune related diseases are known and have been extensively studied. Such diseases include immune-mediated inflammatory diseases (eg rheumatoid arthritis, immune-mediated renal disease, hepatobiliary disease, inflammatory bowel disease (IBD), psoriasis, and asthma), non-immune-mediated inflammatory diseases , Infections, immunodeficiency diseases, tumors, and transplant rejections. In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified.
In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified. Immune related diseases can be treated in one example by suppressing the immune response. The use of neutralizing antibodies that suppress molecules with immunostimulatory activity is beneficial for the treatment of immune-mediated and inflammatory diseases. Molecules that suppress immune responses (proteins directly or using antibody agonists) can be used to suppress immune responses and thus ameliorate immune-related diseases.

The following tests were conducted.
Hematological analysis Test description: A blood test was performed with Abbott Cell-Dyn 3500R (automatic hematology analyzer). Part of the feature includes a differential of white blood cells consisting of five parts. The patient report can cover over 22 parameters in total.
result:
(− / −) Mice showed a decrease in total white blood cell count, absolute lymphocyte count, and absolute monocyte count compared to their (+ / +) littermates and background means.
Analyzed wt / het / hom: 7/4/8
Fluorescence activated cell sorting (FACS) analysis Procedure:
FACS analysis of peripheral blood immune cell composition containing CD4, CD8 and T cell receptors was performed to evaluate natural killer cell leukocyte markers and TNK as panNK, CD19 and CD45 of B lymphocytes. FACS analysis was performed on 2 wild type mice and 6 homozygous mice, including cells obtained from thymus, spleen, bone marrow and lymph nodes.
In these studies, cells to be analyzed were isolated from thymus, peripheral blood, spleen, bone marrow and lymph nodes. Flow cytometry was designed to determine the relative proportion of CD4 and CD8 positive T cells, B cells, NK cells and monocytes in the mononuclear cell population. Immune status was assessed using a Becton-Dickinson FACSCalibur 3-laser FACS machine. For phenotypic analysis and screening, this machine records the number of CD4 + / CD8-, CD8 + / CD4-, NK, B cells and monocytes in addition to the CD4 + / CD8 + ratio. Mononuclear cell profiles were obtained by staining a single sample of lysed peripheral blood from each mouse with a set of 6 lineage specific antibodies: CD45 PerCP, anti-TCRb APC, CD4 PE, CD8 FITC , Pan-NK PE, and CD19 FITC. Two antibodies labeled with FITC and PE stained mutually exclusive cell types. The samples were analyzed with CellQuest software using a Becton Dickinson FACSCalibur flow cytometer.
result:
(− / −) Mice showed an increase in the average percentage of CD4 cells and a decrease in the average percentage of B cells compared to their (+ / +) littermates and background means.
Analyzed wt / het / hom: 7/4/8
Ovalbumin challenge:
Procedure: The assay was performed on 7 wild type and 8 homozygotes. Chicken ovalbumin (OVA) is a T cell-dependent antigen and is a model protein widely used for studying antigen-specific immune responses in mice. OVA is non-toxic and inert and therefore does not harm animals if an immune response is not elicited. The characteristics of the mouse immune response to OVA are already largely elucidated, and immunodominant peptides have been identified that elicit T cell responses. Anti-OVA antibodies can be detected 8-10 days after immunization using an enzyme-linked immunosorbent assay (ELIZA), and the determination of the different isotypes of the antibody results in a complex process that leads to poor response in genetically modified mice New information can be obtained.
As described above, this protocol assesses the ability of mice to increase antigen-specific immune responses. The animals were injected intraperitoneally with 50 mg chicken ovalbumin emulsified in Freund's complete adjuvant, and the serum titer of anti-ovalbumin antibodies (IgM, IgG1 and IgG2 subclass) was measured 14 days later. The amount of OVA-specific antibody contained in the serum sample was proportional to the absorbance (OD) value generated by the instrument scanning the 96-well sample plate. Data was collected for each set of serum samples with varying degrees of dilution.
Analyzed wt / het / hom: 7/4/8
Results of this antigen administration:
(− / −) Mice showed a decrease (substantially zero) in average serum IgG2a response to ovalbumin challenge compared to their (+ / +) pups. That is, these knockout mice showed reduced ability of OVA-specific antibodies to elicit responses to T cell-dependent OVA antigens, presumably due to Th cell loss. Thus, the PRO258 polypeptide or agonist thereof appears to stimulate the immune system and is used when this action is effective in individuals such as leukemia, other types of cancer, and immunocompromised patients such as AIDS patients. It will be possible. Thus, inhibitors or antagonists of PRO258 polypeptides appear to participate in the suppression of immune responses and are useful candidates for suppressing adverse immune responses in the case of, for example, graft rejection or graft-versus-host disease. It is thought that.
Overall summary of immunological observations In summary, ovalbumin challenge studies, hematology and FACS results show that homozygous mutant mice have impaired immune systems, especially total white blood cell counts and lymphocytes and monocytes As well as the inability to elicit an OVA-specific antibody response. All of these studies show a negative phenotype associated with the knockout of the DNA35918-1174 gene encoding the PRO258 polypeptide. Thus, PRO258 polypeptides and their antagonists are important for a healthy immune system and may be useful for stimulating or inducing the protective function of the immune system.

(C) Phenotypic analysis: CNS / neurology In the field of neurology, the analysis here is depression, generalized anxiety disorder, attention deficit hyperactivity disorder, obsessive compulsive disorder, schizophrenia, cognitive impairment, hyperalgesia And focused on identifying targets that have been validated in vivo for the treatment of neurological and psychiatric disorders, including sensory organ disorders. Neurological disorders include a category defined as “anxiety disorders” including, but not limited to, mild to moderate anxiety, anxiety disorders due to general medical conditions, and unspecified anxiety disorders Generalized anxiety disorder, panic attack, panic disorder with agoraphobia, panic disorder without agoraphobia, post-traumatic stress syndrome, social phobia, specific phobias, substance-induced anxiety disorder, acute alcohol withdrawal , Obsessive-compulsive disorder, agoraphobia, bipolar disorder I or II, bipolar disorder not otherwise specified, circulatory temperament disease, depressive disorder, major depressive disorder, mood disorder, substance-induced mood disorder . In addition, anxiety disorders can be applied to personality disorders including, but not limited to, the following types: paranoid, antisocial, avoidance behavior, borderline personality disorder, addiction, acting, self-loving , Obsessive, schizophrenic, and schizophrenic.
procedure:
Behavioral screening was performed on a cohort consisting of 4 wild type, 4 heterozygotes and 8 homozygous mutant mice. All behavioral tests were performed between 12 and 16 weeks of age, as long as the time of the test had to be accelerated due to reduced viability. These trials included open field trials to measure anxiety, activity level and exploration.
Explanation of circadian testing:
Female mice were housed individually in a 48.2 cm x 26.5 cm home cage at 4 pm on the first day of testing and provided food and water as needed. The animals were placed under a 12 hour light / dark cycle of lighting at 7 am and turning off at 7 pm. The system software records the number of ray breaks caused by animal movements using ray blocking that automatically splits into walking movements. Activity was recorded 60 times at 1 hour intervals in a 3 day study. The resulting data was represented by the median activity level recorded at each hour (circadian rhythm) and the total median activity in each light / dark period (spontaneous motor activity) over a three day study period.
result:
When compared to gender-matched (+ / +) littermates and background means, (− / −) mice showed a decrease in locomotor activity during the 1-hour habit period of the home cage activity test. As a result, the circadian rhythm was suppressed because there was a significant decrease in the dark period compared to the littermate control.
Analyzed wt / het / hom: 6/4/12
Inverted Screen Test Behavioral screening was performed on a cohort consisting of 4 wild type, 4 heterozygotes and 8 homozygous mutant mice. All behavioral tests were performed between 12 and 16 weeks of age, as long as the time of the test had to be accelerated due to reduced survival. These trials included open field trials to measure anxiety, activity level and exploration.
Inverted Screen Test Data Exercise intensity / coordination measurements were made using an inverted screen. Immature mice were individually housed on a square (7.5 cm x 7.5 cm) wire screen mounted horizontally on a metal rod. The rod was then rotated 180 degrees and the mouse was under the screen. During a one minute test session, behavioral responses of falling, not climbing and climbing were recorded as follows:
Genotype Fall (%) Climb (%)
+ / + (N = 4) 0/4 (0) 0/4 (0)
+/- (n = 4) 0/4 (0) 4/4 (100) *
-/-(N = 8) 1/8 (13) 7/8 (88) *
* Encoding showed significant differences.
When there was a 50% point difference in drop response between (− / −) mice or (+/−) mice and (+ / +) mice, a loss of exercise intensity was evident. 0/8 or 1/8 non-climbing (-/-) or (+/-) mice showed a loss of motor coordination. 7/8 or 8/8 climbed (− / −) or (+/−) mice showed increased motor coordination.
result:
The inverted screen test is designed to measure basic sensory and motility observations. In the inverted screen test, 7/8 (-/-) mice and 0/4 (+ / +) mice climbed the screen, and (-/-) mice observed increased motor coordination. It was done.
Analyzed wt / het / hom: 6/4/12

(D) Phenotypic analysis: Cardiology In the area of cardiovascular biology, hypertension, atherosclerosis, heart failure, stroke, various coronary artery diseases, dyslipidemias such as high cholesterol (hypercholesterolemia) and Targets for the treatment of elevated serum triglycerides (hypertriglyceridemia), diabetes, and / or obesity have now been identified. Phenotypic tests include measurement of serum cholesterol and triglycerides.
Blood lipid Procedure:
A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. High cholesterol levels and elevated blood levels of triglycerides are recognized risk factors in the progression of cardiovascular disease and / or diabetes. Measuring blood lipids facilitates the discovery of biological switches that regulate blood lipid levels. Inhibition of factors that increase blood lipid levels may be useful in reducing the risk of cardiovascular disease. In this blood chemistry test, cholesterol readings were recorded using COBAS Integra400 (mfr: Roche). Analyzed wt / het / hom: 4/4/8
result:
(1) (− / −) mice showed increased mean serum cholesterol levels when compared to (+ / +) littermates with matched gender and background means. Mean serum cholesterol levels were significantly above the normal range. (2) (− / −) mice also showed a significant increase in mean serum glucose levels. During the glucose tolerance test, (− / −) mice showed an increase in mean fasting serum glucose levels compared to gender matched (+ / +) littermates and background means.
In summary, these knockout mutant mice showed a negative phenotype with respect to lipid metabolism. That is, a mutant mouse lacking the PRO258 gene can function as a model for treating cardiovascular disease. PRO258 polypeptides, their agonists or the genes encoding PRO258 appear to be useful in regulating blood lipids, particularly in maintaining normal cholesterol metabolism. Thus, such agents are useful for the treatment of cardiovascular diseases associated with abnormal lipid metabolism such as hypertension, atherosclerosis, heart failure, stroke, various coronary artery diseases, and / or obesity.
At the same time, the knockout mice showed an expression pattern of deficiency in glucose homeostasis with increased fasting serum glucose levels. This is indicative of a diabetic or prediabetic condition. Based on these results, PRO258 (or an agonist thereof) or its encoding gene is useful for the treatment of glucose metabolism deficiency and / or diabetes.

(E) Bone metabolism and physical diagnostics: bone metabolism: radiological phenotype analysis In the area of bone metabolism, targets are identified here for the treatment of arthritis, osteoporosis, osteopenia and marble bone disease, and Targets that promote fracture healing are identified. The exam includes:
DEXA for measuring bone mineral density in the femur and vertebra
• Micro CT for very high resolution and very sensitive measurement of bone mineral content in both trabecular and cortical bone.
Dexa Analysis-Test Method Description Procedure: A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. Dual energy X-ray absorption measurement (DEXA) was successfully used to identify changes in bone. Anesthetized animals were examined and bone mineral density (BMC), BMC / LBM ratio, volumetric bone density (vBMD), whole body BMD, femoral BMD and vertebra BMD were measured.
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Bone micro CT analysis Procedure: Micro CT was also used to perform very sensitive BMD measurements. One vertebra and one thigh were removed from a cohort of 4 wild type and 8 homozygous mice. Measurements were taken of the five vertebral traebecular volumes, traebecular thickness, bond density, and total bone area and cortical thickness of the mid-thigh. A micro CT40 scan provided detailed information on bone mass and structure. Multiple bones were placed in the sample holder and scanned automatically. Instrument software was used to select areas of interest for analysis. Trabecular parameters were analyzed in the 5th lumbar vertebra (LV5) with 16 micrometer resolution, and cortical bone parameters were analyzed in the mid-femoral axis with 20 micrometer resolution.
result:
Micro-CT: In (− / −) mice, when compared to (+ / +) littermates with matched gender and background average, bone measurements decreased in the fifth lumbar vertebra (mean lumbar volume, number , Reduction in thickness and bond density). There was a decrease in the total area of the femur. In addition, mutant (− / −) mice showed a decrease in heart rate with a standard deviation of 2 (2) below average.
Summary:
These results indicate that knockout mutant mice exhibit abnormal bone metabolism with significant bone loss similar to osteoporosis, characterized by bone loss with reduced density and possibly fragility leading to fractures. found. Thus, the PRO258 polypeptide or agonist thereof is thought to function in maintaining bone homeostasis. In addition, PRO258 or its encoding gene may be useful for bone healing, or for the treatment of osteoarthritis or osteoporosis. On the other hand, an antagonist of PRO258 or a gene encoding the same is considered to lead to abnormal or pathological bone disorders including inflammatory diseases related to abnormal bone metabolism such as arthritis, osteoarthritis and osteoporosis.

Generation and Analysis of Mice with 35.8 DNA39969-1185 (UNQ250) Gene Disruption In these knockout experiments, the gene encoding PRO287 polypeptide (designated DNA39969-1185 (UNQ250)) was disrupted. The gene specific information for these studies is as follows: The mutated mouse gene corresponds to the following: nucleotide reference number: NM — 029620 or deposit number: NM — 0296620 NID: gi 22095010 reference number NM — 0296200.1 Musmus Cruz Procollagen C endopeptidase enhancer 2 (Pcolce2); protein reference number: NP_083896 or accession number NP_083896 NID: gi 22095011 reference number NP_083896.1 (NM_0296620) procollagen C endopeptidase enhancer 2 (Musmus Cruz); human gene sequence reference number: NM_013363 or deposit number: NM_013363 NID: gi 16904386 Reference number NM_013363.2 Homosa Ensprocollagen C endopeptidase enhancer 2 (PCOLCE2); human protein sequence is reference number: NP_037495 or deposit number: NP_037495 NID: gi 7019483 reference number NP_0349363 (NM_013363) procollagen C endopeptidase enhancer 2 (homosapiens) Correspond.
The mouse genes of interest are Pcolce2 (procollagen C endopeptidase enhancer 2), an ortholog of human PCOLCE2. Another name is PCPE2 or the like.
PCOLCE2 is a secreted glycoprotein that binds to the C-terminus of type 1 procollagen and enhances the cleavage of procollagen by C proteinases such as bone morphogenetic protein 1. The trabecular meshwork, lung, heart, brain, liver, skeletal muscle, kidney, pancreas, and placenta express PCOLCE2 mRNA; however, PCOLCE2 protein is mainly detected in the trabecular meshwork. PCOLCE2 appears to be involved in cartilage formation in various tissues during the developmental stage (Steiglitz et al., J Biol Chem, 277 (51): 49820-30 (2002); Xu et al., Genomics, 66 (3 ): 264-73 (2000)).
Genetic information
wt het hom Total observation 25 39 18 82
Expected value 20.5 41 20.5 82
Chi-square = 1.39 Significance = 0.49901 (hom / n) = 0.22 Average number of pups = 8
Mutant: Retrovirus insertion (OST)
A retrovirus was inserted into the intron between encoded exons 1 and 2 (NCBI accession number NM — 029620.1)
Wild-type expression of the target gene was detected in the brain, spinal cord, eye, thymus, spleen, and lung of 13 adult tissue samples tested by RT-PCR.
RT-PCR analysis revealed that no transcription was seen in the analyzed (− / −) mice (M-201).

35.8.1. Phenotype analysis (disrupted gene: DNA39969-1185 (UNQ250)
(A) Summary of overall phenotype:
Due to a mutation in the gene encoding the ortholog of human procollagen C endopeptidase enhancer 2 (PCOLCE2), (− / −) mice showed growth retardation and decreased bone measurements. Increased uric acid levels and decreased serum phosphate levels were also observed in mutant (− / −) mice. As a result of RT-PCR, there was no transcription.

(B) Bone metabolism and physical diagnosis (1) Measurement of tissue mass and lean body mass-Dexa
Dexa Analysis-Test Description Procedure: In this assay, a cohort of 4 wild type, 4 heterozygotes and 8 homozygotes was tested. Dual energy X-ray absorption (DEXA) was successfully used to identify changes in total tissue mass (TTM).
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Body measurements (body length and body weight): Body length and body weight were measured at about 16 weeks of age.
result:
(− / −) Mice showed a decrease in mean body weight and mean body length compared to gender-matched (+ / +) littermates and background means.
Analyzed wt / het / hom: 37/54/28
(2) Bone metabolism: radiological phenotype analysis In the area of bone metabolism, targets are identified here for the treatment of arthritis, osteoporosis, osteopenia and marble bone disease, and targets that promote fracture healing Identified. The exam includes:
DEXA for measuring bone mineral density in the femur and vertebra
• Micro CT for very high resolution and very sensitive measurement of bone mineral content in both trabecular and cortical bone.
Dexa Analysis-Test Method Description Procedure: A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. Dual energy X-ray absorption measurement (DEXA) was successfully used to identify changes in bone. Anesthetized animals were examined and bone mineral density (BMC), BMC / LBM ratio, volumetric bone density (vBMD), whole body BMD, femoral BMD and vertebra BMD were measured.
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Bone micro CT analysis Procedure: Micro CT was also used to perform very sensitive BMD measurements. One vertebra and one thigh were removed from a cohort of 4 wild type and 8 homozygous mice. Measurements were taken of the five vertebral traebecular volumes, traebecular thickness, bond density, and total bone area and cortical thickness of the mid-thigh. A micro CT40 scan provided detailed information on bone mass and structure. Multiple bones were placed in the sample holder and scanned automatically. Instrument software was used to select areas of interest for analysis. Trabecular parameters were analyzed in the 5th lumbar vertebra (LV5) with 16 micrometer resolution, and cortical bone parameters were analyzed in the mid-femoral axis with 20 micrometer resolution.
result:
DEXA: (− / −) mice showed a decrease in mean total tissue volume and lean body mass when compared to (+ / +) littermates with matched gender and background means. These mutant mice also showed a decrease in average bone mineral density and bone density.
Micro-CT analysis: In (− / −) mice, the mean vertebra trabecular volume, number, thickness, and bond density decreased when compared to gender-matched (+ / +) littermates and background means As well as a decrease in mean femoral cross-sectional area.
Analytical value wt / het / hom: 4/4/8.
In addition, body fat in (− / −) mice was significantly reduced.
Summary:
These results indicate that knockout mutant mice exhibit abnormal bone metabolism with significant bone loss similar to osteoporosis, characterized by bone loss with reduced density and possibly fragility leading to fractures. found. Thus, the PRO287 polypeptide or agonist thereof is thought to function in maintaining bone homeostasis. In addition, PRO287 or its encoding gene may be useful for bone healing, or for the treatment of osteoarthritis or osteoporosis. On the other hand, an antagonist of PRO287 or a gene encoding the same is considered to cause abnormal or pathological bone disorders including inflammatory diseases related to abnormal bone metabolism such as arthritis, osteoarthritis and osteoporosis.
(− / −) Mice analyzed by DEXA had a significant growth retardation characterized by a marked decrease in total tissue mass and total fat and a decrease in body weight and body length when compared to their (+ / +) littermates. showed that. These results are likely due to problems associated with the hypothalamic-pituitary axis that can affect bone growth. Combining this with the decrease in bone measurements suggests tissue wasting such as cachexia. Thus, PRO287 polypeptides or agonists thereof are believed to be useful in the treatment of bone disorders, and may be useful in the treatment of growth diseases or the prevention of cachexies or other tissue wasting diseases.

(C) Blood Chemistry—Uric Acid and Serum Phosphate Levels COBAS Integra 400 (Manufacturer: Roche) was used to perform blood chemistry tests on mice in a clinical setting.
result:
Mutant (− / −) mice showed increased uric acid levels and decreased serum phosphate levels compared to their control wild type littermates.

Generation and Analysis of Mice with 35.9 DNA40587-1231 (UNQ289) Gene Disruption In these knockout experiments, the gene encoding PRO328 polypeptide (designated DNA40587-1231 (UNQ289)) was disrupted. The gene-specific information for these studies is as follows: The mutated mouse gene corresponds to the following: nucleotide reference number: NM — 02734 or deposit number: NM — 023734 NID: 12963802 Musmus Cruz RIKEN cDNA 1200009H11 gene (1200009H11Rik ); Protein Reference Number: Q9ET66 or Deposit Number: Q9ET66 NID: Musmus Cruz (mouse). Cysteine rich protease inhibitor. MOUSESPTRNRDB; human gene sequence reference number: NM — 153370 or homosapiens protease inhibitor 16 (PI16); human protein sequence is reference number Q8NBK0 or deposit number: Q8NBK0 NID: homosapiens (human). Virtual protein PLACE1010482. Corresponding to
The mouse gene of interest encodes a hypothetical secreted protein and is an ortholog of human PI16 (protease inhibitor 16).
PI16 contains a signal peptide, an SCP-like extracellular protein (SCP) domain, and multiple internal repeats. SCP domains are found in many different species of cell body proteins. For example, insect venom allergens, mammalian testis-specific proteins, and proteins associated with plant lesion formation (Pfam deposit no. PF00188). PI16 is a homologue of protease inhibitor 15 (PI15) and further includes an SCP domain and a function as a secreted serine protease (trypsin) inhibitor (Yamakawa et al., Biochim Biophys Acta, 1395 (2): 202-8 ( 1998)). The function of PI16 has not been demonstrated by experiment.
Genetic information:
wt het hom Total observation 16 45 22 83
Expected value 20.75 41.5 20.75 83
Chi-square = 1.46 Significance = 0.48243 (hom / n) = 0.27 Average number of pups = 8
Mutant: Retrovirus insertion (OST)
A retrovirus was inserted into the intron between encoded exons 2 and 3 (NCBI accession number NM — 03734.2)
Wild type expression of the target gene was detected in 13 adult tissue samples tested by RT-PCR as well as embryonic stem (ES) cells.
As a result of RT-PCR analysis, it was found that the analyzed (− / −) mouse (M-97) had no transcription.

35.9.1. Phenotype analysis (disrupted gene: DNA40587-1231 (UNQ289)
(A) Summary of overall phenotype:
Mutation of the gene encoding the ortholog of human proteaase inhibitor 16 (PI16) resulted in an immunological phenotype in (− / −) mice. Also, increased glucose tolerance was observed during the glucose tolerance test of (− / −) mice. A change in the fifth lumbar spine was also observed (measured values were reduced compared to littermate controls). As a result of RT-PCR, there was no transcription.

(B) Immunological phenotypic analysis Immune-related and inflammatory diseases are in normal physiology, responding to invasion or injury, initiating repair of invasion or injury, and innate and acquired protective power against foreign organisms. Physiological pathways important for the incorporation of are very complex and multiple connected signs or consequences. A disease or condition is a condition in which these normal physiological pathways are subject to additional invasion or injury, either directly as a result of abnormal control or excessive stimulation, as a response to self, or as a combination thereof. It occurs when causing.
The origins of these diseases often involve multiple pathways and often multiple different physiological systems / pathways, and intervening in multiple of these pathways can lead to remission or therapeutic effects. Can be mentioned. Therapeutic intervention can be done by antagonizing harmful processes / pathways or stimulating beneficial processes / pathways.
T lymphocytes (T cells) are an important component of a mammalian immune response. T cells recognize antigens associated with self-molecules encoded by genes within major histocompatibility antigens (MHC). Antigens can be expressed with MHC molecules on the surface of antigen-presenting cells, virus-infected cells, cancer cells, grafts and the like. T cell lines remove degenerative cells that pose a threat to the health of the host mammal. T cells include helper T cells and cytotoxic T cells. Helper T cells proliferate on a large scale when they recognize antigen-MHC complexes on antigen-presenting cells. Helper T cells also secrete various cytokines, lymphokines, which play a central role in the activity of B cells, cytotoxic T cells and various other cells that participate in the immune response.
In many immune responses, inflammatory cells infiltrate the site of injury or infection. Migrating cells are neutrophils, eosinophils, monocytes or lymphocytes, which can be determined by histological examination of the affected tissue. Current Protocols in Immunology, ed John E. Coligan, 1994 John Wiley & Sons, Inc.
Many immune related diseases are known and have been extensively studied. Such diseases include immune-mediated inflammatory diseases (eg rheumatoid arthritis, immune-mediated renal disease, hepatobiliary disease, inflammatory bowel disease (IBD), psoriasis, and asthma), non-immune-mediated inflammatory diseases , Infections, immunodeficiency diseases, tumors, and transplant rejections. In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified.
In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified. Immune related diseases can be treated in one example by suppressing the immune response. The use of neutralizing antibodies that suppress molecules with immunostimulatory activity is beneficial for the treatment of immune-mediated and inflammatory diseases. Molecules that suppress immune responses (proteins directly or using antibody agonists) can be used to suppress immune responses and thus ameliorate immune-related diseases.

The following tests were conducted.
Hematological analysis Test description: A blood test was performed with Abbott Cell-Dyn 3500R (automatic hematology analyzer). Part of the feature includes a differential of white blood cells consisting of five parts. The patient report can cover over 22 parameters in total.
result:
(− / −) Mice showed an increase in mean red blood cell distribution width compared to their (+ / +) littermates and background means.
Analyzed wt / het / hom: 9/4/14
Fluorescence activated cell sorting (FACS) analysis / tissue specific FACS
procedure:
FACS analysis of peripheral blood immune cell composition containing CD4, CD8 and T cell receptors was performed to evaluate natural killer cell leukocyte markers and TNK as panNK, CD19 and CD45 of B lymphocytes. FACS analysis was performed on 2 wild type mice and 6 homozygous mice, including cells obtained from thymus, spleen, bone marrow and lymph nodes.
In these studies, cells to be analyzed were isolated from thymus, peripheral blood, spleen, bone marrow and lymph nodes. Flow cytometry was designed to determine the relative proportion of CD4 and CD8 positive T cells, B cells, NK cells and monocytes in the mononuclear cell population. Immune status was assessed using a Becton-Dickingson FACSCalibur 3-laser FACS machine. For phenotypic analysis and screening, this machine records the number of CD4 + / CD8-, CD8 + / CD4-, NK, B cells and monocytes in addition to the CD4 + / CD8 + ratio. Mononuclear cell profiles were obtained by staining a single sample of lysed peripheral blood from each mouse with a set of 6 lineage specific antibodies: CD45 PerCP, anti-TCRb APC, CD4 PE, CD8 FITC , Pan-NK PE, and CD19 FITC. Two antibodies labeled with FITC and PE stained mutually exclusive cell types. The samples were analyzed with CellQuest software using a Becton Dickinson FACSCalibur flow cytometer.
result:
Tissue-specific FACS: (− / −) mice showed a decrease in the average percentage of CD21Hi CD23Med cells in the spleen and lymph nodes. An increase in the average percentage of CD25 + cells was also observed in the spleen and lymph nodes of (− / −) mice.
Analyzed wt / het / hom: 9/4/14
In summary, knockout of DNA40587-1231 (the gene encoding the PRO328 polypeptide) reduced the subset of B cells-peripheral zone B cells that included a pool of memory cells and participated in fast immune responses. Thus, antagonists or inhibitors of PRO328 polypeptide are expected to exhibit the same phenotype. PRO328 polypeptides appear to be useful in the development or generation of marginal zone B cells that are useful for participating in fast immune responses.

(C) Phenotypic analysis: Metabolism-Blood chemistry / Glucose tolerance In the field of metabolism, the treatment of diabetes can be targeted. Blood chemistry phenotype analysis includes blood glucose measurements. Blood chemistry tests were performed on mice using a COBAS Integra 400 (manufacturer: Roche). In the field of metabolism, the treatment of diabetes can be targeted. Blood chemistry phenotype analysis includes a glucose tolerance test that measures changes in insulin sensitivity and glucose metabolism. Abnormal glucose tolerance test results may indicate the following disorders or conditions, but are not limited to: Type 1 and Type 2 diabetes, Syndrome X, various cardiovascular diseases and / or obesity.
Procedure: This assay used a cohort of 2 wild type mice and 4 homozygotes. The glucose tolerance test is a standard method for defining a loss of sugar homeostasis in mammals. The corresponding test was carried out using a Lifescan glucometer. Animals were injected intraperitoneally with a 20% solution of D-glucose at 2 g / kg and blood glucose levels were measured 0, 30, 60 and 90 minutes after injection. Analyzed wt / het / hom: 4/4/8
result:
(− / −) Mice showed increased glucose tolerance compared to (+ / +) littermates and background averages of matched gender. That is, knockout mice show a pattern of expression opposite to impaired glucose homeostasis, and therefore PRO328 antagonists or their encoded genes are useful in the treatment of diseases associated with impaired glucose homeostasis and abnormal glucose metabolism. It seems to be.

(D) Bone metabolism and physical diagnostics: bone metabolism: radiological phenotype analysis In the area of bone metabolism, targets are identified here for the treatment of arthritis, osteoporosis, osteopenia and marble bone disease, and Targets that promote fracture healing are identified. The exam includes:
DEXA for measuring bone mineral density in the femur and vertebra
• Micro CT for very high resolution and very sensitive measurement of bone mineral content in both trabecular and cortical bone.
Dexa Analysis-Test Method Description Procedure: A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. Dual energy X-ray absorption measurement (DEXA) was successfully used to identify changes in bone. Anesthetized animals were examined and bone mineral density (BMC), BMC / LBM ratio, volumetric bone density (vBMD), whole body BMD, femoral BMD and vertebra BMD were measured.
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Bone micro CT analysis Procedure: Micro CT was also used to perform very sensitive BMD measurements. One vertebra and one thigh were removed from a cohort of 4 wild type and 8 homozygous mice. Measurements were taken of the five vertebral traebecular volumes, traebecular thickness, bond density, and total bone area and cortical thickness of the mid-thigh. A micro CT40 scan provided detailed information on bone mass and structure. Multiple bones were placed in the sample holder and scanned automatically. Instrument software was used to select areas of interest for analysis. Trabecular parameters were analyzed in the 5th lumbar vertebra (LV5) with 16 micrometer resolution, and cortical bone parameters were analyzed in the mid-femoral axis with 20 micrometer resolution.
result:
DEXA: (− / −) mice showed a reduction in mean total tissue volume and total fat when compared to (+ / +) littermates and background averages of matched gender.
Micro-CT analysis: (− / −) mice show a decrease in mean vertebra trabecular volume, thickness, and bond density when compared to gender-matched (+ / +) littermates and background means It was done.
Analytical value wt / het / hom: 4/4/10].
Summary:
These results indicate that knockout mutant mice exhibit abnormal bone metabolism with significant bone loss similar to osteoporosis, characterized by bone loss with reduced density and possibly fragility leading to fractures. found. Therefore, PRO328 polypeptide or an agonist thereof is considered to function to maintain bone homeostasis. In addition, PRO328 or its encoding gene may be useful for bone healing, or for the treatment of osteoarthritis or osteoporosis. On the other hand, an antagonist of PRO328 or a gene encoding the same is considered to cause abnormal or pathological bone disorders including inflammatory diseases related to abnormal bone metabolism such as arthritis, osteoarthritis and osteoporosis.
(− / −) Mice analyzed by DEXA had a significant growth retardation characterized by a marked decrease in total tissue mass and total fat and a decrease in body weight and body length when compared to their (+ / +) littermates. showed that. These results are likely due to problems associated with the hypothalamic-pituitary axis that can affect bone growth. Combining this with the decrease in bone measurements suggests tissue wasting such as cachexia. Thus, PRO328 polypeptides or agonists thereof are believed to be useful in the treatment of bone disorders, and may be useful in the treatment of growth diseases or the prevention of cachexies or other tissue wasting diseases.

35.10 Generation and analysis of mice with DNA40592-1242 (UNQ303) gene disruption In these knockout experiments, the gene encoding PRO344 polypeptide (designated DNA40592-1242 (UNQ303)) was disrupted. The gene specific information for these studies is as follows: Mutated mouse genes correspond to the following: Nucleotide reference number: BC023068 or Musmus Cruz C1q and tumor necrosis factor-related protein 5; protein reference number: Q8R002 or deposit number: Q8R002 NID: Musmus Cruz (mouse). Similar to DKFZP586B0621 protein (virtual protein); human gene sequence reference number: NM — 015645 or homosapiens C1q and tumor necrosis factor related protein 5 (C1QTNF5); human protein sequence is reference number Q9BXJ0 or deposit number: Q9BXJ0 NID: homosapiens (human) ). Corresponds to complement C1q tumor necrosis factor-related protein 5 precursor.
The disrupted mouse gene is C1qtnf5 (C1q and tumor necrosis factor-related protein 5), which is an ortholog of human C1QTNF5. Alternative names include CTRP5 and complement-c1q tumor necrosis factor-related protein 5.
C1QTNF5 is a hypothetical secreted protein and contains a signal peptide, a collagen triple helical repeat (Pfam deposit number PF01391), and a complement composition C1q domain (SMART deposit number SM00110). The C1q domain is a globular structure found in many collagens and the C1 enzyme complex that activates the serum complement system. The folding of this domain is similar to that of tumor necrosis factor. The molecular function and biological role of C1QTNF5 is unknown.
Genetic information:
wt het hom Total observation 19 31 16 66
Expected value 16.5 33 16.5 66
Chi-square = 0.52 Significance = 0.777292 (hom / n) = 0.24 Average number of pups = 7
Mutant: Retrovirus insertion (OST)
A retrovirus was inserted between encoded exons 1 and 2 (NCBI accession number NM — 145613.2)
Wild-type expression of the target gene was detected in brain, spinal cord, eye, lung, kidney, skeletal muscle, and heart of 13 adult tissue samples tested by RT-PCR. The large band was an unspliced gene-specific transcript.
PCR analysis revealed that the analyzed (− / −) mice (M-131) had no transcription.

35.11. Phenotypic analysis (disrupted gene: DNA40592-1242 (UNQ303)
(A) Summary of overall phenotype:
Mutations in the gene encoding the ortholog of human C1q and tumor necrosis factor-related protein 5 (C1QTNF5) resulted in retinal degeneration in (− / −) mice. In addition, (− / −) mice showed abnormal bone measurements with a decrease in measurements at the fifth lumbar vertebra. Knockout mice also showed a significant reduction in total body fat and an increase in uric acid levels. As a result of RT-PCR, there was no transcription.

(B) Cardiovascular phenotype analysis In the area of cardiovascular biology, phenotypic tests were performed to identify potential targets for treating cardiovascular, endothelial or angiogenic diseases. Such phenotypic tests are fundus imaging and angiography to flag various eye abnormalities by determining the retinal arteriovenous rate (A / V rate). Abnormal A / V ratio corresponds to a systemic disease or disorder (and any disease caused by hypertension, such as atherosclerosis), diabetes, or ophthalmic diseases, such as those associated with vascular disease due to hypertension Represents other signs of eye disease. Such eye abnormalities may include, but are not limited to: retinal abnormalities include retinal dysplasia, various retinopathy, restenosis, retinal artery occlusion or occlusion; Retinal degeneration causing secondary atrophy of the vasculature, retinitis pigmentosa, macular atrophy, Stargardt disease, congenital stationary night blindness, lack of whole choroid, rotational atrophy, Leber's congenital cataract, retinoschisis, Wagner syndrome , Usher syndrome, Zellweger syndrome, Sardino-Mainser syndrome, Senior Loken syndrome, Bardee-Bedle syndrome, Alport syndrome, Alstrem syndrome, Cocaine syndrome, congenital spinal dysplasia, Flynn-Eyed syndrome, Friedreich ataxia, Hullgren's syndrome, Marshall syndrome, Albers-Schonberg disease, Lefsum disease, Keynes Ahr Syndrome, Wardenburg Syndrome, Alagille Syndrome, Myotonic Dystrophy, Olive Bridge Cerebellar Atrophy, Pierre-Marie Syndrome, Stickler Syndrome, Carotine Memories, Cystine Accumulation, Wolfram Syndrome, Bassen Kornzweig Syndrome, abetalipoproteinemia, dyschromia, Batten's disease, mucopolysaccharidosis, homocystinuria, or mannosidosis.
Procedure: In this assay, a cohort consisting of 4 wild type, 4 heterozygotes and 8 homozygous mutant mice was tested. Fundus imaging was performed on conscious animals using a Kowa Genesis small fundus camera modified by Hawes and co-authors (Hawes et al., 1999 Molecular Vision 1999; 5:22). Fluorescein intraperitoneal injection enabled the acquisition of fluorescence algorithms and direct fundus images for each examination. In addition to direct ophthalmic changes, this test can detect retinal changes associated with systemic diseases such as diabetes and atherosclerosis or other retinal abnormalities. A fundus picture under normal light was provided. Angiographic photographs have made it possible to examine the arteries and veins of the eye. In addition, the vein-to-artery ratio (A / V) of the eye was determined.
An ophthalmic analysis was performed on the F2 wild type, heterozygous and homozygous mutant progeny produced using the protocol described above. Specifically, the A / V ratio was measured and calculated according to the fundus image using Kowa COMIT + software. This test is a color photograph taken through a dilated pupil: the images help detect and classify many diseases. The ratio of artery to vein (A / V) is the ratio of the diameter of the artery to the vein diameter (measured before branching the vessel). Many diseases, such as diabetes, cardiovascular disease, papillary edema, optic nerve atrophy or other eye abnormalities such as retinal degeneration (also known as retinitis pigmentosa), or retinal dysplasia, visual impairment or blindness This ratio will be affected. Thus, compared to wild-type (+ / +) littermates, phenotypic observations showed increased arterial to vein ratios in homozygous (-/-) and heterozygous (+/-) mutant offspring The results show such a pathological condition.
result:
Fundus: Of the 7 non-white (-/-) mice analyzed, 6 (F134, F155, F158, M164, M171, and F183) showed multiple white spots covering the entire retina, It was accompanied by weakening. This indicates that the varieties have retinal degeneration similar to human spotted retinal disease. Analyzed wt / het / hom: 4/4/8
Microscopic pathological observations showed signs of retinal degeneration in the 4 (− / −) mice analyzed (M-173, M-188, F-197, and F-199). Histological degeneration was observed in the area of the outer granular layer of the retina where increased apoptotic cells were shown. In this project, gene expression analysis could not be performed.
In summary, in this study, fundus photography shows that (-/-) mice show severe retinal degeneration, or marked retinal vascular weakness, compared to their (+ / +) littermates. It has been found. Angiograms demonstrated that mutant (-/-) mice show retinal vessel weakening with capillary aneurysms. Similarly, microscopic observations showed bilateral retinal degeneration in mutant (− / −) mice. That is, by knocking out the gene identified as DNA40592-1242 encoding the PRO344 polypeptide, homozygous mutant progeny exhibit a phenotype associated with retinal degeneration. Such detected retinal changes include systemic diseases or disorders of the circulatory system associated with vascular diseases due to hypertension (and any disease that causes hypertension, such as atherosclerosis), diabetes or retinal degeneration, etc. It is most commonly associated with other eye diseases that correspond to ophthalmic diseases. Thus, antagonists of the gene encoding PRO344 produce similar pathological retinal changes, while agonists are hypertension, atherosclerosis, or other ophthalmic diseases including retinal degeneration and diseases associated with this condition. It would be useful as a therapeutic agent in the treatment of (as described above).

(C) Bone metabolism and physical diagnostics: bone metabolism: radiological phenotype analysis In the area of bone metabolism, targets are identified here for the treatment of arthritis, osteoporosis, osteopenia and marble bone disease, and Targets that promote fracture healing are identified. The exam includes:
DEXA for measuring bone mineral density in the femur and vertebra
• Micro CT for very high resolution and very sensitive measurement of bone mineral content in both trabecular and cortical bone.
Dexa Analysis-Test Method Description Procedure: A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. Dual energy X-ray absorption measurement (DEXA) was successfully used to identify changes in bone. Anesthetized animals were examined and bone mineral density (BMC), BMC / LBM ratio, volumetric bone density (vBMD), whole body BMD, femoral BMD and vertebra BMD were measured.
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Bone micro CT analysis Procedure: Micro CT was also used to perform very sensitive BMD measurements. One vertebra and one thigh were removed from a cohort of 4 wild type and 8 homozygous mice. Measurements were taken of the five vertebral traebecular volumes, traebecular thickness, bond density, and total bone area and cortical thickness of the mid-thigh. A micro CT40 scan provided detailed information on bone mass and structure. Multiple bones were placed in the sample holder and scanned automatically. Instrument software was used to select areas of interest for analysis. Trabecular parameters were analyzed in the 5th lumbar vertebra (LV5) with 16 micrometer resolution, and cortical bone parameters were analyzed in the mid-femoral axis with 20 micrometer resolution.
result:
DEXA: (− / −) mice showed a significant reduction in total body fat mass when compared to littermate controls. In addition, (− / −) mutant mice had increased uric acid levels (observed in blood chemistry analysis).
Micro-CT analysis: In (− / −) mice, the mean vertebra trabecular volume, number, thickness, and bond density decreased when compared to gender-matched (+ / +) littermates and background means And a decrease in mean femoral cross-sectional area. Analytical value wt / het / hom: 4/4/8.
These results indicate that knockout mutant mice exhibit abnormal bone metabolism with significant bone loss similar to osteoporosis, characterized by bone loss with reduced density and possibly fragility leading to fractures. found. Therefore, it is thought that PRO344 or an agonist thereof functions to maintain bone homeostasis. In addition, PRO344 or its encoding gene is thought to be useful for bone healing or for the treatment of arthritis or osteoporosis. On the other hand, antagonists of PRO344 are thought to lead to abnormal or pathological bone disorders including inflammatory diseases related to abnormal bone metabolism including osteoarthritis, osteoporosis and osteopenia. In addition, a decrease in total body fat mass in (− / −) mice suggested tissue wasting disease.

Generation and Analysis of Mice with 35.11 DNA44804-1248 (UNQ314) Gene Disruption In these knockout experiments, the gene encoding PRO357 polypeptide (designated DNA44804-1248 (UNQ312)) was disrupted. The gene specific information for these studies is as follows: Mutated mouse genes correspond to the following: Nucleotide reference number: NM — 139307 or Musmus Cruz slit-like 2 (Drosophila) (Slitl2); protein reference number : NP — 647468 or Slit-like 2 [Musmus Cruz]; human gene sequence reference number: BC013767 or deposit number: BC013767 NID: 15487338 homosapiens homosapiens, similar to RIKEN cDNA 261528G05 gene, cloned image: 3875837; human protein sequence reference number Q96CX1 or deposit number: Q96CX1 NID: Homo sapiens (human). RIKEN cDNA 2610528G05 gene (fragment). HUMANSPTRNRDB. Corresponding to
The disrupted mouse gene is Slitl2 (Slit-like 2 [Drosophila]), an ortholog of the human virtual protein LOC114990. Alias names include virtual proteins BC013767 and 2610528G05Rik.
Slit proteins (eg, SLIT1) are extracellular proteins that play an important role in the developmental process, particularly in the formation of the nervous and endocrine systems. Slit-type proteins are thought to aid cell migration (Piper and Little, Bioessays, 25 (1): 32-8 (2003)). Thus, due to homology, LOC114990 appears to be secreted or mostly extracellular and assist the developmental stage.
Genetic information:
wt het hom Total observation 15 33 13 61
Expected value 15.25 30.5 15.25 61
Chi-square = 0.54 Significance = 0.76300 (hom / n) = 0.21 Average number of pups = 4
Mutant: Retrovirus insertion (OST)
A retrovirus was inserted into the disrupted gene in encoded exon 2 (NCBI accession number NM — 139307)
Wild type expression of the target gene was detected in 13 adult tissue samples tested by RT-PCR, as well as in embryonic stem (ES) cell kidney, skeletal muscle, and heart.
RT-PCR analysis revealed that the analyzed (− / −) mouse (F-59) had no transcription. The destruction of the target gene was confirmed by inverse PCR.

35.11.1. Phenotypic analysis (disrupted gene: DNA44804-1248 (UNQ314)
(A) Summary of overall phenotype:
Mutations in the gene encoding the orthologue of the human hypothetical protein (BC013767) increased the average bone mineral content of the whole body, femur, and vertebra, volumetric bone density, and bone density. Some (− / −) mice were smaller than (+ / +) littermates and died earlier (only 19 days after birth). (+/-) mice were also small and died early. Male (-/-) mice showed infertility. In knockout mice, serum triglycerides, ketone bodies, and glucose levels increased and blood pressure increased. (− / −) Mice also showed an increase in bone measurements and an increase in total body fat. As a result of RT-PCR, there was no transcription.

(B) Bone metabolism and physical diagnosis (1) Measurement of tissue mass and lean body mass-Dexa
Dexa Analysis-Test Description Procedure: In this assay, a cohort of 4 wild type, 4 heterozygotes and 8 homozygotes was tested. Dual energy X-ray absorption (DEXA) was successfully used to identify changes in total tissue mass (TTM).
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Body measurements (body length and body weight): Body length and body weight were measured at about 16 weeks of age.
result:
Some (-/-) mice were smaller than their (+ / +) littermates and died only 19 days after birth. The remaining (− / −) mice appeared healthy. Many (+/−) mice were also small, with low organ mass and died early. Two male (− / −) mice that could be analyzed showed an increase in mean systolic blood pressure compared to their gender-matched (+ / +) littermates and background means. Analyzed wt / het / hom: 14/27/10
Fertility: The analyzed male (− / −) mice (M-106) were infertile.
Pathology: Microscopic observation of a single (− / −) mouse (M-106) analyzed showed seroconducting exudate from one middle ear. In addition, a cyst was seen in the testis along one side of the degeneration. Analyzed wt / het / hom: 0/2/1
(2) Bone metabolism: radiological phenotype analysis In the area of bone metabolism, targets are identified here for the treatment of arthritis, osteoporosis, osteopenia and marble bone disease, and targets that promote fracture healing Identified. The exam includes:
DEXA for measuring bone mineral density in the femur and vertebra
• Micro CT for very high resolution and very sensitive measurement of bone mineral content in both trabecular and cortical bone.
Dexa Analysis-Test Method Description Procedure: A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. Dual energy X-ray absorption measurement (DEXA) was successfully used to identify changes in bone. Anesthetized animals were examined and bone mineral density (BMC), BMC / LBM ratio, volumetric bone density (vBMD), whole body BMD, femoral BMD and vertebra BMD were measured.
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Bone micro CT analysis Procedure: Micro CT was also used to perform very sensitive BMD measurements. One vertebra and one thigh were removed from a cohort of 4 wild type and 8 homozygous mice. Measurements were taken of the five vertebral traebecular volumes, traebecular thickness, bond density, and total bone area and cortical thickness of the mid-thigh. A micro CT40 scan provided detailed information on bone mass and structure. Multiple bones were placed in the sample holder and scanned automatically. Instrument software was used to select areas of interest for analysis. Trabecular parameters were analyzed in the 5th lumbar vertebra (LV5) with 16 micrometer resolution, and cortical bone parameters were analyzed in the mid-femoral axis with 20 micrometer resolution.
result:
DEXA: In (− / −) mice, the mean bone mineral density, volumetric bone density, and whole body, femur and vertebrae when compared to (+ / +) littermates and background averages of matched gender An increase in bone density was shown. Mutant mice also showed an increase in total body fat and a corresponding increase in blood triglycerides, suggesting abnormal lipid metabolism. Analyzed wt / het / hom: 4/8/8
Micro-CT analysis: (− / −) mice had increased measurements of the fifth lumbar spine when compared to wild-type littermates with matching gender.
Summary:
Multiple mutant (− / −) mice were much smaller than their (+ / +) littermates and showed signs of growth retardation. In addition, heterozygous (+/−) mice showed growth inhibition and reduced viability, were small and did not survive as long as their (+ / +) littermates. In addition, (− / −) mice showed an increase in average bone mineral density, volumetric bone density and whole body and femur bone density compared to their (+ / +) littermates. From the above results, it has been found that knockout mutant mice exhibit not only growth failure and decreased viability but also bone abnormalities related to bone diseases such as marble bone disease. Marble bone disease is a condition characterized by abnormal thickening and hardening of bone and abnormal fragility of bone. Thus, the PRO357 polypeptide or agonist thereof is important for normal growth and normal bone metabolism and is considered useful for the treatment of marble bone disease or other related bone diseases. In addition, male (− / −) mice showed signs of infertility and testicular degeneration. Thus, the PRO357 polypeptide or agonist thereof appears to be useful for the prevention and / or treatment of such bone disorders and also plays an important role in maintaining normal growth and development.

(C) Phenotypic analysis: Cardiology In the field of cardiovascular biology, hypertension, atherosclerosis, heart failure, stroke, various coronary artery diseases, dyslipidemia such as high cholesterol (hypercholesterolemia) and Targets for the treatment of elevated serum triglycerides (hypertriglyceridemia), diabetes, and / or obesity have now been identified. Phenotypic tests include measurement of serum cholesterol and triglycerides.
Blood lipid Procedure:
A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. High cholesterol levels and elevated triglyceride blood levels are recognized risk factors in the progression of cardiovascular disease and / or diabetes. Measuring blood lipids facilitates the discovery of biological switches that regulate blood lipid levels. Inhibition of factors that increase blood lipid levels may be useful in reducing the risk of cardiovascular disease. In this blood chemistry test, cholesterol readings were recorded using COBAS Integra400 (mfr: Roche).
result:
When compared to the background average of gender-matched (+ / +) littermates and male (+ / +) mice, (− / −) mice showed increased mean serum triglycerides, ketone bodies and glucose levels . In addition, (− / −) mice showed an increase in blood pressure.
When compared to the background average of gender-matched (+ / +) littermates and male (+ / +) mice, (− / −) mice showed a significant increase in triglyceride levels. In addition, an increase in mean serum glucose levels suggested diabetes. An increase in mean systolic blood pressure due to blood chemistry indicated hypertension or other cardiovascular disease. Thus, mutant mice lacking the PRO357 gene can function as a model for cardiovascular diseases including diabetes. PRO357 polypeptide or its encoding gene is thought to be useful for the control of normal blood lipid levels such as triglycerides and / or blood glucose. Thus, PRO357 polypeptide or an agonist thereof may be used in cardiovascular diseases such as hypertension, atherosclerosis, heart failure, stroke, various coronary artery diseases, hypercholesterolemia, hypertriglyceridemia, diabetes and / or obesity. It seems to be useful for treatment.

Generation and Analysis of Mice with 35.12 DNA44184-1319 (UNQ330) Gene Disruption In these knockout experiments, the gene encoding PRO526 polypeptide (designated DNA44184-1319 (UNQ330)) was disrupted. The gene specific information for these studies is as follows: The mutated mouse gene corresponds to: nucleotide reference number: NM_022982 or deposit number: NM_022982 NID: gi 12667793 reference number NM_022982.1 Musmus Cruz reticulon 4 receptor (Rtn4r); protein reference number: Q99PI8 or Reticulon 4 receptor precursor (Nogo receptor) (NgR) (Nogo-66 receptor); human gene sequence reference number: NM — 023004 or homosapiens reticulon 4 receptor (RTN4R); Reference number: Q9BZR6 or Reticulon 4 receptor precursor (Nogo receptor) (NgR) (Nogo-66 receptor) Corresponding to over (UNQ330 / PRO526).
The target mouse gene is Rtn4r (reticulon 4 receptor), an ortholog of human RTN4R. Alias names include NgR, NOGOR, nogo receptor, and Nogo-66 receptor.
RTN4R is a glycosylphosphatidylinositol tethered extracellular protein (RTN4; also known as NOGO), oligodendrocyte myelin glycoprotein (OMG), and myelin-related glycoprotein (MAG) that functions as a receptor for reticulon4 (Fournier et al., Nature, 409- (6818): 341-6 (2001); Wang, Koprivica et al., Nature, 417 (6892): 941-4 (2002); Liu et al., Science, 297 ( 5584): 1190-3 (2002)). When bound to these ligands, RTN4R binds to transmembrane protein and neurotrophin growth factor family receptor RTN4R and to the nervous system specific transmembrane protein LINGO-1. This binding causes a signal to be transmitted inside the cell (Wang, Kim et al., Nature, 420 (6911): 74-8 (2002); Wong et al., Nat Neurosci, 5 (12): 1302-8 (2002) Mi et al., Nat Neurosci, 7 (3): 221-8 (2004) RTN4R is involved in the induction of axon and the development of the nervous system.In addition, RTN4R and its signaling composition are It is a target for inhibitors that allow axon regeneration after injury (Fisher et al., J Neurosci, 24 (7): 1646-51 (2004); Song et al., J Neurosci, 24 (2): 542-6 (2004 Lee et al., Nat Rev Drug Discov, 2 (11): 872-8 (2003)).
Targeted or gene trap mutations were generated in strain 129SvEv ^Brd -derived embryonic stem (ES) cells. Chimeric mice were crossed to C57BL / 6J albino mice to produce F1 heterozygous animals. These progeny were crossed to produce F2 wild type, heterozygous, and homozygous mutant progeny. Very occasionally, for example, when F1 mice are rarely obtained from the chimera, F1 heterozygous mice are crossed with 129SvEv ^Brd / C57 hybrid mice to generate additional heterozygous animals for cross fertilization and F2 mice. Was produced. Level 1 phenotypic analysis was performed on the mice thus produced.
wt het hom Total observation 20 36 22 78
Expected value 19.5 39 19.5 78
Chi-square = 0.56 Significance = 0.75424 (hom / n) = 0.28 Average number of pups = 8
Mutant: homologous recombination (standard)
Targeting coded exon 1 (NCBI deposit number NM — 022982.1)
Wild type expression of the target gene was detected in all 13 adult tissue samples and embryonic stem (ES) cells tested by RT-PCR.
Southern hybridization analysis confirmed target gene disruption.

35.12.1. Phenotypic analysis (broken gene: DNA44184-1319 (UNQ330)
(A) Summary of overall phenotype:
Mutation of the gene encoding the orthologon of human reticulon 4 receptor (RTN4R) increased glucose tolerance and decreased mean serum cholesuterol, triglyceride and glucose levels in (− / −) mice. Male (− / −) mice showed increased lean body mass, increased bone density, and increased bone mineral density in the whole body, femur and vertebra, and increased average body weight. Mutant mice also showed a marked increase in TNF-α and IL-6 responses to LPS challenge. Gene disruption was confirmed by Southern blotting.

(B) Immunological phenotypic analysis Immune-related and inflammatory diseases are in normal physiology, responding to invasion or injury, initiating repair of invasion or injury, and innate and acquired protective power against foreign organisms. Physiological pathways important for the incorporation of are very complex and multiple connected signs or consequences. A disease or condition is a condition in which these normal physiological pathways are subject to additional invasion or injury, either directly as a result of abnormal control or excessive stimulation, as a response to self, or as a combination thereof. It occurs when causing.
The origins of these diseases often involve multiple pathways and often multiple different physiological systems / pathways, and intervening in multiple of these pathways can lead to remission or therapeutic effects. Can be mentioned. Therapeutic intervention can be done by antagonizing harmful processes / pathways or stimulating beneficial processes / pathways.
T lymphocytes (T cells) are an important component of a mammalian immune response. T cells recognize antigens associated with self-molecules encoded by genes within major histocompatibility antigens (MHC). Antigens can be expressed with MHC molecules on the surface of antigen-presenting cells, virus-infected cells, cancer cells, grafts and the like. T cell lines remove degenerative cells that pose a threat to the health of the host mammal. T cells include helper T cells and cytotoxic T cells. Helper T cells proliferate on a large scale when they recognize antigen-MHC complexes on antigen-presenting cells. Helper T cells also secrete various cytokines, lymphokines, which play a central role in the activity of B cells, cytotoxic T cells and various other cells that participate in the immune response.
In many immune responses, inflammatory cells infiltrate the site of injury or infection. Migrating cells are neutrophils, eosinophils, monocytes or lymphocytes, which can be determined by histological examination of the affected tissue. Current Protocols in Immunology, ed John E. Coligan, 1994 John Wiley & Sons, Inc.
Many immune related diseases are known and have been extensively studied. Such diseases include immune-mediated inflammatory diseases (eg rheumatoid arthritis, immune-mediated renal disease, hepatobiliary disease, inflammatory bowel disease (IBD), psoriasis, and asthma), non-immune-mediated inflammatory diseases , Infections, immunodeficiency diseases, tumors, and transplant rejections. In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified.
In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified. Immune related diseases can be treated in one example by suppressing the immune response. The use of neutralizing antibodies that suppress molecules with immunostimulatory activity is beneficial for the treatment of immune-mediated and inflammatory diseases. Molecules that suppress immune responses (proteins directly or using antibody agonists) can be used to suppress immune responses and thus ameliorate immune-related diseases.

The following tests were conducted.
Acute phase response:
Test Description: Bacterial lipopolysaccharide (LPS) is an endotoxin and as such is a potent inducer of the acute phase response and systemic inflammation. Level 1 LPS mice were injected intraperitoneally with a sublethal dose of LPS in 200 μL of sterile saline using a 26 gauge needle. The dose was 1 μg / g body weight 3 hours after injection based on the average body weight of the tested mice. A 100 μl blood sample was then taken and analyzed for the presence of TNFa, MCP-1, and IL-6 with a FACSCalibur instrument.
result:
(− / −) Mice showed a significant increase in mean serum IL-6 and TNF-α responses to LPS challenge compared to their pups and background means.
In summary, administration of LPS endotoxin antigen demonstrated that knockout mice lacking the gene encoding PRO526 polypeptide exhibit immunological abnormalities compared to their wild-type pups. In particular, mutant mice showed reduced ability to elicit an immunological response (production of TNF-α and IL-6) when administered LPS endotoxin antigen. This indicates a strong pro-inflammatory response. IL-6 and TNF-α contribute to the subsequent B cell activation stage. In addition, IL-6 plays an important role in the induction of acute phase responses and systemic inflammation. This indicates that an inhibitor of PRO526 polypeptide or an antagonist thereof, or an encoding gene thereof, stimulates the immune system and if this effect is beneficial to the individual, such as leukemia and other types of cancer, and AIDS patients It seems that it can be used for immunodeficient patients. Accordingly, PRO526 polypeptides or agonists thereof serve to suppress immune responses and are useful candidates for suppressing adverse immune responses, for example in the case of graft rejection or graft-versus-host disease.

(C) Bone metabolism and physical diagnosis (1) Measurement of tissue mass and lean body mass-Dexa
Dexa Analysis-Test Description Procedure: In this assay, a cohort of 4 wild type, 4 heterozygotes and 8 homozygotes was tested. Dual energy X-ray absorption (DEXA) was successfully used to identify changes in total tissue mass (TTM).
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Body measurements (body length and body weight): Body length and body weight were measured at about 16 weeks of age.
result:
(− / −) Mice showed significant weight gain compared to their wild-type littermate controls.
(2) Bone metabolism: radiological phenotype analysis In the area of bone metabolism, targets are identified here for the treatment of arthritis, osteoporosis, osteopenia and marble bone disease, and targets that promote fracture healing Identified. The exam includes:
DEXA for measuring bone mineral density in the femur and vertebra
• Micro CT for very high resolution and very sensitive measurement of bone mineral content in both trabecular and cortical bone.
Dexa Analysis-Test Method Description Procedure: A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. Dual energy X-ray absorption measurement (DEXA) was successfully used to identify changes in bone. Anesthetized animals were examined and bone mineral density (BMC), BMC / LBM ratio, volumetric bone density (vBMD), whole body BMD, femoral BMD and vertebra BMD were measured.
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Bone micro CT analysis Procedure: Micro CT was also used to perform very sensitive BMD measurements. One vertebra and one thigh were removed from a cohort of 4 wild type and 8 homozygous mice. Measurements were taken of the five vertebral traebecular volumes, traebecular thickness, bond density, and total bone area and cortical thickness of the mid-thigh. A micro CT40 scan provided detailed information on bone mass and structure. Multiple bones were placed in the sample holder and scanned automatically. Instrument software was used to select areas of interest for analysis. Trabecular parameters were analyzed in the 5th lumbar vertebra (LV5) with 16 micrometer resolution, and cortical bone parameters were analyzed in the mid-femoral axis with 20 micrometer resolution.
result:
DEXA: male (-/-) is an increase in average lean body mass and average bone mineral density in the whole body, femur and vertebra when compared to (+ / +) littermates and background averages of matched gender It showed an increase in quantity and bone density.
Micro CT: (− / −) mice showed increased bone density bone density when compared to their wild-type littermates and background means.
Summary:
In summary, male (-/-) mice show an increase in mean lean body mass, bone mineral density, and whole body and femoral bone density when compared to their (+ / +) littermates of matching gender. Indicated. These results suggest that the knockout mutant phenotype is associated with bone abnormalities such as marble bone disease. Marble bone disease is a condition characterized by abnormal thickening and hardening of bone. Thus, PRO526 polypeptide or antagonists thereof may be effective in treating marble bone disease or other bone diseases. On the other hand, inhibitors or antagonists of PRO526 polypeptides appear to be useful for bone healing. Analyzed wt / het / hom: 4/4/8

(D) Phenotypic analysis: Cardiology In the area of cardiovascular biology, hypertension, atherosclerosis, heart failure, stroke, various coronary artery diseases, dyslipidemias such as high cholesterol (hypercholesterolemia) and Targets for the treatment of elevated serum triglycerides (hypertriglyceridemia), diabetes, and / or obesity have now been identified. Phenotypic tests include measurement of serum cholesterol and triglycerides.
Blood lipid Procedure:
A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. High cholesterol levels and elevated triglyceride blood levels are recognized risk factors in the progression of cardiovascular disease and / or diabetes. Measuring blood lipids facilitates the discovery of biological switches that regulate blood lipid levels. Inhibition of factors that increase blood lipid levels may be useful in reducing the risk of cardiovascular disease. In this blood chemistry test, cholesterol readings were recorded using COBAS Integra400 (mfr: Roche).
result:
When compared to gender-matched (+ / +) littermates and background means, (− / −) mice showed a decrease in mean serum cholesterol, triglyceride and glucose levels. In summary, these knockout mutant mice showed a positive phenotype for lipid and / or sugar metabolism. That is, a mutant mouse lacking the PRO526 gene can function as a model for treating cardiovascular disease. PRO526 antagonists or their encoded genes appear to be useful in regulating blood lipids, particularly in maintaining normal cholesterol metabolism. Thus, inhibitors or antagonists of PRO526 polypeptide are useful in the treatment of cardiovascular diseases associated with abnormal lipid metabolism such as hypertension, atherosclerosis, heart failure, stroke, various coronary artery diseases, obesity, and / or diabetes. It is.

Phenotypic Analysis: Metabolism-Blood Chemistry / Glucose Tolerance In the field of metabolism, the treatment of diabetes can be targeted. Blood chemistry phenotype analysis includes blood glucose measurements. Blood chemistry tests were performed on mice using a COBAS Integra 400 (manufacturer: Roche). In the field of metabolism, the treatment of diabetes can be targeted. Blood chemistry phenotype analysis includes a glucose tolerance test that measures changes in insulin sensitivity and glucose metabolism. Abnormal glucose tolerance test results may indicate the following disorders or conditions, but are not limited to: Type 1 and Type 2 diabetes, Syndrome X, various cardiovascular diseases and / or obesity.
Procedure: This assay used a cohort of 2 wild type mice and 4 homozygotes. The glucose tolerance test is a standard method for defining a loss of sugar homeostasis in mammals. The corresponding test was carried out using a Lifescan glucometer. Animals were injected intraperitoneally with a 20% solution of D-glucose at 2 g / kg and blood glucose levels were measured 0, 30, 60 and 90 minutes after injection. Analyzed wt / het / hom: 4/4/8
result:
(− / −) Mice showed increased glucose tolerance compared to (+ / +) littermates and background averages of matched gender. Thus, knockout mice exhibit a phenotypic pattern opposite to glucose homeostasis, and thus an antagonist of PRO526 or its encoding gene is useful for the treatment of diseases related to glucose homeostasis and abnormal glucose metabolism I think that the.

Generation and analysis of mice with 35.13 DNA49631-1328 (UNQ389) gene disruption In these knockout experiments, the gene encoding PRO724 polypeptide (designated DNA49631-1328 (UNQ389)) was disrupted. The gene specific information for these studies is as follows: The mutated mouse gene corresponds to the following: nucleotide reference number: NM_022993 or deposit number: NM_022993 NID: 12667805 Receptor associated protein 10 (Lrp10); protein reference number: Q9EPE8 or deposit number: Q9EPE8 NID: Musmus Cruz (mouse). 8. Low density lipoprotein receptor related protein MOUSESPTRNRDB; human gene sequence reference number: NM — 014045 or deposit number: NM — 014045 NID: 13027587 homosapiens homosapiens DKFZP564C1940 protein (DKFZP564C1940); Deposit number: Q86T02 NID: Homo sapiens (human). It corresponds to the human full-length cDNA clone CS0DK002YO06 of Homo sapiens (human) HeLa cells.
The mouse genes of interest are Lrp10 (low density lipoprotein receptor-related protein 10), an ortholog of human LRP10. Alias names are Lrp9, MGC8675, DKFZP564C1940, and the like.
LRP10 is a type 1 plasma membrane protein predicted to be expressed primarily in the liver and mediates uptake of apolipoprotein E-enriched β-VLDL in vitro. Thus, it appears to function as a receptor for low density lipoprotein in vivo. In addition to the liver, LRP10 is also found in the kidney and brain, especially at high levels in the blood vessel wall. LRP10 may participate in the uptake of apoE-containing lipoprotein (Sugiyama et al., Biochemistry, 39 (51): 15817-25 (2000)).
Targeted or gene trap mutations were generated in strain 129SvEv ^Brd -derived embryonic stem (ES) cells. Chimeric mice were crossed to C57BL / 6J albino mice to produce F1 heterozygous animals. These progeny were crossed to produce F2 wild type, heterozygous, and homozygous mutant progeny. Very occasionally, for example, when F1 mice are rarely obtained from the chimera, F1 heterozygous mice are crossed with 129SvEv ^Brd / C57 hybrid mice to generate additional heterozygous animals for cross fertilization and F2 mice. Was produced. Level 1 phenotypic analysis was performed on the mice thus produced.
wt het hom Total observation 17 29 17 63
Expected value 15.75 31.5 15.75 63
Chi-square = 0.40 Significance = 0.82003 (hom / n) = 0.27 Average number of pups = 6
Mutant: homologous recombination (standard)
Targeted coding exon 1 (NCBI deposit number NM — 02993.2)
Wild-type expression of the target gene was detected in all 13 adult tissue samples tested by RT-PCR, as well as in embryonic stem (ES) cells.
Southern hybridization analysis confirmed target gene disruption.

35.13.1. Phenotype analysis (disrupted gene: DNA49631-1328 (UNQ389)
(A) Summary of overall phenotype:
Mutation of the gene encoding the orthologue of human low density lipoprotein receptor-related protein 10 (LRP10) caused a rapid decrease in the rate of dermal fibroblast proliferation in (− / −) mice. In addition, (− / −) mice showed increased bone measurements. Mutant mice also had impaired glucose tolerance. Mutant (− / −) mice also showed immunological abnormalities characterized by decreased levels of eosinophils and monocytes and increased levels of CD8 + cells. Gene disruption was confirmed by Southern blotting.

(B) Immunological phenotypic analysis Immune-related and inflammatory diseases are in normal physiology, responding to invasion or injury, initiating repair of invasion or injury, and innate and acquired protective power against foreign organisms. Physiological pathways important for the incorporation of are very complex and multiple connected signs or consequences. A disease or condition is a condition in which these normal physiological pathways are subject to additional invasion or injury, either directly as a result of abnormal control or excessive stimulation, as a response to self, or as a combination thereof. It occurs when causing.
The origins of these diseases often involve multiple pathways and often multiple different physiological systems / pathways, and intervening in multiple of these pathways can lead to remission or therapeutic effects. Can be mentioned. Therapeutic intervention can be done by antagonizing harmful processes / pathways or stimulating beneficial processes / pathways.
T lymphocytes (T cells) are an important component of a mammalian immune response. T cells recognize antigens associated with self-molecules encoded by genes within major histocompatibility antigens (MHC). Antigens can be expressed with MHC molecules on the surface of antigen-presenting cells, virus-infected cells, cancer cells, grafts and the like. T cell lines remove degenerative cells that pose a threat to the health of the host mammal. T cells include helper T cells and cytotoxic T cells. Helper T cells proliferate on a large scale when they recognize antigen-MHC complexes on antigen-presenting cells. Helper T cells also secrete various cytokines, lymphokines, which play a central role in the activity of B cells, cytotoxic T cells and various other cells that participate in the immune response.
In many immune responses, inflammatory cells infiltrate the site of injury or infection. Migrating cells are neutrophils, eosinophils, monocytes or lymphocytes, which can be determined by histological examination of the affected tissue. Current Protocols in Immunology, ed John E. Coligan, 1994 John Wiley & Sons, Inc.
Many immune related diseases are known and have been extensively studied. Such diseases include immune-mediated inflammatory diseases (eg rheumatoid arthritis, immune-mediated renal disease, hepatobiliary disease, inflammatory bowel disease (IBD), psoriasis, and asthma), non-immune-mediated inflammatory diseases , Infections, immunodeficiency diseases, tumors, and transplant rejections. In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified.
In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified. Immune related diseases can be treated in one example by suppressing the immune response. The use of neutralizing antibodies that suppress molecules with immunostimulatory activity is beneficial for the treatment of immune-mediated and inflammatory diseases. Molecules that suppress immune responses (proteins directly or using antibody agonists) can be used to suppress immune responses and thus ameliorate immune-related diseases.

The following tests were conducted.
(1) Fluorescence activated cell sorting (FACS) analysis Procedure:
FACS analysis of peripheral blood immune cell composition containing CD4, CD8 and T cell receptors was performed to evaluate natural killer cell leukocyte markers and TNK as panNK, CD19 and CD45 of B lymphocytes. FACS analysis was performed on 2 wild type mice and 6 homozygous mice, including cells obtained from thymus, spleen, bone marrow and lymph nodes.
In these studies, cells to be analyzed were isolated from thymus, peripheral blood, spleen, bone marrow and lymph nodes. Flow cytometry was designed to determine the relative proportion of CD4 and CD8 positive T cells, B cells, NK cells and monocytes in the mononuclear cell population. For phenotypic analysis and screening, this machine records the number of CD4 + / CD8-, CD8 + / CD4-, NK, B cells and monocytes in addition to the CD4 + / CD8 + ratio. Mononuclear cell profiles were obtained by staining a single sample of lysed peripheral blood from each mouse with a set of 6 lineage specific antibodies: CD45 PerCP, anti-TCRb APC, CD4 PE, CD8 FITC , Pan-NK PE, and CD19 FITC. Two antibodies labeled with FITC and PE stained mutually exclusive cell types. The samples were analyzed with CellQuest software using a Becton Dickinson FACSCalibur flow cytometer.
(2) Hematological analysis Test description: A blood test was conducted with Abbott Cell-Dyn 3500R (automatic blood analyzer). Part of the feature includes a differential of white blood cells consisting of five parts. The patient report can cover over 22 parameters in total.
result:
(− / −) Mice showed a decrease in neutrophils and monocytes compared to their (+ / +) littermates and background means.
FACS analysis also showed that (− / −) mice showed an increase in the average percentage of CD8 + cells when compared to their (+ / +) littermates and background means.
Analyzed wt / het / hom: 7/5/8
In summary, hematological analysis and FACS results show that homozygous mutant mice show a decrease in the number of eosinophils and monocytes compared to their littermate controls, and macrophage precursor levels It was shown to be low. However, (− / −) mice also showed an increase in the proportion of CD8 + cells. The CD8 + molecule is a co-receptor that cooperates with the T cell receptor in antigen recognition and specifically binds only to the invariant site of MHC class 1 molecules. During antigen recognition, CD8 + molecules bind to the T cell surface by the composition of the T cell receptor to form cytotoxic CD8 + T cells. Thus, inhibitors or antagonists of PRO724 polypeptides are important in T cell mediated responses involved in the MHC class 1 pathway and are effective when cytotoxic T cells are required for host defense against cytosolic pathogens. In contrast, PRO724 polypeptides or agonists thereof are expected to mimic a negative phenotype, resulting in a lack of an average percentage of CD8 + cells and thereby a MHC class 1 deficiency. Such a disease model arises when cell surface MHC class 1 molecules are almost completely gone. In patients in such a state, the level of mRNA encoding an MHC class 1 molecule is normal, and the production level of MHC class 1 protein is normal. However, these individuals are immunocompromised, particularly due to a lack of CD8 + T cells. This causes a severe immunodeficiency disorder with a fatally suppressed response to almost all pathogens.

(C) Bone metabolism and physical diagnostics: radiological phenotype analysis In the area of bone metabolism, targets are identified here for the treatment of arthritis, osteoporosis, osteopenia and marble bone disease, and fracture healing. Promoting targets are identified. The exam includes:
DEXA for measuring bone mineral density in the femur and vertebra
• Micro CT for very high resolution and very sensitive measurement of bone mineral content in both trabecular and cortical bone.
Dexa Analysis-Test Method Description Procedure: A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. Dual energy X-ray absorption measurement (DEXA) was successfully used to identify changes in bone. Anesthetized animals were examined and bone mineral density (BMC), BMC / LBM ratio, volumetric bone density (vBMD), whole body BMD, femoral BMD and vertebra BMD were measured.
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Bone micro CT analysis Procedure: Micro CT was also used to perform very sensitive BMD measurements. One vertebra and one thigh were removed from a cohort of 4 wild type and 8 homozygous mice. Measurements were taken of the five vertebral traebecular volumes, traebecular thickness, bond density, and total bone area and cortical thickness of the mid-thigh. A micro CT40 scan provided detailed information on bone mass and structure. Multiple bones were placed in the sample holder and scanned automatically. Instrument software was used to select areas of interest for analysis. Trabecular parameters were analyzed in the 5th lumbar vertebra (LV5) with 16 micrometer resolution, and cortical bone parameters were analyzed in the mid-femoral axis with 20 micrometer resolution.
result:
DEXA: (− / −) mice showed an increase in average bone density when compared to (+ / +) littermates with matched gender and background means.
Micro-CT analysis: In (− / −) mice, mean vertebra trabecular volume, number, thickness, and bond density increased when compared to gender-matched (+ / +) littermates and background means It has been shown.
Analysis value wt / het / hom: 4/4/9
Summary:
In summary, (− / −) mice showed an increase in mean bone mineral density, whole body and femur bone density when compared to (+ / +) littermates of matched gender. These results indicate that the knockout mutant phenotype is associated with bone abnormalities such as marble bone disease. Marble osteopathy is a condition characterized by abnormal thickening and hardening of bone and abnormal fragility of bone. Thus, PRO724 polypeptides or agonists thereof are believed to be effective in treating marble bone disease or other bone diseases. On the other hand, inhibitors or antagonists of PRO724 polypeptides appear to be useful for bone healing.

(D) Oncology phenotype analysis In the field of oncology, targets have been identified here for the treatment of solid tumors, lymphomas and leukemias.
Proliferation of adult skin cells Procedure: Skin cells were isolated from 16 week old animals (2 wild type and 4 homozygous). These were grown in the first fibroblast culture and the fibroblast proliferation rate was measured by a strictly controlled protocol. The ability of this assay to detect hyperproliferative and hypoproliferative phenotypes showed p53 and Ku80. Proliferation was measured using Brdu Incorporaton.
Specifically, a dermal fibroblast proliferation assay was used for this study. The increase in cells in standard culture was used as an indicator of relative proliferative capacity. Primary fibroblasts were established from histological examination of skin collected from wild type and mutant mice. Two or three cultures containing 50,000 cells were seeded and grown for 6 days. At the end of the culture period, the number of cells in the culture was determined using an electronic particle counter.
Results: (− / −) mice showed a sharp decrease in the average skin fibroblast proliferation rate when compared to (+ / +) litters of matched gender and background average. Thus, homozygous mutant mice showed a hypoproliferative phenotype. As shown in these observations, PRO724 polypeptide antagonists or their encoded genes appear to be useful in reducing abnormal cell proliferation, such as tumor cell growth.

(E) Phenotypic analysis: Metabolism-Blood chemistry / Glucose tolerance In the field of metabolism, the treatment of diabetes can be targeted. Blood chemistry phenotype analysis includes blood glucose measurements. Blood chemistry tests were performed on mice using a COBAS Integra 400 (manufacturer: Roche). In the field of metabolism, the treatment of diabetes can be targeted. Blood chemistry phenotype analysis includes a glucose tolerance test that measures changes in insulin sensitivity and glucose metabolism. Abnormal glucose tolerance test results may indicate the following disorders or conditions, but are not limited to: Type 1 and Type 2 diabetes, Syndrome X, various cardiovascular diseases and / or obesity.
Procedure: This assay used a cohort of 2 wild type mice and 4 homozygotes. The glucose tolerance test is a standard method for defining a loss of sugar homeostasis in mammals. The corresponding test was carried out using a Lifescan glucometer. Animals were injected intraperitoneally with a 20% solution of D-glucose at 2 g / kg and blood glucose levels were measured 0, 30, 60 and 90 minutes after injection. Analyzed wt / het / hom: 4/4/8
result:
(− / −) Mice showed a decrease in mean serum glucose levels compared to gender-matched (+ / +) littermates and background means. In addition, (− / −) mice showed impaired glucose tolerance compared to gender-matched (+ / +) littermates and background means.
Analyzed wt / het / hom: 4/4/8
From the above results, (− / −) mice were compared with their (+ / +) littermates of matching gender in the presence of normal fasting blood glucose at all four time points. It was found to show a decrease in sex. That is, knockout mice show a phenotypic pattern of impaired glucose homeostasis, and thus the PRO724 polypeptide (or agonist thereof) or its encoding gene can be used to treat various cardiovascular diseases including glucose homeostasis and / or diabetes. Seems to be useful.

Generation and Analysis of Mice with 35.14 DNA48331-1329 (UNQ395) Gene Disruption In these knockout experiments, a gene encoding PRO731 polypeptide (designated DNA48331-1329 (UNQ395)) was disrupted. The gene specific information for these studies is as follows: The mutated mouse gene corresponds to the following: nucleotide reference number: NM — 017378 or deposit number: NM — 017378 NID: 8393915 Protein Reference Number: O55134 or Deposit Number: O55134 NID: Musmus Cruz (mouse). Vascular cadherin2. MOUSESPTRNRDB; human gene sequence reference number: NM — 016580 or deposit number: NM — 016580 NID: 14589925 Homo sapiens homo sapiens protocadherin 12 (PCDH12); Protocadherin 12 precursor (vascular cadherin 2) (vascular endothelial cadherin 2) (VE-cadherin-2) (VE-cad-2). HUMANSPTRNRDB. Corresponding to
The mouse genes of interest are Pcdh12 (purotokadoherin 12), an ortholog of human PCDH12. Alias names are Pcdh14, VE-cad-2, VE-cadherin-2, VECAD2, protocadherin 14, and vascular endothelial cadherin-2.
PCDH12 is a type 1 membrane protein expressed in the vascular endothelium and appears to function as a cadherin family cell adhesion molecule. This protein consists of an extracellular domain containing 6 cadherin repeats, a transmembrane region, and a cytoplasmic C-terminus. Unlike vascular endothelial cadherin 1, PCDH12 does not interact with catenin and does not affect cell migration or growth. PCDH12 promotes aggregation clusters and homotypic calcium-dependent adhesion at intracellular junctions (Telo et al., J Biol Chem, 273 (28): 17565-72 (1998); Wu and Maniatis, Proc Natl Acad Sci USA, 97 (7): 3124-9 (2000)).
Targeted or gene trap mutations were generated in strain 129SvEv ^Brd -derived embryonic stem (ES) cells. Chimeric mice were crossed to C57BL / 6J albino mice to produce F1 heterozygous animals. These progeny were crossed to produce F2 wild type, heterozygous, and homozygous mutant progeny. Very occasionally, for example, when F1 mice are rarely obtained from the chimera, F1 heterozygous mice are crossed with 129SvEv ^Brd / C57 hybrid mice to generate additional heterozygous animals for cross fertilization and F2 mice. Was produced. Level 1 phenotypic analysis was performed on the mice thus produced.
wt het hom Total observation 20 40 19 79
Expected value 19.75 39.5 19.75 79
Chi-square = 0.04 Significance = 0.998119 (hom / n) = 0.24 Average number of pups = 8
Mutant: homologous recombination (standard)
Targeting coded exon 1 (NCBI deposit number NM — 0177.88.1)
Wild-type expression of the target gene was detected in all 13 adult tissue samples tested by RT-PCR except the stomach, small intestine, and large intestine.
Southern hybridization analysis confirmed target gene disruption.

35.14.1. Phenotype analysis (disrupted gene: DNA48331-1329 (UNQ395)
(A) Summary of overall phenotype:
Mutations in the gene encoding the ortholog of human protocadherin 12 (PCDH12) result in an increase in (− / −) mice, increased body weight, total tissue mass, and lean body mass, and increased bone related measurements. It has been shown. In addition, (− / −) mice showed an increase in organ weight, total body fat, and total body fat. In addition, (− / −) mice showed a reduced proportion of natural killer cells and blood eosinophils. Gene disruption was confirmed by Southern blotting.

(B) Immunological phenotypic analysis Immune-related and inflammatory diseases are in normal physiology, responding to invasion or injury, initiating repair of invasion or injury, and innate and acquired protective power against foreign organisms. Physiological pathways important for the incorporation of are very complex and multiple connected signs or consequences. A disease or condition is a condition in which these normal physiological pathways are subject to additional invasion or injury, either directly as a result of abnormal control or excessive stimulation, as a response to self, or as a combination thereof. It occurs when causing.
The origins of these diseases often involve multiple pathways and often multiple different physiological systems / pathways, and intervening in multiple of these pathways can lead to remission or therapeutic effects. Can be mentioned. Therapeutic intervention can be done by antagonizing harmful processes / pathways or stimulating beneficial processes / pathways.
T lymphocytes (T cells) are an important component of a mammalian immune response. T cells recognize antigens associated with self-molecules encoded by genes within major histocompatibility antigens (MHC). Antigens can be expressed with MHC molecules on the surface of antigen-presenting cells, virus-infected cells, cancer cells, grafts and the like. T cell lines remove degenerative cells that pose a threat to the health of the host mammal. T cells include helper T cells and cytotoxic T cells. Helper T cells proliferate on a large scale when they recognize antigen-MHC complexes on antigen-presenting cells. Helper T cells also secrete various cytokines, lymphokines, which play a central role in the activity of B cells, cytotoxic T cells and various other cells that participate in the immune response.
In many immune responses, inflammatory cells infiltrate the site of injury or infection. Migrating cells are neutrophils, eosinophils, monocytes or lymphocytes, which can be determined by histological examination of the affected tissue. Current Protocols in Immunology, ed John E. Coligan, 1994 John Wiley & Sons, Inc.
Many immune related diseases are known and have been extensively studied. Such diseases include immune-mediated inflammatory diseases (eg rheumatoid arthritis, immune-mediated renal disease, hepatobiliary disease, inflammatory bowel disease (IBD), psoriasis, and asthma), non-immune-mediated inflammatory diseases , Infections, immunodeficiency diseases, tumors, and transplant rejections. In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified.
In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified. Immune related diseases can be treated in one example by suppressing the immune response. The use of neutralizing antibodies that suppress molecules with immunostimulatory activity is beneficial for the treatment of immune-mediated and inflammatory diseases. Molecules that suppress immune responses (proteins directly or using antibody agonists) can be used to suppress immune responses and thus ameliorate immune-related diseases.

Fluorescence activated cell sorting (FACS) analysis Procedure:
FACS analysis of peripheral blood immune cell composition containing CD4, CD8 and T cell receptors was performed to evaluate natural killer cell leukocyte markers and TNK as panNK, CD19 and CD45 of B lymphocytes. FACS analysis was performed on 2 wild type mice and 6 homozygous mice, including cells obtained from thymus, spleen, bone marrow and lymph nodes.
In these studies, cells to be analyzed were isolated from thymus, peripheral blood, spleen, bone marrow and lymph nodes. Flow cytometry was designed to determine the relative proportion of CD4 and CD8 positive T cells, B cells, NK cells and monocytes in the mononuclear cell population. For phenotypic analysis and screening, this machine records the number of CD4 + / CD8-, CD8 + / CD4-, NK, B cells and monocytes in addition to the CD4 + / CD8 + ratio. Mononuclear cell profiles were obtained by staining a single sample of lysed peripheral blood from each mouse with a set of 6 lineage specific antibodies: CD45 PerCP, anti-TCRb APC, CD4 PE, CD8 FITC , Pan-NK PE, and CD19 FITC. Two antibodies labeled with FITC and PE stained mutually exclusive cell types. The samples were analyzed with CellQuest software using a Becton Dickinson FACSCalibur flow cytometer.
result:
FACS: (− / −) mice showed a reduction in the average proportion of natural killer cells and blood eosinophils when compared to their (+ / +) littermates and background means. Analyzed wt / het / hom: 7/4/8
In summary, FACS results indicate that homozygous mutant mice are immune systems, especially in terms of a reduction in the average proportion of natural killer cells that exhibit a negative phenotype associated with knockout of the DNA48331-1329 gene encoding PRO731 polypeptide. Has been shown to have deficiencies. Natural killer cells are cells that are linked to viral immunity and protection against tumors and are therefore the first line of defense against viral infections. Natural killer cells or NK cells have been identified by their ability to act as effectors of antibody-dependent cell-mediated cytotoxicity and kill specific lymphoid tumor cell lines in vitro without the need for prior immunization or activation. However, its known function in host defense is one that works early in the infection of multiple intracellular pathogens, particularly herpes viruses. Thus, PRO731 polypeptides and agonists thereof are important for a healthy immune system, and appear to be useful for stimulating the immune system, particularly during viral infections.

(C) Bone metabolism and physical diagnosis (1) Measurement of tissue mass and lean body mass-Dexa
Dexa Analysis-Test Description Procedure: In this assay, a cohort of 4 wild type, 4 heterozygotes and 8 homozygotes was tested. Dual energy X-ray absorption (DEXA) was successfully used to identify changes in total tissue mass (TTM).
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Body measurements (body length and body weight): Body length and body weight were measured at about 16 weeks of age.
result:
(− / −) Mice showed an increase in average body weight compared to gender matched (+ / +) littermates and background means. Organ weight also increased significantly. Analyzed wt / het / hom: 28/58/33
Pathology: Microscopic observation revealed apoptosis of olfactory neuroepithelial cells in 3 out of 6 (-/-) mice and 1 out of 2 (+ / +) mice.
Gene expression: LacZ activity was not detected in a set of tissues by immunohistochemical analysis. Analyzed wt / het / hom: 4/2/13

(2) Bone metabolism: radiological phenotype analysis In the area of bone metabolism, targets are identified here for the treatment of arthritis, osteoporosis, osteopenia and marble bone disease, and targets that promote fracture healing Identified. The exam includes:
DEXA for measuring bone mineral density in the femur and vertebra
• Micro CT for very high resolution and very sensitive measurement of bone mineral content in both trabecular and cortical bone.
Dexa Analysis-Test Method Description Procedure: A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. Dual energy X-ray absorption measurement (DEXA) was successfully used to identify changes in bone. Anesthetized animals were examined and bone mineral density (BMC), BMC / LBM ratio, volumetric bone density (vBMD), whole body BMD, femoral BMD and vertebra BMD were measured.
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Bone micro CT analysis Procedure: Micro CT was also used to perform very sensitive BMD measurements. One vertebra and one thigh were removed from a cohort of 4 wild type and 8 homozygous mice. Measurements were taken of the five vertebral traebecular volumes, traebecular thickness, bond density, and total bone area and cortical thickness of the mid-thigh. A micro CT40 scan provided detailed information on bone mass and structure. Multiple bones were placed in the sample holder and scanned automatically. Instrument software was used to select areas of interest for analysis. Trabecular parameters were analyzed in the 5th lumbar vertebra (LV5) with 16 micrometer resolution, and cortical bone parameters were analyzed in the mid-femoral axis with 20 micrometer resolution.
result:
DEXA: In (− / −) mice, mean total tissue volume, lean body mass, whole body bone density, and volumetric bone when compared to (+ / +) littermates and background means of matching gender An increase in density was shown. In addition, (− / −) mice showed an increase in average total fat percentage and total fat volume.
Micro-CT analysis: In (− / −) mice, when compared to gender-matched (+ / +) littermates and background means, the mean spine vertebral trabecula volume, number, and increased connection density; An increase in mean cortical thickness and cross-sectional area of the femoral midaxis was shown.
Analytical value wt / het / hom: 4/4/8.
In summary, (− / −) mice have gained weight, increased body fat, increased mean lean body mass, increased bone mineral density, and systemic body weight compared to (+ / +) littermates of matched gender. And increased bone density in the femur. The observed increase in body weight, body fat, and average lean body mass in (− / −) mutant mice suggests an obese phenotype. Such data suggests that the DNA48331-1329 gene encoding the PRO731 polypeptide plays a role in negatively controlling proliferation and growth (cell / organ size) and is important for cell survival. . In addition, abnormal bone measurements indicated that the knockout mutant phenotype is involved in bone abnormalities such as marble osteopathy. Marble bone disease is a condition characterized by abnormal thickening and hardening of the bone and abnormal fragility of the bone. Thus, the PRO731 polypeptide or agonist thereof may be effective in the treatment of marble bone disease or other bone diseases. On the other hand, inhibitors or antagonists of PRO731 polypeptides appear to be useful for bone healing.

Generation and Analysis of Mice with 35.15 DNA48334-1435 (UNQ396) Gene Disruption In these knockout experiments, the gene encoding PRO732 polypeptide (designated DNA48334-1435 (UNQ396)) was disrupted. The gene-specific information for these studies is as follows: The mutated mouse gene corresponds to: nucleotide reference number: NM_019760 or deposit number: NM_019760 NID: gi 9790268 reference number NM_019760.1 Differences Expressed Musmus Cruz tumor 1 (Tdel1); protein reference number: Q9QZI8 or deposit number: Q9QZI8 NID: Musmus Cruz (mouse). Differentially expressed tumor 1 protein-like (membrane protein TMS-2). MOUSESPTRNRDB; human gene sequence reference number: NM — 020755 or accession number: NM — 020755 NID: gi 24308212 reference number NM — 0207555.1 Probably a differential utterance-like mouse tumor ortholog of homosapiens (TDE1L); human protein sequence is reference number Q9NRX5 or Deposit number: Q9NRX5 NID: Homo sapiens (human). Differentially expressed tumor 1 protein-like. HUMANSPTRNRDB. Corresponding to
The target mouse genes are Tde2 (differentially expressed tumor 2), an ortholog of human TDE2. Other names are Tms2, TMS-2, Tde11, AIGP2, membrane protein TMS-2, and differentially expressed tumor 1 like. TDE2 is a hypothetical complex plasma membrane expressed in neurons of the central nervous system (Grossman et al., J Exp Biol 203 Pt 3: 447-57 (2000)) and other tissues such as bladder, kidney, and muscle. It is a protein (Player et al., Int J Cancer, 107 (2): 238-43 (2003)). This protein consists of multiple transmembrane regions contained within the “TMS membrane protein / differentially expressed oncoprotein (TDE)” domain. This domain is found in several other proteins and consists of a family that is differentially expressed in various tumors and cell lines (Pfam accession number PF03348). For example, TDE2 tends to be expressed more strongly in non-small cell lung cancer than adjacent normal tissue. In contrast, TDE2 expression in lung tumors tends to be weaker than adjacent non-malignant organ branching epithelia (Player et al., Int J Cancer, 107 (2): 238-43 (2003)). The function of this protein is unknown.
Genetic information:
wt het hom Total observation 13 32 9 54
Expected value 13.5 27 13.5 54
Chi-square = 2.44 Significance = 0.29457 (hom / n) = 0.17 Average number of pups = 6
Mutant: Retrovirus insertion (OST)
A retrovirus was inserted into the intron between encoded exons 1 and 2 (NCBI accession number NM_019760.1)
Wild-type expression of the target gene was detected in all 13 adult tissue samples tested by RT-PCR except bone.
RT-PCR analysis revealed that the analyzed (− / −) mouse (M-133) had no transcription. The destruction of the target gene was confirmed by inverse PCR.

35.15.1. Phenotype analysis (disrupted gene: DNA48334-1435 (UNQ396)
(A) Summary of overall phenotype:
Mutations in the gene encoding the ortholog of human differentially expressed tumor 2 (TDE2) caused growth retardation and bone abnormalities (decrease in bone measurements) in (− / −) mice. In addition, (− / −) mice showed an increase in average serum glucose levels and impaired glucose tolerance. In addition, the open field test was found to increase the activity of mutant (− / −) mice during the open field test. As a result of RT-PCR, there was no transcription.

(B) Bone metabolism and physical diagnosis (1) Measurement of tissue mass and lean body mass-Dexa
Dexa Analysis-Test Description Procedure: In this assay, a cohort of 4 wild type, 4 heterozygotes and 8 homozygotes was tested. Dual energy X-ray absorption (DEXA) was successfully used to identify changes in total tissue mass (TTM).
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Body measurements (body length and body weight): Body length and body weight were measured at about 16 weeks of age.
result:
(− / −) Mice showed a decrease in mean body weight and mean body length compared to gender-matched (+ / +) littermates and background means. The difference was noticeable for males. Analyzed wt / het / hom: 20/45/10
Pathology / microscopy: Hydrocephalus was seen in several (− / −) mice used for analysis.
Gene expression: LacZ activity was not detected in a set of tissues by immunohistochemical analysis. Analyzed wt / het / hom: 2/2/6
(2) Bone metabolism: radiological phenotype analysis In the area of bone metabolism, targets are identified here for the treatment of arthritis, osteoporosis, osteopenia and marble bone disease, and targets that promote fracture healing Identified. The exam includes:
DEXA for measuring bone mineral density in the femur and vertebra
• Micro CT for very high resolution and very sensitive measurement of bone mineral content in both trabecular and cortical bone.
Dexa Analysis-Test Method Description Procedure: A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. Dual energy X-ray absorption measurement (DEXA) was successfully used to identify changes in bone. Anesthetized animals were examined and bone mineral density (BMC), BMC / LBM ratio, volumetric bone density (vBMD), whole body BMD, femoral BMD and vertebra BMD were measured.
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Bone micro CT analysis Procedure: Micro CT was also used to perform very sensitive BMD measurements. One vertebra and one thigh were removed from a cohort of 4 wild type and 8 homozygous mice. Measurements were taken of the five vertebral traebecular volumes, traebecular thickness, bond density, and total bone area and cortical thickness of the mid-thigh. A micro CT40 scan provided detailed information on bone mass and structure. Multiple bones were placed in the sample holder and scanned automatically. Instrument software was used to select areas of interest for analysis. Trabecular parameters were analyzed in the 5th lumbar vertebra (LV5) with 16 micrometer resolution, and cortical bone parameters were analyzed in the mid-femoral axis with 20 micrometer resolution.
result:
DEXA: (− / −) mice showed a decrease in mean total tissue volume and lean body mass when compared to (+ / +) littermates with matched gender and background means. These mutant animals also showed a decrease in measurements related to average bone mineral density and bone density.
Micro-CT analysis: In (− / −) mice, the volume, number, thickness, and connectivity density of the average spinal vertebral trabecula were reduced when compared to gender-matched (+ / +) littermates and background means As well as a reduction in mean femoral midshaft cortical thickness.
Analytical value wt / het / hom: 4/4/8.
Summary:
These results indicate that knockout mutant mice exhibit abnormal bone metabolism with significant bone loss similar to osteoporosis, characterized by bone loss with reduced density and possibly fragility leading to fractures. found. Therefore, PRO732 polypeptide or an agonist thereof is considered to function to maintain bone homeostasis. In addition, PRO732 or its encoding gene may be useful for maintaining bone homeostasis and bone healing, or for treating arthropathy or osteoporosis. On the other hand, an antagonist of PRO732 or its encoding gene is thought to cause abnormal or pathological bone disorders including inflammatory diseases related to abnormal bone metabolism including arthritis, osteoporosis and osteopenia.
(− / −) Mice analyzed by DEXA showed a marked decrease in total tissue mass and lean body mass when compared to their (+ / +) littermates. This suggests that growth delay occurred in these mutants. This combined with the appearance of abnormal bone measurements suggests tissue wasting such as cachexia or other growth-related disorders. Thus, PRO732 polypeptides or agonists thereof may not only be useful for the treatment of bone disorders, but may be useful for the prevention of growth related disorders such as cachexia and / or other tissue wasting disease depletion.

(C) Phenotypic analysis: Metabolism-Blood chemistry / Glucose tolerance In the field of metabolism, the treatment of diabetes can be targeted. Blood chemistry phenotype analysis includes blood glucose measurements. Blood chemistry tests were performed on mice using a COBAS Integra 400 (manufacturer: Roche). In the field of metabolism, the treatment of diabetes can be targeted. Blood chemistry phenotype analysis includes a glucose tolerance test that measures changes in insulin sensitivity and glucose metabolism. Abnormal glucose tolerance test results may indicate the following disorders or conditions, but are not limited to: Type 1 and Type 2 diabetes, Syndrome X, various cardiovascular diseases and / or obesity.
Procedure: This assay used a cohort of 2 wild type mice and 4 homozygotes. The glucose tolerance test is a standard method for defining a loss of sugar homeostasis in mammals. The corresponding test was carried out using a Lifescan glucometer. Animals were injected intraperitoneally with a 20% solution of D-glucose at 2 g / kg and blood glucose levels were measured 0, 30, 60 and 90 minutes after injection.
result:
Blood chemistry: (-/-) mice showed an increase in mean serum glucose levels compared to gender-matched (+ / +) littermates and background means. In the glucose tolerance test: 4 (− / −) mice were analyzed and 2 (M-157 and M-167) were compared to (+ / +) litters with matched gender and background means. Showed an increase in fasting serum glucose levels. Analyzed wt / het / hom: 4/5/8
From the above studies, (− / −) mice were glucose-resistant in the presence of normal fasting blood glucose at all four time points when compared to their (+ / +) littermates of matching gender. It was found to show a decrease in sex. That is, knockout mice show a phenotypic pattern of impaired glucose homeostasis, and thus PRO732 polypeptide (or an agonist thereof) or its encoding gene appears to be useful for the treatment of impaired glucose homeostasis.

(D) Phenotypic analysis: CNS / neurology In the field of neurology, the analysis here is depression, generalized anxiety disorder, attention deficit hyperactivity disorder, obsessive compulsive disorder, schizophrenia, cognitive impairment, hyperalgesia And focused on identifying targets that have been validated in vivo for the treatment of neurological and psychiatric disorders, including sensory organ disorders. Neurological disorders include a category defined as “anxiety disorders” including, but not limited to, mild to moderate anxiety, anxiety disorders due to general medical conditions, and unspecified anxiety disorders Generalized anxiety disorder, panic attack, panic disorder with agoraphobia, panic disorder without agoraphobia, post-traumatic stress syndrome, social phobia, specific phobias, substance-induced anxiety disorder, acute alcohol withdrawal , Obsessive-compulsive disorder, agoraphobia, bipolar disorder I or II, bipolar disorder not otherwise specified, circulatory temperament disease, depressive disorder, major depressive disorder, mood disorder, substance-induced mood disorder . In addition, anxiety disorders can be applied to personality disorders including, but not limited to, the following types: paranoid, antisocial, avoidance behavior, borderline personality disorder, addiction, acting, self-loving , Obsessive, schizophrenic, and schizophrenic.
procedure:
Behavioral screening was performed on a cohort consisting of 4 wild type, 4 heterozygotes and 8 homozygous mutant mice. All behavioral tests were performed between 12 and 16 weeks of age, as long as the time of the test had to be accelerated due to reduced survival. These trials included open field trials to measure anxiety, activity level and exploration.
Open field test:
Some targets of known drugs showed phenotype in open field tests. These include seratonin transporters, dopamine transporters (Giros et al., Nature. 1996 Feb 15; 379 (6566): 606-12), and GABA receptors (Homanics et al., Proc Natl Acad Sci US A. 1997 Apr 15; 94 ( 8): Including 4143-8) knockout. An automated open field assay was customized to handle changes in emotional state and changes in search patterns for learning. First, the field (40 × 40 cm) was selected to be relatively large relative to the mouse, thus taking up changes in locomotion associated with the search. There are also four holes in the floor that allow you to poke the nose, an activity that is particularly relevant to exploration. Several factors were also designed to enhance the emotional state associated with this trial. The open field test was the first experimental procedure in which mice were tested, and the measurements made were the first experience with the subject's chambers. The open field was brightly lit. All of these factors increase the natural anxiety associated with new and open spaces. The pattern and degree of exploration activity, in particular the total distance traveled from the center, can then identify changes in susceptibility to anxiety or depression. A large active area (40 cm × 40 cm, AccuScan Instruments VersaMax animal activity monitor system) using infrared beams at three different levels was used to record standing, nasal pricking into the hole, and locomotor activity. The animal was placed in the center and its activity was measured for 20 minutes. Data from this test was analyzed 5 times at 4 minute intervals. The total distance traveled (cm), the number of vertical movements (rise), the number of hole penetrations, and the total distance traveled from the center were recorded.
The tendency of mice to show a normal habituation response to the new environment was assessed by determining the total change in their horizontal locomotor activity over 5 time intervals. This calculated slope of change in activity over time was determined using the total travel distance normalized to the absolute value. The slope was determined from a regression line through normalized activity in each of the five time intervals. Normal habit effects are represented by negative slope values. Analyzed wt / het / hom: 5/4/8
result:
(− / −) Mice showed a decrease in median total time in the central area during the open field test when compared to (+ / +) littermates of matching gender. This indicates an increased anxiety-like response in the variant. As noted above, significant differences were observed during the open field test. (− / −) Mice showed a decrease in median total time in the central region when compared to (+ / +) littermates of matching gender. This type of behavior is consistent with an increased anxiety-like response. Thus, knockout mice have mild to moderate anxiety, generalized medical anxiety and / or bipolar disorder; hyperactivity; sensory disturbances; obsessive compulsive disorder, schizophrenia or paranoid personality Showed a phenotype consistent with. Thus, PRO732 polypeptides or agonists thereof would be useful for treating such neurological disorders or ameliorating symptoms associated with anxiety disorders.

Generation and Analysis of Mice with 35.16 DNA58844-1409 (UNQ487) Gene Disruption In these knockout experiments, the gene encoding PRO1003 polypeptide (designated DNA58846-1409 (UNQ487)) was disrupted. The gene-specific information for these studies is as follows: The mutated mouse gene corresponds to: nucleotide reference number: NM_032541 or deposit number: NM_032541 NID: gi 14211541 reference number NM_032541.1 Musmus Cruz Hepcidin antibacterial peptide (Hamp); protein reference number: Q9EQ21 or deposit number: Q9EQ21 NID: Musmus Cruz (mouse). Prohepcidin (hepcidin antibacterial peptide). MOUSESPTRNRDB; human gene sequence reference number: NM_021175 or deposit number: NM_021175 NID: gi 10863972 reference number NM_021175.1 homosapiens hepcidin antibacterial peptide (HAMP); human protein sequence is reference number P81172 or deposit number: P81172 NID: homosapiens Human). Antimicrobial peptide hepcidin precursor (liver expressed antimicrobial peptide) (LEAP-1) (virtual liver tumor regressor) (PLTR) [including hepcidin 25 (HEPC25); hepcidin 20 (HEPC20)]. Corresponds to HUMANSPTRNRDB.
The disrupted mouse gene is hepcidin antibacterial peptide (Hamp), an ortholog of human HAMP. Alias names include HEPC1, HEPC, HFE2, LEAP1, LEAP-1, and liver-expressed antimicrobial peptides.
HAMP is a protein secreted mainly from the liver and functions as a mediator of iron-regulated hormones and innate immunity. The 84 amino acid protein contains a 25 amino acid hepcidin core, propeptide, and signal peptide at the C-terminus. The positively charged hydrophilic residue and the hydrophilic residue of the mature 25 amino acid hepcidin core peptide are spatially separated, allowing the peptide to disrupt the bacterial membrane (Ganz Tomas., Blood, 102 (3): 783-8 (2003)).
HAMP is involved in iron homeostasis. Increasing iron loading increases HAMP expression, resulting in decreased dietary iron absorption, transplacental iron transport, and iron movement from spleen and liver macrophages. Mutations in the HAMP gene cause juvenile hereditary hemochromatosis, which can lead to iron overload, cirrhosis, cardiomyopathy, arthritis and endocrine failure. HAMP has strong antibacterial activity against bacteria and some fungi. However, individuals lacking active HAMP still have the ability to prevent infection, suggesting that the role of HAMP as an antibacterial agent is not critical (Roetto et al., Nat Genet, 33 (1) : 21-2 (2003)). Inflammation upregulates HAMP and in some cases causes iron damage and anemia against inflammatory diseases, osteoarthritis, and malignant tumors (Ganz Tomas, Blood, 102 (3): 783-8 (2003)) .
Proc Natl Acad Sci USA, 98 (15): 8780-5 (2001) by Nicolas and co-researchers described that mice lacking HAMP (generated by knockout of transcription factor genes that control HAMP expression) Causes visceral iron overload. In mouse models of hemochromatosis, Nicolas and collaborators Nat Genet, 34 (1): 97-101 (2003) suppresses iron accumulation normally occurring in such mice by overexpression of HAMP. It has been shown. Among wild-type mice, Proc Natl Acad Sci USA, 99 (7): 4596-601 (2002) by Nicolas and collaborators, showed mice with pale white skin that died in the first few hours of life due to overexpression of HAMP. It has been shown to be born. These animals had low body iron levels and had severe microcytic hypochromic anemia.
Targeted or gene trap mutations were generated in strain 129SvEv ^Brd -derived embryonic stem (ES) cells. Chimeric mice were crossed to C57BL / 6J albino mice to produce F1 heterozygous animals. These progeny were crossed to produce F2 wild type, heterozygous, and homozygous mutant progeny. Very occasionally, for example, when F1 mice are rarely obtained from the chimera, F1 heterozygous mice are crossed with 129SvEv ^Brd / C57 hybrid mice to generate additional heterozygous animals for cross fertilization and F2 mice. Was produced. Level 1 phenotypic analysis was performed on the mice thus produced.
wt het hom Total observation 20 33 24 77
Expected value 19.25 38.5 19.25 77
Chi-square = 1.99 Significance = 0.37028 (hom / n) = 0.31 Average number of pups = 8
Mutant: homologous recombination (standard)
Targeted encoded exons 1 and 2 (NCBI accession number NM_032541.1)
Wild-type expression of the target gene was detected in all 13 adult tissue samples except liver, heart and fat, as well as embryonic stem (ES) cells tested by RT-PCR. Southern hybridization analysis confirmed target gene disruption.

35.16.1. Phenotypic analysis (disrupted gene: DNA58846-1409 (UNQ487)
(A) Summary of overall phenotype:
Mutation of the gene encoding the ortholog of human hepcidin antibacterial peptide (HAMP) enhanced glucose tolerance in (− / −) mice. Knockout (− / −) mice also showed an increase in serum uric acid levels. Gene disruption was confirmed by Southern blotting.

(B) Phenotypic analysis: Metabolism-Blood chemistry / Glucose tolerance In the field of metabolism, the treatment of diabetes can be targeted. Blood chemistry phenotype analysis includes blood glucose measurements. Blood chemistry tests were performed on mice using a COBAS Integra 400 (manufacturer: Roche). In the field of metabolism, the treatment of diabetes can be targeted. Blood chemistry phenotype analysis includes a glucose tolerance test that measures changes in insulin sensitivity and glucose metabolism. Abnormal glucose tolerance test results may indicate the following disorders or conditions, but are not limited to: Type 1 and Type 2 diabetes, Syndrome X, various cardiovascular diseases and / or obesity.
Procedure: This assay used a cohort of 2 wild type mice and 4 homozygotes. The glucose tolerance test is a standard method for defining a loss of sugar homeostasis in mammals. The corresponding test was carried out using a Lifescan glucometer. Animals were injected intraperitoneally with a 20% solution of D-glucose at 2 g / kg and blood glucose levels were measured 0, 30, 60 and 90 minutes after injection. Analyzed wt / het / hom: 4/4/9
result:
(− / −) Mice showed enhanced glucose tolerance and a significant decrease in mean serum glucose compared to gender-matched (+ / +) littermates and background means. That is, the knockout mice showed an expression pattern opposite to that of glucose homeostasis. From this observation, PRO1003 or its encoding gene appears to be useful for the treatment of glucose homeostasis and / or any metabolic failure associated therewith. In addition, knockout mutant (− / −) mice showed increased serum uric acid levels (greater than 2D above the background average). However, there was no other indication of kidney damage.

Generation and Analysis of Mice with 35.17 DNA59616-1465 (UNQ547) Gene Disruption In these knockout experiments, the gene encoding PRO1104 polypeptide (designated as DNA59616-1465 (UNQ547)) was disrupted. The gene specific information for these studies is as follows: Mutated mouse genes correspond to: Nucleotide reference number: NM — 131066 or Muskulus, similar to hypothetical protein FLJ20519 (LOC29588); protein reference number : Similar to XP — 131066 or hypothetical protein FLJ20519 [Musmus crurus]; human gene sequence reference number: NM — 018860 or homosapiens hypothetical protein FLJ20519 (FLJ20519); human protein sequence corresponds to reference number NP — 060330 or hypothetical protein FLJ20519 [homosapiens] To do.
The disrupted mouse gene is a hypothetical protein (provisional name, LOC229588), which is orthologous to the human hypothetical protein FLJ20519.
Bioinformatic analysis has predicted a signal peptide-like region at the N-terminus. Overall, this protein is expected to be secreted or located in the plasma membrane.
Genetic information:
wt het hom Total observations 8 19 20 47
Expected value 11.75 23.5 11.75 47
Chi-square = 7.85 Significance = 0.01973 (hom / n) = 0.43 Average number of pups = 7
Mutant: Retrovirus insertion (OST)
A retrovirus was inserted into the first encoded exon (deposit number: XM — 131066).
When tested by RT-PCR, wild-type expression of the target gene was detected in lung embryonic stem (ES) cells and 13 adult tissue samples in the spinal cord, eye, thymus and lung.
RT-PCR analysis revealed that the analyzed (− / −) mice (M-104) had no transcription. The destruction of the target gene was confirmed by inverse PCR.

35.17.1. Phenotype analysis (disrupted gene: DNA59616-1465 (UNQ547)
(A) Summary of overall phenotype:
Mutations in the gene encoding the orthologue of human hypothetical protein (FLJ2519) increased body weight and body length measurements, as well as body weight and femur measurements. Ovalbumin (OVA) challenge reduced the anti-OVA titer in homozygous knockout mice. In addition, (− / −) mice showed enhanced glucose tolerance compared to their wild-type littermates. As a result of RT-PCR, there was no transcription.

(B) Immunological phenotypic analysis Immune-related and inflammatory diseases are in normal physiology, responding to invasion or injury, initiating repair of invasion or injury, and innate and acquired protective power against foreign organisms. Physiological pathways important for the incorporation of are very complex and multiple connected signs or consequences. A disease or condition is a condition in which these normal physiological pathways are subject to additional invasion or injury, either directly as a result of abnormal control or excessive stimulation, as a response to self, or as a combination thereof. It occurs when causing.
The origins of these diseases often involve multiple pathways and often multiple different physiological systems / pathways, and intervening in multiple of these pathways can lead to remission or therapeutic effects. Can be mentioned. Therapeutic intervention can be done by antagonizing harmful processes / pathways or stimulating beneficial processes / pathways.
T lymphocytes (T cells) are an important component of a mammalian immune response. T cells recognize antigens associated with self-molecules encoded by genes within major histocompatibility antigens (MHC). Antigens can be expressed with MHC molecules on the surface of antigen-presenting cells, virus-infected cells, cancer cells, grafts and the like. T cell lines remove degenerative cells that pose a threat to the health of the host mammal. T cells include helper T cells and cytotoxic T cells. Helper T cells proliferate on a large scale when they recognize antigen-MHC complexes on antigen-presenting cells. Helper T cells also secrete various cytokines, lymphokines, which play a central role in the activity of B cells, cytotoxic T cells and various other cells that participate in the immune response.
In many immune responses, inflammatory cells infiltrate the site of injury or infection. Migrating cells are neutrophils, eosinophils, monocytes or lymphocytes, which can be determined by histological examination of the affected tissue. Current Protocols in Immunology, ed John E. Coligan, 1994 John Wiley & Sons, Inc.
Many immune related diseases are known and have been extensively studied. Such diseases include immune-mediated inflammatory diseases (eg rheumatoid arthritis, immune-mediated renal disease, hepatobiliary disease, inflammatory bowel disease (IBD), psoriasis, and asthma), non-immune-mediated inflammatory diseases , Infections, immunodeficiency diseases, tumors, and transplant rejections. In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified.
In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified. Immune related diseases can be treated in one example by suppressing the immune response. The use of neutralizing antibodies that suppress molecules with immunostimulatory activity is beneficial for the treatment of immune-mediated and inflammatory diseases. Molecules that suppress immune responses (proteins directly or using antibody agonists) can be used to suppress immune responses and thus ameliorate immune-related diseases.

The following tests were conducted.
Ovalbumin challenge:
Procedure: The assay was performed on 7 wild type and 8 homozygotes. Chicken ovalbumin (OVA) is a T cell-dependent antigen and is a model protein widely used for studying antigen-specific immune responses in mice. OVA is non-toxic and inert and therefore does not harm animals if an immune response is not elicited. The characteristics of the mouse immune response to OVA are already largely elucidated, and immunodominant peptides have been identified that elicit T cell responses. Anti-OVA antibodies can be detected 8-10 days after immunization using an enzyme-linked immunosorbent assay (ELIZA), and the determination of the different isotypes of the antibody results in a complex process that leads to poor response in genetically modified mice New information can be obtained.
As described above, this protocol evaluates the ability of mice to raise an antigen-specific immune response. The animals were injected intraperitoneally with 50 mg chicken ovalbumin emulsified in Freund's complete adjuvant, and the serum titer of anti-ovalbumin antibodies (IgM, IgG1 and IgG2 subclass) was measured 14 days later. The amount of OVA-specific antibody contained in the serum sample was proportional to the absorbance (OD) value generated by the instrument scanning the 96-well sample plate. Data was collected for each set of serum samples with varying degrees of dilution.
Analyzed wt / het / hom: 7/4/8
Results of this antigen administration:
(− / −) Mice showed a decrease in mean serum IgG2a response to ovalbumin challenge compared to their (+ / +) pups. That is, these knockout mice showed reduced ability of OVA-specific antibodies to respond to T cell-dependent OVA antigens, presumably due to Th cell loss. Thus, PRO1104 polypeptides or agonists thereof are expected to stimulate the immune system, and this effect is likely to be effective in individuals such as leukemia and other types of cancer, and immunocompromised patients such as AIDS patients. Seems useful in some cases. Thus, inhibitors or antagonists of PRO1104 polypeptides are valuable candidates for suppressing adverse immune responses, for example in the case of graft rejection or graft-versus-host disease.

(C) Bone metabolism and physical diagnosis (1) Measurement of tissue mass and lean body mass-Dexa
Dexa Analysis-Test Description Procedure: In this assay, a cohort of 4 wild type, 4 heterozygotes and 8 homozygotes was tested. Dual energy X-ray absorption (DEXA) was successfully used to identify changes in total tissue mass (TTM).
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Body measurements (body length and body weight): Body length and body weight were measured at about 16 weeks of age.
result:
(− / −) Mice showed an increase in average body weight and an increase in average body length compared to gender-matched (+ / +) littermates and background means (at least one (1) standard deviation was Greater than controls less than 8 weeks old). Analyzed wt / het / hom: 15/22/16
(2) Bone metabolism: radiological phenotype analysis In the area of bone metabolism, targets are identified here for the treatment of arthritis, osteoporosis, osteopenia and marble bone disease, and targets that promote fracture healing Identified. The exam includes:
DEXA for measuring bone mineral density in the femur and vertebra
• Micro CT for very high resolution and very sensitive measurement of bone mineral content in both trabecular and cortical bone.
Dexa Analysis-Test Method Description Procedure: A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. Dual energy X-ray absorption measurement (DEXA) was successfully used to identify changes in bone. Anesthetized animals were examined and bone mineral density (BMC), BMC / LBM ratio, volumetric bone density (vBMD), whole body BMD, femoral BMD and vertebra BMD were measured.
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Bone micro CT analysis Procedure: Micro CT was also used to perform very sensitive BMD measurements. One vertebra and one thigh were removed from a cohort of 4 wild type and 8 homozygous mice. Measurements were taken of the five vertebral traebecular volumes, traebecular thickness, bond density, and total bone area and cortical thickness of the mid-thigh. A micro CT40 scan provided detailed information on bone mass and structure. Multiple bones were placed in the sample holder and scanned automatically. Instrument software was used to select areas of interest for analysis. Trabecular parameters were analyzed in the 5th lumbar vertebra (LV5) with 16 micrometer resolution, and cortical bone parameters were analyzed in the mid-femoral axis with 20 micrometer resolution.
result:
DEXA: (− / −) mice showed an increase in mean total tissue volume and lean body mass when compared to gender-matched (+ / +) littermates and background means.
Micro-CT analysis: (− / −) mice showed an increase in mean femoral mid-axis cross-sectional area when compared to gender-matched (+ / +) littermates and background means.
Analytical value wt / het / hom: 4/4/8.
In summary, (− / −) mice have increased body weight and length, average total tissue volume and lean body mass, and bone cross-sectional area measurements compared to (+ / +) littermates of matched gender. The value increased. These observations suggest obesity and / or growth failure phenotypes. In addition, mutant (− / −) mice showed abnormal bone development. Thus, PRO1104 polypeptides or agonists thereof are useful for normal growth and bone development and are thought to function in the treatment of growth or metabolic disorders associated with obesity and / or bone disorders. In addition, PRO1104 or its encoding gene may be useful for bone healing, or for the treatment of osteoarthritis or osteoporosis.

(D) Phenotypic analysis: Metabolism-Blood chemistry / Glucose tolerance In the field of metabolism, the treatment of diabetes can be targeted. Blood chemistry phenotype analysis includes blood glucose measurements. Blood chemistry tests were performed on mice using a COBAS Integra 400 (manufacturer: Roche). In the field of metabolism, the treatment of diabetes can be targeted. Blood chemistry phenotype analysis includes a glucose tolerance test that measures changes in insulin sensitivity and glucose metabolism. Abnormal glucose tolerance test results may indicate the following disorders or conditions, but are not limited to: Type 1 and Type 2 diabetes, Syndrome X, various cardiovascular diseases and / or obesity.
Procedure: This assay used a cohort of 2 wild type mice and 4 homozygotes. The glucose tolerance test is a standard method for defining a loss of sugar homeostasis in mammals. The corresponding test was carried out using a Lifescan glucometer. Animals were injected intraperitoneally with a 20% solution of D-glucose at 2 g / kg and blood glucose levels were measured 0, 30, 60 and 90 minutes after injection. Analyzed wt / het / hom: 4/4/9
result:
(− / −) Mice showed enhanced glucose tolerance and a significant decrease in mean serum glucose compared to gender-matched (+ / +) littermates and background means. That is, the knockout mice showed an expression pattern opposite to that of glucose homeostasis. From this observation, the PRO1104 polypeptide or its encoding gene appears to be useful in the treatment of glucose homeostasis and / or any metabolic disorders associated therewith.

Generation and Analysis of Mice with 35.18 DNA44694-1500 (UNQ581) Gene Disruption In these knockout experiments, the gene encoding PRO1151 polypeptide (designated as DNA44694-1500 (UNQ581)) was disrupted. The gene-specific information for these studies is as follows: The mutated mouse gene corresponds to the following: nucleotide reference number: NM — 028331 or Musmus Cruz C1q and tumor necrosis factor associated protein 6 (C1qtnf6); protein Reference number: Q8BKR0 or deposit number: Q8BKR0 NID: Musmus Cruz (mouse). Slightly similar to complement C1Q tumor necrosis factor-related protein; human gene sequence reference number: NM — 031910 or homosapiens C1q and tumor necrosis factor-related protein 6 (C1QTNF6), transcript variant 1; human protein sequence is reference number: NP — 114116 Or C1q and tumor necrosis factor-related protein 6; complement-c1q tumor necrosis factor-related protein 6 [Homo sapiens] gi 32967300 Reference number NP_872292.1 C1q and tumor necrosis factor-related protein 6; complement-c1q tumor necrosis factor-related protein 6 [Homo sapiens] corresponds to gi 132745331 gb AAK17966.1 complement-c1q tumor necrosis factor related protein [Homo sapiens].
The mouse genes of interest are C1qtnf6 (C1q and tumor necrosis factor-related protein 6), an ortholog of human C1QTNF6. Alias names include CTRP6, ZACRP6, and complement-c1q tumor necrosis factor-related protein 6.
C1QTNF6 is a putative secreted protein that contains a signal peptide, a collagen triple helix repeat, and a “complement composition C1q” domain. Collagen triple helix repeats are mostly found in collagen and are generally extracellular structural proteins (Pfam accession number PF01391). The C1q domain is found in many collagen and C1 enzyme complexes and activates the serum complement system. C1q and tumor necrosis factor are similar (SMART deposit no. SM00110). The function of this protein is unknown.
Targeted or gene trap mutations were generated in strain 129SvEv ^Brd -derived embryonic stem (ES) cells. Chimeric mice were crossed to C57BL / 6J albino mice to produce F1 heterozygous animals. These progeny were crossed to produce F2 wild type, heterozygous, and homozygous mutant progeny. Very occasionally, for example, when F1 mice are rarely obtained from the chimera, F1 heterozygous mice are crossed with 129SvEv ^Brd / C57 hybrid mice to generate additional heterozygous animals for cross fertilization and F2 mice. Was produced. Level 1 phenotypic analysis was performed on the mice thus produced.
wt het hom Total observation 18 25 13 56
Expected value 14 28 14 56
Chi-square = 1.54 Significance = 0.44641 (hom / n) = 0.23 Average number of pups = 8
Mutant: homologous recombination (standard)
Targeted encoded exon 2 (NCBI deposit number NM — 02831.2)
Wild-type expression of the target gene was detected in 13 adult tissue samples tested by RT-PCR, as well as in all of the embryonic stem (ES) cells except skeletal muscle.
Southern hybridization analysis confirmed target gene disruption.

38.18.1. Phenotype analysis (disrupted gene: DNA44694-1500 (UNQ581)
(A) Summary of overall phenotype:
Mutations in the gene encoding the orthologue of human C1q and tumor necrosis factor-related protein 6 (C1QTNF6) reduced bone density measurements. Gene disruption was confirmed by Southern blotting.

(B) Bone metabolism: radiological phenotype analysis In the area of bone metabolism, targets are identified here for the treatment of arthritis, osteoporosis, osteopenia and marble bone disease, and targets that promote fracture healing. Identified. The exam includes:
DEXA for measuring bone mineral density in the femur and vertebra
• Micro CT for very high resolution and very sensitive measurement of bone mineral content in both trabecular and cortical bone.
Dexa Analysis-Test Method Description Procedure: A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. Dual energy X-ray absorption measurement (DEXA) was successfully used to identify changes in bone. Anesthetized animals were examined and bone mineral density (BMC), BMC / LBM ratio, volumetric bone density (vBMD), whole body BMD, femoral BMD and vertebra BMD were measured.
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Bone micro CT analysis Procedure: Micro CT was also used to perform very sensitive BMD measurements. One vertebra and one thigh were removed from a cohort of 4 wild type and 8 homozygous mice. Measurements were taken of the five vertebral traebecular volumes, traebecular thickness, bond density, and total bone area and cortical thickness of the mid-thigh. A micro CT40 scan provided detailed information on bone mass and structure. Multiple bones were placed in the sample holder and scanned automatically. Instrument software was used to select areas of interest for analysis. Trabecular parameters were analyzed in the 5th lumbar vertebra (LV5) with 16 micrometer resolution, and cortical bone parameters were analyzed in the mid-femoral axis with 20 micrometer resolution.
result:
DEXA: (− / −) mice showed a decrease in average bone density in the whole body and femur when compared to (+ / +) littermates with matched gender and background means.
Micro-CT analysis: (− / −) mice showed a reduction in mean femoral midshaft cortex thickness when compared to gender-matched (+ / +) littermates and background means.
Analytical value wt / het / hom: 5/4/8.
These results indicate that knockout mutant mice exhibit abnormal bone metabolism with significant bone loss similar to osteoporosis, characterized by bone loss with reduced density and possibly fragility leading to fractures. found. Therefore, PRO1151 polypeptide or an agonist thereof is considered useful for maintaining bone homeostasis. In addition, PRO1151 or its encoding gene may be useful for bone healing, or for the treatment of arthropathy or osteoporosis. On the other hand, an antagonist of PRO1151 or its encoding gene is considered to cause abnormal or pathological bone disorders including inflammatory diseases related to abnormal bone metabolism such as arthritis, osteoarthritis, osteoporosis and osteopenia.

標的突然変異又はジーントラップ突然変異を株１２９ＳｖＥｖ^Ｂｒｄ-由来胚性幹(ＥＳ)細胞において生じさせた。キメラマウスをＣ５７ＢＬ／６Ｊアルビノマウスに交雑してＦ１ヘテロ接合体動物を産生した。これらの子孫を交雑させてＦ２野生型、ヘテロ接合体、及びホモ接合体突然変異子孫を産生した。極くたまに、例えばＦ１マウスがキメラからほとんど得られなかった場合に、Ｆ１ヘテロ接合マウスを１２９ＳｖＥｖ^Ｂｒｄ／Ｃ５７ハイブリッドマウスと交雑させ、交雑受精のための付加的なヘテロ接合動物を生じさせてＦ２マウスを産生せしめた。このように産生されたマウスに対し、レベル１の表現型分析を行った。
wt het hom 合計
観察値 22 18 30 70
予想値 17.5 35 17.5 70
カイ二乗 = 18.34 有意性=0.00010 (hom/n) = 0.43 平均産仔数 = 7
突然変異型：レトロウイルス挿入（ＯＳＴ）
コード化エキソン１と２の間にレトロウイルスが挿入された（寄託番号ＮＭ＿０２５９５２）
標的遺伝子の野生型の発現は、骨格筋、骨、及び脂肪を除く、ＲＴ-ＰＣＲで試験された１３の成体組織試料に検出された。
ＲＴ−ＰＣＲ分析により、分析した（０／−）マウス（Ｍ−９７）に転写が無いことが判明した。 35.19 Generation and analysis of mice with DNA64888-1526 (UNQ628) gene disruption In these knockout experiments, the gene encoding PRO1244 polypeptide (designated DNA64888-1526 (UNQ628)) was disrupted. The gene specific information for these studies is as follows: The mutated mouse gene corresponds to: nucleotide reference number: NM — 025952 or Musmus Cruz RIKEN cDNA 261529 C04 gene (26152929 C04Rik); protein reference number: NP — 080228 or Transplantation related protein [Musmus crurus]; human gene sequence reference number: NM — 032121 or homosapiens transplantation related protein (DKFZp564K142); human protein sequence corresponds to reference number NP — 115497 or transplantation related protein [Homosapiens].
The disrupted mouse gene encodes a hypothetical protein, which is an ortholog of human FLJ14726. Alias names include hypothetical proteins 2610529C04Rik, IAG2, 2410001C15Rik, PRO0756, DKFZp564K142, transplantation-related proteins, and transplantation-related uterine proteins [Homo sapiens].
FLJ14726 contains an OST3 / OST6 motif (Pfam PF04756), which suggests that it is an oligosaccharide transferase and is located in the endoplasmic reticulum. Proteins with similar functions have been disclosed and studied in the field of yeast (Knauer and Lehle, J Biol Chem, 274 (24): 17249-56 (1999)).
This project is X-linked and the hemizygote does not have a pronounced phenotype.
Summary of X-linked gene disruption by sex and genotype (includes only agouti pups from male chimeras)
Summary of gender-linked gender X-linked gene disruption

Targeted or gene trap mutations were generated in strain 129SvEv ^Brd -derived embryonic stem (ES) cells. Chimeric mice were crossed to C57BL / 6J albino mice to produce F1 heterozygous animals. These progeny were crossed to produce F2 wild type, heterozygous, and homozygous mutant progeny. Very occasionally, for example, when F1 mice are rarely obtained from the chimera, F1 heterozygous mice are crossed with 129SvEv ^Brd / C57 hybrid mice to generate additional heterozygous animals for cross fertilization and F2 mice. Was produced. Level 1 phenotypic analysis was performed on the mice thus produced.
wt het hom Total observation 22 18 30 70
Expected value 17.5 35 17.5 70
Chi-square = 18.34 Significance = 0.00010 (hom / n) = 0.43 Average number of pups = 7
Mutant: Retrovirus insertion (OST)
A retrovirus was inserted between encoded exons 1 and 2 (deposit number NM — 025952)
Wild-type expression of the target gene was detected in 13 adult tissue samples tested by RT-PCR, excluding skeletal muscle, bone, and fat.
RT-PCR analysis revealed that the analyzed (0 / −) mouse (M-97) had no transcription.

35.19.1. Phenotypic analysis (disrupted gene: DNA64888-1526 (UNQ628)
(A) Summary of overall phenotype:
Mutation of the gene encoding the ortholog of the human transplantation related protein (DKFZp564K142) protein increased mean serum glucose levels. As a result of RT-PCR, there was no transcription.

(B) Phenotypic analysis: Metabolism-Blood chemistry / Glucose tolerance In the field of metabolism, the treatment of diabetes can be targeted. Blood chemistry phenotype analysis includes blood glucose measurements. Blood chemistry tests were performed on mice using a COBAS Integra 400 (manufacturer: Roche). In the field of metabolism, the treatment of diabetes can be targeted. Blood chemistry phenotype analysis includes a glucose tolerance test that measures changes in insulin sensitivity and glucose metabolism. Abnormal glucose tolerance test results may indicate the following disorders or conditions, but are not limited to: Type 1 and Type 2 diabetes, Syndrome X, various cardiovascular diseases and / or obesity.
Procedure: This assay used a cohort of 2 wild type mice and 4 homozygotes. The glucose tolerance test is a standard method for defining a loss of sugar homeostasis in mammals. The corresponding test was carried out using a Lifescan glucometer. Animals were injected intraperitoneally with a 20% solution of D-glucose at 2 g / kg and blood glucose levels were measured 0, 30, 60 and 90 minutes after injection. Analyzed wt / het / hom: 4/4/8
result:
Blood chemistry: (-/-) mice showed an increase in mean serum glucose levels compared to gender-matched (+ / +) littermates and background means.
That is, the knockout mouse showed an expression pattern of glucose homeostasis. From this observation, the PRO1244 polypeptide or agonist thereof appears to be useful in the treatment of glucose homeostasis and / or any metabolic disease associated therewith.

35.20 Generation and analysis of mice with DNA66511-1563 (UNQ666) gene disruption In these knockout experiments, the gene encoding PRO1298 polypeptide (designated DNA665115633 (UNQ666)) was disrupted. The gene-specific information for these studies is as follows: The mutated mouse gene corresponds to: nucleotide reference number: NM_0199898 or deposit number: NM_0199898 NID: 9910439 (1300013N08Rik); protein reference number: Q9JJA8 or Q9JJA8 Q9JJA8 brain CDNA, clone MNCB-5081; human gene sequence reference number: NM_033087 or deposit number: NM_0330887 NID: 1486181835 homosapiens homosapiens virtual protein FLJ1411 Reference number: Q9H553 or Q9H553 Q9H553 BA13B9.1 Corresponds to a novel protein similar to GLYCOS.
The mouse genes of interest are Alg2 (asparagine-linked glycosylation 2 homologue [yeast, α-1,3-mannosyltransferase]), an ortholog of human ALG2. Alias names include ALPG2, CDGIi, MNCb-5081, hALPG2, FLJ14511, homologues of yeast ALG2, and GDP-Man: Man (1) GlcNAc (2) -PP dolicol mannosyltransferase.
ALG2 is an α, 1,3-mannosyltransferase located in the lumen of the endoplasmic reticulum that catalyzes the formation of Manα1,3-ManGlcNAc2-PP-doricol from Man1GlcNAc2-PP-doricol and GDP-mannose. ALG2 is thought to play an important role in glycoprotein biosynthesis. Loss-of-function mutations in ALG2 cause congenital disorders of glycosylated type Ii. Individuals with this mutation are normal at birth but develop multisystem failures by the age of one year. Such disorders include mental retardation, seizures, iris coloboma, dysmyelination, hepatomegaly, and coagulopathy (Thiel et al., J Biol Chem, 278 (25): 22498-505 (2003) ).
Target or gene supplemental mutations were generated in embryonic liver (ES) cells from line 129SvEv ^Brd . Chimeric mice were raised to C57BL / 6J albino mice to generate F1 heterozygous animals. These progeny were cross-fertilized to produce F2 wild type, heterozygous, and homozygous mutant progeny. In rare circumstances, such as when there are few F1 mice derived from chimeras, F1 heterozygous mice are crossed to 129SvEv ^Brd / C57 hybrid mice to produce additional heterozygous animals and cross fertilization to generate F2 mice. Used for.
wt het hom Total observations 10 37 0 47
Expected value 11.75 23.5 11.75 47
Chi-square = 19.77 Significance = 0.00005 (hom / n) = 0.00 Average number of pups = 5
Mutant: homologous recombination (standard)
Targeted encoded exon 2 (NCBI accession number NM — 01998.2)
Wild-type expression of the target gene was detected in all 13 adult tissue samples tested by RT-PCR and in embryonic stem (ES) cells other than lung, bone, and fat.
Southern hybridization analysis confirmed target gene disruption.

35.20.1. Phenotype analysis (disrupted gene: DNA66511-1563 (UNQ666)
(A) Summary of overall phenotype:
A mutation in the gene encoding the ortholog of the human asparagine-linked glycosylation 2 homolog (ALG2) killed (− / −) mice. (+/−) mice showed a decrease in dermal fibroblast proliferation. Heterozygous (+/−) mice showed increased total tissue deposition, increased fat percentage, and increased BMC / LBM ratio. The disruption of the gene was confirmed by Southern blot.
Considerations regarding embryogenesis abnormalities (death) Embryonic lethality in knockout mice is usually due to various serious developmental problems, including but not limited to neurodegenerative diseases, angiogenic disorders, Inflammatory diseases or cases where genes / proteins play an important role in basic cell signaling processes in many cell types. In addition, embryonic lethality is useful as a potential cancer model. Similarly, corresponding heterozygous (+/−) mutant animals are particularly useful when presenting phenotypes and / or pathology reports that reveal very helpful clues regarding the function of the knockout gene. For example, EPO knockout animals were embryonic lethal, but embryo pathological reports showed a severe shortage of RBCs.

(B) Pathology Microscopic observation: Not examined due to embryonic lethality. On day 12.5, 40 embryos were observed: (+/−) embryo 28, (+ / +) embryo 6, resorbable mole 4, and unknown 2.
Gene expression: No LacZ activity was detected in a group of tissues by immunohistochemical analysis.

(C) Oncology phenotype analysis In the field of oncology, targets have been identified here for the treatment of solid tumors, lymphomas and leukemias.
Proliferation of adult skin cells Procedure: Skin cells were isolated from 16 week old animals (2 wild type and 4 homozygous). These were grown in the first fibroblast culture and the fibroblast proliferation rate was measured by a strictly controlled protocol. The ability of this assay to detect hyperproliferative and hypoproliferative phenotypes showed p53 and Ku80. Proliferation was measured using Brdu Incorporaton.
Specifically, a dermal fibroblast proliferation assay was used for this study. The increase in cells in standard culture was used as an indicator of relative proliferative capacity. Primary fibroblasts were established from histological examination of skin collected from wild type and mutant mice. A culture solution containing 2 or 3 50,000 cells was seeded and grown for 6 days. At the end of the culture period, the number of cells in the culture was determined using an electronic particle coefficient device.
Results: (+/-) mice showed a decrease in the average skin fibroblast proliferation rate when compared to (+ / +) littermates of matched gender and background means. Thus, homozygous mutant mice showed a hypoproliferative phenotype. As shown in these observations, PRO1298 polypeptide antagonists or their encoded genes appear to be useful in the treatment of diseases associated with abnormal cell proliferation.

(D) Bone metabolism and physical diagnostics: bone metabolism: radiological phenotype analysis In the area of bone metabolism, targets are identified here for the treatment of arthritis, osteoporosis, osteopenia and marble bone disease, and Targets that promote fracture healing are identified. The exam includes:
DEXA for measuring bone mineral density in the femur and vertebra
• Micro CT for very high resolution and very sensitive measurement of bone mineral content in both trabecular and cortical bone.
Dexa Analysis-Test Method Description Procedure: Dual energy X-ray absorption measurement (DEXA) was successfully used to identify changes in bone. Anesthetized animals were examined and bone mineral density (BMC), BMC / LBM ratio, volumetric bone density (vBMD), whole body BMD, femoral BMD and vertebra BMD were measured.
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Bone micro CT analysis Procedure: Micro CT was also used to perform very sensitive BMD measurements. One vertebra and one thigh were removed from a cohort of 4 wild type and 8 heterozygous mice. Measurements were taken of the five vertebral traebecular volumes, traebecular thickness, bond density, and total bone area and cortical thickness of the mid-thigh. A micro CT40 scan provided detailed information on bone mass and structure. Multiple bones were placed in the sample holder and scanned automatically. Instrument software was used to select areas of interest for analysis. Trabecular parameters were analyzed in the 5th lumbar vertebra (LV5) with 16 micrometer resolution, and cortical bone parameters were analyzed in the mid-femoral axis with 20 micrometer resolution.
result:
In DEXA: (+/-) mice, the mean total tissue volume and total body fat (% and grams) and BMC / LBM when compared to (+ / +) littermates and background averages of matching gender An increase in the ratio was shown.
Micro-CT analysis: (+/−) mice increased trabecular bone volume, number, thickness, and bond density when compared to gender-matched (+ / +) littermates and background means, and An increase in mean femoral midshaft thickness area was shown.
In summary, (+/−) mice showed an increase in mean total tissue volume and total body fat, as well as bone measurements of trabecular bone and femoral midaxis compared to (+ / +) littermates of matched gender. Showed an increase. These observations suggest an obesity and / or growth disorder phenotype. In addition, mutant (+/−) mice showed abnormal bone development. Thus, PRO1298 polypeptides or agonists thereof are useful for normal growth and bone development and may be useful for the treatment of growth or metabolic disorders associated with obesity and / or bone disorders.

Generation and analysis of mice with 35.21 DNA64966-1575 (UNQ679) gene disruption In these knockout experiments, the gene encoding PRO1313 polypeptide (designated DNA64966-1575 (UNQ679)) was disrupted. The gene specific information for these studies is as follows: The mutated mouse gene corresponds to: nucleotide reference number: NM_175187 or Musmus Cruz RIKEN cDNA 280446P07 gene; protein reference number: NP_780396 or RIKEN cDNA 28010446P07 [Musmus crurus]; human gene sequence reference number: NM — 153354 or homosapiens virtual protein MGC33214 (MGC33214); human protein sequence corresponds to reference number: NP — 699185 or hypothetical protein MGC33214 [Homosapiens].
The mouse gene of interest encodes a virtual membrane protein (2810446P07Rik) and is an ortholog of the human virtual membrane protein (MGC33214).
MGC33214 is probably a membrane protein and contains seven transmembrane domains. The function of this protein is currently unknown. MGC33214 is most similar to a wide variety of other virtual proteins, including a very large (5722 amino acid) rat virtual protein termed “ATP binding cassette transporter A13”. Bioinformatics analysis suggests that this protein can be located on the plasma membrane, but can also be located on the endoplasmic reticulum and nuclear membrane.
Genetic information:
wt het hom Total observation 22 41 8 71
Expected value 17.75 35.5 17.75 71
Chi-square = 7.23 Significance = 0.02698 (hom / n) = 0.11 Average number of pups = 8
Mutant: Retrovirus insertion (OST)
A retrovirus was inserted into the intron between encoded exons 1 and 2 (NCBI deposit number NM_175187.3)
Wild type expression of the target gene was detected in all 13 adult tissue samples and embryonic stem (ES) cells tested by RT-PCR.
Due to lethality, no transcriptional expression analysis was performed. The destruction of the target gene was confirmed by inverse PCR.

35.21.1. Phenotype analysis (disrupted gene: DNA64966-1575 (UNQ679)
(A) Summary of overall phenotype:
Mutation of a gene encoding an ortholog of human virtual membrane protein (MGC33214) caused (− / −) mice to die. A notable phenotype was observed in (+/−) mice. All (-/-) offspring died at the time of genotyping.
Considerations regarding abnormalities in embryogenesis (death) Embryonic death in knockout mice is usually caused by a variety of serious developmental problems, including but not limited to neurodegenerative diseases, angiogenic disorders, inflammation Sexually transmitted diseases, or cases where genes / proteins play an important role in basic cell signaling processes in many cell types. In addition, embryonic lethality is useful as a potential cancer model. Similarly, corresponding heterozygous (+/−) mutant animals are particularly useful when presenting phenotypes and / or pathology reports that reveal very helpful clues regarding the function of the knockout gene. For example, EPO knockout animals were embryonic lethal, but embryo pathological reports showed a severe shortage of RBCs.

(B) Embryonic expression studies In situ hybridization (ISH) studies NM_175187 (exon 10-12) E6.5d, E7.5d using probes formed at base pairs 969-1407 from the starting ATG Specific and ubiquitous staining of (+ / +) mouse embryonic placenta at E9.5d, E10.5d, E11.5d and E12.5D was observed. Another probe showed specific UNQ679 staining in the center of the back (ubiquitous staining) (probe formed at base pair 1317-1888 from the initiating ATG of NM — 175187 (starting exon 12 of 3′UTR )). On the other hand, UNQ679 homozygous (-/-) mice were anemic compared to wild-type (+ / +) controls at E13.5d and were shown to be much smaller. Compared to the E14.5d wild-type embryo, the 14.5d mutant (-/-) mice showed a clear placental defect. In addition, the head and eyes of the E16.5d UNQ679 (− / −) embryo were not formed correctly. UNQ679 (− / −) mutant embryos had a small, anemic, malformed heart at E15.5d. Thus, UNQ679 is essential for placental and normal development. The anemia observed in E13.5d mutant (− / −) embryos was probably due to placental developmental failure.

Generation and Analysis of Mice with 35.22 DNA68885-1678 (UNQ776) Gene Disruption In these knockout experiments, the gene encoding PRO1570 polypeptide (designated DNA688851678 (UNQ776)) was disrupted. The gene specific information for these studies is as follows: Mutated mouse genes correspond to: nucleotide reference number: NM_145403 or deposit number: NM_145403 NID: transmembrane protease, serine 4 (membrane type) 21703805 Musmus crusmus musculus similar to serine protease 2) (MT-SP2) (LOC214523); protein reference number: Q8VCA5 or deposit number: Q8VCA5 NID: Musmus cruz (mouse). Similar to transmembrane protease, serine 4. MOUSESPTRNRDB; human gene sequence reference number: NM — 019894 or accession number: NM — 019894 NID: 15451939 homosapiens homosapiens transmembrane protease, serine 4 (TMPRSS4); human protein sequence is reference number Q9NRS4 or accession number: Q9NRS4 NID: homosapiens (human ). Transmembrane protease, serine 4 (EC 3.4.21.-) (membrane-type serine protease 2) (MT-SP2). HUMANSPTRNRDB. Corresponding to
The mouse genes of interest are Tmprss4 (transmembrane protease, serine 4), an ortholog of human TMPRSS4. Alias names are membrane serine protease 2, MT-SP2, transmembrane serine protease 3, and TMPRSS3.
TMPRSS4 is a type 2 membrane protein and appears to function as a serine protease of the chymotrypsin family. This protein contains a signal anchor and an extracellular trypsin-like serine protease domain. TMPRSS4 is overexpressed in pancreatic cancer but not in normal pancreas. This suggests that TMPRSS4 may be involved in metastasis (Wallrapp et al., Cancer Res, 60 (10): 2602-6 (2000); Gress et al., Genes Chromosomes Cancer, 19 (2): 97-103 (1997)). TMPRSS4 can regulate renal sodium transport by activating epithelial sodium channels (ENaC) expressed in collecting ducts (Vuagniaux et al., J Gen Physiol, 120 (2): 191-201 (2002). )).
Targeted or gene trap mutations were generated in strain 129SvEv ^Brd -derived embryonic stem (ES) cells. Chimeric mice were crossed to C57BL / 6J albino mice to produce F1 heterozygous animals. These progeny were crossed to produce F2 wild type, heterozygous, and homozygous mutant progeny. Very occasionally, for example, when F1 mice are rarely obtained from the chimera, F1 heterozygous mice are crossed with 129SvEv ^Brd / C57 hybrid mice to generate additional heterozygous animals for cross fertilization and F2 mice. Was produced. Level 1 phenotypic analysis was performed on the mice thus produced.
wt het hom Total observations 24 33 14 71
Expected value 17.75 35.5 17.75 71
Chi-square = 3.17 Significance = 0.20505 (hom / n) = 0.20 Average number of pups = 8
Mutant: homologous recombination (standard)
Targeted encoded exons 3-5 (NCBI accession number NM_145403.1)
Wild-type expression of the target gene was detected in all 13 adult tissue samples tested by RT-PCR except spinal cord, thymus, bone, and fat.
Southern hybridization analysis confirmed target gene disruption.

35.22.1. Phenotypic analysis (disrupted gene: DNA68885-16778 (UNQ776)
(A) Summary of overall phenotype:
Mutations in the gene encoding the ortholog of the human transmembrane protease, serine 4 (TMPRSS4), increased anxiety-related responses in (− / −) mice. In addition, (− / −) mice showed increased skin fibroblast proliferation. Mutant (− / −) mice also showed elevated mean serum triglyceride levels and elevated mean serum glucose levels with impaired glucose tolerance. An increased response to LPS challenge was also observed in (− / −) mice. Gene disruption was confirmed by Southern blotting.

(B) Immunological phenotypic analysis Immune-related and inflammatory diseases are in normal physiology, responding to invasion or injury, initiating repair of invasion or injury, and innate and acquired protective power against foreign organisms. Physiological pathways important for the incorporation of are very complex and multiple connected signs or consequences. A disease or condition is a condition in which these normal physiological pathways are subject to additional invasion or injury, either directly as a result of abnormal control or excessive stimulation, as a response to self, or as a combination thereof. It occurs when causing.
The origins of these diseases often involve multiple pathways and often multiple different physiological systems / pathways, and intervening in multiple of these pathways can lead to remission or therapeutic effects. Can be mentioned. Therapeutic intervention can be done by antagonizing harmful processes / pathways or stimulating beneficial processes / pathways.
T lymphocytes (T cells) are an important component of a mammalian immune response. T cells recognize antigens associated with self-molecules encoded by genes within major histocompatibility antigens (MHC). Antigens can be expressed with MHC molecules on the surface of antigen-presenting cells, virus-infected cells, cancer cells, grafts and the like. T cell lines remove degenerative cells that pose a threat to the health of the host mammal. T cells include helper T cells and cytotoxic T cells. Helper T cells proliferate on a large scale when they recognize antigen-MHC complexes on antigen-presenting cells. Helper T cells also secrete various cytokines, lymphokines, which play a central role in the activity of B cells, cytotoxic T cells and various other cells that participate in the immune response.
In many immune responses, inflammatory cells infiltrate the site of injury or infection. Migrating cells are neutrophils, eosinophils, monocytes or lymphocytes, which can be determined by histological examination of the affected tissue. Current Protocols in Immunology, ed John E. Coligan, 1994 John Wiley & Sons, Inc.
Many immune related diseases are known and have been extensively studied. Such diseases include immune-mediated inflammatory diseases (eg rheumatoid arthritis, immune-mediated renal disease, hepatobiliary disease, inflammatory bowel disease (IBD), psoriasis, and asthma), non-immune-mediated inflammatory diseases , Infections, immunodeficiency diseases, tumors, and transplant rejections. In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified.
In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified. Immune related diseases can be treated in one example by suppressing the immune response. The use of neutralizing antibodies that suppress molecules with immunostimulatory activity is beneficial for the treatment of immune-mediated and inflammatory diseases. Molecules that suppress immune responses (proteins directly or using antibody agonists) can be used to suppress immune responses and thus ameliorate immune-related diseases.
The following tests were conducted.

Acute phase response:
Test Description: Bacterial lipopolysaccharide (LPS) is an endotoxin and as such is a potent inducer of the acute phase response and systemic inflammation. Level 1 LPS mice were injected intraperitoneally with a sublethal dose of LPS in 200 μL of sterile saline using a 26 gauge needle. The dose was 1 μg / g body weight 3 hours after injection based on the average body weight of the tested mice. A 100 μl blood sample was then taken and analyzed for the presence of TNFa, MCP-1, and IL-6 with a FACSCalibur instrument.
result:
(− / −) Mice showed an increase in mean serum MCP-1 response to LPS challenge compared to their pups and background means.
Analyzed wt / het / hom: 7/4/11
In summary, as a result of administration of LPS endotoxin antigen, it was found that knockout mice lacking the gene encoding PRO1570 polypeptide exhibit immunological abnormalities compared to their wild-type pups. In one example, mutant mice showed an increased ability to elicit an immunological response (production of MCP-1) when administered LPS endotoxin antigen. This indicates a pro-inflammatory response. MCP-1 contributes to the subsequent B cell activation stage. In addition, MCP-1 plays an important role in the induction of acute phase responses and systemic inflammation. Such findings indicate that inhibitors or antagonists of PRO1570 polypeptide stimulate the immune system, and if this effect is beneficial to the individual, such as leukemia and other types of cancer, and immune deficiencies such as AIDS patients It seems to be usable for patients. Thus, PRO1570 polypeptides or agonists thereof are useful for suppressing immune responses, such as for suppressing adverse immune responses in the case of graft rejection or graft-versus-host disease.

(C) Phenotypic analysis: CNS / neurology In the field of neurology, the analysis here is depression, generalized anxiety disorder, attention deficit hyperactivity disorder, obsessive compulsive disorder, schizophrenia, cognitive impairment, hyperalgesia And focused on identifying targets that have been validated in vivo for the treatment of neurological and psychiatric disorders, including sensory organ disorders. Neurological disorders include a category defined as “anxiety disorders” including, but not limited to, mild to moderate anxiety, anxiety disorders due to general medical conditions, and unspecified anxiety disorders Generalized anxiety disorder, panic attack, panic disorder with agoraphobia, panic disorder without agoraphobia, post-traumatic stress syndrome, social phobia, specific phobias, substance-induced anxiety disorder, acute alcohol withdrawal , Obsessive-compulsive disorder, agoraphobia, bipolar disorder I or II, bipolar disorder not otherwise specified, circulatory temperament disease, depressive disorder, major depressive disorder, mood disorder, substance-induced mood disorder . In addition, anxiety disorders can be applied to personality disorders including, but not limited to, the following types: paranoid, antisocial, avoidance behavior, borderline personality disorder, addiction, acting, self-loving , Obsessive, schizophrenic, and schizophrenic.
procedure:
Behavioral screening was performed on a cohort consisting of 4 wild type, 4 heterozygotes and 8 homozygous mutant mice. All behavioral tests were performed between 12 and 16 weeks of age, as long as the time of the test had to be accelerated due to reduced survival. These trials included open field trials to measure anxiety, activity level and exploration.
Open field test:
Some targets of known drugs showed phenotype in open field tests. These include seratonin transporters, dopamine transporters (Giros et al., Nature. 1996 Feb 15; 379 (6566): 606-12), and GABA receptors (Homanics et al., Proc Natl Acad Sci US A. 1997 Apr 15; 94 ( 8): Including 4143-8) knockout. An automated open field assay was customized to handle changes in emotional state and changes in search patterns for learning. First, the field (40 × 40 cm) was selected to be relatively large relative to the mouse, thus taking up changes in locomotion associated with the search. There are also four holes in the floor that allow you to poke the nose, an activity that is particularly relevant to exploration. Several factors were also designed to enhance the emotional state associated with this trial. The open field test was the first experimental procedure in which mice were tested, and the measurements made were the first experience with the subject's chambers. The open field was brightly lit. All of these factors increase the natural anxiety associated with new and open spaces. The pattern and degree of exploration activity, in particular the total distance traveled from the center, can then identify changes in susceptibility to anxiety or depression. A large active area (40 cm × 40 cm, AccuScan Instruments VersaMax animal activity monitor system) using infrared beams at three different levels was used to record standing, nasal pricking into the hole, and locomotor activity. The animal was placed in the center and its activity was measured for 20 minutes. Data from this test was analyzed 5 times at 4 minute intervals. The total distance traveled (cm), the number of vertical movements (rise), the number of hole penetrations, and the total distance traveled from the center were recorded.
The tendency of mice to show a normal habituation response to the new environment was assessed by determining the total change in their horizontal locomotor activity over 5 time intervals. This calculated slope of change in activity over time was determined using the total travel distance normalized to the absolute value. The slope was determined from a regression line through normalized activity in each of the five time intervals. Normal habit effects are represented by negative slope values. Analyzed wt / het / hom: 4/4/8
result:
(-/-) Mice showed reduced median time in the central area and nose thrusting behavior into the hole during the open field test when compared to (+ / +) littermates of matching gender . This indicates an increased anxiety-like response in the variant.
As noted above, significant differences were observed during the open field test. (− / −) Mice showed a decrease in median total time in the central region when compared to (+ / +) littermates of matching gender. This type of behavior is consistent with an increased anxiety-like response. Thus, knockout mice have mild to moderate anxiety, generalized medical anxiety and / or bipolar disorder; hyperactivity; sensory disturbances; obsessive compulsive disorder, schizophrenia or paranoid personality Showed a phenotype consistent with. Thus, PRO1570 polypeptides or agonists thereof may be useful for treating such neurological disorders or ameliorating symptoms associated with anxiety disorders.

(D) Oncology phenotype analysis In the field of oncology, targets have been identified here for the treatment of solid tumors, lymphomas and leukemias.
Proliferation of adult skin cells Procedure: Skin cells were isolated from 16 week old animals (2 wild type and 4 homozygous). These were grown in the first fibroblast culture and the fibroblast proliferation rate was measured by a strictly controlled protocol. The ability of this assay to detect hyperproliferative and hypoproliferative phenotypes showed p53 and Ku80. Proliferation was measured using Brdu Incorporaton.
Specifically, a dermal fibroblastic differential growth assay was used for this study. The increase in cells in standard culture was used as an indicator of relative proliferative capacity. Primary fibroblasts were established from histological examination of skin collected from wild type and mutant mice. A culture solution containing 2 or 3 50,000 cells was seeded and grown for 6 days. At the end of the culture period, the number of cells in the culture was determined using an electronic particle coefficient device.
Results: (-/-) mice showed an increase in the average skin fibroblast proliferation rate when compared to (+ / +) littermates of matched gender and background means. Thus, homozygous mutant mice showed a hyperproliferative phenotype. As shown in these observations, PRO1570 polypeptides or agonists thereof are believed to be useful in reducing abnormal cell proliferation such as tumor cell growth.

(E) Phenotypic analysis: Cardiology In the field of cardiovascular biology, hypertension, atherosclerosis, heart failure, stroke, various coronary artery diseases, dyslipidemias such as high cholesterol (hypercholesterolemia) and Targets for the treatment of elevated serum triglycerides (hypertriglyceridemia), diabetes, and / or obesity have now been identified. Phenotypic tests include measurement of serum cholesterol and triglycerides.
Blood lipid Procedure:
A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. High cholesterol levels and elevated triglyceride blood levels are recognized risk factors in the progression of cardiovascular disease and / or diabetes. Measuring blood lipids facilitates the discovery of biological switches that regulate blood lipid levels. Inhibition of factors that increase blood lipid levels may be useful in reducing the risk of cardiovascular disease. In this blood chemistry test, cholesterol readings were recorded using COBAS Integra400 (mfr: Roche).
result:
When compared to gender matched (+ / +) littermates and background means, (− / −) mice showed an increase in mean serum triglyceride and cholesterol levels.
As summarized above, (− / −) mice have a marked increase in triglyceride levels when compared to the background average of gender-matched (+ / +) littermates and male (+ / +) mice. showed that. In addition, an increase in mean serum glucose levels suggested diabetes. That is, a mutant mouse lacking the PRO1570 gene can function as a model for cardiovascular diseases including diabetes. PRO1570 polypeptide or its encoding gene appears to be useful in modulating the levels of normal blood lipids such as triglycerides. Thus, PRO1570 polypeptides or agonists thereof can treat cardiovascular diseases such as hypertension, atherosclerosis, heart failure, stroke, various coronary artery diseases, hypercholesterolemia, hypertriglyceridemia, diabetes and / or obesity. It is considered useful.

Generation and Analysis of Mice with 35.23 DNA8079-2523 (UNQ870) Gene Disruption In these knockout experiments, the gene encoding PRO1886 polypeptide (designated DNA8079-2523 (UNQ870)) was disrupted. The gene-specific information for these studies is as follows: the mutated mouse gene corresponds to: nucleotide reference number: XM — 134593 or Musmus Cruz hypothesis protein 4932417I16 (49332417I16); protein reference number: XP — 134593 or Similar to predicted CDS, bilateral deadline putative protein (4J193) [Musmuscruz]; human gene sequence reference number: AK025820 or homosapiens cDNA: FLJ22167 fis, clone HRC00584; human protein sequence is reference number BAB15244 or Corresponds to an unspecified protein product [Homo sapiens].
The disrupted mouse gene encodes a hypothetical protein (49332417I16Rik) and is an ortholog of the human hypothetical protein FLJ22167. Another name is hypothetical protein 4932417I16 (mouse).
Bioinformatic analysis of FLJ22167 showed that it is a transmembrane protein, probably located in the plasma membrane or endoplasmic reticulum. In humans, some FLJ22167 transcripts overlap with transcription of an adjacent gene (CHST5), but such duplication is not observed in mice. Such duplication may cause FLJ22167 to be identified as an isoform of a possible enzyme (CHST5).
Genetic information:
wt het hom Total observation 29 28 0 57
Expected value 14.25 28.5 14.25 57
Chi-square = 29.53 Significance = 0.00000 (hom / n) = 0.00 Average number of pups = 6
Mutant: Retrovirus insertion (OST)
A retrovirus was inserted in the intron in front of the encoded exon 1 (NCBI accession number AK030046)
Wild type expression of the target gene was detected in all 13 adult tissue samples and embryonic stem (ES) cells tested by RT-PCR.
Due to lethality, transcriptional expression analysis was not performed. The destruction of the target gene was confirmed by inverse PCR.

35.23.1. Phenotypic analysis (broken gene: DNA8079-2523 (UNQ870)
(A) Summary of overall phenotype:
Mutation of a gene encoding an ortholog of the human hypothetical protein (FLJ22167) caused (− / −) mice to die. One quarter (1/4) of the children of UNQ870 were born. (+/−) mice showed an increase in total body fat (% and grams) and an increase in mean total tissue volume. In addition, a decrease in fibroblast proliferation was observed in (+/−) mice.
Considerations regarding abnormalities in embryogenesis (death) Embryonic death in knockout mice is usually caused by a variety of serious developmental problems, including but not limited to neurodegenerative diseases, angiogenic disorders, inflammation Sexually transmitted diseases, or cases where genes / proteins play an important role in basic cell signaling processes in many cell types. In addition, embryonic lethality is useful as a potential cancer model. Similarly, corresponding heterozygous (+/−) mutant animals are particularly useful when presenting phenotypes and / or pathology reports that reveal very helpful clues regarding the function of the knockout gene. For example, EPO knockout animals were embryonic lethal, but embryo pathological reports showed a severe shortage of RBCs.

(B) Other expression and embryo observations UNQ870 was upregulated in endometrial adenocarcinoma (see Examples 41 and 42 for protocol). Microscopic observations showed that one-third (1/3) of heterozygous (+/−) mice had hydronephrosis in the right kidney.
UNQ870 homozygous (-/-) fetuses showed heart damage at E15.5d.
Three quarters (3/4) of UNQ870 homozygous (− / −) fetuses were anemic and one quarter of UNQ870 homozygous (− / −) fetuses having eyes at E14.5d. (1/4) was anemic and had an eye at E15.5d, but no vaginal closure. Normal eyelid development results in an eyelid primordium at E12.5d and a fusion eyelid between 15.5d-16.5d and the eye opens at P12-14d. There is a parallel between fistula closure and wound healing (progressive events occur in parallel). In (− / −) mutant fetuses, other factors such as FGF8 expression, neurogenin 2 expression, Gli3 and Dlx2 expression, and EyaI expression all seemed to be degenerated. Expression of FGF8 at E10.5d of UNQ870 (− / −) was decreased; staining in telencephalic vesicles and nasal plates of UNQ870 (− / −) was decreased. Neurogenin 2 expression decreased at E10.5d of UNQ870; UNQ870 (− / −) staining decreased in the telencephalon, or ventral staining in UNQ870 (− / −) decreased or absent. It was. Expression of Gli3 in UNQ870 (− / −) E10.5d was denatured; (staining in the telencephalon, bow arch, and eye follicle was reduced). Expression of Dlx2 in E9.5d of UNQ870 (− / −) was denatured; the staining domain in the AER of wild type (+ / +) limb buds was reduced. The expression of EyaI in E9.5d of UNQ870 (− / −) was denatured; staining in the arch and optic vesicles was reduced. See Example 44 for the ISH protocol.
The Pax6 knockout was similar to the UNQ870 knockout. The small eye (Sey) was a semi-dominant mutation of the Pax6 gene. Homozygous (− / −) resulted in complete loss of the eye and nose primordium. Based on comparative mapping studies and phenotypic similarities, it was suggested that Sey is homologous to human congenital aniridia (iris deficiency).

(C) Bone metabolism and physical diagnosis (1) Measurement of tissue mass and lean body mass-Dexa
Dexa Analysis-Test Description Procedure: Dual energy X-ray absorption (DEXA) was successfully used to identify changes in total tissue mass (TTM).
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Body measurements (body length and body weight): Body length and body weight were measured at about 16 weeks of age.
result:
(+ / +) Mice showed an increase in mean body weight compared to gender-matched (+ / +) littermates and background means.
(2) Bone metabolism: radiological phenotype analysis In the area of bone metabolism, targets are identified here for the treatment of arthritis, osteoporosis, osteopenia and marble bone disease, and targets that promote fracture healing Identified. The exam includes:
DEXA for measuring bone mineral density in the femur and vertebra
• Micro CT for very high resolution and very sensitive measurement of bone mineral content in both trabecular and cortical bone.
Dexa Analysis-Test Method Description Procedure: Dual energy X-ray absorption measurement (DEXA) was successfully used to identify changes in bone. Anesthetized animals were examined and bone mineral density (BMC), BMC / LBM ratio, volumetric bone density (vBMD), whole body BMD, femoral BMD and vertebra BMD were measured.
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
result:
DEXA: (+/−) mice showed an increase in average total tissue volume, total body fat percentage, and total body fat mass compared to (+ / +) litters and background averages that matched their gender.
These studies suggested that mutated (+/−) non-human transgenic animals show a negative phenotype associated with obesity. Thus, it is suggested that PRO1886 polypeptides or agonists thereof are essential for normal growth and metabolic processes and are particularly important for the prevention and / or treatment of obesity.

(D) Oncology phenotype analysis In the field of oncology, targets have been identified here for the treatment of solid tumors, lymphomas and leukemias.
Proliferation of adult skin cells Procedure: Skin cells were isolated from 16 week old animals (2 wild type and 4 homozygous). These were grown in the first fibroblast culture and the fibroblast proliferation rate was measured by a strictly controlled protocol. The ability of this assay to detect hyperproliferative and hypoproliferative phenotypes showed p53 and Ku80. Proliferation was measured using Brdu Incorporaton.
Specifically, a dermal fibroblastic differential growth assay was used for this study. The increase in cells in standard culture was used as an indicator of relative proliferative capacity. Primary fibroblasts were established from histological examination of skin collected from wild type and mutant mice. A culture solution containing 2 or 3 50,000 cells was seeded and grown for 6 days. At the end of the culture period, the number of cells in the culture was determined using an electronic particle coefficient device.
Results: (-/-) mice showed a sharp decline in the average skin fibroblast proliferation rate when compared to (+ / +) litters of matched gender and background average. Thus, homozygous mutant mice showed a hypoproliferative phenotype. As shown in these observations, PRO724 polypeptide antagonists or their encoded genes appear to be useful in reducing abnormal cell proliferation, such as tumor cell growth.

Generation and analysis of mice with 35.24 DNA76788-2526 (UNQ873) gene disruption In these knockout experiments, the gene encoding PRO1891 polypeptide (DNA76788-2526) (designated UNQ873) was disrupted. The gene-specific information for these studies is as follows: The mutated mouse gene corresponds to: nucleotide reference number: NM — 033615 or deposit number: NM — 036315 NID: gi23956237 reference number NM — 03615.1. Integrin and metalloprotease domain 33 (Adam33); protein reference number: Q923W9 or deposit number: Q923W9 NID: Musmus Cruz (mouse). ADAM33 precursor (EC 3.4.24.) (Disintegrin and metalloprotease domain 33). MOUSESPTRNRDB; human gene sequence reference number: NM — 025220 or accession number: NM — 025220 NID: 18252044 homosapiens homosapiens disintegrin and metalloprotease domain 33 (Adam33); human protein sequence is reference number Q9BZ11 or accession number: Q9BZ11 NID: Human). ADAM33 PRECURSOR (EC 3.4.24.-) (disintegrin and metalloprotease domain 33). HUMANSPTRNRDB. Corresponding to
The mouse gene of interest is Adam33 (disintegrin and metalloprotease domain 33), an ortholog of human ADAM33. Other names include Adaml, metalloprotease disintegrin, and disintegrin and reprolysin metalloproteinase family proteins.
ADAM33 is a type I essential membrane protein that probably functions as a zinc metalloprotease and cell adhesion molecule. The protein consists of a large extracellular domain, a transmembrane site, and a short cytoplasmic C-terminus. The large extracellular domain contains a propeptide, a zinc metalloprotease catalytic domain, a disintegrin domain, a cysteine-rich region, and an EGF-like domain. The propeptide is cleaved to form a mature protein. ADAM33 is widely expressed and is highly expressed especially in placenta, lung, spleen and vein. ADAM33 expression does not appear to be liver (Yoshinaka et al., Gene, 282 (1-2): 227-36 (2002); Van Eerdewegh et al., Nature, 418 (6896): 426-30 (2002); Garlisi et al. Biochem Biophys Res Commun, 301 (1): 35-43 (2003)). In general, the biological role of the ADAM33 and ADAM families is unclear; however, they are involved in processes such as fertilization, neurogenesis, myogenesis, fetal TGF-α release and inflammatory responses (Primakoff and Myles, Trends Genet, 16 (2): 83-7 (2000)).
ADAM33 has been implicated in asthma and bronchial hyperresponsiveness. Proteases are expressed in human lung fibroblasts and bronchial smooth muscle and play a central role in airway tissue repair. Damage to airway epithelial cells by activated T cells results in smooth muscle hyperplasia, fibroblast proliferation, increased matrix deposition, and bronchial smooth muscle quiescence, contraction to proliferation, conversion to synthetic . Altering ADAM33 activity or expression can be a source of abnormal tracheal repair in the bronchial hyperresponse (Van Eerdewegh et al., Nature, 418 (6896): 426-30 (2002)).
Targeted or gene trap mutations were generated in strain 129SvEv ^Brd -derived embryonic stem (ES) cells. Chimeric mice were crossed to C57BL / 6J albino mice to produce F1 heterozygous animals. These progeny were crossed to produce F2 wild type, heterozygous, and homozygous mutant progeny. Very occasionally, for example, when F1 mice are rarely obtained from the chimera, F1 heterozygous mice are crossed with 129SvEv ^Brd / C57 hybrid mice to generate additional heterozygous animals for cross fertilization and F2 mice. Was produced. Level 1 phenotypic analysis was performed on the mice thus produced.
wt het hom Total observation 15 48 21 84
Expected value 21 42 21 84
Chi-square = 2.57 Significance = 0.27645 (hom / n) = 0.25 Average number of pups = 9
Mutant: homologous recombination (standard)
Targeted encoded exons 12 to 16 (NCBI accession number NM — 03615.1)
Wild type expression of the target gene was detected in all but 13 fat tissue samples tested by RT-PCR.
Southern hybridization analysis confirmed target gene disruption.

35.24.1. Phenotype analysis (disrupted gene: DNA76788-2526 (UNQ873)
(A) Overview of overall phenotype:
Mutations in the gene encoding the ortholog of human disintegrin and metalloprotease domain 33 (ADAM33) increased the IgG1 response to ovalbumin challenge in (− / −) mice. The (− / −) mice also showed an increase in serum triglycerides, an increase in mean serum insulin, and a decrease in bone density measurements. Furthermore, the glucose tolerance test suggested insulin resistance. Moreover, immunological abnormalities were observed in (− / −) mice. Gene disruption was confirmed by Southern blotting.

(B) Immunological phenotypic analysis Immune-related and inflammatory diseases are in normal physiology, responding to invasion or injury, initiating repair of invasion or injury, and innate and acquired protective power against foreign organisms. Physiological pathways important for the incorporation of are very complex and multiple connected signs or consequences. A disease or condition is a condition in which these normal physiological pathways are subject to additional invasion or injury, either directly as a result of abnormal control or excessive stimulation, as a response to self, or as a combination thereof. It occurs when causing.
The origins of these diseases often involve multiple pathways and often multiple different physiological systems / pathways, and intervening in multiple of these pathways can lead to remission or therapeutic effects. Can be mentioned. Therapeutic intervention can be done by antagonizing harmful processes / pathways or stimulating beneficial processes / pathways.
T lymphocytes (T cells) are an important component of a mammalian immune response. T cells recognize antigens associated with self-molecules encoded by genes within major histocompatibility antigens (MHC). Antigens can be expressed with MHC molecules on the surface of antigen-presenting cells, virus-infected cells, cancer cells, grafts and the like. T cell lines remove degenerative cells that pose a threat to the health of the host mammal. T cells include helper T cells and cytotoxic T cells. Helper T cells proliferate on a large scale when they recognize antigen-MHC complexes on antigen-presenting cells. Helper T cells also secrete various cytokines, lymphokines, which play a central role in the activity of B cells, cytotoxic T cells and various other cells that participate in the immune response.
In many immune responses, inflammatory cells infiltrate the site of injury or infection. Migrating cells are neutrophils, eosinophils, monocytes or lymphocytes, which can be determined by histological examination of the affected tissue. Current Protocols in Immunology, ed John E. Coligan, 1994 John Wiley & Sons, Inc.
Many immune related diseases are known and have been extensively studied. Such diseases include immune-mediated inflammatory diseases (eg rheumatoid arthritis, immune-mediated renal disease, hepatobiliary disease, inflammatory bowel disease (IBD), psoriasis, and asthma), non-immune-mediated inflammatory diseases , Infections, immunodeficiency diseases, tumors, and transplant rejections. In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified.
In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified. Immune related diseases can be treated in one example by suppressing the immune response. The use of neutralizing antibodies that suppress molecules with immunostimulatory activity is beneficial for the treatment of immune-mediated and inflammatory diseases. Molecules that suppress immune responses (proteins directly or using antibody agonists) can be used to suppress immune responses and thus ameliorate immune-related diseases.
The following tests were conducted.

Ovalbumin antigen challenge Procedure: This assay was performed on 7 wild-type and 8 homozygotes. Chicken ovalbumin (OVA) is a T cell-dependent antigen and is commonly used as a model protein for investigating antigen-specific immune responses in mice. Even when no immune response is elicited, OVA is non-toxic, inactive and will not cause harm to animals. The mouse immune response to OVA has been well characterized to the extent that immunodominant peptides have been identified to elicit T cell responses. Anti-OVA antibodies can be detected 8-10 days after immunization using enzyme-linked immunosorbent assay (ELIZA), and analysis of different isotypes of antibodies can cause defective responses in genetically engineered mice More information about complex processes can be obtained.
As described above, this protocol evaluates the ability of mice to raise an antigen-specific immune response. Animals were administered IP with 50 mg of hen ovalbumin emulsified in complete Freund's adjuvant, and the serum titer of anti-ovalbumin antibodies (IgM, IgG1 and IgG2 subclasses) was measured 14 days later. The amount of OVA-specific antibody in the serum sample was proportional to the absorbance (OD) value obtained by the device scanning the 96 well sample plate. Data was collected for a set of serial dilutions for each serum sample. Analyzed wt / het / hom: 9/4/14
Results of this challenge: (− / −) mice exhibited an increase in mean serum IgG1 response to ovalbumin challenge compared to (+ / +) littermates. Therefore, these knockout mice exhibited an increased ability to elicit an OVA-specific antibody response against the T cell-dependent OVA antigen. In addition, inhibitors (antagonists) of PRO1891 polypeptides are expected to stimulate the immune system, and this effect is found to be useful in individuals such as leukemias and other types of cancer, and in immunocompromised patients such as AIDS patients. I will. Accordingly, PRO1891 polypeptides or agonists thereof are useful in inhibiting immune responses, and are useful candidates for suppressing adverse immune responses, for example in the case of graft rejection or graft-versus-host disease. .

(C) Bone metabolism: radiological phenotype analysis In the area of bone metabolism, here we identify targets for the treatment of arthritis, osteoporosis, osteopenia and marble bone disease, and targets that promote fracture healing Identified. The exam includes:
DEXA for measuring bone density in the femur and vertebra
-Micro CT for high resolution and high sensitivity measurement of cancellous and cortical bone density.
Dexa Analysis-Test Method Description Procedure: A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. Dual energy X-ray absorption measurement (DEXA) was successfully used to identify changes in bone. Anesthetized animals were examined and bone mineral density (BMC), BMC / LBM ratio, volumetric bone density (vBMD), whole body BMD, femoral BMD and vertebra BMD were measured.
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].

Bone micro CT analysis Procedure: Also very sensitive BMD measurements were performed using micro CT. One vertebra and one thigh were removed from a cohort of 4 wild type and 8 homozygous mice. Measurements were taken of the five vertebral traebecular volumes, traebecular thickness, bond density, and total bone area and cortical thickness of the mid-thigh. Detailed information on bone mass and structure was obtained by micro CT40 scan. Multiple bones were placed in the sample holder and scanned automatically. Instrument software was used to select areas of interest for analysis. The cancellous bone parameters were analyzed in the fifth lumbar vertebra (LV5) with 16 micrometer resolution, and the cortical bone parameters were analyzed in the mid-femoral axis with a resolution of 20 micrometers.
result:
DEXA: Male and female (-/-) mice show a decrease in mean bone mineral density, bone density and volumetric bone density when compared to gender-matched (+ / +) littermates and background means It was done.
Micro-CT analysis: In (− / −) mice, the mean spinal bone volume, number, thickness, and binding density compared to (+ / +) littermates and background means that matched their gender A decrease was shown. Analyzed wt / het / hom: 4/4/8.
These results indicate that knockout mutant mice show abnormal bone metabolism with significant bone loss similar to osteoporosis, characterized by bone loss with reduced density and possibly fragility leading to fractures. found. Therefore, PRO1891 or an agonist thereof is considered to function to maintain bone homeostasis. In addition, PRO1891 or its encoding gene is thought to be useful for bone healing, or for the treatment of osteoarthritis or osteoporosis. On the other hand, an antagonist of PRO1891 or a gene encoding the same is considered to cause abnormal or pathological bone disorders including inflammatory diseases related to abnormal bone metabolism such as arthritis, osteoporosis and osteopenia.

(D) Phenotypic analysis: Cardiology In the area of cardiovascular biology, hypertension, atherosclerosis, heart failure, stroke, various coronary artery diseases, dyslipidemias such as high cholesterol (hypercholesterolemia) and Targets for the treatment of elevated serum triglycerides (hypertriglyceridemia), diabetes and / or obesity have now been identified. Phenotypic tests include measurement of serum cholesterol and triglycerides.
Blood lipid Procedure:
A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. High cholesterol levels and triglyceride blood levels are recognized risk factors in the progression of cardiovascular disease and / or diabetes. Measuring blood lipids facilitates the discovery of biological switches that regulate blood lipid levels. Inhibition of factors that increase blood lipid levels may be useful to reduce the risk of cardiovascular disease. In blood chemistry tests, cholesterol measurements were recorded using COBAS Integra400 (mfr: Roche).
result:
Compared to (+ / +) littermates and background means with matched gender, (− / −) mice showed an increase in mean serum triglyceride levels.
In summary, (− / −) mice showed a marked increase in triglyceride levels when compared to (+ / +) littermates and background means that matched their gender. Thus, mutant mice lacking PRO1891 can be provided as a model of cardiovascular disease. PRO1891 polypeptide or its encoding gene is useful for the regulation of blood lipids such as triglycerides. Thus, PRO1891 polypeptides or agonists thereof are used to treat cardiovascular diseases such as hypertension, atherosclerosis, heart failure, stroke, various coronary artery diseases, hypercholesterolemia, hypertriglyceridemia, diabetes and / or obesity. Useful for.

(E) Phenotypic analysis: Metabolism-blood chemistry / glucose tolerance test In the area of metabolism, targets for the treatment of diabetes can be identified. Blood chemistry phenotype analysis includes blood glucose measurements. COBAS Integra400 (mfr: Roche) was used in the blood chemistry test for mice. In the area of metabolism, targets for the treatment of diabetes can be identified. The blood chemistry phenotype analysis includes a glucose tolerance test, which measures changes in insulin sensitivity and glucose metabolism. Abnormal glucose tolerance test results suggest, but are not limited to, the following disorders or conditions: Type 1 and Type 2 diabetes, X syndrome, various cardiovascular diseases and / or obesity.
Procedure: In this assay, a cohort of 2 wild type and 4 homozygous mice was tested. The glucose tolerance test is the standard for defining impaired glucose homeostasis in mammals. A glucose tolerance test was performed using a life scan glucometer. Animals were administered IP with 2 g / kg D-glucose as a 20% solution and blood glucose levels were measured at 0, 30, 60 and 90 minutes after administration. Analyzed wt / het / hom: 4/4/8.
Insulin data:
Study Description: Lexicon Genetics used the Cobra II series Auto-Gamma Counting System in a clinical setting for quantitative insulin assays in mice.
result:
Compared to (+ / +) littermates and background means with matched gender, (− / −) mice showed an increase in mean serum insulin levels.
However, blood chemistry studies showed an increase in mean serum glucose levels in (− / −) mice when compared to (+ / +) littermates and background means that matched their gender. The glucose tolerance test showed an increase in mean fasting serum glucose levels in (− / −) mice when compared to (+ / +) littermates and background means that matched their gender.
Thus, knockout mice showed a impaired glucose homeostasis phenotype with elevated fasting serum glucose levels suggesting signs of diabetes or pre-diabetes even when insulin levels were increased. Based on these results, it can be said that PRO1891 (or an agonist thereof) or its encoding gene is useful for the treatment of impaired glucose metabolism (expressed in insulin resistance) and / or diabetes.

Generation and Analysis of Mice with 35.25 DNA88804-2575 (UNQ1934) Gene Disruption In these knockout experiments, the gene encoding the PRO4409 polypeptide (designated DNA88004-2575 (UNQ1934)) was disrupted. The gene-specific information for these studies is as follows: The mutated mouse gene corresponds to: nucleotide reference number: NM — 028065 or deposit number: NM — 028065 NID: gi21312509 reference number NM — 02805.1. Musmus Cruz RIKEN cDNA 1600025D17 gene (1600025D17Rik); protein reference number: Q9DAU1 or deposit number: Q9DAU1 NID: Musmus Cruz (mouse). 1600025D17Rik protein (putative retinoic acid regulatory protein) (RIKEN cDNA 1600025D17 gene). MOUSESPTRNRDB; human gene sequence reference number: NM — 006586 or or homosapiens trinucleotide repeat containing 5 (TNRC5); human protein sequence is reference number Q9BT09 or deposit number: Q9BT09 NID: homosapiens (human). A hypothetical protein (DJ475N16.1) (CTG4A). HUMANSPTRNRDB. Corresponding to
The mouse gene of interest is a hypothetical protein (1600025D17Rik), an ortholog of the human protein TNRC5 (trinucleotide repeat containing 5). Aliases are CAG repeat-containing extension repeat domains and CAG / CTG.
TNRC5 is a hypothetical protein containing CAG repeats and appears to be most involved in specific diseases, those with neuropsychiatric signs (Margolis et al., Hum Genet, 100 (1): 114-22 (1997)). The protein contains a signal peptide but no other identifiable domains. The cellular location of TNRC5 is ambiguous, and bioinformatic analysis suggests that the protein is secreted or located in the endoplasmic reticulum. TNRC5 gene transcription appears to be under the control of retinoids and has an important role in development and physiology (Glozak et al., Mol Endocrinol, 17 (1): 27-41 (2003)).
Genetic information
wt het hom Total observation 20 37 10 67
Expected value 16.75 33.5 16.75 67
Chi-square = 3.72 Significance = 0.15595 (hom / n) = 0.15 Average number of pups = 8
Mutant: Retrovirus insertion (OST)
A retrovirus is inserted into the intron between encoded exons 1 and 2 (NCBI accession number NM — 02805.2)
Wild-type expression of the target gene was detected in 13 adult tissue samples tested by RT-PCR and embryonic stem (ES) cells in kidney, stomach, small and large intestine, and adipocytes.
Transcriptional expression analysis was not performed due to low survival. Target gene disruption was confirmed by inverse PCR.

35.25.1. Phenotypic analysis (disrupted gene: DNA88004-2575 (UNQ1934)
(A) Overview of overall phenotype:
Mutation of the gene encoding the ortholog of human trinucleotide repeat containing 5 (TNRC5) resulted in (-/-) mice with small growth failure. UNQ1934 has been shown to be ubiquitously expressed between 7.5d and 12.5d in wild-type offspring embryogenesis. (− / −) Mutants were euthanized by 3 weeks of age and dissected. 40% fewer homozygotes than expected were genotyped. Heterozygous (+/−) mice showed a reduction in total tissue mass and fat (% and grams) when compared to their wild-type littermate control individuals and background means.

Studies related to embryonic developmental abnormalities of lethality Embryonic lethality in knockout mice includes but is not limited to neurodegenerative diseases, angiogenic diseases, inflammatory diseases or genes / proteins fundamental to many types of cells Arise from a variety of serious developmental problems, including those that play an important role in the process of successful cell signaling. In addition, embryonic lethality is useful as a potential cancer model. Similarly, the corresponding heterozygous (+/−) mutant animals are particularly useful when they exhibit a phenotype and / or pathological report that reveals a highly informative clue regarding the function of the knockout gene. Useful. For example, EPO knockout animals are embryonic lethal, but pathological reports in the embryo showed a marked deletion of RBCs.

(B) Physical diagnostics-Tissue mass and lean body mass measurement-Dexa
(1) Dexa analysis—Explanation of the test Procedure: Change in total tissue mass (TTM) was identified using the dual energy X-ray absorption method (DEXA) successfully.
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Body measurements (length and weight)
Body measurement: Body length and weight were measured at about 16 weeks of age.
result:
Overall findings: (− / −) mice were small, showed growth failure and were euthanized by 3 weeks of age for pathological analysis.
Body weight: (− / −) mice showed a decrease in average body weight as measured in the second week when compared to their gender-matched (+ / +) littermates and background means.
Pathology:
Microscopic findings: (− / −) mice are smaller than (+ / +) littermates and die by 4 weeks of age. No histopathological lesions leading to early death were observed.
Gene expression: No new transcript expression was detected in the tissue panel analyzed by in situ hybridization.
Summary Compared to their (+ / +) littermates, the analyzed (− / −) mice had a significantly reduced survival rate, as indicated by the inability to survive up to 4 weeks of age. (− / −) Mice were very small in size and showed a significant decrease in body weight suggesting growth delay of these mutants. Although histopathological findings did not show any histopathological lesions, the negative phenotype showed tissue wasting symptoms with severe growth retardation. Thus, PRO4409 polypeptides or agonists thereof should be essential for normal growth and / or growth metabolism and are therefore useful in the treatment or prevention of growth diseases such as cachexia or other tissue debilitating diseases. It can be said that there is.

(2) Bone metabolism: radiological phenotype analysis In the area of bone metabolism, targets are identified here for the treatment of arthritis, osteoporosis, osteopenia and marble bone disease, and targets that promote fracture healing Identified. The exam includes:
DEXA for measuring bone density in the femur and vertebra
-Micro CT for high resolution and high sensitivity measurement of cancellous and cortical bone density.
Dexa Analysis-Test Method Description Procedure: Dual energy X-ray absorption measurement (DEXA) was successfully used to identify changes in bone. Anesthetized animals were examined and bone mineral density (BMC), BMC / LBM ratio, volumetric bone density (vBMD), whole body BMD, femoral BMD and vertebra BMD were measured.
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
result:
DEXA: (+/−) mice showed a decrease in mean total tissue mass, percent total fat and total fat mass when compared to gender matched (+ / +) littermates and background means.
These studies suggested that the mutant (+/−) non-human transgenic animals display a negative phenotype that may be associated with tissue wasting disease. Therefore, PRO4409 polypeptides or agonists thereof are essential for normal growth and metabolic processes, and are particularly important for the prevention and / or treatment of growth and / or tissue wasting diseases.

35.26. Generation and analysis of mice with DNA92265-2669 (UNQ2446) gene disruption In these knockout experiments, the gene encoding PRO5725 polypeptide (designated DNA92265-2669 (UNQ2446)) was disrupted. The gene specific information for these studies is as follows: the mutated mouse gene corresponds to: nucleotide reference number: NM — 175024 or Musmus Cruz RIKEN cDNA G630049C14 gene (G630049C14Rik); protein reference number: Q8BN06 Or deposit number: Q8BN06 NID: Musmus Cruz (mouse). Hypothetical protein; human gene sequence reference number: NM_198443 or homosapiens MRCC2446 (UNQ2446); human protein sequence corresponds to NP_940845 or MRCC2446 [homosapiens] gi | 37161883 | gb | AAQ89142.1 | .
The target mouse gene encodes a hypothetical protein (G630049C14Rik), which is an ortholog of the hypothetical human protein MRCC2446. The human gene is also known as UNQ2446.
Human and mouse genes encode putative secreted proteins. The mouse hypothetical protein also contains other than the signal peptide, C-terminal transmembrane portion and other identifiable domains. Human proteins contain other than signal peptides and other identifiable domains. Both proteins are slightly similar to neuritin, an extracellular protein anchored on the neuronal cell membrane that appears to be involved in neurite formation (Naeve et al., Proc Natl Acad Sci USA, 94 (6 ): 2648 53 (1997)).
Genetic information
wt het hom Total observation 20 30 15 65
Expected value 16.25 32.5 16.25 65
Chi-square = 1.15 Significance = 0.556162 (hom / n) = 0.23 Average number of pups = 7
Mutant: Retrovirus insertion (OST)
Retroviral insertion occurs within encoded exon 2 (deposit number NM — 175024.1)
Wild-type expression of the target gene was detected in 13 adult tissue samples tested by RT-PCR, as well as in all of the embryonic stem (ES) cells except skeletal muscle.
RT-PCR showed that the analyzed (− / −) mouse (M-121) had no transcript.

35.26.1. Phenotype analysis (disrupted gene: DNA92265-2669 (UNQ2446)
(A) Overview of overall phenotype:
Mutations in the gene encoding the hypothetical human protein ortholog were observed to reduce body weight, lean body mass, bone density and bone mineral content, and the fifth lumbar spine measurement. There was no transcription observed with RT-PCR.

(C) Physical diagnostics-Measurement of tissue mass and lean body mass-Dexa
Dexa Analysis-Test Description Procedure: In this assay, a cohort of 4 wild type, 4 heterozygotes and 8 homozygotes was tested. Dual energy X-ray absorption (DEXA) was successfully used to identify changes in total tissue mass (TTM).
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Body measurements (length and weight)
Body measurements: Body length and weight were measured at approximately 16 weeks of age.
result:
(− / −) Mice showed a decrease in mean body weight compared to gender-matched (+ / +) littermates and background means. Analyzed wt / het / hom: 28/36/22.
(− / −) Mice were very small in size and showed a significant decrease in body weight suggesting growth delay of these mutants. The pathological findings showed no histopathological lesions, but a negative phenotype suggested growth retardation. Therefore, the PRO5725 polypeptide or agonist thereof should be essential for normal growth and / or growth metabolism and can therefore be useful for the treatment or prevention of growth-related diseases.

(2) Bone metabolism: radiological phenotype analysis In the area of bone metabolism, targets are identified here for the treatment of arthritis, osteoporosis, osteopenia and marble bone disease, and targets that promote fracture healing Identified. The exam includes:
DEXA for measuring bone density in the femur and vertebra
-Micro CT for high resolution and high sensitivity measurement of cancellous and cortical bone density.
Dexa Analysis-Test Method Description Procedure: A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. Dual energy X-ray absorption measurement (DEXA) was successfully used to identify changes in bone. Anesthetized animals were examined and bone mineral density (BMC), BMC / LBM ratio, volumetric bone density (vBMD), whole body BMD, femoral BMD and vertebra BMD were measured.
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Bone micro CT analysis Procedure: Micro CT was also used to perform very sensitive BMD measurements. One vertebra and one thigh were removed from a cohort of 4 wild type and 8 homozygous mice. Measurements were taken of the five vertebral traebecular volumes, traebecular thickness, bond density, and total bone area and cortical thickness of the mid-thigh. Detailed information on bone mass and structure was obtained by micro CT40 scan. Multiple bones were placed in the sample holder and scanned automatically. Instrument software was used to select areas of interest for analysis. The cancellous bone parameters were analyzed in the fifth lumbar vertebra (LV5) with 16 micrometer resolution, and the cortical bone parameters were analyzed in the mid-femoral axis with a resolution of 20 micrometers.
result:
DEXA: (− / −) mice showed a reduction in mean lean body mass, bone mineral density and bone density when compared to gender matched (+ / +) littermates and background means.
Micro-CT analysis: In (− / −) mice, mean spinal bone volume, number, thickness, and bond density decreased when compared to gender-matched (+ / +) littermates and background means As well as a decrease in mean femoral mid-cortical thickness.
Analyzed wt / het / hom: 4/4/8.

Summary:
These results indicate that knockout mutant mice exhibit abnormal bone metabolism with significant bone loss similar to osteoporosis, characterized by bone loss with reduced density and possibly fragility leading to fractures. found. Therefore, it is thought that PRO5725 polypeptide or an agonist thereof functions to maintain bone homeostasis. In addition, PRO5725 or its encoding gene may be useful for maintaining bone homeostasis and bone healing, or for treating osteoarthritis or osteoporosis. On the other hand, an antagonist of PRO5725 or a gene encoding the same is considered to cause abnormal or pathological bone disorders including inflammatory diseases related to abnormal bone metabolism such as arthritis, osteoporosis and osteopenia.
The (− / −) mice analyzed by DEXA show a marked decrease in lean body mass compared to their (+ / +) littermates, suggesting a mutant growth retardation. This, when combined with abnormal findings in bone measurements, suggests tissue wasting such as cachexia or other growth-related diseases. Thus, PRO5725 polypeptides or agonists thereof are believed to be useful in the treatment of bone disorders and may be useful in the prevention of growth related diseases such as cachexia and / or other tissue wasting diseases.

Generation and Analysis of Mice with 35.27 DNA98591 (UNQ2506) Gene Disruption In these knockout experiments, the gene encoding the PRO5994 polypeptide (designated DNA98591 (UNQ2506)) was disrupted. The gene specific information for these studies is as follows: Mutated mouse genes correspond to the following: Nucleotide reference number: NM — 011463 or Musmuscle serine protease inhibitor, Kazal type 4 (Spink4); protein reference number: O35679 or deposit number: O35679 NID: Musmus Cruz (mouse). Serine protease inhibitor, Kazal type 4 precursor (peptide PEC-60 homolog) (MPGC60 protein). MOUSESPTRNRDB; human gene sequence reference number: NM_014471 or deposit number: NM_014471 NID: gi7657452 reference number NM_0144471.1 homosapiens serine protease inhibitor, Kazal type 4 (Spink4); human protein sequence, reference number O60575 or accession number: O60575 Sapiens (human). Serine protease inhibitor, Kazal type 4 precursor (peptide PEC-60 homolog). HUMANSPTRNRDB. Corresponding to
The mouse gene of interest is Spin4 (serine protease inhibitor, Kazal type 4), an ortholog of human SPINK4. Other names include MPGC60, PEC60, and digestive peptides.
SPINK4 is a putative secreted serine protease inhibitor that is mainly expressed in the intestinal tract (Krause et al., Differentiation, 63 (5): 285 94 (1998)). SPINK4 is an apparent human ortholog of porcine PEC60 (SwissProt P37109), which has been shown to inhibit glucose-induced insulin secretion. PEC60 was isolated from rat and pig brains (Norberg et al., Cell Mol Life Sci, 60 (2): 378 81 (2003)).
Targeted or gene trap mutations were generated in strain 129SvEv ^Brd -derived embryonic stem (ES) cells. Chimeric mice were crossed to C57BL / 6J albino mice to produce F1 heterozygous animals. These progeny were crossed to produce F2 wild type, heterozygous, and homozygous mutant progeny. Very occasionally, for example, when F1 mice are rarely obtained from the chimera, F1 heterozygous mice are crossed with 129SvEv ^Brd / C57 hybrid mice to generate additional heterozygous animals for cross fertilization and F2 mice. Was produced. Level 1 phenotypic analysis was performed on the mice thus produced.
wt het hom Total observation 21 41 27 89
Expected value 22.25 44.5 22.25 89
Chi-square = 1.36 Significance = 0.50673 (hom / n) = 0.30 Average number of pups = 9
Mutant: homologous recombination (standard)
Targeting coded exon 1 (NCBI deposit number NM — 01463.1)
Wild-type expression of the target gene was detected in all 13 adult tissue samples tested by RT-PCR, except brain, lung and skeletal muscle.
Southern hybridization analysis confirmed target gene disruption.

35.27.1. Phenotype analysis (broken gene: DNA98591 (UNQ2506)
(A) Summary of overall phenotype:
Mutations in the gene encoding the orthologue of the human serine protease inhibitor, Kazal type 4 (Spink4) reduced body weight and body length, as well as tissue mass measurements. The (− / −) mice also showed increased frequency of lymphocyte hyperplasia and tissue inflammation. Gene disruption was confirmed by Southern blotting.

(B) Bone metabolism and physical diagnosis (1) Measurement of tissue mass and lean body mass-Dexa
Dexa Analysis-Test Description Procedure: In this assay, a cohort of 4 wild type, 4 heterozygotes and 8 homozygotes was tested. Dual energy X-ray absorption (DEXA) was successfully used to identify changes in total tissue mass (TTM).
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Body measurements (length and weight):
Body measurement: Body length and body weight were measured at about 16 weeks of age.
result:
Overall findings: Agouti (-/-) mice were much smaller than their black (+ / +) littermates.
Compared to the background average, (− / −) mice showed a decrease in average body weight and a decrease in body length.

(2) Bone metabolism: radiological phenotype analysis In the area of bone metabolism, targets are identified here for the treatment of arthritis, osteoporosis, osteopenia and marble bone disease, and targets that promote fracture healing Identified. The exam includes:
DEXA for measuring bone density in the femur and vertebra
-Micro CT for high resolution and high sensitivity measurement of cancellous and cortical bone density.
Dexa Analysis-Test Method Description Procedure: A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. Dual energy X-ray absorption measurement (DEXA) was successfully used to identify changes in bone. Anesthetized animals were examined and bone mineral density (BMC), BMC / LBM ratio, volumetric bone density (vBMD), whole body BMD, femoral BMD and vertebra BMD were measured.
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
result:
DEXA: (− / −) mice showed a reduction in mean total tissue volume and lean body mass when compared to gender matched (+ / +) littermates and background means.
Analyzed wt / het / hom: 4/4/8.

Summary:
Based on the above results, the knockout mutant (− / −) mice analyzed by DEXA are very small in size, and there is a marked decrease in total tissue mass and lean body mass suggesting growth retardation in these mutants, as well as body weight and length. A decrease was shown. Thus, PRO5994 polypeptides or agonists thereof are essential for normal growth and / or growth metabolism and are therefore likely to be useful in the treatment or prevention of growth diseases, cachexies or other tissue wasting diseases.

(C) Pathological findings Knockout (-/-) mice showed increased frequency of lymphocyte hyperplasia and tissue inflammation.

Generation and analysis of mice with 35.28 DNA107701-2711 (UNQ2545) gene disruption In these knockout experiments, the gene encoding PRO6097 polypeptide (designated DNA107701-2711 (UNQ2545)) was disrupted. The gene specific information for these studies is as follows: The mutated mouse gene corresponds to the following: Nucleotide reference number: NM — 028787 or Musmuskull Solute Carrier Family 35, Member F5 (Slc35f5); protein reference number : Q9DBK9 or Q9DBK9 Q9DBK9 1300003P13RIK protein; human gene sequence reference number: NM — 025181 or homosapiens solute carrier family 35, member F5 (Slc35f5); Corresponding to RIKEN cDNA 1300003P13 gene (NS5ATP3).
The mouse gene of interest is Slc35f5 (solute carrier family 35, member F5) which is an ortholog of human SLC35F5. Alias names include 1300003P13Rik and FLJ22004.
SLC35F5 is a predicted complex cell membrane protein of unknown function and contains 10 transmembrane moieties. Most transmembrane moieties are contained within domains that are slightly similar to those found in carbohydrate / phosphate transporter (KOG4313) and drug permease (COG0697) (Marchler-Bauer et al., Nucleic Acids Res , 31 (1): 383-7 (2003)).
Targeted or gene trap mutations were generated in strain 129SvEv ^Brd -derived embryonic stem (ES) cells. Chimeric mice were crossed to C57BL / 6J albino mice to produce F1 heterozygous animals. These progeny were crossed to produce F2 wild type, heterozygous, and homozygous mutant progeny. Very occasionally, for example, when F1 mice are rarely obtained from the chimera, F1 heterozygous mice are crossed with 129SvEv ^Brd / C57 hybrid mice to generate additional heterozygous animals for cross fertilization and F2 mice. Was produced. Level 1 phenotypic analysis was performed on the mice thus produced.
wt het hom Total observation 17 35 12 64
Expected value 16 32 16 64
Chi-square = 1.34 Significance = 0.51075 (hom / n) = 0.19 Average number of pups = 7
Mutant: homologous recombination (standard)
Targeted encoded exons 1 to 3 (NCBI accession number NM — 0287.87.2)
Wild type expression of the target gene was detected in all 13 adult tissue samples and embryonic stem (ES) cells tested by RT-PCR except bone.
Southern hybridization analysis confirmed target gene disruption.

35.28.1. Phenotype analysis (disrupted gene: 107701-2711 (UNQ2545))
(A) Overview of overall phenotype:
Mutations in the gene encoding the ortholog of human solute carrier family 35, member F5 (SLC35F5) reduced body weight, total tissue mass, lean body mass and bone measurements in (− / −) mice. Mutant knockout mice also showed decreased or diminished IgG2a response to ovalbumin challenge. Furthermore, compared to the littermate control individuals, in mutant (-/-) mice, an increase in the proportion of T cells with a decrease in natural killer cells and B cells and an increase in the proportion of CD4 T cells is observed. An immune disorder was indicated. Gene disruption was confirmed by Southern blotting.

(B) Immunological phenotypic analysis Immune-related and inflammatory diseases are in normal physiology, responding to invasion or injury, initiating repair of invasion or injury, and innate and acquired protective power against foreign organisms. Physiological pathways important for the incorporation of are very complex and multiple connected signs or consequences. A disease or condition is a condition in which these normal physiological pathways are subject to additional invasion or injury, either directly as a result of abnormal control or excessive stimulation, as a response to self, or as a combination thereof. It occurs when causing.
The origins of these diseases often involve multiple pathways and often multiple different physiological systems / pathways, and intervening in multiple of these pathways can lead to remission or therapeutic effects. Can be mentioned. Therapeutic intervention can be done by antagonizing harmful processes / pathways or stimulating beneficial processes / pathways.
T lymphocytes (T cells) are an important component of a mammalian immune response. T cells recognize antigens associated with self-molecules encoded by genes within major histocompatibility antigens (MHC). Antigens can be expressed with MHC molecules on the surface of antigen-presenting cells, virus-infected cells, cancer cells, grafts and the like. T cell lines remove degenerative cells that pose a threat to the health of the host mammal. T cells include helper T cells and cytotoxic T cells. Helper T cells proliferate on a large scale when they recognize antigen-MHC complexes on antigen-presenting cells. Helper T cells also secrete various cytokines, lymphokines, which play a central role in the activity of B cells, cytotoxic T cells and various other cells that participate in the immune response.
In many immune responses, inflammatory cells infiltrate the site of injury or infection. Migrating cells are neutrophils, eosinophils, monocytes or lymphocytes, which can be determined by histological examination of the affected tissue. Current Protocols in Immunology, ed John E. Coligan, 1994 John Wiley & Sons, Inc.
Many immune related diseases are known and have been extensively studied. Such diseases include immune-mediated inflammatory diseases (eg rheumatoid arthritis, immune-mediated renal disease, hepatobiliary disease, inflammatory bowel disease (IBD), psoriasis, and asthma), non-immune-mediated inflammatory diseases , Infections, immunodeficiency diseases, tumors, and transplant rejections. In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified.
In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified. Immune related diseases can be treated in one example by suppressing the immune response. The use of neutralizing antibodies that suppress molecules with immunostimulatory activity is beneficial for the treatment of immune-mediated and inflammatory diseases. Molecules that suppress immune responses (proteins directly or using antibody agonists) can be used to suppress immune responses and thus ameliorate immune-related diseases.
The following tests were conducted.

Ovalbumin antigen challenge Procedure: This assay was performed on 7 wild-type and 8 homozygotes. Chicken ovalbumin (OVA) is a T cell-dependent antigen and is commonly used as a model protein for investigating antigen-specific immune responses in mice. Even when no immune response is elicited, OVA is non-toxic, inactive and will not cause harm to animals. The mouse immune response to OVA has been well characterized to the extent that immunodominant peptides have been identified to elicit T cell responses. Anti-OVA antibodies can be detected 8-10 days after immunization using enzyme-linked immunosorbent assay (ELIZA), and analysis of different isotypes of antibodies can cause defective responses in genetically engineered mice More information about complex processes can be obtained.
As described above, this protocol evaluates the ability of mice to raise an antigen-specific immune response. Animals were administered IP with 50 mg of hen ovalbumin emulsified in complete Freund's adjuvant, and the serum titer of anti-ovalbumin antibodies (IgM, IgG1 and IgG2 subclasses) was measured 14 days later. The amount of OVA-specific antibody in the serum sample was proportional to the absorbance (OD) value obtained by the device scanning the 96 well sample plate. Data was collected for a set of serial dilutions for each serum sample. Analyzed wt / het / hom: 8/4/9
Results of this antigen administration:
Compared to (+ / +) littermates and background means, (− / −) mice exhibited a decrease in mean serum IgG2a response to ovalbumin challenge. Thus, these knockout mice exhibited a reduced ability to elicit an OVA-specific antibody response against the T cell-dependent OVA antigen.
In summary, in the ovalbumin challenge test, knockout mice lacking the gene encoding PRO6097 polypeptide showed immune abnormalities compared to their wild-type littermates. In particular, mutant mice had a reduced ability to elicit an immune response when administered a T cell-dependent OVA antigen. Accordingly, PRO6097 polypeptides or agonists thereof are useful for stimulating the immune system (such as T cell proliferation) and this effect is effective in individuals such as leukemia and other types of cancer, and in immunocompromised patients such as AIDS patients. Will be useful when useful. Accordingly, inhibitors (antagonists) of PRO6097 polypeptides are useful in inhibiting immune responses, such as useful candidates for suppressing adverse immune responses in the case of graft rejection or graft-versus-host disease. It is.

Fluorescence activated cell classification (FACS) analysis Procedure:
FACS analysis of peripheral blood immune cell compositions including CD4, CD8 and T cell receptors for assessing T lymphocytes, CD19 for B lymphocytes, CD45 as a leukocyte marker, and natural killer cell pan NK was performed. . FACS analysis was performed on 2 wild type and 6 homozygous mice, including cells from thymus, spleen, bone marrow and lymph nodes.
In these studies, analyzed cells were isolated from thymus, peripheral blood, spleen, bone marrow and lymph nodes. Flow cytometry was designed to determine the relative proportion of CD4 and CD8 positive T cells, B cells, NK cells and monocytes of the mononuclear cell population. Immune status was assessed using a Becton-Dickinson FACSCalibur 3-laser FACS machine. For phenotypic analysis and screening, the machine recorded the number of CD4 + / CD8-, CD8 + / CD4-, NK, B cells and monocytes in addition to the CD4 + / CD8 + ratio.
Six strain-specific antibodies: mononuclear by staining a single sample of lysed peripheral blood of each mouse in a panel of CD45 PerCP, anti-TCRb APC, CD4 PE, CD8 FITC, pan NK PE and CD19 FITC Cell distribution was determined. The two FITC and PE antibodies color incompatible cell types. Samples were analyzed using a Becton Dickinson FACSCalibur flow cytometer with CellQuest software.
result:
FACS: Compared to their (+ / +) littermates and background average, (− / −) mice showed an increase in the proportion of T cells with a decrease in the average proportion of natural killer cells and B cells (CD4 T cell % Increase). Analyzed wt / het / hom: 7/4/8.
In summary, FACS results show that homozygous mutant mice exhibit characteristic immunological abnormalities with increased T cell numbers but reduced average proportions of natural killer cells and B cells. It has been suggested. [Natural killer cells are the first line of defense against viral infections because these cells are involved in viral immunity and defense against tumors]. Natural killer cells or NK cells act as antibody-dependent cell-mediated cytotoxic effectors and have been identified as capable of killing specific lymphoid tumor cell lines in vitro without the need for pre-immunization or activation . However, known functions in host defense are early in the infection of several intracellular pathogens, particularly herpesviruses. On the one hand, the beneficial effect of increasing T cell populations by knocking out the gene encoding PRO6097 polypeptide was shown. Thus, the PRO6097 polypeptide or PRO6097-encoding gene appears to act as a negative regulator of T cell proliferation. Opposite effects were shown for B cells and natural killer cell populations.

(B) Bone metabolism and physical diagnosis (1) Measurement of tissue mass and lean body mass-Dexa
Dexa Analysis-Test Description Procedure: In this assay, a cohort of 4 wild type, 4 heterozygotes and 8 homozygotes was tested. Dual energy X-ray absorption (DEXA) was successfully used to identify changes in total tissue mass (TTM).
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Body measurements (length and weight):
Body measurement: Body length and body weight were measured at about 16 weeks of age.
result:
(− / −) Mice showed an increase in average body weight when compared to their gender matched (+ / +) littermates and background means. Analyzed wt / het / hom: 21/40/15.

(2) Bone metabolism: radiological phenotype analysis In the area of bone metabolism, targets are identified here for the treatment of arthritis, osteoporosis, osteopenia and marble bone disease, and targets that promote fracture healing Identified. The exam includes:
DEXA for measuring bone density in the femur and vertebra
-Micro CT for high resolution and high sensitivity measurement of cancellous and cortical bone density.
Dexa Analysis-Test Method Description Procedure: A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. Dual energy X-ray absorption measurement (DEXA) was successfully used to identify changes in bone. Anesthetized animals were examined and bone mineral density (BMC), BMC / LBM ratio, volumetric bone density (vBMD), whole body BMD, femoral BMD and vertebra BMD were measured.
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Bone micro CT analysis Procedure: Micro CT was also used to perform very sensitive BMD measurements. One vertebra and one thigh were removed from a cohort of 4 wild type and 8 homozygous mice. Measurements were taken of the five vertebral traebecular volumes, traebecular thickness, bond density, and total bone area and cortical thickness of the mid-thigh. Detailed information on bone mass and structure was obtained by micro CT40 scan. Multiple bones were placed in the sample holder and scanned automatically. Instrument software was used to select areas of interest for analysis. The cancellous bone parameters were analyzed in the fifth lumbar vertebra (LV5) with 16 micrometer resolution, and the cortical bone parameters were analyzed in the mid-femoral axis with a resolution of 20 micrometers.
result:
DEXA: In (− / −) mice, mean total tissue volume, lean body mass, bone mineral density, and bone density in the whole body and thigh compared to (+ / +) littermates and background averages with matched gender Increased.
Micro-CT: Knockout (-/-) showed an increase in cancellous bone volume, number, and binding density compared to its littermates.
In summary, (− / −) mice have increased body weight and length, average total tissue volume and increased lean body mass, and bone density measurements and (+ / +) littermates of matched gender. An increase in cancellous bone measurements was shown. Heterozygous mice (+/−) showed similar bone effects, but the increase in measured values was between wild-type and homozygous values. These findings suggest an obesity and / or growth disease type phenotype. Furthermore, the mutant (− / −) mice showed abnormal bone measurements. Therefore, PRO6097 polypeptide or an agonist thereof is useful for normal growth and bone development, and can be said to have a role in the treatment of related growth or metabolic diseases associated with bone diseases such as obesity and / or marble bone disease.

35.29. Generation and analysis of mice with DNA 108792-2753 (UNQ2966) gene disruption In these knockout experiments, the gene encoding PRO7425 polypeptide (designated DNA108792-2753 (UNQ2966)) was disrupted. The gene specific information for these studies is as follows: the mutated mouse gene corresponds to: nucleotide reference number: NM — 176993 or Musmus Cruz RIKEN cDNA A530065I17 gene (A530065I17Rik); protein reference number: NP — 799677 Or RIKEN cDNA A530065I17 gene (Musmus crus); human gene sequence reference number: NM — 198275 or homosapiens hypothetical protein LOC196264 (LOC196264); human protein sequence corresponds to reference number: NP — 936016 or hypothetical protein LOC196264 [homosapiens] .
The disrupted mouse gene encodes a hypothetical protein (provisional name, A530065I17Rik), which is an ortholog of the hypothetical human protein FLJ38080. Other names for human loci include LOC196264 and QQRG2966.
Analysis of FLJ38080 showed that two transmembrane domains (one near each end) were adjacent to the central Igv-type motif (InterPro IPR0003596). This feature suggests that the protein is partly or completely extracellular and is probably involved in signal transduction or protein-protein interactions.
Genetic information
wt het hom Total observation 16 32 20 68
Expected value 17 34 17 68
Chi-square = 0.71 Significance = 0.770262 (hom / n) = 0.29 Average number of pups = 8
Mutant: Retrovirus insertion (OST)
Retroviral insertion occurs in the intron between encoded exons 2 and 3 (NCBI accession number BQ713326)
Wild-type expression of the target gene was detected in all 13 adult tissue samples tested by RT-PCR except thymus, lung, skeletal muscle and adipocytes.
RT-PCR analysis showed that the analyzed (− / −) mice (M-75) had no transcripts.

35.29.1. Phenotypic analysis (disrupted gene: DNA108792-2753 (UNQ2966)
(A) Overview of overall phenotype:
Mutation of the gene encoding an ortholog of a hypothetical human protein (FLJ38080) caused (− / −) mice to show sebaceous hyperplasia and severe growth retardation. In addition, (− / −) mice showed a decrease in the mean body weight and a decrease in the bone measure. In addition, (− / −) mice showed severe depletion of body fat storage material and kidney hypertrophy. In (− / −) mice, low insulin levels as well as abnormal changes in mean serum ALT (alanine aminotransaminase) and alkaline phosphatase (possibly due to bone mineral calcification) suggesting liver disease were observed. Furthermore, mutant (− / −) mice exhibited severe functional decline in the circadian rhythm test. There was no transcription observed with RT-PCR.

(B) Phenotypic analysis: CNS / neurology In the field of neurology, the analysis here is epilepsy, generalized anxiety disorder, attention deficit hyperactivity disorder, obsessive compulsive disorder, schizophrenia, cognitive impairment, pain sensation The focus was on identifying in vivo validated targets for the treatment of neurological and psychiatric disorders, including hypersensitivity and sensory disorders. Neurological disorders include but are not limited to mild to moderate anxiety, anxiety disorders due to general medical conditions, unspecified anxiety disorders, generalized anxiety disorders, panic attacks, panic disorders that indicate agoraphobia, Panic disorder without agoraphobia, post-traumatic stress syndrome, social phobia, specific phobias, substance-induced anxiety disorder, acute alcohol withdrawal, obsessive compulsive disorder, agoraphobia, bipolar disorder I or II Including those classified in “anxiety disorders” including bipolar disorders, cardiovascular disorders, depressive disorders, major depressive disorders, mood disorders, and substance-induced mood disorders, not otherwise specified. In addition, anxiety disorders may be applied to personality disorders, including but not limited to the following types: paranoia, social dislike, avoidance behavior, borderline personality disorder, addiction, hysteria, self-love, obsessive-compulsive nerve Schizophrenia and schizophrenia type personality.
procedure:
Behavioral screening was performed on a cohort of 4 wild-type, 4 heterozygotes and 8 homozygous mutant mice. All behavioral tests were performed between 12 and 16 weeks of age unless earlier testing was required for reduced viability. These trials included open fields for measuring anxiety, activity levels and exploration.

Open field test:
Some targets of known drugs showed phenotype in open field tests. These include seratonin transporters, dopamine transporters (Giros et al., Nature. 1996 Feb 15; 379 (6566): 606-12), and GABA receptors (Homanics et al., Proc Natl Acad Sci US A. 1997 Apr 15; 94 ( 8): Including 4143-8) knockout. An automated open field assay was customized to deal with changes in search patterns related to emotional state and learning. First, the field (40 × 40 cm) was selected to be relatively large with respect to the mouse, thus taking up changes in locomotion associated with the search. There are also four holes in the floor that allow you to poke the nose, an activity that is particularly relevant to exploration. Several factors were also designed to enhance the emotional state associated with this trial. The open field test was the first experimental procedure in which mice were tested, and the measurements made were the first experience with the subject's chambers. The open field was brightly lit. All of these factors increase the natural anxiety associated with new and open spaces. The pattern and degree of exploration activity, in particular the total distance traveled from the center, can then identify changes in susceptibility to anxiety or depression. A large active area (40 cm × 40 cm, AccuScan Instruments VersaMax animal activity monitoring system) using infrared beams at three different levels was used to record standing, thrusting into the hole, and locomotor activity. The animal was placed in the center and its activity was measured for 20 minutes. Data from this test was analyzed 5 times at 4 minute intervals. The total distance traveled (cm), the number of vertical movements (rise), the number of hole penetrations, and the total distance traveled from the center were recorded.
The tendency of mice to show a normal habituation response to the new environment is assessed by determining the total change in their horizontal locomotion over 5 time intervals. This calculated slope of change in activity over time is determined using the total travel distance normalized rather than the absolute value. The slope is determined from the regression line through normalized activity in each of the five time intervals. Normal habit effects are represented by negative slope values.
result:
Compared to (+ / +) littermates, (− / −) mice had reduced standard wander during the open field test. This suggests abnormalities in the adaptive response of the mutant to the new environment.

Explanation of circadian testing:
Female mice were housed individually in a 48.2 cm x 26.5 cm home cage at 4 pm on the first day of testing and provided food and water as needed. The animals were exposed to a 12 hour light / dark cycle with lights on at 7 am and lights off at 7 pm. With this system software, the number of light interruptions caused by animal movements is recorded, with light blocking automatically splitting into gait. Activity was recorded 60 times at 1 hour intervals in a 3-day study. The resulting data was represented by the intermediate total activity of each light / dark period (spontaneous momentum) over the 3 day test period, and the intermediate activity level (circadian rhythm) recorded at each hour. Thus, mutant (− / −) mice showed severe functional decline. Analyzed wt / het / hom: 4/4/8.
result:
Compared to gender-matched (+ / +) littermates and background means, (− / −) mice were one hour adaptable, 12 hours adaptable, and light-dark during the home cage activity test. Showed unusual activity. (− / −) Mice showed no diurnal changes during the 3 day study period.
As already outlined, significant differences were observed in the home cage activity test. Compared to their (+ / +) littermates, (− / −) mice exhibited a decrease in the number of walks during the second light period. In addition, homozygous (− / −) mice have a reduced activity ratio of light to dark and light to total periods compared to their (+ / +) littermates, which An abnormal circadian rhythm response of the body is suggested. These results are consistent with the findings of the open field test, suggesting that homozygous mutant mice usually display circadian rhythms associated with lethargy or depression disorders. Thus, the PRO7425 polypeptide or its encoding gene is useful for the treatment of such neurological disorders including depressive disorders or other reduced anxiety-like symptoms.

Function observation battery (FOB) test:
Test Description: FOB is a set of conditions applied to animals to measure global sensory and motor deficits. A subset of the Irwin neurological screen test is used to assess overall neurological function. In general, short-term tactile, olfactory, and visual stimuli are applied to animals to determine their ability to detect and respond normally. These simple tests take approximately 10 minutes and the mice are returned to their home cage at the end of the test.
result:
Basic sensory and motor findings: Compared to their (+ / +) littermates, all eight (-/-) mice showed hair loss along with bruises in a functional observation battery test It was.

(C) Bone metabolism and physical diagnosis (1) Tissue mass and lean body mass measurement-Dexa
Dexa Analysis-Test Description Procedure: A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. Dual energy X-ray absorption (DEXA) was successfully used to identify changes in total tissue mass (TTM).
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI, ie whole body, vertebrae and both thighs).
Body measurements (length and weight)
Body measurement: Body length and weight were measured at about 16 weeks of age.
result:
Overall findings: (-/-) mice are darker and darker than their (+ / +) littermates, have darker and more sticky stool, and have thin, oily hair with bald spots. It was.
Male and female (− / −) mice showed a decrease in average body weight and a decrease in average body length when compared to their gender-matched (+ / +) littermates and background averages.
Also, (− / −) mice had a reduced average heart rate when compared to (+ / +) littermates and background averages of matched gender.
Analyzed wt / het / hom: 12/23/17.
Pathology:
Microscopic findings: (− / −) mice were diffuse but showed increased sebaceous hyperplasia. Mutant skin lesions differed in severity from one area to the other and were usually not associated with inflammation. Even in areas containing growing hair follicles, the majority of sebaceous glands were active and hyperplastic.
Gene expression: No new transcript expression was detected in the tissue panel analyzed by in situ hybridization. Analyzed wt / het / hom: 2/1/6.

(2) Bone metabolism: radiological phenotype analysis In the area of bone metabolism, targets are identified here for the treatment of arthritis, osteoporosis, osteopenia and marble bone disease, and targets that promote fracture healing Identified. The exam includes:
DEXA for measuring bone density in the femur and vertebra
-Micro CT for high resolution and high sensitivity measurement of cancellous and cortical bone density.
Dexa Analysis-Test Method Description Procedure: A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. Dual energy X-ray absorption measurement (DEXA) was successfully used to identify changes in bone. Anesthetized animals were examined and bone mineral density (BMC), BMC / LBM ratio, volumetric bone density (vBMD), whole body BMD, femoral BMD and vertebra BMD were measured.
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Bone micro CT analysis Procedure: Micro CT was also used to perform very sensitive BMD measurements. One vertebra and one thigh were removed from a cohort of 4 wild type and 8 homozygous mice. Measurements were taken of the five vertebral traebecular volumes, traebecular thickness, bond density, and total bone area and cortical thickness of the mid-thigh. Detailed information on bone mass and structure was obtained by micro CT40 scan. Multiple bones were placed in the sample holder and scanned automatically. Instrument software was used to select areas of interest for analysis. The cancellous bone parameters were analyzed in the fifth lumbar vertebra (LV5) with 16 micrometer resolution, and the cortical bone parameters were analyzed in the mid-femoral axis with a resolution of 20 micrometers.
CAT scan procedure:
Mice were injected intraperitoneally with the CT contrast agent Omnipaque 300 (Nycomed Amershan, 300 mg iodine per ml, 0.25 ml per animal, or 2.50-3.75 g iodine per kg body weight). After resting in the cage for less than 10 minutes, the mice were sedated by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight). The anesthetized animal on the test table was laid in the prone position, and a CAT scan was performed using a microCAT scanner (ImTek, Inc.). Three-dimensional images were reconstructed with the Feldkamp algorithm for workstation clusters using ImTek 3D RECON software.

result:
DEXA: Male and female (− / −) mice have weight-related measurements (total tissue mass, lean body mass, total fat mass) when compared to gender-matched (+ / +) litters and background means. And% total body fat) and bone mineral-related measurements (bone mineral content, volumetric bone density, and whole body, vertebral and femoral bone density). This suggests severe growth retardation in the mutant.
Micro-CT: (− / −) mice have decreased vertebral cancellous bone volume, number, thickness and bond density when compared to gender matched (+ / +) littermates and background means, It showed a decrease in the thickness and cross-sectional area of the mean femoral midshaft cortex.
These results indicate that knockout mutant mice show abnormal bone metabolism with significant bone loss similar to osteoporosis, characterized by bone loss with reduced density and possibly fragility leading to fractures. found. Therefore, PRO7425 or an agonist thereof appears to be useful in maintaining bone homeostasis function. Furthermore, PRO7425 or its encoding gene is useful for bone healing or the treatment of arthritis or osteoporosis, while antagonists to PRO7425 or its encoding gene are associated with abnormal bone metabolism such as arthritis, osteoporosis and osteopenia It is thought to cause abnormal or pathological bone disorders including inflammatory diseases.
CAT scan: All three (-/-) mice used in the study generally showed reduced body size and severe depletion of abdominal and subcutaneous body fat storage materials. Two mutants (M-83 and M-121) had bilaterally expanded kidneys when compared to their (+ / +) and (+/-) littermates with normal body size . However, no obvious lesions were observed in the kidney. Analyzed wt / het / hom: 4/4/9.
Thus, in summary, the (− / −) mice analyzed by DEXA are very small in size, indicating a decrease in bone mineral density and bone density suggesting growth retardation in these mutants, a decrease in total tissue and lean body mass, body There was a significant decrease in fat storage material and a significant decrease in body weight and length. These findings were consistent with tissue wasting symptoms and / or growth retardation. Thus, PRO7425 polypeptide or an agonist thereof should be essential for normal growth and / or growth metabolism and therefore would be useful in the treatment or prevention of growth diseases, cachexies or other tissue wasting diseases. .

(D) Phenotypic analysis: metabolism-blood chemistry In the area of metabolism, targets for the treatment of diabetes can be identified. Blood chemistry phenotype analysis includes the measurement of serum insulin levels as an indicator of changes in full-course metabolism. Abnormal glucose tolerance test results suggest the following disorders or conditions: type 1 and type 2 diabetes, syndrome X, various cardiovascular diseases and / or obesity.
Insulin data:
Study Description: Lexicon Genetics used the Cobra II series Auto-Gamma Counting System in a clinical setting for quantitative insulin assays in mice.
result:
Compared to (+ / +) littermates and background means with matched gender, (− / −) mice showed an increase in mean serum insulin levels. Furthermore, in other blood chemistry analyses, mutant (− / −) mice showed an increase in mean serum ALT (alanine aminotransaminase) and serum alkaline phosphatase suggesting liver disease. Ketones were also found in the urine of mutant mice. These results suggest a diabetic phenotype.

35.30. Generation and analysis of mice with DNA129542-2808 (UNQ3103) gene disruption In these knockout experiments, the gene encoding PRO10102 polypeptide (designated DNA129542-2808 (UNQ3103)) was disrupted. The gene-specific information for these studies is as follows: Mutated mouse genes correspond to: Nucleotide reference number: NM — 021319 or Musmus Cruz peptidoglycan recognition protein-like (Pglypl-pending); protein reference number : NP — 067294 or peptidoglycan recognition protein-like; TAG-like (Musmus crus); human gene sequence reference number: NM — 052890 or homosapiens peptidoglycan recognition protein L precursor (PGRP-L); human protein sequence reference number: NP — 443122 or peptidoglycan recognition Corresponds to protein L precursor (PGRP-L) [Homo sapiens].
The target mouse gene is peptidoglycan recognition protein-like (Pglyrpl-pending), an ortholog of human peptidoglycan recognition protein L precursor (PGRP-L). Alias names include TAGL, tagL, PGRP-L, TAGL-β, tagl-β, TAGL-α, tagL-α, PGLYRPL, TAGL-like and TAG-like.
PGRP-L is a conserved N-acetylmuramoyl-L-alanine amidase expressed in the liver that cleaves lactylamide bonds in bacterial cell wall peptidoglycans (Gelius et al., Biochem Biophys Res Commun, 306 (4): 988-94 (2003)). Bioinformatic analysis of PGRP-L suggested that the protein was secreted and contained a signal peptide and a C-terminal “N-acetylmuramoyl-L-alanine amidase” domain (Pfam 01510). However, PGRP-L can be an essential membrane protein (Kibardin et al., J Mol Biol, 326 (2): 467-74 (2003)).
Mutants lacking the C-terminal amidase catalytic domain can bind gram positive bacteria, gram negative bacteria and peptidoglycans. This suggests that the catalytic and peptidoglycan-binding domains are different (Kibardin et al., 2003). PGRP-L appears to work in innate immunity, bacterial recognition and degradation in the liver (Gelius et al., Biochem Biophys Res Commun, 306 (4): 988-94 (2003), Kibardin et al., J Mol Biol, 326 (2): 467-74 (2003)).
Targeted or gene trap mutations were generated in strain 129SvEv ^Brd -derived embryonic stem (ES) cells. Chimeric mice were crossed to C57BL / 6J albino mice to produce F1 heterozygous animals. These progeny were crossed to produce F2 wild type, heterozygous, and homozygous mutant progeny. Very occasionally, for example, when F1 mice are rarely obtained from the chimera, F1 heterozygous mice are crossed with 129SvEv ^Brd / C57 hybrid mice to generate additional heterozygous animals for cross fertilization and F2 mice. Was produced. Level 1 phenotypic analysis was performed on the mice thus produced.
wt het hom Total observation 17 35 16 68
Expected value 17 34 17 68
Chi-square = 0.09 Significance = 0.995684 (hom / n) = 0.24 Average number of pups = 7
Mutant: homologous recombination (standard)
Targeting coded exons 1 to 2 (NCBI accession number NM — 021319)
Wild-type expression of the target gene was detected in all 13 adult tissue samples and embryonic stem (ES) cells tested by RT-PCR except kidney, testis and bone.
Southern hybridization analysis confirmed target gene disruption.

35.30.1. Phenotype analysis (disrupted gene: 129542-2808 (UNQ3103))
(A) Overview of overall phenotype:
Mutation of the gene encoding the orthologue of human peptidoglycan recognition protein L precursor (PGRP-L) reduced anxiety-related responses in female (− / −) mice. However, male (− / −) mice did not show the same response. There was a strong tendency to suffer from stress-induced hyperthermia seen in mutant (− / −) mice. Although these findings indicate an anxiety-related phenotype, the expression patterns unique to the liver do not suggest the consequences of these behaviors. Gene disruption was confirmed by Southern blot.
(B) Expression pattern UNQ3103 shows very specific expression in the liver (see Example 41 for procedures).

(C) Phenotypic analysis: CNS / neurology In the field of neurology, the analysis here is epilepsy, generalized anxiety disorder, attention deficit hyperactivity disorder, obsessive compulsive disorder, schizophrenia, cognitive impairment, pain sensation The focus was on identifying in vivo validated targets for the treatment of neurological and psychiatric disorders, including hypersensitivity and sensory disorders. Neurological disorders include but are not limited to mild to moderate anxiety, anxiety disorders due to general medical conditions, unspecified anxiety disorders, generalized anxiety disorders, panic attacks, panic disorders that indicate agoraphobia, Panic disorder without agoraphobia, post-traumatic stress syndrome, social phobia, specific phobias, substance-induced anxiety disorder, acute alcohol withdrawal, obsessive compulsive disorder, agoraphobia, bipolar disorder I or II Including those classified in “anxiety disorders” including bipolar disorders, cardiovascular disorders, depressive disorders, major depressive disorders, mood disorders, and substance-induced mood disorders, not otherwise specified. In addition, anxiety disorders may be applied to personality disorders, including but not limited to the following types: paranoia, social dislike, avoidance behavior, borderline personality disorder, addiction, hysteria, self-love, obsessive-compulsive nerve Schizophrenia and schizophrenia type personality.
procedure:
Behavioral screening was performed on a cohort of 4 wild-type, 4 heterozygotes and 8 homozygous mutant mice. All behavioral tests were performed between 12 and 16 weeks of age unless earlier testing was required for reduced viability. These trials included open fields for measuring anxiety, activity levels and exploration.

Open field test:
Some targets of known drugs showed phenotype in open field tests. These include seratonin transporters, dopamine transporters (Giros et al., Nature. 1996 Feb 15; 379 (6566): 606-12), and GABA receptors (Homanics et al., Proc Natl Acad Sci US A. 1997 Apr 15; 94 ( 8): Including 4143-8) knockout. An automated open field assay was customized to deal with changes in search patterns related to emotional state and learning. First, the field (40 × 40 cm) was selected to be relatively large with respect to the mouse, thus taking up changes in locomotion associated with the search. There are also four holes in the floor that allow you to poke the nose, an activity that is particularly relevant to exploration. Several factors were also designed to enhance the emotional state associated with this trial. The open field test was the first experimental procedure in which mice were tested, and the measurements made were the first experience with the subject's chambers. The open field was brightly lit. All of these factors increase the natural anxiety associated with new and open spaces. The pattern and degree of exploration activity, in particular the total distance traveled from the center, can then identify changes in susceptibility to anxiety or depression. A large active area (40 cm × 40 cm, AccuScan Instruments VersaMax animal activity monitoring system) using infrared beams at three different levels was used to record standing, thrusting into the hole, and locomotor activity. The animal was placed in the center and its activity was measured for 20 minutes. Data from this test was analyzed 5 times at 4 minute intervals. The total distance traveled (cm), the number of vertical movements (rise), the number of hole penetrations, and the total distance traveled from the center were recorded.
The tendency of mice to show a normal habituation response to the new environment is assessed by determining the total change in their horizontal locomotion over 5 time intervals. This calculated slope of change in activity over time is determined using the total travel distance normalized rather than the absolute value. The slope is determined from the regression line through normalized activity in each of the five time intervals. Normal habit effects are represented by negative slope values.
result:
Differences were seen in the open field test. Compared to gender-matched (+ / +) littermates and background means, female (− / −) mice showed an increase in median total time in the middle. Male (-/-) mice did not show the same response.
As noted above, differences were observed in the open field activity test. Compared to (+ / +) littermates with matched gender, female (− / −) mice showed an increase in median total time in the middle. This suggests a decrease in the anxiety-like response of the mutant. Hence, knockout mice showed a phenotype consistent with depressive disorder, schizophrenia and / or bipolar disease. Therefore, the PRO10102 polypeptide and its agonists may be useful for the treatment and amelioration of symptoms associated with depressive disorders.

Function observation battery (FOB) test:
Test Description: FOB is a set of conditions applied to animals to measure global sensory and motor deficits. A subset of the Irwin neurological screen test is used to assess overall neurological function. In general, short-term tactile, olfactory, and visual stimuli are applied to animals to determine their ability to detect and respond normally. These simple tests take approximately 10 minutes and the mice are returned to their home cage at the end of the test.
result:
Mutant (− / −) mice showed a strong tendency to suffer from stress-induced hyperthermia (3/4 (− / −) mice tested increased 2 standard deviations (2SD) over the background average) showed that).

35.31. Generation and analysis of mice with DNA 148380-2827 (UNQ3126) gene disruption In these knockout experiments, the gene encoding PRO10282 polypeptide (designated DNA148380-2827 (UNQ3126)) was disrupted. The gene specific information for these studies is as follows: The mutated mouse gene corresponds to: nucleotide reference number: NM_009291 or deposit number NM_009291 NID: gi66778170 reference number NM_009291.1 Musmus Cruz retinoic acid Stimulated by gene 6 (Stra6); protein reference number: O70491 or deposit number: O70491NID: Musmus Cruz (mouse). Retinoic acid responsive protein. MOUSESPTRNRDB; human gene sequence reference number: NM_022369 or accession number NM_022369 NID: gi2131699 reference number NM_022369.2 homosapiens hypothetical protein FLJ12541 similar to Stra6; Sapiens (human). Corresponding to STRA6 isoform HUMANSPTRNRDB.
The mouse gene of interest is an orthologue of human “stimulated by retinoic acid gene 6” and is Stra6 (stimulated by retinoic acid gene 6). Other names include FLJ12541.
Stra6 is a possibly complex cell membrane protein induced by retinoic acid. The protein has eight transmembrane domains but does not contain any other identifiable domains. Stra6 is often located in blood organ disorders and can function as a component of transport devices. Stra6 is expressed in Sertoli cells (Bouillet et al., Mech Dev, 63 (2): 173-86 (1997)) during spermatogenic development and in developing mouse thighs (Chazaud et al., Dev Genet, 19 ( 1): 66-73 (1996)). Wnt-1 enhances retinoid-induced Stra6 expression and Stra6 mRNA can be overexpressed in human colorectal cancer as well as other tumors controlled by activation of the Wnt-1 / β-catenin pathway (Szeto et al., Cancer Res, 61 (10): 4197-205 (2001), Tice et al., J Biol Chem, 277 (16): 14329-35 (2002)).
Genetic information
wt het hom Total observations 16 34 19 69
Expected value 17.25 34.5 17.25 69
Chi-square = 0.28 Significance = 0.887138 (hom / n) = 0.28 Average number of pups = 7
Mutant: Retrovirus insertion (OST)
A retrovirus is inserted into the intron between encoded exons 1 and 2 (NCBI accession number NM_009291.1)
Wild-type expression of the target gene was detected in brain, thymus and lung among 13 adult tissue samples tested by RT-PCR.
RT-PCR analysis revealed that the analyzed (− / −) mice (M-76) had no transcripts. Target gene disruption was confirmed by inverse PCR.

35.31.1. Phenotype analysis (disrupted gene: DNA148380-2827 (UNQ3126))
(A) Overview of overall phenotype:
Due to the mutation of the gene encoding the ortholog of “what is stimulated by retinoic acid gene 6” (STRA6), growth delay and bone measurements were observed in (− / −) mice. (− / −) Mice also increased mean serum glucose levels. There were no transcripts observed with RT-PCR.

(B) Bone metabolism and physical diagnosis (1) Measurement of tissue mass and lean body mass-Dexa
Dexa Analysis-Test Description Procedure: In this assay, a cohort of 4 wild type, 4 heterozygotes and 8 homozygotes was tested. Dual energy X-ray absorption (DEXA) was successfully used to identify changes in total tissue mass (TTM).
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI, ie whole body, vertebrae and both thighs).
Body measurements (length and weight):
Body measurement: Body length and body weight were measured at about 16 weeks of age.
result:
(− / −) Mice showed a decrease in mean body weight when compared to (+ / +) littermates and background means that matched their gender. Analyzed wt / het / hom: 16/37/19.

(2) Bone metabolism: radiological phenotype analysis In the area of bone metabolism, targets are identified here for the treatment of arthritis, osteoporosis, osteopenia and marble bone disease, and targets that promote fracture healing Identified. The exam includes:
DEXA for measuring bone density in the femur and vertebra
-Micro CT for high resolution and high sensitivity measurement of cancellous and cortical bone density.
Dexa Analysis-Test Method Description Procedure: A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. Dual energy X-ray absorption measurement (DEXA) was successfully used to identify changes in bone. Anesthetized animals were examined and bone mineral density (BMC), BMC / LBM ratio, volumetric bone density (vBMD), whole body BMD, femoral BMD and vertebra BMD were measured.
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].
Bone micro CT analysis Procedure: Micro CT was also used to perform very sensitive BMD measurements. One vertebra and one thigh were removed from a cohort of 4 wild type and 8 homozygous mice. Measurements were taken of the five vertebral traebecular volumes, traebecular thickness, bond density, and total bone area and cortical thickness of the mid-thigh. Detailed information on bone mass and structure was obtained by micro CT40 scan. Multiple bones were placed in the sample holder and scanned automatically. Instrument software was used to select areas of interest for analysis. The cancellous bone parameters were analyzed in the fifth lumbar vertebra (LV5) with 16 micrometer resolution, and the cortical bone parameters were analyzed in the mid-femoral axis with a resolution of 20 micrometers.

result:
DEXA: (-/-) mice showed a decrease in mean total tissue mass and lean body mass when compared to gender matched (+ / +) littermates and background means. In addition to these notable changes, fat (% and gram), bone density and bone mineral content were all lower than their wild-type littermates, consistent with (− / −) mice that showed a decrease in size. It was.
Micro-CT: Compared with (+ / +) littermates and background averages that matched their gender, (− / −) mice showed a decrease in mean vertebral cancellous bone volume, number, thickness and bond density, and mean thigh The bone thickness and cross-sectional area of bone axis cortex were reduced.
These results indicate that knockout mutant mice show abnormal bone metabolism with significant bone loss similar to osteoporosis, characterized by bone loss with reduced density and possibly fragility leading to fractures. found. Thus, PRO10282 or agonists thereof may be useful in maintaining bone homeostasis function. In addition, PRO10282 or its encoding gene is useful for bone healing or the treatment of arthritis or osteoporosis, while antagonists to PRO10282 or its encoding gene are associated with abnormal bone metabolism such as arthritis, osteoporosis and osteopenia. It is thought to result in abnormal or pathological bone disorders including associated inflammatory diseases.
Thus, in summary, the (− / −) mice analyzed by DEXA are very small in size, indicating a decrease in bone mineral density and bone density, lean body mass and total tissue mass, suggesting growth delay of these mutants. It showed a decrease, a significant depletion of body fat storage material, and a significant decrease in body weight and length. Therefore, the PRO10282 polypeptide or agonist thereof should be essential for normal growth and / or growth metabolism and is therefore useful for the treatment or prevention of growth diseases, cachexies or other tissue wasting diseases. I can say that.

(E) Phenotypic analysis: Metabolism-blood chemistry / glucose tolerance test In the area of metabolism, targets for the treatment of diabetes can be identified. Blood chemistry phenotype analysis includes blood glucose measurements. COBAS Integra400 (mfr: Roche) was used in the blood chemistry test for mice. In the area of metabolism, targets for the treatment of diabetes can be identified. The blood chemistry phenotype analysis includes a glucose tolerance test, which measures changes in insulin sensitivity and glucose metabolism. Abnormal glucose tolerance test results suggest, but are not limited to, the following disorders or conditions: Type 1 and Type 2 diabetes, X syndrome, various cardiovascular diseases and / or obesity.
Procedure: In this assay, a cohort of 2 wild type and 4 homozygous mice was tested. The glucose tolerance test is the standard for defining impaired glucose homeostasis in mammals. A glucose tolerance test was performed using a life scan glucometer. Animals were administered IP with 2 g / kg D-glucose as a 20% solution and blood glucose levels were measured at 0, 30, 60 and 90 minutes after administration. Analyzed wt / het / hom: 4/4/8.
result:
Blood chemistry: (-/-) mice showed an increase in mean serum glucose levels when compared to (+ / +) littermates and background means that matched their gender. In the glucose tolerance test, (− / −) mice showed an increase in mean fasting serum glucose levels when compared to (+ / +) littermates and background means that matched their gender.
Thus, knockout mice exhibited a impaired glucose homeostasis phenotype pattern with elevated levels of fasting serum glucose suggesting symptoms of diabetes or pre-diabetes. Based on these results, it can be said that PRO10282 (or an agonist thereof) or its encoding gene is useful for the treatment of impaired glucose metabolism and / or diabetes.

35.32. Generation and analysis of mice with the DNA347767 (UNQ14964) gene disruption In these knockout experiments, the gene encoding the PRO61709 polypeptide (designated DNA347767 (UNQ14964)) was disrupted. The gene specific information for these studies is as follows: the mutated mouse gene corresponds to the following: nucleotide reference number: NM — 172294 or Musmus Cruz sulfatase 1 (Sulf1); protein reference number: Q8K007 or deposit Number: Q8K007 NID: Musmus Cruz (mouse). Extracellular sulfatase Sulf-1 precursor (EC 3.1.6.-) (MSulf-1); human gene sequence reference number: NM — 015170 or homosapiens sulfatase 1 (SULF1); human protein sequence reference number: Q8IWU6 or extracellular It corresponds to the sulfatase Sulf-1 precursor (HSulf-1) gi | 27356932 | gb | AAM768860.1 | extracellular sulfatase SULF-1 [homosapiens].
The disrupted mouse gene is Sulf1 (sulfatase 1), an ortholog of human SULF1. Other names include AW121680, extracellular sulfatase SULF-1, SULF-1, HSULF-1, KIAA1077, and sulfatase FP.
SULF1 is a secreted allylsulfatase that has the ability to remove sulfate from glucosamine within a small region of heparin. This effect on heparin appears to inhibit signaling by heparin-dependent growth factors, thereby inhibiting cell proliferation and facilitating apoptosis (Morimoto-Tomita, et al., J Biol Chem, 277 ( 51): 49175-85 (2002), Lai et al., J Biol Chem, 278 (25): 23107-17 (2003), Lai et al., Gastroenterology, 126 (1): 231-48 (2004)). Downregulation of SULF1 may be a mechanism by which certain types of cancer cells enhance growth factor signaling (Lai et al., J Biol Chem, 278 (25): 23107-17 (2003)).
Targeted or gene trap mutations were generated in strain 129SvEv ^Brd -derived embryonic stem (ES) cells. Chimeric mice were crossed to C57BL / 6J albino mice to produce F1 heterozygous animals. These progeny were crossed to produce F2 wild type, heterozygous, and homozygous mutant progeny. Very occasionally, for example, when F1 mice are rarely obtained from the chimera, F1 heterozygous mice are crossed with 129SvEv ^Brd / C57 hybrid mice to generate additional heterozygous animals for cross fertilization and F2 mice. Was produced. Level 1 phenotypic analysis was performed on the mice thus produced.
wt het hom Total observations 31 44 19 94
Expected value 23.5 47 23.5 94
Chi-square = 3.45 Significance = 0.17846 (hom / n) = 0.20 Average number of pups = 9
Mutant: Retrovirus insertion (OST)
Insertion occurs in the intron before encoded exon 1 (NCBI accession number NM — 1722.94.1)
Wild type expression of the target gene was detected in all 13 adult tissue samples tested by RT-PCR as well as in embryonic stem (ES) cells.
RT-PCR analysis revealed that the analyzed (− / −) mice (M-208) had no transcripts.

35.32.1. Phenotypic analysis (disrupted gene: DNA347767 (UNQ14964)
(A) Summary of overall phenotype:
Mutation of the gene encoding the ortholog of human sulfatase 1 (SULF1) resulted in a decrease in MCP-1 response to IL-6, TNFα and LPS challenge in (− / −) mice. There were no transcripts observed with RT-PCR.

(B) Immunological phenotypic analysis Immune-related and inflammatory diseases are in normal physiology, responding to invasion or injury, initiating repair of invasion or injury, and innate and acquired protective power against foreign organisms. Physiological pathways important for the incorporation of are very complex and multiple connected signs or consequences. A disease or condition is a condition in which these normal physiological pathways are subject to additional invasion or injury, either directly as a result of abnormal control or excessive stimulation, as a response to self, or as a combination thereof. It occurs when causing.
The origins of these diseases often involve multiple pathways and often multiple different physiological systems / pathways, and intervening in multiple of these pathways can lead to remission or therapeutic effects. Can be mentioned. Therapeutic intervention can be done by antagonizing harmful processes / pathways or stimulating beneficial processes / pathways.
T lymphocytes (T cells) are an important component of a mammalian immune response. T cells recognize antigens associated with self-molecules encoded by genes within major histocompatibility antigens (MHC). Antigens can be expressed with MHC molecules on the surface of antigen-presenting cells, virus-infected cells, cancer cells, grafts and the like. T cell lines remove degenerative cells that pose a threat to the health of the host mammal. T cells include helper T cells and cytotoxic T cells. Helper T cells proliferate on a large scale when they recognize antigen-MHC complexes on antigen-presenting cells. Helper T cells also secrete various cytokines, lymphokines, which play a central role in the activity of B cells, cytotoxic T cells and various other cells that participate in the immune response.
In many immune responses, inflammatory cells infiltrate the site of injury or infection. Migrating cells are neutrophils, eosinophils, monocytes or lymphocytes, which can be determined by histological examination of the affected tissue. Current Protocols in Immunology, ed John E. Coligan, 1994 John Wiley & Sons, Inc.
Many immune related diseases are known and have been extensively studied. Such diseases include immune-mediated inflammatory diseases (eg rheumatoid arthritis, immune-mediated renal disease, hepatobiliary disease, inflammatory bowel disease (IBD), psoriasis, and asthma), non-immune-mediated inflammatory diseases , Infections, immunodeficiency diseases, tumors, and transplant rejections. In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified.
In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified. Immune related diseases can be treated in one example by suppressing the immune response. The use of neutralizing antibodies that suppress molecules with immunostimulatory activity is beneficial for the treatment of immune-mediated and inflammatory diseases. Molecules that suppress immune responses (proteins directly or using antibody agonists) can be used to suppress immune responses and thus ameliorate immune-related diseases.
The following tests were conducted.

Acute phase response:
Test Description: Bacterial lipopolysaccharide (LPS) is an endotoxin and as such is a potent inducer of the acute phase response and systemic inflammation. Level 1 LPS mice were injected intraperitoneally with a sublethal dose of LPS in 200 μL of sterile saline using a 26 gauge needle. The dose was 1 μg / g body weight 3 hours after injection based on the average body weight of the tested mice. A 100 μl blood sample was then taken and analyzed for the presence of TNFa, MCP-1, and IL-6 with a FACSCalibur instrument.
result:
(− / −) Mice showed a decrease in mean serum IL-6 (and TNF-α and MCP-1) responses to LPS challenge compared to their (+ / +) pups. Analyzed wt / het / hom: 8/4/8.
In summary, administration of LPS endotoxin antigen has demonstrated that knockout mice lacking the gene encoding PRO61709 polypeptide exhibit immunological abnormalities compared to their wild-type pups. In particular, mutant mice showed reduced ability to elicit an immunological response (production of TNF-α, MCP-1 and IL-6) when administered LPS endotoxin antigen. This indicates a lack of pro-inflammatory response. IL-6, MCP-1 and TNFα contribute to the subsequent B cell activation stage. In addition, they play an important role in the induction of acute phase responses and systemic inflammation. This indicates that the PRO61709 polypeptide or agonist thereof stimulates the immune system and can be used in immunocompromised patients, such as leukemia and other types of cancer, and AIDS patients, if this effect is beneficial to the individual. I think that the. Accordingly, inhibitors or antagonists of PRO61709 polypeptides are useful for suppressing immune responses and are useful candidates for suppressing adverse immune responses in the case of, for example, graft rejection or graft-versus-host disease.

Generation and Analysis of Mice with 35.33 DNA58801-1052 (UNQ455) Gene Disruption In these knockout experiments, the gene encoding PRO779 polypeptide (designated DNA58801-1052 (UNQ455)) was disrupted. The gene specific information for these studies is as follows: The mutated mouse gene corresponds to: nucleotide reference number: NM_033042 or deposit number: NM_033042 NID: 14719437 Musmus Cruz Musmus Cruz Tumor Necrosis Factor Receptor Superfamily, member 12 (Tnfrsfl2); protein reference number: Q99MM1 or deposit number: Q99MM1 Q99MM1 WSL-1-like protein; human gene sequence reference number: NM_003790 or deposit number: NM_003790 NID: 4507568 homosapiens tumor necrosis factor receptor Superfamily, member 12 (translocation chain-associated membrane protein) (TNFRSF12); human protein sequence corresponds to: 93038 or TR12_ human Q93038 WSL-1 protein precursor apoptosis -MEDI.
The mouse gene of interest is Tnfrsf25 (tumor necrosis factor receptor superfamily, member 25), an ortholog of human TNFRSF25. Other names include DR3, TR3, Wsl, DDR3, LARD, APO-3, TRAMP, WSL-1, WSL-LR, Tnfrsf12, WSL-1 protein, death receptor β, death domain receptor 3, apoptosis-inducing receptor, apoptosis mediator Receptor, death domain receptor 3 soluble form, death lymphocyte-related receptor, translocation chain-paired membrane protein, and tumor necrosis factor receptor superfamily member 12.
TNFRSF25 is expressed in thymocytes and lymphocytes that function as receptors for the ligands TNFSF12 (tumor necrosis factor (ligand) superfamily, member 12) and TNFSF15 (tumor necrosis factor (ligand) superfamily, member 15). Type cell membrane protein. Activation of TNFRSF25 stimulates apoptosis or, conversely, promotes T cell expansion by nuclear factor κ-B-mediated processes (Chinnaiyan et al., Science 274 (5289): 990-2 (1996), Kitson Et al., Nature 384 (6607): 372-5 (1996), Migone et al., Immunity 16 (3): 479-92 (2002), Wen et al., J Biol Chem 278 (40): 39251-8 (2003)). TNFRSF25 appears to have a role in lymphocyte homeostasis. Wang et al., Mol Cell Biol 21 (10): 3451-61 (2001) showed that negative selection and anti-CD3-induced apoptosis were impaired in TNFRSF25 homozygous null mice but not in wild-type mice. . This suggests that there is no duplication in removing thymic autoreactive T cells.
Targeted or gene trap mutations were generated in strain 129SvEv ^Brd -derived embryonic stem (ES) cells. Chimeric mice were crossed to C57BL / 6J albino mice to produce F1 heterozygous animals. These progeny were crossed to produce F2 wild type, heterozygous, and homozygous mutant progeny. Very occasionally, for example, when F1 mice are rarely obtained from the chimera, F1 heterozygous mice are crossed with 129SvEv ^Brd / C57 hybrid mice to generate additional heterozygous animals for cross fertilization and F2 mice. Was produced. Level 1 phenotypic analysis was performed on the mice thus produced.
wt het hom Total observations 21 42 21 84
Expected value 21 42 21 84
Chi-square = 0.00 Significance = 1.00000 (hom / n) = 0.25 Average number of pups = 8
Mutant: homologous recombination (standard)
Targeted encoded exons 1 to 5 (NCBI accession number NM — 033042.2)
Wild type expression of the target gene was detected in all 13 adult tissue samples tested by RT-PCR as well as in embryonic stem (ES) cells.
RT-PCR analysis showed that the analyzed (− / −) mice (M-208) had no transcripts.

35.33.1. Phenotypic analysis (disrupted gene: DNA58801-1052 (UNQ455)
(A) Summary of overall phenotype:
Mutations in the gene encoding the ortholog of the tumor necrosis factor receptor superfamily, member 12 (TNFRSFl2) reduce (− / −) lumbar fifth vertebral measurements in (− / −) mice when compared to wild-type littermate controls and background means did. In addition, mutant knockout mice had enhanced IgG responses to ovalbumin challenge.

(B) Immunological phenotypic analysis Immune-related and inflammatory diseases are in normal physiology, responding to invasion or injury, initiating repair of invasion or injury, and innate and acquired protective power against foreign organisms. Physiological pathways important for the incorporation of are very complex and multiple connected signs or consequences. A disease or condition is a condition in which these normal physiological pathways are subject to additional invasion or injury, either directly as a result of abnormal control or excessive stimulation, as a response to self, or as a combination thereof. It occurs when causing.
The origins of these diseases often involve multiple pathways and often multiple different physiological systems / pathways, and intervening in multiple of these pathways can lead to remission or therapeutic effects. Can be mentioned. Therapeutic intervention can be done by antagonizing harmful processes / pathways or stimulating beneficial processes / pathways.
T lymphocytes (T cells) are an important component of a mammalian immune response. T cells recognize antigens associated with self-molecules encoded by genes within major histocompatibility antigens (MHC). Antigens can be expressed with MHC molecules on the surface of antigen-presenting cells, virus-infected cells, cancer cells, grafts and the like. T cell lines remove degenerative cells that pose a threat to the health of the host mammal. T cells include helper T cells and cytotoxic T cells. Helper T cells proliferate on a large scale when they recognize antigen-MHC complexes on antigen-presenting cells. Helper T cells also secrete various cytokines, lymphokines, which play a central role in the activity of B cells, cytotoxic T cells and various other cells that participate in the immune response.
In many immune responses, inflammatory cells infiltrate the site of injury or infection. Migrating cells are neutrophils, eosinophils, monocytes or lymphocytes, which can be determined by histological examination of the affected tissue. Current Protocols in Immunology, ed John E. Coligan, 1994 John Wiley & Sons, Inc.
Many immune related diseases are known and have been extensively studied. Such diseases include immune-mediated inflammatory diseases (eg rheumatoid arthritis, immune-mediated renal disease, hepatobiliary disease, inflammatory bowel disease (IBD), psoriasis, and asthma), non-immune-mediated inflammatory diseases , Infections, immunodeficiency diseases, tumors, and transplant rejections. In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified.
In the field of immunology, targets for the treatment of inflammation and inflammatory diseases have been identified. Immune related diseases can be treated in one example by suppressing the immune response. The use of neutralizing antibodies that suppress molecules with immunostimulatory activity is beneficial for the treatment of immune-mediated and inflammatory diseases. Molecules that suppress immune responses (proteins directly or using antibody agonists) can be used to suppress immune responses and thus ameliorate immune-related diseases.
The following tests were conducted.

Ovalbumin antigen challenge Procedure: This assay was performed on 7 wild-type and 8 homozygotes. Chicken ovalbumin (OVA) is a T cell-dependent antigen and is commonly used as a model protein for investigating antigen-specific immune responses in mice. Even when no immune response is elicited, OVA is non-toxic, inactive and will not cause harm to animals. The mouse immune response to OVA has been well characterized to the extent that immunodominant peptides have been identified to elicit T cell responses. Anti-OVA antibodies can be detected 8-10 days after immunization using enzyme-linked immunosorbent assay (ELIZA), and analysis of different isotypes of antibodies can cause defective responses in genetically engineered mice More information about complex processes can be obtained.
As described above, this protocol evaluates the ability of mice to raise an antigen-specific immune response. Animals were administered IP with 50 mg of hen ovalbumin emulsified in complete Freund's adjuvant, and the serum titer of anti-ovalbumin antibodies (IgM, IgG1 and IgG2 subclasses) was measured 14 days later. The amount of OVA-specific antibody in the serum sample was proportional to the absorbance (OD) value obtained by the device scanning the 96 well sample plate. Data was collected for a set of serial dilutions for each serum sample. Analyzed wt / het / hom: 8/4/9
Results of this antigen administration:
Compared to its (+ / +) littermates and background means, (− / −) mice exhibited an increase in mean serum IgG2a response to ovalbumin challenge. Therefore, these knockout mice exhibited an increased ability to elicit an OVA-specific antibody response against the T cell-dependent OVA antigen.
In summary, in the ovalbumin challenge test, knockout mice lacking the gene encoding PRO779 polypeptide showed immune abnormalities compared to their wild-type littermates. In particular, mutant mice were enhanced in their ability to elicit an immune response when administered a T cell-dependent OVA antigen. Thus, inhibitors or agonists of PRO779 polypeptides are useful for stimulating the immune system (such as T cell proliferation), and this effect is such as individuals such as leukemia and other types of cancer, and immunocompromised patients such as AIDS patients. Will be useful if it helps. Accordingly, PRO779 polypeptides or agonists thereof are useful in inhibiting immune responses and are useful candidates for suppressing adverse immune responses, for example in the case of graft rejection or graft-versus-host disease. .

(B) Bone metabolism: radiological phenotype analysis In the area of bone metabolism, here we identify targets for the treatment of arthritis, osteoporosis, osteopenia and marble osteopathy, and targets that promote fracture healing Identified. The exam includes:
DEXA for measuring bone density in the femur and vertebra
-Micro CT for high resolution and high sensitivity measurement of cancellous and cortical bone density.
Dexa Analysis-Test Method Description Procedure: A cohort of 4 wild type, 4 heterozygotes and 8 homozygotes were tested in this assay. Dual energy X-ray absorption measurement (DEXA) was successfully used to identify changes in bone. Anesthetized animals were examined and bone mineral density (BMC), BMC / LBM ratio, volumetric bone density (vBMD), whole body BMD, femoral BMD and vertebra BMD were measured.
Mice were anesthetized by intraperitoneal injection of Avertin (1.25% 2,2,2-tribromoethanol, 20 ml / kg body weight), body length and body weight were measured, then PIXImus ™ densitometer for DEXA scan The mouse was placed in the prone position on the (Lunar Inc.) platform. Lunar PIXImus software was used to measure bone density (BMD) and fat composition (% fat) and total tissue mass (TTM) in the region of interest (ROI) [ie whole body, vertebrae and both thighs].

Bone micro CT analysis Procedure: Also very sensitive BMD measurements were performed using micro CT. One vertebra and one thigh were removed from a cohort of 4 wild type and 8 homozygous mice. Measurements were taken of the five vertebral traebecular volumes, traebecular thickness, bond density, and total bone area and cortical thickness of the mid-thigh. Detailed information on bone mass and structure was obtained by micro CT40 scan. Multiple bones were placed in the sample holder and scanned automatically. Instrument software was used to select areas of interest for analysis. The cancellous bone parameters were analyzed in the fifth lumbar vertebra (LV5) with 16 micrometer resolution, and the cortical bone parameters were analyzed in the mid-femoral axis with a resolution of 20 micrometers.
result:
Micro CT: (− / −) mice show a decrease in bone volume fifth lumbar vertebrae measurements, cancellous bone number and decreased binding density when compared to gender matched (+ / +) littermates and background means It was. These results indicate that knockout mutant mice show abnormal bone metabolism with significant bone loss similar to osteoporosis, characterized by bone loss with reduced density and possibly fragility leading to fractures. found. Thus, it appears that PRO779 polypeptide or an agonist thereof works to maintain bone homeostasis. In addition, PRO779 or its encoding gene is useful in maintaining bone homeostasis and may be important for bone healing, or useful for the treatment of osteoarthritis or osteoporosis, while antagonists to PRO779 or The encoded gene is believed to lead to abnormal or pathological bone disorders including inflammatory diseases associated with abnormal bone metabolism such as arthritis, osteoporosis and osteopenia.

Example 36: PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258 as hybridization probe, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1413, PRO1413, PRO1413, PRO1413 , PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 The following methods are used: PRO196, PRO217, PRO231, PRO236, PRO245, PRO246 8, PRO 287, PRO 328, PRO 344, PRO 357, PRO 526, PRO 724, PRO 731, PRO 732, PRO 1003, PRO 1104, PRO 1151, PRO 1244, PRO 1298, PRO 1313, PRO 1570, PRO 1886, PRO 1891, PRO 10409, PRO 10291, PRO Describes the use of nucleotide sequences encoding PRO61709 or PRO779 polypeptides as hybridization probes.
Full length or mature PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO12, PRO1104 DNA comprising a sequence encoding PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 is a homologous DNA of a human tissue cDNA library or a human tissue genomic library (PRO196, PRO2 7, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1259, PRO13598, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or those encoding a naturally occurring variant of PRO779 polypeptide, etc.).
Hybridization and washing of filters containing any library DNA was performed under the following high stringency conditions. Radiolabels PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1187 Hybridization of PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 derived probes to the filter was performed using 50% formamide, 5 × SSC, 0.1% SDS, 0.1% sodium pyrophosphate, 50 mM. Sodium phosphate pH 6.8, 2 × Denhardt's solution, and was carried out over 20 hours at 42 ° C. in a 10% solution of dextran sulfate. The filter was washed at 42 ° C. in 0.1 × SSC and 0.1% SDS aqueous solution.
Next, full-length native sequences PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1413, PRO1413, PRO11513PRO , PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or DNA having the desired sequence identity with the polypeptide using the standard techniques known in the art. Could be identified.

Example 37: PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1413, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 Expression of PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 This example is expressed by recombinant expression in E. coli PRO196, PRO217, PRO231, PRO246, PRO246, RO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, RO18910, RO18409, RO4409P The preparation of an aglycosylated form of PRO61709 or PRO779 polypeptide is illustrated.
First, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO12413PRO DNA sequences encoding the PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides were amplified using selected PCR primers. This primer must contain a restriction enzyme site corresponding to the restriction enzyme site on the selected expression vector. A variety of expression vectors can be used. An example of a suitable vector is pBR322 (derived from E. coli; see Bolivar et al., Gene, 2:95 (1977)) containing genes for ampicillin and tetracycline resistance. The vector was digested with restriction enzymes and dephosphorylated. The PCR amplified sequence was then ligated to the vector. The vector is preferably an antibiotic resistance gene, trp promoter, polyHis leader (including the first 6 STII codons, polyHis sequence, and enterokinase cleavage site), PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, RO4409, RO4594, RO4 PRO779 De region comprises a sequence encoding a lambda transcriptional gathered factors and argU gene.
This ligation mixture was then utilized to transform selected E. coli strains using the method described in Sambrook et al. (Supra). Transformants were identified by their ability to grow on LB plates and then antibiotic resistant colonies were selected. Plasmid DNA was isolated and could be confirmed by restriction analysis and DNA sequencing.
Selected clones could be grown overnight in liquid medium such as LB broth supplemented with antibiotics. This overnight culture may then be used to inoculate a larger scale culture. Cells are then grown to the desired optical density, during which the expression promoter begins to act.
After further culturing the cells for several hours, the cells can be collected by centrifugation. Cell pellets obtained by centrifugation can be solubilized using various agents known in the art, and then lysed PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357. , PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO1097, RO102PRO82 Under conditions that allow secure binding It can be purified using the genus chelating column.

PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10012, PRO1304, PRO1304, PRO1304, PRO1304, PRO1304 , PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 may be expressed in E. coli. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213 DNA encoding PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 was first amplified using selected PCR primers. This primer provides a restriction enzyme site that corresponds to the restriction enzyme site of the selected expression vector, and efficient and reliable translation initiation, rapid purification on metal chelate columns, and proteolytic removal with enterokinase. Contains other useful sequences to give. The PCR-amplified poly-His tag sequence was then ligated into an expression vector, which was used for transformation of an E. coli host based on strain 52 (W3110 fuhA (tonA) longalErpoHts (htpRts) clpP (lacIq)). Transformants were first treated with 3-5 O.D. with shaking at 30 ° C. in LB containing 50 mg / ml carbenicillin. D. Grow to 600. The culture was then added to CRAP medium (3.57 g (NH ₄ ) ₂ SO ₄ , 0.71 g sodium citrate · 2H 2 O, 1.07 g KCl, 5.36 g Difco yeast extract, 5.36 g in 500 mL water. Diluted 50-100 fold in Sheffield hycase SF and 110 mM MPOS, pH 7.3, mixed with 0.55% (w / v) glucose and 7 mM MgSO ₄ ) and shaken at 30 ° C. Grow for about 20-30 hours. Samples were removed to confirm expression by SDS-PAGE analysis, and the bulk medium was centrifuged so that the cells were pelleted. The cell pellet was frozen until purification and refolding (refolding).

E. coli paste from 0.5 to 1 L fermentation (6-10 g pellet) was resuspended in 10 volumes (w / v) in 7 M guanidine, 20 mM Tris, pH 8 buffer. Solid sodium sulfate and sodium tetrathionate were added to final concentrations of 0.1 M and 0.02 M, respectively, and the solution was stirred at 4 ° C. overnight. This step results in a denatured protein in which all cysteine residues are blocked with sulfite. The solution was concentrated in a Beckman Ultracentrifuge at 40,000 rpm for 30 minutes. The supernatant is diluted with 3-5 volumes of metal chelate column buffer (6M guanidine, 20 mM Tris, pH 7.4) and filtered through a 0.22 micron filter for clarity. The clear extract was loaded onto a 5 ml Qiagen Ni-NTA metal chelate column equilibrated with metal chelate column buffer. The column was washed with an addition buffer containing 50 mM imidazole (Calbiochem, Utrol grade), pH 7.4. The protein was eluted with a buffer containing 250 mM imidazole. Fractions containing the desired protein were pooled and stored at 4 ° C. The protein concentration was estimated by its absorption at 280 nm using the extinction coefficient calculated based on its amino acid sequence.
By gradually diluting the sample in freshly prepared regeneration buffer consisting of 20 mM Tris, pH 8.6, 0.3 M NaCl, 2.5 M urea, 5 mM cysteine, 20 mM glycine and 1 mM EDTA, The protein was regenerated. The refolding volume was selected so that the final protein concentration was 50-100 μg / ml. The refolding solution was slowly stirred at 4 ° C. for 12-36 hours. The refolding reaction was stopped by adding TFA at a final concentration of 0.4% (about pH 3). Prior to further purification of the protein, the solution was filtered through a 0.22 micron filter and acetonitrile was added at a final concentration of 2-10%. The renatured protein was chromatographed on a Poros R1 / H reverse phase column using a 0.1% TFA transfer buffer and elution with a 10-80% acetonitrile gradient. Aliquots of fractions with A280 absorption were analyzed on SDS polyacrylamide gels and fractions containing homologous regenerative proteins were pooled. In general, most correctly regenerated protein species are eluted at the lowest concentration of acetonitrile because these species are the most compact and their hydrophobic inner surface is shielded from interaction with the reverse phase resin. Aggregated species are usually eluted at higher acetonitrile concentrations. In addition to removing the incorrectly regenerated protein from the desired form, the reverse phase process also removes endotoxin from the sample.
Desired regenerated PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1213, PRO1213, PRO1213, PRO1213 Fractions containing PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides were pooled and acetonitrile was removed using a gentle stream of nitrogen directed at the solution. The protein was prepared in 20 mM Hepes, pH 6.8 containing 0.14 M sodium chloride and 4% mannitol by gel filtration and sterile filtration on G25 Superfine (Pharmacia) resin equilibrated with dialysis or preparation buffer.

Example 38: PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1104, RO1213, PRO1413, PRO1413, PRO1213, PRO1213, PRO1213 Expression of PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 This example is a potentially glycosylated form of PRO196, PRO217, PRO231 by recombinant expression in mammalian cells. , PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, RO1598, RO1 The preparation of PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides is illustrated.
The vector pRK5 (see EP307,247 published on March 15, 1989) was used as an expression vector. In some cases, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1213, RO1213, PRO1213, PRO1213 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 DNA is ligated to pRK5 having a selected restriction enzyme and PRO196, PRO217 using the ligation method as described in Sambrook et al. , PRO231 PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, RO1598, RO1 PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 DNA is inserted. The resulting vectors are pRK5-PRO227, pRK5-pRK5-PRO233, pRK5-PRO217, pRK5-PRO1328, pRK5-PRO4342, pRK5-PRO7423, pRK5-PRO10096, pRK5-PRO21K, pRK5-R35PRO
The selected host cell can be a 293 cell. Human 293 cells (ATCC CCL 1573) were grown and confluent in tissue culture plates in media such as DMEM supplemented with fetal bovine serum and optionally nourishing ingredients and / or antibiotics. About 10 μg of pRK5-PRO227, pRK5-pRK5-PRO233, pRK5-PRO217, pRK5-PRO1328, pRK5-PRO4342, pRK5-PRO7423, pRK5-PRO10096, pRK5-PRO21K, pRK5-PRO3584 It was mixed with gene-encoded DNA [Thimmappaya et al., Cell, 31: 543 (1982))] and dissolved in 500 μl of 1 mM Tris-HCl, 0.1 mM EDTA, 0.227 M CaCl ₂ . To this mixture, drop-like 500 μl of 50 mM HEPES (pH 7.35), 280 mM NaCl, 1.5 mM NaPO ₄ was added, and a precipitate was formed at 25 ° C. for 10 minutes. The precipitate was suspended and added to 293 cells and allowed to settle for about 4 hours at 37 ° C. The medium was aspirated and 2 ml of 20% glycerol in PBS was added for 30 seconds. The 293 cells were then washed with serum free medium, fresh medium was added, and the cells were incubated for about 5 days.
Approximately 24 hours after transfection, the medium was removed and replaced with medium (only) or medium containing 200 μCi / ml ³⁵ S-cysteine and 200 μCi / ml ³⁵ S-methionine. After 12 hours of incubation, conditioned media was collected, concentrated with a spin filter and added to a 15% SDS gel. The treated gel is dried, and then PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1413, PRO11513, PRO12713PRO , PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides were exposed to the film for a selected time period. The medium containing the transformed cells was further incubated (in serum-free medium) and the medium was tested with the selected bioassay.

In alternative technologies, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1413, PRO1213PRO1, PRO1213PRO PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709, or PRO779 are obtained using the dextran sulfate method described in Somparyrac et al., Proc. Natl. Acad. Sci., 12: 7575 (1981). Are transiently introduced into 293 cells. 293 cells were grown to maximal density in spinner flasks and 700 μg pRK5-PRO227, pRK5-pRK5-PRO233, pRK5-PRO217, pRK5-PRO1328, pRK5-PRO4342, pRK5-PRO7423, pRK5-PRO5P, RRK5-84 Add pRK5-PRO353 or pRK5-PRO1885 DNA. The cells were first concentrated from the spinner flask by centrifugation and washed with PBS. The DNA-dextran precipitate was incubated on the cell pellet for 4 hours. Cells were treated with 20% glycerol for 90 seconds, washed with tissue culture medium, and re-introduced into the spinner flask containing tissue culture medium, 5 μg / ml bovine insulin and 0.1 μg / ml bovine transferrin. After about 4 days, the conditioned medium was centrifuged and filtered to remove cells and cell debris. Subsequently expressed PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1213, PRO1213, PRO1213 , PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 can be concentrated and purified by selected methods such as dialysis and / or column chromatography.
PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 can be expressed in CHO cells. pRK5-PRO227, pRK5-pRK5- PRO233, pRK5-PRO217, pRK5-PRO1328, pRK5-PRO4342, pRK5-PRO7423, pRK5-PRO10096, pRK5-PRO21384, pRK5-PRO353 or pRK5-PRO1885 is, CaPO ₄ or DEAE- dextran, etc. CHO cells can be transfected using known reagents. As described above, the cell culture medium can be incubated and the culture medium can be replaced with culture medium (only) or a medium containing a radioactive label such as ³⁵ S-methionine. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 After identifying the presence of the PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, the medium may be replaced with serum-free medium. Preferably, the medium is incubated for about 6 days and then the conditioned medium is collected. Subsequently, expressed PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1104, PRO11513 Media containing PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 can be concentrated and purified by any selected method.

In addition, epitope tags PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO12144 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 may be expressed in host CHO cells. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 may be subcloned from the pRK5 vector. Subclone inserts can be subjected to PCR and fused to a frame with a selected epitope tag, such as a poly-his tag in a baculovirus expression vector. Next, poly-his tags PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1104, PRO1213, PRO1213, PRO1213 The PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 inserts can be subcloned into an SV40 operative vector containing a selectable marker such as DHFR for selection of stable clones. Finally, CHO cells were transfected with the SV40 agonist vector (as described above). In order to confirm expression, labeling may be performed as described above. Expressed poly-his tags PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1104, PRO11513, PRO11513 , PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 can then be concentrated and purified by selected methods such as Ni ²⁺ -chelate affinity chromatography.
Also, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1 183, PRO1 183 , PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 may be expressed in CHO and / or COS cells by transient expression methods and in CHO cells by other stable expression methods.
Stable expression in CHO cells was performed using the following method. Proteins may be IgG constructs (immunoadhesins) in which the coding sequence (eg, extracellular domain) of each protein's solubilized form is fused to an IgG1 hinge, CH2 and CH2 domains, or a poly-His Expressed as a tag form.

Following PCR amplification, the corresponding DNA was subcloned into a CHO expression vector using standard techniques as described in Ausubel et al., Current Protocols of Molecular Biology, Unit 3.16, John Wiley and Sons (1997). The CHO expression vector has restriction sites compatible with 5 ′ and 3 ′ of the DNA of interest and is constructed so that the cDNA can be conveniently shuttled. The vector used was expressed in CHO cells as described in Lucas et al., Nucl. Acids Res. 24: 9, 1774-1779 (1996), and used for expression of the cDNA of interest and dihydrofolate reductase (DHFR). The SV40 early promoter / enhancer is used for control. DHFR expression allows selection for stable maintenance of the plasmid following transfection.
12 μg of the desired plasmid DNA is introduced into about 10 million CHO cells of the commercially available transfection reagents Superfect® (Qiagen), Dosper® and Fugene® (Boehringer Mannheim). Cells were grown as described in Lucas et al. Above. Approximately 3 × 10 ⁷ cells were frozen in ampoules for further growth and production as described below.
An ampoule containing the plasmid DNA was placed in a water bath, thawed, and mixed by vortexing. The contents were pipetted into a centrifuge tube containing 10 mL of medium and centrifuged at 1000 rpm for 5 minutes. The supernatant was aspirated and the cells were resuspended in 10 mL selective medium (0.2 μm filtered PS20, 5% 0.2 μm diafiltered fetal bovine serum added). The cells are then divided into 100 mL spinners containing 90 mL selective medium. After 1-2 days, the cells are transferred to a 250 mL spinner filled with 150 mL selective medium and incubated at 37 ° C. After a further 2-3 days, 250 mL, 500 mL and 2000 mL spinners were seeded at 3 × 10 ⁵ cells / mL. The cell medium was replaced with fresh medium by centrifugation and resuspended in production medium. Any suitable CHO medium may be used, but in practice the production medium described in US Pat. No. 5,122,469 issued June 16, 1992 was used. A 3 L production spinner was seeded at 1.2 × 10 ⁶ cells / mL. On day 0, the pH was measured. On the first day, the spinner was sampled and sprayed with filtered air. On the second day, sample the spinner, change the temperature to 33 ° C, 30 mL of 500 g / L glucose and 0.6 mL of 10% antifoam (eg 35% polydimethylsiloxane emulsion, Dow Corning 365 Medical Grade Emulsion) I took. Throughout production, the pH was adjusted and maintained near 7.2. After 10 days, or until viability was below 70%, cell culture medium was collected by centrifugation and filtered through a 0.22 μm filter. The filtrate was stored at 4 ° C. or immediately packed into a purification column.

For the poly-His tag construct, the protein was purified using a Ni-NTA column (Qiagen). Prior to purification, imidazole was added to the conditioned medium to a concentration of 5 mM. Conditioned medium was pumped at 4 ° C. at a flow rate of 4-5 ml / min onto a 6 ml Ni-NTA column equilibrated with 20 mM Hepes, pH 7.4 buffer containing 0.3 M NaCl and 5 mM imidazole. After packing, the column was further washed with equilibration buffer and the protein was eluted with equilibration buffer containing 0.25M imidazole. The highly purified protein is subsequently desalted with 25 ml G25 Superfine (Pharmacia) in a storage buffer containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol, pH 6.8, and at −80 ° C. Stored in
Immunoadhesin (Fc-containing) constructs were purified from conditioned media as follows. Conditioned medium was pumped onto a 5 ml protein A column (Pharmacia) equilibrated with 20 mM sodium phosphate buffer, pH 6.8. After packing, the column was washed strongly with equilibration buffer and then eluted with 100 mM citric acid, pH 3.5. The eluted protein was immediately neutralized by collecting 1 ml fractions in a tube containing 275 μL of 1M Tris buffer, pH 9. The highly purified protein was subsequently desalted in the storage buffer described above for the poly-His tag protein. Uniformity was assessed by SDS-polyacrylamide gel and N-terminal amino acid sequencing by Edman degradation.

Example 39: PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1104, RO1213, PRO1413, PRO1413, PRO1213, PRO1413 Expression of PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 The following methods are used in yeasts: PRO196, PRO217, PRO231, PRO246, RO246, RO236, , PRO 328, PRO 344, PRO 357, PRO 526, PRO 724, PRO 731, PRO 732, PRO 1003, PRO 1104, PRO 1151, PRO 1244, PRO 1298, PRO 1313, PRO 1570, PRO 1886, PRO 1891, PRO 4409, PRO 9425, PRO 9409, PRO 9425, PRO The recombinant expression of is described.
First, from the ADH2 / GAPDH promoter, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1 4 Yeast expression vectors for intracellular production or secretion of PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 are generated. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 DNA encoding PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 and the promoter is inserted into the appropriate restriction enzyme site of the selected plasmid, and PRO196, PRO217, PRO231, PRO236, PRO245, PRO24. , PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO18960, PRO18991 , Directing intracellular expression of PRO61709 or PRO779. For secretion, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1213, PRO1213, PRO1213, PRO1213 , PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779, DNA encoding the ADH2 / GAPDH promoter, native PRO196, PRO217, PRO231, PRO23 , PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1357, PRO1857, PRO1857, , PRO10102, PRO10282, PRO61709 or PRO779 signal peptide or other mammalian signal peptide, or yeast alpha factor or invertase secretion signal / leader sequence, and (if necessary) PRO196, PRO217, PRO231, PRO236, PRO245, PRO24 6, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1895, PRO4985, PRO1891 It can be cloned with a linker sequence for expression of PRO10282, PRO61709 or PRO779.
Yeast strains such as yeast strain AB110 can then be transformed with the expression plasmid and cultured in the selected fermentation medium. The transformed yeast supernatant can be analyzed by precipitation with 10% trichloroacetic acid and separation by SDS-PAGE, followed by staining of the gel with Coomassie blue staining.
Subsequently, recombinant PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1244, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 are obtained by removing yeast cells from the fermentation medium by centrifugation and then concentrating the medium using a selected cartridge filter. Can be separated and purified. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 The concentrate comprising PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 may be further purified using a selected column chromatography resin.

Example 40: PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1212, PRO1100, RO1120, PRO1100, PRO1100 Expression of PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 The following methods are used to express PRO196, PRO217, PRO23, PRO23, PRO2 245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1586, PRO1586, PRO1586, PRO1598 Recombinant expression of PRO10102, PRO10282, PRO61709 or PRO779 is described.
PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 A sequence encoding PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 was fused upstream of an epitope tag contained in a baculovirus expression vector. Such epitope tags include poly-his tags and immunoglobulin tags (such as the Fc region of IgG). A variety of plasmids can be used, including plasmids derived from commercially available plasmids such as pVL1393 (Navagen). Briefly, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1215, PRO1215 PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 or PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO347, RO343, PRO34 , PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO8225, PRO102PRO For example, a sequence encoding the extracellular domain of a transmembrane protein or a sequence encoding a mature protein when the protein is extracellular is amplified by PCR with primers complementary to the 5 ′ and 3 ′ regions. The 5 ′ primer may include flanking (selected) restriction enzyme sites. The product is then digested with selected restriction enzymes and subcloned into an expression vector.
Recombinant baculoviruses were transferred simultaneously using the above plasmid and BaculoGold (trade name) virus DNA (Pharmingen) using lipofectin (commercially available from GIBCO-BRL) in Spodoptera frugiperda ("Sf9") cells (ATCC CRL 1711). It is created by After incubation at 28 ° C. for 4-5 days, the released virus was collected and used for further amplification. Viral infection and protein expression were performed as described in O'Reilley et al., Baculovirus expression vectors: A laboratory Manual, Oxford: Oxford University Press (1994).

Next, the expressed poly-his tags PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1104, PRO1104 PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 are purified, for example, by Ni ²⁺ -chelate affinity chromatography as follows. Extracts were prepared from virus-infected recombinant Sf9 cells as described in Rupert et al., Nature, 362: 175-179 (1993). Briefly, Sf9 cells were washed and sonicated buffer (25 mL Hepes, pH 7.9; 12.5 mM MgCl ₂ ; 0.1 mM EDTA; 10% glycerol; 0.1% NP-40; 0 .4M KCl) and sonicated twice on ice for 20 seconds. The sonicated product was clarified by centrifugation, and the supernatant was diluted 50-fold with a loading buffer (50 mM phosphate, 300 mM NaCl, 10% glycerol, pH 7.8) and filtered through a 0.45 μm filter. A Ni ²⁺ -NTA agarose column (commercially available from Qiagen) was prepared with a total volume of 5 mL, washed with 25 mL of water and equilibrated with 25 mL of loading buffer. The filtered cell extract was loaded onto the column at 0.5 mL per minute. The column was washed with loading buffer to A ₂₈₀ baseline where fraction collection began. The column was then washed with a secondary wash buffer (50 mM phosphate; 300 mM NaCl, 10% glycerol, pH 6.0) that elutes nonspecifically bound protein. After reaching A ₂₈₀ baseline again, the column was developed with a 0 to 500 mM imidazole gradient in the secondary wash buffer. 1 mL fractions were collected and analyzed by SDS-PAGE and silver staining or Western blot with Ni ²⁺ -NTA conjugated to alkaline phosphatase (Qiagen). Eluted His ₁₀ -tags PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1104, PRO11513, PRO11513 Fractions containing PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 were pooled and dialyzed against loading buffer.
Alternatively, IgG tag (or Fc tag) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1104, RO1213 , PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 can be purified using known chromatographic techniques including, for example, protein A or protein G column chromatography. .

Example 41: Tissue expression profiling using GeneExpress® A polypeptide (and encoding it) whose expression is significantly upregulated in a particular tumor tissue of interest compared to other tumors and / or normal tissues In order to identify nucleic acids), a proprietary database containing gene expression information (GeneExpress®, Gene Logic Inc., Gaithersburg, MD, USA) was analyzed. Specifically, analysis of the GeneExpress® database was performed at Gene Logic Inc. (Used with GeneExpress (R) database available from (Gaithersburg, Maryland, USA) . The evaluation of positive hits in the analysis is based on several criteria including, for example, tissue specificity, tumor specificity and expression level in normal base tissue and / or normal proliferative tissue. A tissue expression profile determined by analysis of the GeneExpress® database shows high tissue expression and upregulation of significant expression in a particular tumor tissue or tumor tissue compared to other tumor tissues and / or normal tissues; The following is a list of molecules that exhibit relatively low expression in normal base tissues and / or normal proliferative tissues depending on the situation. Tissue expression profiling was performed on multiple UNQ genes and the results are shown in Example 35.

Example 42: Microarray analysis to detect UNQ gene upregulation in cancerous tumors Nucleic acid microarrays, often containing thousands of gene sequences, are differentially expressed in diseased tissue compared to normal counterparts It is useful for identification. By using nucleic acid microarrays, test and control mRNA samples from test and control tissue samples are reverse transcribed and labeled for cDNA probe generation. The cDNA probe is then hybridized to a nucleic acid array immobilized on a solid support. The array is constructed so that the sequence and position of each part of the array can be known. For example, selected genes that are known to be expressed in a particular disease state can be arrayed on a solid support. Hybridization of the labeled probe with a particular array site indicates that the sample from which the probe was generated expresses the gene. A gene or genes that are overexpressed in diseased tissue are identified when the hybridization signal of the probe from the test (disease tissue) sample is greater than the hybridization signal from the control (normal tissue) sample. The implication of this result is that proteins that are overexpressed in diseased tissues are useful not only as diagnostic markers for disease states, but also as therapeutic targets for treatment of disease states.
Nucleic acid hybridization methodologies and microarray technology are well known to those skilled in the art. As an example, the specific preparation of nucleic acids for hybridization and probes, slides, and hybridization conditions are all detailed in PCT / US01 / 10482 filed on 30 March 2001, which is incorporated herein by reference. Include in the book.

In this example, by studying cancerous tumors taken from various human tissues for up-regulation of gene expression associated with cancerous tumors from different types of tissues and / or non-cancerous human tissues, We attempted to identify polypeptides that are overexpressed in cancerous tumors. In some experiments, cancerous human tumor tissue and non-cancerous human tumor tissue of the same type of tissue (often from the same patient) were collected and analyzed for UNQ expression. In addition, a “universal” epithelial control prepared by taking cancerous human tumor tissue from any of a variety of different human tumors and pooling non-cancerous human tissue of epithelial origin including liver, kidney and lung Comparison with the sample. The mRNA isolated from the pooled tissue was a mixture of expressed gene products from these different tissues. Microarray hybridization experiments with pooled control samples produced a linear plot for the two-color analysis. The slope of the line generated in the two-color analysis was then used to normalize the (test / control detection) ratio for each experiment. The normalized ratios derived from various experiments were then compared and used for gene expression clustering. Thus, a pooled “universal control” sample not only allows effective determination of relative gene expression by simply comparing two samples, but also allows multiple samples over multiple experiments. Allows comparison.
In this experiment, nucleic acid probes derived from UNQ-encoding nucleic acid sequences disclosed herein were used to form microarrays, and RNA from various tumor tissues was used to hybridize thereto. The results of these experiments are shown below. The results indicate that the various UNQ polypeptides of the present invention are significantly overexpressed in various human tumor tissues compared to the corresponding normal tissues. Furthermore, all of the following molecules were significantly expressed in their particular tumor tissues when compared to “universal” epithelial controls. As mentioned above, these data indicate that the UNQ polypeptides of the present invention are useful not only as diagnostic markers for the presence of one or more tumors, but also as therapeutic targets for the treatment of those tumors. ing. Microarray analysis was performed on a plurality of UNQ genes, and the results are shown in Example 35.

Example 43: Quantitative Analysis of UNQ mRNA Expression In this assay, a 5 ′ nuclease assay (eg, TaqMan®) and real-time quantitative PCR (eg, ABI Prizm7700 Sequence Detection System® (Perkin Elmer, Applied Biosystems Division, Foster City, California)) was used to find genes that are significantly overexpressed in cancerous tumors or tumors compared to other cancerous tumors or normal non-cancerous tissues. The 5 ′ nuclease assay reaction is a fluorescent PCR-based technique that utilizes the 5 ′ exonuclease activity of Taq DNA polymerase enzyme to monitor gene expression in real time. Two oligonucleotide primers (whose sequence is based on the gene of interest or EST sequence) are used to generate a typical amplicon in the PCR reaction. A third oligonucleotide, or probe, is designed to detect the nucleotide sequence located between the two PCR primers. This probe is not extendable by Taq DNA polymerase enzyme and is labeled with a reporter fluorescent dye and a quencher fluorescent dye. Any laser-induced radiation from the reporter dye is quenched by the quenching dye if the two dyes are located in close proximity on the probe. During the PCR amplification reaction, the Taq DNA polymerase enzyme cleaves the probe in a template-dependent manner. The resulting probe fragments separate in solution and the signal from the released reporter dye is independent of the fire extinguishing effect of the second fluorescent material. One molecule of reporter dye is released for each newly synthesized molecule, and detection of the non-quenched reporter dye provides the basis for quantitative interpretation of the data.
The 5 ′ nuclease approach is performed on a real-time quantitative PCR instrument such as ABI Prism7700 ™ sequence detection. The system consists of a thermocycler, laser, charge coupled device (CCD) camera and computer. In this system, samples are amplified in a 96-well format on a thermocycler. During amplification, laser-induced fluorescence signals are collected in real time via all 96-well fiber optic measurement cables and detected with a CCD. The system includes software for operating the device and for analyzing the data.
The starting material for the screening was mRNA isolated from a variety of different cancerous tissues. This mRNA is accurately quantified, for example, fluorometrically. As a negative control, RNA was isolated from various normal tissues of the same tissue type as the cancerous tissue being tested.

  5 'nuclease assay data is initially expressed as Ct, or threshold cycle. This is defined as the cycle in which the reporter signal accumulates above the background level of fluorescence. The ΔCt value is used as a quantitative measure of the relative number of starting copies of a particular labeled sequence in a nucleic acid sample when comparing cancer mRNA results to normal human mRNA results. 1 Ct unit corresponds to a relative increase of approximately 2 fold over 1 PCR cycle or standard, 2 units corresponds to a 4 fold relative increase, 3 units corresponds to a 8 fold relative increase, etc. Alternatively, the relative fold increase in mRNA expression between different tissues can be quantitatively measured. Using this technique, the molecule is significantly overexpressed in certain tumors compared to its normal non-cancerous tissue (from the same and different donors), and thus for cancer diagnosis and treatment in mammals. Represents an excellent polypeptide target. Results specific for the UNQ gene are disclosed in Example 35.

Example 44: In situ hybridization In situ hybridization is a powerful and versatile technique for the detection and localization of nucleic acid sequences in cell or tissue preparations. It is useful, for example, in identifying gene expression sites, analyzing the tissue distribution of transcripts, identifying and localizing viral infections, tracking changes in specific mRNA synthesis and assisting in chromosomal mapping.
In situ hybridization is performed using PCR-generated ³³ P-labeled riboprobe according to an optimized version of the protocol of Lu and Gillett, Cell Vision 1: 169-176 (1994). Briefly, formalin-fixed, paraffin-embedded human tissue was sectioned, deparaffinized, deproteinized with proteinase K (20 g / ml) for 15 minutes at 37 ° C., and as described in Lu and Gillett, supra. In situ hybridization. (33-P) UTP-labeled antisense riboprobe is generated from the PCR product and hybridized overnight at 55 ° C. The slides are immersed in Kodak NTB2 nuclear track emulsion and exposed for 4 weeks.
³³ P-riboprobe synthesis 6.0 μl (125 mCi) of ³³ P-UTP (Amersham BF 1002, SA <2000 Ci / mmol) was speed-vacuum dried. The following ingredients were added to each tube containing dry ³³ P-UTP:
2.0 μl of 5 × transcription buffer 1.0 μl of DTT (100 mM)
2.0 μl NTP mixture (2.5 mM: 10 μl each 10 mM GTP, CTP and ATP + 10 μl H ₂ O)
1.0 μl of UTP (50 μM)
1.0 μl of RNasin
1.0 μl of DNA template (1 μg)
1.0 μl H ₂ O
1.0 μl RNA pomerase (T3 = AS, T7 = S, normal for PCR products)
Tubes were incubated at 37 ° C. for 1 hour, 1.0 μl RQ1 DNase was added, and then incubated at 37 ° C. for 15 minutes. 90 μl TE (10 mM Tris pH 7.6 / 1 mM EDTA pH 8.0) was added and the mixture was pipetted onto DE81 paper. The remaining solution was loaded into a Microcon-50 ultrafiltration unit and spun using program 10 (6 minutes). The filtration unit was converted to a second tube and spun using program 2 (3 minutes). After the final recovery spin, 100 μl TE was added. 1 μl of final product was pipetted onto DE81 paper and counted with 6 ml of BIOFLUOR II.
The probe was run on a TBE / urea gel. 1-3 μl probe or 5 μl RNA MrkIII was added to 3 μl loading buffer. After heating on a heating block to 95 ° C. for 3 minutes, the probe was immediately placed on ice. The gel wells were run and filled with sample and run at 180-250 volts for 45 minutes. The gel was wrapped with Saran wrap and exposed to an XAR film with a reinforcing screen for 1 hour to overnight in a −70 ° C. refrigerator.

³³ P-hybridization Pretreatment of frozen sections Slides were removed from the refrigerator, placed on an aluminum tray and thawed at room temperature for 5 minutes. The tray was placed in a 55 ° C. incubator for 5 minutes to reduce condensation. Slides were fixed in 4% paraformaldehyde for 10 minutes in a steam hood and washed with 0.5 × SSC for 5 minutes at room temperature (25 ml 20 × SSC + 975 ml SQ H ₂ O). After deproteinization for 10 minutes at 37 ° C. in 0.5 μg / ml proteinase (12.5 μl of 10 mg / ml stock in 250 ml preheated RNase-free RNase buffer), sections are washed with 0.5 × SSC for 10 minutes at room temperature did. Sections were dehydrated in 70%, 95%, 100% ethanol for 2 minutes each.
B. Pretreatment of paraffin-embedded sections:
Slides were deparaffinized, placed in SQ H ₂ O and rinsed twice with 2 × SSC for 5 minutes each at room temperature. Sections were 20 μg / ml proteinase K (500 μl 10 mg / ml in 250 ml RNase-free RNase buffer; 37 ° C., 15 minutes) —human embryo or 8 × proteinase K (100 μl in 250 ml RNase buffer, 37 ° C., 30 minutes) — Deproteinized with formalin tissue. Subsequent rinsing and dehydration with 0.5 × SSC was performed as described above.
C. Pre-hybrid:
Slides were arranged in plastic boxes lined with Box buffer (4 × SSC, 50% formamide) -saturated filter paper.
D. Hybridization:
1.0 × 10 ⁶ cpm probe and 1.0 μl tRNA (50 mg / ml stock) per slide were heated at 95 ° C. for 3 minutes. Slides were chilled on ice and 48 μl of hybridization buffer was added per slide. After vortexing, 50 μl of ³³ P mixture was added to 50 μl of prehybridization on the slide. Slides were incubated overnight at 55 ° C.
E. Washing:
Washing was performed at room temperature with 2 × 10 min, 2 × SSC, EDTA (400 ml 20 × SSC + 16 ml 0.25 M EDTA, Vf = 4 L) followed by RNase A treatment for 30 min at 37 ° C. (500 μl of 10 mg / ml in 250 ml RNase buffer = 20 μg / ml). Slides were washed 2 × 10 minutes with 2 × SSCEDTA at room temperature. Stringent wash conditions are as follows: 2 hours at 55 ° C., 0.1 × SSC, EDTA (20 ml 20 × SSC + 16 ml EDTA, V _f = 4 L).
F. Oligonucleotides In situ analysis was performed on the various DNA sequences disclosed herein. The oligonucleotides used for these analyzes were obtained to be complementary to the nucleic acid (or its complementary strand) shown in the accompanying figures.

G. Results In situ analysis was performed on the various DNA sequences disclosed herein. The results of these analyzes are as follows:
(1) DNA279661 (TAT502)
Moderate expression was observed in the gastrointestinal mucosa. In the large and small intestine, expression appeared throughout the inner epithelium. Expression in the stomach was concentrated in the pit epithelium and was not seen in the main cells and mural cells. A small to moderate signal was detected in the core layers of the two kidneys, which localized to the confluent plaques.
Expression was seen in 11 out of 15 ovarian carcinomas (surface epithelial and adenocarcinoma) and 1 Brenner tumor. Expression was seen in 6 out of 8 uterine carcinomas, including 1 MMMT (malignant mixed Muellerian tube tumor). Expression was also observed in normal bronchial mucosa, with expression levels ranging from very small to moderate. Strong expression was observed in 10 of 16 non-small cell lung carcinomas. Expression was also observed in 19 of 19 colorectal adenocarcinomas, 8 of 9 gastric adenocarcinomas, 2 of 2 pancreatic adenocarcinomas, 2 of 4 esophageal carcinomas, and 11 of 11 Found in metastatic adenocarcinoma.

Example 45: PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 Preparation of antibodies that bind to PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 This example includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO258, PRO258, PRO258 328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO59725, PRO9725, PRO Illustrates the preparation of monoclonal antibodies capable of specific binding.
Techniques for the production of monoclonal antibodies are known in the art and are described, for example, in Goding above. Immunogens that can be used are purified PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO1104 PRO 1313, PRO 1570, PRO 1886, PRO 1891, PRO 4409, PRO 5725, PRO 5994, PRO 6097, PRO 7425, PRO 10102, PRO 10282, PRO 61709 or PRO 779 polypeptide, PRO 196, PRO 217, PRO 231, PRO 236, PRO 245, PRO 246, PRO 246, PRO 28, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO59725, PRO9725, PRO9725, PRO9725 Fusion protein containing peptide, recombinant on the cell surface: PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1003 104, including PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, cells expressing PRO61709 or PRO779 polypeptide. The selection of the immunogen can be made without undue experimentation by one skilled in the art.
Mice such as Balb / c were emulsified in complete Freund's adjuvant and injected subcutaneously or intraperitoneally at 1-100 micrograms PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO8225, PRO82P Alternatively, the immunogen may be emulsified in MPL-TDM adjuvant (Ribi Immunochemical Research, Hamilton, Montana) and injected into the animal's hind footpad. Immunized mice are then boosted 10 to 12 days later with additional immunogen emulsified in the selected adjuvant. Thereafter, for several weeks, the mice are boosted with additional immunization injections. Anti-PRO196, Anti-PRO217, Anti-PRO231, Anti-PRO236, Anti-PRO245, Anti-PRO246, Anti-PRO258, Anti-PRO287, Anti-PRO328, Anti-PRO344, Anti-PRO357, Anti-PRO526, Anti-PRO724, Anti-PRO731, Anti-PRO1003, Anti-PRO1003, PRO1003 , Anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10282, anti-PRO67179 or anti-PRO6779 Serum samples from retroorbital hemorrhage were tested in mice for testing in an ELISA assay for detection. It may be periodically obtained.
After a suitable antibody titer has been detected, animals that are “positive” for antibodies are labeled as PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731. , PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO61709 . Three to four days later, mice were sacrificed and spleen cells were removed. The spleen cells were then (using 35% polyethylene glycol), P3X63AgU. Fused to 1st selected mouse myeloma cell line. Hybridoma cells were generated by fusion and then plated on 96-well tissue culture plates containing HAT (hypoxanthine, aminopterin, and thymidine) medium to inhibit the growth of non-fused cells, myeloma hybrids, and spleen cell hybrids.
The hybridoma cells are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1413, PRO11513PRO, PRO1413, PRO11513PRO. Screened by ELISA for reactivity against PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 Determination of “positive” hybridoma cells that secrete the desired monoclonal antibody to PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 is within the scope of common general knowledge.
Positive hybridoma cells were injected intraperitoneally into syngeneic Balb / c mice and ascites containing anti-PRO227, anti-PRO233, anti-PRO217, anti-PRO1328, anti-PRO4342, anti-PRO7423, anti-PRO210096, anti-PRO21384, anti-PRO353 or anti-PRO185 monoclonal antibody Is generated. Alternatively, hybridoma cells can be grown in tissue culture flasks or roller bottles. Purification of monoclonal antibodies produced in ascites can be performed using ammonium sulfate precipitation followed by gel exclusion chromatography. Alternatively, affinity chromatography based on the affinity of antibody for protein A or protein G can also be used.

Example 46: PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258 using specific antibodies, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10012, PRO1103, PRO1104 PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide Purification of native or recombinant PRO196, PRO217, PRO231, PRO236, PRO246, RO246 O287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, RO4, RO9, PRO9409, PRO5409 PRO779 polypeptides can be purified by various standard protein purification methods in the art. For example, pro-PRO227, pro-PRO233, pro-PRO217, pro-PRO1328, pro-PRO4342, pro-PRO7423, pro-PRO10096, pro-PRO21384, pro-PRO353 or pro-PRO185 polypeptide, mature PRO196, mature PRO217, Mature PRO231, mature PRO236, mature PRO245, mature PRO246, mature PRO246, mature PRO258, mature PRO287, mature PRO328, mature PRO344, mature PRO357, mature PRO526, mature PRO724, mature PRO731, mature PRO732, mature PRO1003, mature PRO11544, mature PRO11544 , Mature PRO1298, mature PRO1313, mature PRO1570, mature PRO1886, mature PRO1 891, mature PRO4409, mature PRO5725, mature PRO5994, mature PRO6097, mature PRO7425, mature PRO10102, mature PRO10282, mature PRO61709 or mature PRO779 polypeptide, or pre-PRO227, pre-PRO233, pre-PRO217, pre-PRO1328, pre- PRO4342, Pre-PRO7423, Pre-PRO10096, Pre-PRO21384, Pre-PRO353 or Pre-PRO1885 polypeptide are the target PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO344, RO344, PRO344, PRO526, PRO724, PRO731, PRO732, PRO1003 , PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 using an antibody specific for an affinity chromatography Purified. In general, the immunoaffinity column is obtained by covalently binding an anti-PRO227, anti-PRO233, anti-PRO217, anti-PRO1328, anti-PRO4342, anti-PRO7423, anti-PRO10096, anti-PRO21384, anti-PRO353 or anti-PRO1835 polypeptide antibody to an activated chromatography resin. Created.
Polyclonal immunoglobulins are prepared from immune sera either by precipitation with ammonium sulfate or purification with immobilized protein A (Pharmacia LKB Biotechnology, Piscataway, NJ). Similarly, monoclonal antibodies are prepared from mouse ascites fluid by ammonium sulfate precipitation or chromatography with immobilized protein A. The partially purified immunoglobulin is covalently bound to a chromatographic resin such as CnBr-activated Sepharose (trade name) (Pharmacia LKB Biotechnology). The antibody is bound to the resin, the resin is blocked, and the derivative resin is washed according to the manufacturer's instructions.
Such immunoaffinity columns are in the solubilized form of PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10012, PRO1104 , PRO196, PRO2361, PRO2361, PRO2361, PRO2361, PRO2361, PRO23, PRO23P1, PRO23PRO217, PRO2367 , PRO24 , PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1586, PRO1586, PRO1586, PRO1586 , PRO10282, PRO61709 or PRO779 polypeptide. This preparation is derived by solubilization of whole cells or cell component fractions obtained via addition of detergents or differential centrifugation by methods known in the art. Alternatively, the solubilized polypeptide containing the signal sequence is secreted in useful amounts into the medium in which the cells are grown.
Solubilized PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1187 PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide-containing preparations are passed through an immunoaffinity column, the columns being PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, RO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, RO4409, PRO4409, PRO4825, RO4 Washing under conditions that allow preferred adsorption of PRO779 polypeptide (eg, high ionic strength buffer in the presence of detergent). The column then breaks down antibody / PRO227, antibody / PRO233, antibody / PRO217, antibody / PRO1328, antibody / PRO4342, antibody / PRO7423, antibody / PRO10096, antibody / PRO21384, antibody / PRO353 or antibody / PRO1885 polypeptide binding. (E.g., low pH buffer such as about 2-3, chaotrope such as high concentration of urea or thiocyanate ion), PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344 , PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, RO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide is collected.

Example 47: Drug screening The present invention is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1104 Particularly useful for screening compounds by using the PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides in various drug screening techniques. is there. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1104 , PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides or fragments, either free in solution, immobilized on a solid support, or carried on the cell surface Alternatively, it may be located inside the cell. One method of drug screening is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1104, RO1213 Utilizing eukaryotic or prokaryotic host cells stably transfected with recombinant nucleic acids expressing PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides or fragments To do. Agents are screened against such transfected cells by a competitive binding assay. Depending on either the viable or immobilized form, such cells can be used in standard binding assays. For example, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, RO1 183PRO The formation of complexes between the PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides or fragments and the reagent being tested may be measured. Alternatively, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1413, PRO11513, PRO1413, PRO11513, PRO11513, PRO11513 , PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides and their target cells can also be tested for reduction in complex formation.
Accordingly, the present invention includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1104, PRO11513 Methods of screening for agents or any other reagent that can affect a disease or disorder related to PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides are provided. In these methods, the reagents are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1103, PRO1213, PRO1213 PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide or fragment is contacted with (i) a reagent and PRO196, PRO217, PRO231, PRO236, RO246, RO246, PRO246 , PRO 287, PRO 328, PRO 344, PRO 357, PRO 526, PRO 724, PRO 731, PRO 732, PRO 1003, PRO 1104, PRO 1151, PRO 1244, PRO 1298, PRO 1313, PRO 1570, PRO 1886, PRO 1825, PRO 5910, PRO4 910 Or for the presence of a complex between PRO779 polypeptides or fragments, or (ii) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, Between RO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61282 and PRO6179 polypeptide or PRO7779 It involves testing for the presence by methods well known in the art. In these competitive binding assays, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1413, PRO11513PRO1, PRO1213PRO , PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides or fragments are typically labeled. After appropriate incubation, free PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1413, PRO11513, PRO11513, PRO11513, PRO11513 PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides or fragments are separated from those in bound form, and the amount of free or uncomplexed label is determined by the amount of a particular reagent PRO196, PRO217, PRO231 PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, RO1598, RO1 Binds to PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide or PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO72 , PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO6779 It becomes a measure of.

Other techniques for drug screening provide high-throughput screening for compounds with appropriate binding affinity for polypeptides and are described in detail in WO 84/03564 published September 13, 1984. ing. Briefly, a number of different small peptide test compounds are synthesized on a solid support such as plastic pins or some other surface. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 When applied to the PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides, the peptide test compounds are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO 28, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO59725, PRO9725, PRO9725, PRO9725 It reacts with the peptide and is washed. Combined PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO12845 PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides are detected by methods well known in the art. Purified PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1284, PRO12151PRO PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides can also be coated directly onto plates for use in the above drug screening techniques. Furthermore, non-neutralizing antibodies can be used to capture the peptide and immobilize it on a solid support.
In addition, the present invention includes PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1413, PRO11513 PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides can bind to neutralizing antibodies PRO196, PRO217, PRO231, PRO236, PRO245, PRO258, PRO258, PRO258, PRO258, O328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, RO5725, PRO9725, PRO9725, PRO9725, PRO Also contemplated are competitive drug screening assays that specifically compete with test compounds for peptides or fragments thereof. In this method, the antibodies are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1413, PRO11513, PRO1413, PRO11513 , PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides can be used to detect the presence of any peptide having one or more antigenic determinants.

Example 48: Rational Drug Design The purpose of rational drug design is to target biologically active polypeptides (eg, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO829, RO82 Small molecules that act, eg agonists, antagonists To produce gonists, or structural analogs of inhibitors. Any of these examples are: PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1413, PRO1213, PRO1213, PRO1213 , PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5995, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides or in vivo PRO196, PRO217, PRO231, PRO236, PRO246, PRO246 58, PRO 287, PRO 328, PRO 344, PRO 357, PRO 526, PRO 724, PRO 731, PRO 732, PRO 1003, PRO 1104, PRO 1151, PRO 1244, PRO 1298, PRO 1313, PRO 1570, PRO 1886, PRO 1091, PRO 10291, PRO 10291, PRO It can be used to create drugs that promote or inhibit the function of PRO61709 or PRO779 polypeptide (Reference, Hodgson, Bio / Technology, 9: 19-21 (1991)).
In one method, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, RO1 , PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, or PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO287, RO287, PRO287, RO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5910, RO5997, RO597 The three-dimensional structure of the inhibitor complex is determined by x-ray crystallography, by computer modeling, most typically by a combination of the two methods. In order to elucidate the structure of the molecule and determine the active site, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1100, PRO1 , PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide must both be identified and charged. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, RO , PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides may provide useful information on modeling based on the structure of homologous proteins. In both cases, the related structural information is similar PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10012, PRO1100, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide-like molecules or used to identify effective inhibitors. Useful examples of rational drug design include molecules with improved activity or stability as shown in Braxton and Wells, Biochemistry, 31: 7796-7801 (1992), or Athauda et al., J. Biochem. , 113: 742-746 (1993), including molecules that act as inhibitors, agonists, or antagonists of natural peptides.
It is also possible to isolate a target-specific antibody selected by the functional assay as described above and elucidate its crystal structure. This method in principle produces a pharmacore on which subsequent drug design can be based. By generating anti-idiotype antibodies (anti-ids) against functional pharmacologically active antibodies, protein crystallography can be bypassed. As a mirror image of the mirror image, the anti-ids binding site can be predicted to be an analog of the original receptor. The anti-id can then be used to identify and isolate the peptide from a bank of chemically or biologically produced peptides. The isolated peptide will function as a pharmacore.
In accordance with the present invention, a sufficient amount of PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732 to perform analytical experiments such as X-ray crystallography. , PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptides are available. Further, PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1104 Knowledge of PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide amino acid sequences provides guidance for use in computer modeling techniques to replace or add to X-ray crystallography.

1 shows the nucleotide sequence of the native sequence PRO196 cDNA (SEQ ID NO: 1), which is a clone designated herein as “DNA22779-1130” (UNQ170). The amino acid sequence (SEQ ID NO: 2) derived from the coding sequence of SEQ ID NO: 1 shown in FIG. The nucleotide sequence of the native sequence PRO217 cDNA (SEQ ID NO: 3) is shown, which is a clone designated herein as “DNA33094-1131” (UNQ191). 4 shows the amino acid sequence (SEQ ID NO: 4) derived from the coding sequence of SEQ ID NO: 3 shown in FIG. The nucleotide sequence of the native sequence PRO231 cDNA (SEQ ID NO: 5) is shown, which is a clone designated herein as “DNA34434-1139” (UNQ205). FIG. 6 shows an amino acid sequence (SEQ ID NO: 6) derived from the coding sequence of SEQ ID NO: 5 shown in FIG. The nucleotide sequence of the native sequence PRO236 cDNA (SEQ ID NO: 7) is shown, which is a clone designated herein as “DNA35599-1168” (UNQ210). 8 shows the amino acid sequence (SEQ ID NO: 8) derived from the coding sequence of SEQ ID NO: 7 shown in FIG. The nucleotide sequence of the native sequence PRO245 cDNA (SEQ ID NO: 9) is shown, and SEQ ID NO: 9 is a clone designated herein as “DNA35638-1141” (UNQ219). The amino acid sequence (SEQ ID NO: 10) derived from the coding sequence of SEQ ID NO: 9 shown in FIG. 9 is shown. The nucleotide sequence of the native sequence PRO246 cDNA (SEQ ID NO: 11) is shown, which is a clone designated herein as “DNA35639-1172” (UNQ220). The amino acid sequence (SEQ ID NO: 12) derived from the coding sequence of SEQ ID NO: 11 shown in FIG. 11 is shown. The nucleotide sequence of the native sequence PRO258 cDNA (SEQ ID NO: 13) is shown, which is a clone designated herein as “DNA35918-1174” (UNQ225). The amino acid sequence (SEQ ID NO: 14) derived from the coding sequence of SEQ ID NO: 13 shown in FIG. 13 is shown. The nucleotide sequence of the native sequence PRO287 cDNA (SEQ ID NO: 15) is shown, which is a clone designated herein as “DNA39969-1185” (UNQ250). FIG. 15 shows an amino acid sequence (SEQ ID NO: 16) derived from the coding sequence of SEQ ID NO: 15 shown in FIG. The nucleotide sequence of the native sequence PRO328 cDNA (SEQ ID NO: 17) is shown, and SEQ ID NO: 17 is a clone designated herein as “DNA40587-1231” (UNQ289). The amino acid sequence (SEQ ID NO: 18) derived from the coding sequence of SEQ ID NO: 17 shown in FIG. The nucleotide sequence of the native sequence PRO344 cDNA (SEQ ID NO: 19) is shown, which is a clone designated herein as “DNA40592-1242” (UNQ303). The amino acid sequence (SEQ ID NO: 20) derived from the coding sequence of SEQ ID NO: 19 shown in FIG. The nucleotide sequence of the native sequence PRO357 cDNA (SEQ ID NO: 21) is shown, which is a clone designated herein as “DNA44804-1248” (UNQ314). 21 shows the amino acid sequence (SEQ ID NO: 22) derived from the coding sequence of SEQ ID NO: 21 shown in FIG. The nucleotide sequence of the native sequence PRO526 cDNA (SEQ ID NO: 23) is shown, which is a clone designated herein as “DNA44184-1319” (UNQ330). 23 shows the amino acid sequence (SEQ ID NO: 24) derived from the coding sequence of SEQ ID NO: 23 shown in FIG. The nucleotide sequence of the native sequence PRO724 cDNA (SEQ ID NO: 25) is shown, which is a clone designated herein as “DNA49631-1328” (UNQ389). The nucleotide sequence of the native sequence PRO724 cDNA (SEQ ID NO: 25) is shown, which is a clone designated herein as “DNA49631-1328” (UNQ389). The amino acid sequence (SEQ ID NO: 26) derived from the coding sequence of SEQ ID NO: 25 shown in FIG. The nucleotide sequence of the native sequence PRO731 cDNA (SEQ ID NO: 27) is shown, and SEQ ID NO: 27 is a clone designated herein as “DNA48331-1329” (UNQ395). The nucleotide sequence of the native sequence PRO731 cDNA (SEQ ID NO: 27) is shown, and SEQ ID NO: 27 is a clone designated herein as “DNA48331-1329” (UNQ395). 27 shows the amino acid sequence (SEQ ID NO: 28) derived from the coding sequence of SEQ ID NO: 27 shown in FIG. The nucleotide sequence of the native sequence PRO732 cDNA (SEQ ID NO: 29) is shown, which is a clone designated herein as DNA48334-1435 ”(UNQ396). The amino acid sequence (SEQ ID NO: 30) derived from the coding sequence of SEQ ID NO: 29 shown in FIG. 29 is shown. The nucleotide sequence of the native sequence PRO1003 cDNA (SEQ ID NO: 31) is shown, which is a clone designated herein as “DNA58846-1409” (UNQ487). The amino acid sequence (SEQ ID NO: 32) derived from the coding sequence of SEQ ID NO: 31 shown in FIG. 31 is shown. The nucleotide sequence of the native sequence PRO1104 cDNA (SEQ ID NO: 33) is shown, which is a clone designated herein as “DNA59616-1465” (UNQ547). The amino acid sequence (SEQ ID NO: 34) derived from the coding sequence of SEQ ID NO: 33 shown in FIG. 33 is shown. The nucleotide sequence of the native sequence PRO1151 cDNA (SEQ ID NO: 35) is shown, which is a clone designated herein as “DNA44694-1500” (UNQ581). The amino acid sequence (SEQ ID NO: 36) derived from the coding sequence of SEQ ID NO: 35 shown in FIG. 35 is shown. The nucleotide sequence of the native sequence PRO1244 cDNA (SEQ ID NO: 37) is shown, which is a clone designated herein as “DNA64888-1526” (UNQ628). The amino acid sequence (SEQ ID NO: 38) derived from the coding sequence of SEQ ID NO: 37 shown in FIG. The nucleotide sequence of the native sequence PRO1298 cDNA (SEQ ID NO: 39) is shown, which is a clone designated herein as “DNA66511-1563” (UNQ666). 39 shows the amino acid sequence (SEQ ID NO: 40) derived from the coding sequence of SEQ ID NO: 39 shown in FIG. The nucleotide sequence of the native sequence PRO1313 cDNA (SEQ ID NO: 41) is shown, which is a clone designated herein as “DNA64966-1575” (UNQ679). 43 shows the amino acid sequence (SEQ ID NO: 42) derived from the coding sequence of SEQ ID NO: 41 shown in FIG. The nucleotide sequence of the native sequence PRO1570 cDNA (SEQ ID NO: 43) is shown, and SEQ ID NO: 43 is a clone designated herein as “DNA68885-1678” (UNQ776). 43 shows the amino acid sequence (SEQ ID NO: 44) derived from the coding sequence of SEQ ID NO: 43 shown in FIG. The nucleotide sequence of the native sequence PRO1886 cDNA (SEQ ID NO: 45) is shown, which is a clone designated herein as “DNA8079-2523” (UNQ870). 45 shows the amino acid sequence (SEQ ID NO: 46) derived from the coding sequence of SEQ ID NO: 45 shown in FIG. The nucleotide sequence of the native sequence PRO1891 cDNA (SEQ ID NO: 47) is shown, which is a clone designated herein as “DNA76788-2526” (UNQ873). The nucleotide sequence of the native sequence PRO1891 cDNA (SEQ ID NO: 47) is shown, which is a clone designated herein as “DNA76788-2526” (UNQ873). 47 shows the amino acid sequence (SEQ ID NO: 48) derived from the coding sequence of SEQ ID NO: 47 shown in FIG. The nucleotide sequence of the native sequence PRO4409 cDNA (SEQ ID NO: 49) is shown, which is a clone designated herein as “DNA88804-2575” (UNQ1934). 49 shows the amino acid sequence (SEQ ID NO: 50) derived from the coding sequence of SEQ ID NO: 49 shown in FIG. The nucleotide sequence of the native sequence PRO5725 cDNA (SEQ ID NO: 51) is shown, which is a clone designated herein as “DNA92265-2669” (UNQ2446). FIG. 52 shows the amino acid sequence (SEQ ID NO: 52) derived from the coding sequence of SEQ ID NO: 51 shown in FIG. The nucleotide sequence of the native sequence PRO5994 cDNA (SEQ ID NO: 53) is shown, which is a clone designated herein as “DNA98591” (UNQ2506). 53 shows the amino acid sequence (SEQ ID NO: 54) derived from the coding sequence of SEQ ID NO: 53 shown in FIG. The nucleotide sequence of the native sequence PRO6097 cDNA (SEQ ID NO: 55) is shown, which is a clone designated herein as “DNA107701-2711” (UNQ2545). An amino acid sequence (SEQ ID NO: 56) derived from the coding sequence of SEQ ID NO: 55 shown in FIG. 55 is shown. The nucleotide sequence of the native sequence PRO7425 cDNA (SEQ ID NO: 57) is shown, which is a clone designated herein as “DNA108792-2753” (UNQ2966). 57 shows the amino acid sequence (SEQ ID NO: 58) derived from the coding sequence of SEQ ID NO: 57 shown in FIG. The nucleotide sequence of the native sequence PRO10102 cDNA (SEQ ID NO: 59) is shown, which is a clone designated herein as “DNA129542-2808” (UNQ3103). An amino acid sequence (SEQ ID NO: 60) derived from the coding sequence of SEQ ID NO: 59 shown in FIG. 59 is shown. SEQ ID NO: 61, which represents the nucleotide sequence of the native sequence PRO10282 cDNA (SEQ ID NO: 61), is a clone designated herein as “DNA148380-2827” (UNQ3126). SEQ ID NO: 61, which represents the nucleotide sequence of the native sequence PRO10282 cDNA (SEQ ID NO: 61), is designated herein as “DNA148380-2827” (UNQ3126). An amino acid sequence (SEQ ID NO: 62) derived from the coding sequence of SEQ ID NO: 61 shown in FIG. 61 is shown. The nucleotide sequence (SEQ ID NO: 63) of the native sequence PRO61709 cDNA is shown, which is a clone designated herein as “DNA347767” (UNQ14964). The nucleotide sequence (SEQ ID NO: 63) of the native sequence PRO61709 cDNA is shown, which is a clone designated herein as “DNA347767” (UNQ14964). An amino acid sequence (SEQ ID NO: 64) derived from the coding sequence of SEQ ID NO: 63 shown in FIG. 63 is shown. The nucleotide sequence of the native sequence PRO779 cDNA (SEQ ID NO: 65) is shown, which is a clone designated herein as “DNA58801-1052” (UNQ455). An amino acid sequence (SEQ ID NO: 66) derived from the coding sequence of SEQ ID NO: 65 shown in FIG. 65 is shown.

Claims (149)

PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 A method for identifying a phenotype associated with disruption of a gene encoding a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide comprising:
(A) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1270 Providing a non-human transgenic animal whose genome comprises a disruption of a gene encoding a PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide;
(B) measuring the physiological properties of the non-human transgenic animal;
(C) comparing the measured physiological properties with those of wild-type animals of matched gender, wherein the physiological properties of the non-human transgenic animal differ from the physiological properties of the wild-type animal. Identified as a phenotype resulting from a gene disruption in   Non-human transgenic animals are PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1413, PRO11513PRO1 2. The method of claim 1, wherein the method is heterozygous for disruption of a gene encoding a PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.   The following phenotypes are exhibited by non-human transgenic animals compared to gender-matched littermates: neuropathy; cardiovascular, endothelial or angiogenic disease; eye abnormalities; immune disease; oncological disease; bone The method according to claim 1, wherein the method is at least one of metabolic abnormality or disease; lipid metabolism disease; or developmental abnormality.   4. The method of claim 3, wherein the neurological disorder is an increased anxiety-like response during an open field activity test.   4. The method of claim 3, wherein the neurological disorder is a reduced anxiety-like response during an open field activity test.   4. The method of claim 3, wherein the neurological disorder is an abnormal circadian rhythm during a home cage activity test.   4. The method of claim 3, wherein the neurological disorder is increased motor coordination during an inverted screen test.   4. The method of claim 3, wherein the neurological disorder is impaired motor coordination during an inverted screen test.   The neurological disorder is depression, generalized anxiety disorder, attention deficit disorder, sleep disorder, hyperactivity disorder, obsessive compulsive disorder, schizophrenia, cognitive dysfunction, hyperalgesia or sensory organ disorder. Method.   4. The method of claim 3, wherein the eye abnormality is a retinal abnormality.   4. The method of claim 3, wherein the eye abnormality is visual impairment or blindness.   11. The method of claim 10, wherein the retinal abnormality is consistent with retinitis pigmentosa.   11. The method of claim 10, wherein the retinal abnormality is characterized by retinal degeneration or retinal dysplasia.   Retinal abnormalities are retinal dysplasia, various retinopathy including retinopathy of prematurity, post lens fibroproliferation, neovascular glaucoma, age-related macular degeneration, diabetic macular edema, corneal neovascularization, corneal transplant angiogenesis, corneal transplant rejection , Retinal / choroidal neovascularization, angle angiogenesis (rubeosis), ocular neovascular disease, vascular restenosis, arteriovenous malformation (AVM), meningioma, hemangioma, hemangiofibroma, thyroid hyperplasia (including Graves' disease) ), Transplantation of cornea and other tissues, retinal artery injury or occlusion; retinal degeneration causing secondary atrophy of retinal vasculature, retinitis pigmentosa, macular atrophy, Stargardt disease, congenital static night blindness, congenital Choroidal deficiency, rotational atrophy of the brain, Labor congenital cataract, retinal segregation, Wagner syndrome, Usher syndrome, Zerweger syndrome, Sardino-Mainser syndrome, senior loken Symptoms, Bardeaux-Biddle syndrome, Alport syndrome, Alstrem syndrome, Cocaine syndrome, congenital spinal dysplasia, Flynn-Eyed syndrome, Friedreich ataxia, Hullgren's syndrome, Marshall syndrome, Albers-Schonberg disease, Refsum disease, Keynes Saier Syndrome, Wardenburg Syndrome, Alagille Syndrome, Myotonic Dystrophy, Olive Bridge Cerebellar Atrophy, Pierre-Marie Syndrome, Stickler Syndrome, Carotinemia, Cystine Accumulation, Wolfram Syndrome, Bassen-Kornzweig Syndrome, No β 11. A method according to claim 10, consistent with lipoproteinemia, dyschromia, Batten's disease, mucopolysaccharidosis, homocystinuria or mannosidosis.   4. The method of claim 3, wherein the eye abnormality is cataract.   Cataract is a systemic disease such as human Down syndrome, Hallerman-Streff syndrome, Rho syndrome, galactosemia, Marfan syndrome, trisomy 13-15, Alport syndrome, myotonic dystrophy, Fabry disease, hypoparathyroidism or 16. A method according to claim 15, consistent with Conradi syndrome.   4. The method of claim 3, wherein the developmental abnormality comprises embryonic lethality or reduced survival.   Cardiovascular, endothelial or angiogenic disease is an arterial disease such as diabetes mellitus; congestive nipple; optic nerve atrophy; atherosclerosis; angina; myocardial infarction such as acute myocardial infarction, cardiac hypertrophy, and heart failure such as congestive heart failure Hypertension; inflammatory vasculitis; Raynaud's disease and Raynaud's phenomenon; aneurysms and arterial restenosis; venous and lymphatic diseases such as thrombophlebitis, lymphangitis, and lymphedema; peripheral vascular disease; cancer such as blood vessels Tumors such as hemangiomas (capillary and spongy), glomus tumors, peripheral vasodilation, bacterial hemangiomatosis, vascular endothelial tumors, hemangiosarcomas, angioderma, Kaposi's sarcoma, lymphangioma, and lymphangiosarcoma Tumor angiogenesis; trauma such as wounds, burns and other damaged tissues, graft fixation, scars; ischemic reperfusion injury; rheumatoid arthritis; cerebrovascular disease; Failure, or osteoporosis, The method of claim 3.   Immune diseases are systemic lupus erythematosus; rheumatoid arthritis; juvenile rheumatoid arthritis; spondyloarthropathy; systemic scleroderma (scleroderma); idiopathic inflammatory myopathy (dermatomyositis, polymyositis); Sjogren's syndrome; Sarcoidosis; autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria); autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura, immune-mediated thrombocytopenia) Thyroiditis (Graves' disease, Hashimoto's thyroiditis, juvenile lymphoid thyroiditis, atrophic thyroiditis); diabetes mellitus, immune-mediated kidney disease (glomerulonephritis, tubulointerstitial nephritis); central and peripheral nervous system Demyelinating diseases such as multiple sclerosis, idiopathic demyelinating polyneuropathy or Guillain-Barre syndrome, and chronic inflammatory demyelinating polyneuropathy; hepatobiliary diseases such as infectious hepatitis (type A B, C, D, hepatitis E and other non-hepatotropic viruses), autoimmune chronic active hepatitis, primary biliary cirrhosis, granulomatous hepatitis, and sclerosing cholangitis; inflammatory bowel Diseases (ulcerative colitis: Crohn's disease); gluten-sensitive enteropathy and Whipple disease; bullous skin disease, erythema multiforme and contact dermatitis, autoimmune or immune-mediated skin diseases including psoriasis; allergic Diseases such as asthma, allergic rhinitis, atopic dermatitis, food hypersensitivity and urticaria; lung immune diseases such as eosinophilic pneumonia, idiopathic pulmonary fibrosis and hypersensitivity pneumonia; or graft rejection and graft The method according to claim 3, which is a transplantation-related disease including anti-host disease.   4. The method according to claim 3, wherein the bone metabolism disorder or disease is arthritis, osteoporosis or marble bone disease.   Non-human transgenic animals have physiological characteristics compared to gender-matched wild-type littermates: increased anxiety-like responses during open field trials; decreased anxiety-like responses during open field activity trials; Abnormal circadian rhythms during home cage activity tests, including a decrease in brain; increased exploratory activity during open field tests; increased stress-induced hyperthermia; increased motor coordination during reverse screen tests; reverse screen test Impaired motor coordination during exercise; increased retinal arterial twist; retinal degeneration characterized by diminished retinal blood vessels; ophthalmic abnormalities; increased mean systolic blood pressure; increased mean fasting serum blood glucose; Decreased blood glucose level; increased average serum cholesterol level; increased average serum triglyceride level; decreased average serum cholesterol level; average serum triglyceride level Increased glucose tolerance; impaired glucose tolerance; increased mean serum insulin levels; decreased mean serum insulin levels; increased uric acid levels; decreased serum phosphate levels; increased alkaline phosphatase levels and alanine amino groups Increased transferase levels; liver disease; increased average percentage of CD25 + in both spleen and lymph nodes; decreased average percentage of natural killer cells; decreased average percentage of CD21HiCD23Med cells in spleen and lymph nodes; average percentage of CD4 cells And increase in mean percentage of B cells; increase in mean percentage of CD8 + cells; increase in mean percentage of eosinophils; decrease in mean serum IgG1 response to ovalbumin antigen administration; mean serum IgG2a response to ovalbumin antigen administration Decrease; mean serum Ig to ovalbumin challenge 1 decreased response; increased mean serum IgG2a response to ovalbumin challenge; increased mean serum MCP-1 response to LPS challenge; increased mean serum TNF-α response to LPS challenge; mean serum MCP to LPS challenge -1 decreased response; decreased mean serum IL-6 response to LPS challenge; decreased TNFα response to LPS challenge; increased mean serum IL6 response to LPS challenge; increased mean platelet count; mean total white blood cell (WBC) ) Decrease in number; Decrease in absolute lymphocyte count; Decrease in absolute monocyte count; Decrease in dermal fibroblast proliferation; Increase in dermal fibroblast proliferation; Increase in total fat and average percentage of total fat mass; Increased; increased average physical condition; increased organ weight; increased total tissue mass (TTM); increased lean body mass (LBM); whole body, thigh And increased bone mineral density (BMD) of the vertebrae; increased bone mineral density (BMC) of the whole body, femur and vertebrae; increased volumetric bone density (vBMD) of the whole body, femur and vertebrae; Increased thickness and cross-sectional area; increased volume, number and connectivity density of average vertebral trabeculae (cancellous bone); increased average percentage of total body fat and total body fat mass; decreased average body weight; decreased average body length; total tissue volume (TTM) decrease; lean body mass (LBM) decrease; femur and vertebra bone density (BMD) decrease; whole body, femur and vertebra bone mineral density (BMC) decrease; whole body, femur and vertebra Decreased volumetric bone density (vBMD); decreased mean femoral cortical thickness and cross-sectional area; decreased average vertebral trabecular volume, number and connectivity density; severe depletion of abdominal and subcutaneous body fat deposition; Weight loss; growth retardation; hydrocephalus; sebaceous hyperplasia and adulthood The olfactory neuroepithelial cell apoptosis; lymphoid hyperplasia and tissue inflammation; developmental abnormalities; male infertility; growth delay with reduced survival; and embryonic mortality. the method of.   PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 An isolated cell derived from a non-human transgenic animal whose genome contains a disruption of a gene encoding a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.   23. The isolated cell of claim 22, which is a mouse cell.   24. The isolated cell of claim 23, wherein the mouse cell is an embryonic stem cell.   Non-human transgenic animals have the following phenotypes compared to gender-matched littermates: neuropathy; cardiovascular, endothelial or angiogenic disease; eye abnormalities; immune disorders; oncological disorders; 23. The isolated cell according to claim 22, which exhibits a disease; a lipid metabolism disease; or an abnormal development. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 A method of identifying an agent that modulates a phenotype associated with disruption of a gene encoding a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide comprising:
(A) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1270 Providing a non-human transgenic animal whose genome comprises a disruption of a gene encoding a PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide;
(B) measuring the physiological properties of the non-human transgenic animal;
(C) comparing the measured physiological properties of (b) with those of wild-type animals of matched gender, wherein the physiological properties of the non-human transgenic animal differ from those of the wild-type animals. Identified as a phenotype resulting from gene disruption in a human transgenic animal;
(D) administering a test agent to the non-human transgenic animal of (a);
(E) determining whether the test agent modulates the identified phenotype associated with gene disruption in the non-human transgenic animal.   The phenotype associated with gene disruption includes neuropathy; cardiovascular, endothelial or angiogenic disease; ocular abnormality; immune disease; oncological disease; bone metabolism disorder or disease; lipid metabolism disease; 26. The method according to 26.   28. The method of claim 27, wherein the neurological disorder is an increased anxiety-like response during an open field activity test.   28. The method of claim 27, wherein the neurological disorder is a reduced anxiety-like response during an open field activity test.   28. The method of claim 27, wherein the neurological disorder is an abnormal circadian rhythm during a home cage activity test.   28. The method of claim 27, wherein the neurological disorder is increased motor coordination during an inverted screen test.   28. The method of claim 27, wherein the neurological disorder is impaired motor coordination during an inverted screen test.   28. The neurological disorder according to claim 27, wherein the neuropathy is depression, generalized anxiety disorder, attention deficit disorder, sleep disorder, hyperactivity disorder, obsessive compulsive disorder, schizophrenia, cognitive dysfunction, hyperalgesia or sensory organ disorder. Method.   28. The method of claim 27, wherein the eye abnormality is a retinal abnormality.   28. The method of claim 27, wherein the eye abnormality is visual impairment or blindness.   35. The method of claim 34, wherein the retinal abnormality is consistent with retinitis pigmentosa.   35. The method of claim 34, wherein the retinal abnormality is characterized by retinal degeneration or retinal dysplasia.   Retinal abnormalities are retinal dysplasia, various retinopathy including retinopathy of prematurity, post lens fibroproliferation, neovascular glaucoma, age-related macular degeneration, diabetic macular edema, corneal neovascularization, corneal transplant angiogenesis, corneal transplant rejection , Retinal / choroidal neovascularization, angle angiogenesis (rubeosis), ocular neovascular disease, vascular restenosis, arteriovenous malformation (AVM), meningioma, hemangioma, hemangiofibroma, thyroid hyperplasia (including Graves' disease) ), Transplantation of cornea and other tissues, retinal artery injury or occlusion; retinal degeneration causing secondary atrophy of retinal vasculature, retinitis pigmentosa, macular atrophy, Stargardt disease, congenital static night blindness, congenital Choroidal deficiency, rotational atrophy of the brain, Labor congenital cataract, retinal segregation, Wagner syndrome, Usher syndrome, Zerweger syndrome, Sardino-Mainser syndrome, senior loken Symptoms, Bardeaux-Biddle syndrome, Alport syndrome, Alstrem syndrome, Cocaine syndrome, congenital spinal dysplasia, Flynn-Eyed syndrome, Friedreich ataxia, Hullgren's syndrome, Marshall syndrome, Albers-Schonberg disease, Refsum disease, Keynes Saier Syndrome, Wardenburg Syndrome, Alagille Syndrome, Myotonic Dystrophy, Olive Bridge Cerebellar Atrophy, Pierre-Marie Syndrome, Stickler Syndrome, Carotinemia, Cystine Accumulation, Wolfram Syndrome, Bassen-Kornzweig Syndrome, No β 35. The method of claim 34, consistent with lipoproteinemia, dystaxia, Batten's disease, mucopolysaccharidosis, homocystinuria, or mannosidosis.   28. The method of claim 27, wherein the eye abnormality is cataract.   Cataract is a systemic disease such as human Down syndrome, Hallerman-Streff syndrome, Rho syndrome, galactosemia, Marfan syndrome, trisomy 13-15, Alport syndrome, myotonic dystrophy, Fabry disease, hypoparathyroidism or 40. The method of claim 39, consistent with Conradi syndrome.   28. The method of claim 27, wherein the developmental abnormality comprises embryonic lethality or reduced survival.   Cardiovascular, endothelial or angiogenic disease is an arterial disease such as diabetes mellitus; congestive nipple; optic nerve atrophy; atherosclerosis; angina; myocardial infarction such as acute myocardial infarction, cardiac hypertrophy, and heart failure such as congestive heart failure Hypertension; inflammatory vasculitis; Raynaud's disease and Raynaud's phenomenon; aneurysms and arterial restenosis; venous and lymphatic diseases such as thrombophlebitis, lymphangitis, and lymphedema; peripheral vascular disease; cancer such as blood vessels Tumors such as hemangiomas (capillary and spongy), glomus tumors, peripheral vasodilation, bacterial hemangiomatosis, vascular endothelial tumors, hemangiosarcomas, angioderma, Kaposi's sarcoma, lymphangioma, and lymphangiosarcoma Tumor angiogenesis; trauma such as wounds, burns and other damaged tissues, graft fixation, scars; ischemic reperfusion injury; rheumatoid arthritis; cerebrovascular disease; Failure, or osteoporosis, The method of claim 27.   Immune diseases are systemic lupus erythematosus; rheumatoid arthritis; juvenile rheumatoid arthritis; spondyloarthropathy; systemic scleroderma (scleroderma); idiopathic inflammatory myopathy (dermatomyositis, polymyositis); Sjogren's syndrome; Sarcoidosis; autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria); autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura, immune-mediated thrombocytopenia) Thyroiditis (Graves' disease, Hashimoto's thyroiditis, juvenile lymphoid thyroiditis, atrophic thyroiditis); diabetes mellitus, immune-mediated kidney disease (glomerulonephritis, tubulointerstitial nephritis); central and peripheral nervous system Demyelinating diseases such as multiple sclerosis, idiopathic demyelinating polyneuropathy or Guillain-Barre syndrome, and chronic inflammatory demyelinating polyneuropathy; hepatobiliary diseases such as infectious hepatitis (type A B, C, D, hepatitis E and other non-hepatotropic viruses), autoimmune chronic active hepatitis, primary biliary cirrhosis, granulomatous hepatitis, and sclerosing cholangitis; inflammatory bowel Diseases (ulcerative colitis: Crohn's disease); gluten-sensitive enteropathy and Whipple disease; bullous skin disease, erythema multiforme and contact dermatitis, autoimmune or immune-mediated skin diseases including psoriasis; allergic Diseases such as asthma, allergic rhinitis, atopic dermatitis, food hypersensitivity and urticaria; lung immune diseases such as eosinophilic pneumonia, idiopathic pulmonary fibrosis and hypersensitivity pneumonia; or graft rejection and graft 28. The method of claim 27, wherein the method is a transplant-related disease including host disease.   28. The method of claim 27, wherein the bone metabolism disorder or disease is arthritis, osteoporosis or marble bone disease.   Non-human transgenic animals have physiological characteristics: increased anxiety-like response during open field trials; reduced anxiety-like response during open field activity trials; migration compared to gender-matched wild-type littermates Abnormal circadian rhythms during home cage activity tests, including decreased numbers; increased exploratory activity during open field tests; increased stress-induced hyperthermia; increased motor coordination during reverse screen test; reverse screen Impaired motor coordination during the trial; increased retinal artery twist; retinal degeneration characterized by retinal vascular attenuation; ophthalmic abnormalities; increased mean systolic blood pressure; increased average fasting serum blood glucose; average Decrease in serum blood glucose level; increase in average serum cholesterol level; increase in average serum triglyceride level; decrease in average serum cholesterol level; average serum triglyceride Increased glucose tolerance; Impaired glucose tolerance; Increased mean serum insulin levels; Decrease in average serum insulin levels; Increase in uric acid levels; Decrease in serum phosphate levels; Increase in alkaline phosphatase levels and alanine amino groups Increased transferase levels; liver disease; increased average percentage of CD25 + in both spleen and lymph nodes; decreased average percentage of natural killer cells; decreased average percentage of CD21HiCD23Med cells in spleen and lymph nodes; average percentage of CD4 cells And increase in mean percentage of B cells; increase in mean percentage of CD8 + cells; increase in mean percentage of eosinophils; decrease in mean serum IgG1 response to ovalbumin antigen administration; mean serum IgG2a response to ovalbumin antigen administration Decrease; mean serum I for ovalbumin challenge Decreased G1 response; increased mean serum IgG2a response to ovalbumin challenge; increased mean serum MCP-1 response to LPS challenge; increased mean serum TNF-α response to LPS challenge; mean serum MCP to LPS challenge -1 decreased response; decreased mean serum IL-6 response to LPS challenge; decreased TNFα response to LPS challenge; increased mean serum IL6 response to LPS challenge; increased mean platelet count; mean total white blood cell (WBC) ) Decrease in number; Decrease in absolute lymphocyte count; Decrease in absolute monocyte count; Decrease in dermal fibroblast proliferation; Increase in dermal fibroblast proliferation; Increase in total fat and average percentage of total fat mass; Increased; increased average physical condition; increased organ weight; increased total tissue mass (TTM); increased lean body mass (LBM); systemic, large Increased bone and vertebra bone density (BMD); Increased bone mineral density (BMC) of whole body, femur and vertebra; Increased volumetric bone density (vBMD) of whole body, femur and vertebra; Average mid femur Increased cortical thickness and cross-sectional area; increased average vertebral trabecular volume, number and connectivity density; increased average body fat and average percentage of total body fat; decreased average body weight; decreased average body length; total tissue mass (TTM) Reduction of lean body mass (LBM); reduction of femur and vertebra bone density (BMD); reduction of bone mineral density (BMC) of whole body, femur and vertebra; volume measurement of whole body, femur and vertebra Reduced bone density (vBMD); reduced mean femoral cortical thickness and cross-sectional area; reduced mean vertebral trabecular volume, number and connectivity density; severe depletion of abdominal and subcutaneous body fat deposition; reduced organ weight Growth retardation; hydrocephalus; sebaceous hyperplasia and growth retardation; 27. The method of claim 26, wherein the method exhibits at least one of apoptosis of olfactory neuroepithelial cells; lymphoid hyperplasia and tissue inflammation; developmental abnormalities; male infertility; growth delay with reduced survival; and embryonic mortality.   27. An agent identified by the method of claim 26.   PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 47. The agent of claim 46, wherein the agent is an agonist or antagonist of a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.   Agonist is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 48. A drug according to claim 47 which is an antibody.   The antagonists are anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 48. A drug according to claim 47 which is an antibody. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 A method of identifying an agent that modulates a physiological property associated with disruption of a gene encoding a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide comprising:
(A) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1270 Providing a non-human transgenic animal whose genome comprises a disruption of a gene encoding a PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide;
(B) measuring the physiological properties of the non-human transgenic animal of (a);
(C) comparing the measured physiological properties of (b) with those of wild-type animals of matched gender, wherein the physiological properties exhibited by the non-human transgenic animal differ from those exhibited by the wild-type animals. Has been identified as a physiological property associated with gene disruption;
(D) administering a test agent to the non-human transgenic animal of (a);
(E) determining whether a physiological property associated with gene disruption is modulated.   Non-human transgenic animals have physiological characteristics: increased anxiety-like response during open field trials; reduced anxiety-like response during open field activity trials; migration compared to gender-matched wild-type littermates Abnormal circadian rhythms during home cage activity tests, including decreased numbers; increased exploratory activity during open field tests; increased stress-induced hyperthermia; increased motor coordination during reverse screen test; reverse screen Impaired motor coordination during the trial; increased retinal artery twist; retinal degeneration characterized by retinal vascular attenuation; ophthalmic abnormalities; increased mean systolic blood pressure; increased average fasting serum blood glucose; average Decrease in serum blood glucose level; increase in average serum cholesterol level; increase in average serum triglyceride level; decrease in average serum cholesterol level; average serum triglyceride Increased glucose tolerance; Impaired glucose tolerance; Increased mean serum insulin levels; Decrease in average serum insulin levels; Increase in uric acid levels; Decrease in serum phosphate levels; Increase in alkaline phosphatase levels and alanine amino groups Increased transferase levels; liver disease; increased average percentage of CD25 + in both spleen and lymph nodes; decreased average percentage of natural killer cells; decreased average percentage of CD21HiCD23Med cells in spleen and lymph nodes; average percentage of CD4 cells And increase in mean percentage of B cells; increase in mean percentage of CD8 + cells; increase in mean percentage of eosinophils; decrease in mean serum IgG1 response to ovalbumin antigen administration; mean serum IgG2a response to ovalbumin antigen administration Decrease; mean serum I for ovalbumin challenge Decreased G1 response; increased mean serum IgG2a response to ovalbumin challenge; increased mean serum MCP-1 response to LPS challenge; increased mean serum TNF-α response to LPS challenge; mean serum MCP to LPS challenge -1 decreased response; decreased mean serum IL-6 response to LPS challenge; decreased TNFα response to LPS challenge; increased mean serum IL6 response to LPS challenge; increased mean platelet count; mean total white blood cell (WBC) ) Decrease in number; Decrease in absolute lymphocyte count; Decrease in absolute monocyte count; Decrease in dermal fibroblast proliferation; Increase in dermal fibroblast proliferation; Increase in total fat and average percentage of total fat mass; Increased; increased average physical condition; increased organ weight; increased total tissue mass (TTM); increased lean body mass (LBM); systemic, large Increased bone and vertebra bone density (BMD); Increased bone mineral density (BMC) of whole body, femur and vertebra; Increased volumetric bone density (vBMD) of whole body, femur and vertebra; Average mid femur Increased cortical thickness and cross-sectional area; increased average vertebral trabecular volume, number and connectivity density; increased average body fat and average percentage of total body fat; decreased average body weight; decreased average body length; total tissue mass (TTM) Reduction of lean body mass (LBM); reduction of femur and vertebra bone density (BMD); reduction of bone mineral density (BMC) of whole body, femur and vertebra; volume measurement of whole body, femur and vertebra Reduced bone density (vBMD); reduced mean femoral cortical thickness and cross-sectional area; reduced mean vertebral trabecular volume, number and connectivity density; severe depletion of abdominal and subcutaneous body fat deposition; reduced organ weight Growth retardation; hydrocephalus; sebaceous hyperplasia and growth retardation; 51. The method of claim 50, showing at least one of apoptosis of olfactory neuroepithelial cells; lymphoid hyperplasia and tissue inflammation; developmental abnormalities; male infertility; growth delay with reduced survival; and embryonic mortality.   51. An agent identified by the method of claim 50.   PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 53. The agent of claim 52, wherein the agent is an agonist or antagonist of a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.   Agonist is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 54. The agent according to claim 53, which is an antibody.   The antagonists are anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 54. The agent according to claim 53, which is an antibody. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 A method of identifying an agent that modulates a behavior associated with disruption of a gene encoding a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide comprising:
(A) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1270 Providing a non-human transgenic animal whose genome comprises a disruption of a gene encoding a PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide;
(B) observe the behavior exhibited by the non-human transgenic animal of (a);
(C) comparing the observed behavior of (b) with that of a wild-type animal of matched gender, where the observed behavior exhibited by a non-human transgenic animal different from the observed behavior exhibited by the wild-type animal Identified as a behavior associated with gene disruption;
(D) administering a test agent to the non-human transgenic animal of (a);
(E) determining whether the agent modulates a behavior associated with gene disruption.   57. The method of claim 56, wherein the behavior is an increased anxiety-like response during an open field activity test.   57. The method of claim 56, wherein the behavior is a reduced anxiety-like response during an open field activity test.   57. The method of claim 56, wherein the behavior is an abnormal circadian rhythm during a home cage activity test.   57. The method of claim 56, wherein the behavior is increased motor coordination during an inverted screen test.   57. The method of claim 56, wherein the behavior is impaired motor coordination during an inverted screen test.   57. The method of claim 56, wherein the behavior is depression, generalized anxiety disorder, attention deficit disorder, sleep disorder, hyperactivity disorder, obsessive compulsive disorder, schizophrenia, cognitive impairment, hyperalgesia or sensory organ disorder. .   57. An agent identified by the method of claim 56.   PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 64. The agent of claim 63, wherein the agent is an agonist or antagonist of a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.   Agonist is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 The drug according to claim 64, which is an antibody.   The antagonists are anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 The drug according to claim 64, which is an antibody. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide-related neurological disorders; cardiovascular, endothelial or angiogenic diseases; ocular abnormalities; immune disorders; oncological disorders; Bone metabolism disorder or disease; lipid metabolism disorder; or developmental disorder A method of identifying a remission or modulate drug,
(A) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1270 Providing a non-human transgenic animal whose genome comprises a disruption of a gene encoding a PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide;
(B) administering a test agent to the non-human transgenic animal;
(C) The test drug is a neuropathy in a non-human transgenic animal; cardiovascular, endothelial or angiogenic disease; ocular abnormality; immune disease; oncological disease; bone metabolism abnormality or disease; lipid metabolism disease; Determining whether to ameliorate or regulate.   68. The method of claim 67, wherein the neurological disorder is an increased anxiety-like response during an open field activity test.   68. The method of claim 67, wherein the neurological disorder is a reduced anxiety-like response during an open field activity test.   68. The method of claim 67, wherein the neurological disorder is an abnormal circadian rhythm during a home cage activity test.   68. The method of claim 67, wherein the neurological disorder is increased motor coordination during an inverted screen test.   68. The method of claim 67, wherein the neurological disorder is impaired motor coordination during an inverted screen test.   68. The neurological disorder is depression, generalized anxiety disorder, attention deficit disorder, sleep disorder, hyperactivity disorder, obsessive compulsive disorder, schizophrenia, cognitive impairment, hyperalgesia or sensory organ disorder Method.   68. The method of claim 67, wherein the eye abnormality is a retinal abnormality.   68. The method of claim 67, wherein the eye abnormality is visual impairment or blindness.   75. The method of claim 74, wherein the retinal abnormality is consistent with retinitis pigmentosa.   75. The method of claim 74, wherein the retinal abnormality is characterized by retinal degeneration or retinal dysplasia.   Retinal abnormalities are retinal dysplasia, various retinopathy including retinopathy of prematurity, post lens fibroproliferation, neovascular glaucoma, age-related macular degeneration, diabetic macular edema, corneal neovascularization, corneal transplant angiogenesis, corneal transplant rejection , Retinal / choroidal neovascularization, angle angiogenesis (rubeosis), ocular neovascular disease, vascular restenosis, arteriovenous malformation (AVM), meningioma, hemangioma, hemangiofibroma, thyroid hyperplasia (including Graves' disease) ), Transplantation of cornea and other tissues, retinal artery injury or occlusion; retinal degeneration causing secondary atrophy of retinal vasculature, retinitis pigmentosa, macular atrophy, Stargardt disease, congenital static night blindness, congenital Choroidal deficiency, rotational atrophy of the brain, Labor congenital cataract, retinal segregation, Wagner syndrome, Usher syndrome, Zerweger syndrome, Sardino-Mainser syndrome, senior loken Symptoms, Bardeaux-Biddle syndrome, Alport syndrome, Alstrem syndrome, Cocaine syndrome, congenital spinal dysplasia, Flynn-Eyed syndrome, Friedreich ataxia, Hullgren's syndrome, Marshall syndrome, Albers-Schonberg disease, Refsum disease, Keynes Saier Syndrome, Wardenburg Syndrome, Alagille Syndrome, Myotonic Dystrophy, Olive Bridge Cerebellar Atrophy, Pierre-Marie Syndrome, Stickler Syndrome, Carotinemia, Cystine Accumulation, Wolfram Syndrome, Bassen-Kornzweig Syndrome, No β 75. The method of claim 74, consistent with lipoproteinemia, dyschromia, Batten's disease, mucopolysaccharidosis, homocystinuria, or mannosidosis.   68. The method of claim 67, wherein the eye abnormality is cataract.   Cataract is a systemic disease such as human Down syndrome, Hallerman-Streff syndrome, Rho syndrome, galactosemia, Marfan syndrome, trisomy 13-15, Alport syndrome, myotonic dystrophy, Fabry disease, hypoparathyroidism or 80. The method of claim 79, consistent with Conradi syndrome.   68. The method of claim 67, wherein the developmental abnormality comprises embryonic lethality or reduced survival.   Cardiovascular, endothelial or angiogenic disease is an arterial disease such as diabetes mellitus; congestive nipple; optic nerve atrophy; atherosclerosis; angina; myocardial infarction such as acute myocardial infarction, cardiac hypertrophy, and heart failure such as congestive heart failure Hypertension; inflammatory vasculitis; Raynaud's disease and Raynaud's phenomenon; aneurysms and arterial restenosis; venous and lymphatic diseases such as thrombophlebitis, lymphangitis, and lymphedema; peripheral vascular disease; cancer such as blood vessels Tumors such as hemangiomas (capillary and spongy), glomus tumors, peripheral vasodilation, bacterial hemangiomatosis, vascular endothelial tumors, hemangiosarcomas, angioderma, Kaposi's sarcoma, lymphangioma, and lymphangiosarcoma Tumor angiogenesis; trauma such as wounds, burns and other damaged tissues, graft fixation, scars; ischemic reperfusion injury; rheumatoid arthritis; cerebrovascular disease; Failure, or osteoporosis, The method of claim 67.   Immune diseases are systemic lupus erythematosus; rheumatoid arthritis; juvenile rheumatoid arthritis; spondyloarthropathy; systemic scleroderma (scleroderma); idiopathic inflammatory myopathy (dermatomyositis, polymyositis); Sjogren's syndrome; Sarcoidosis; autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria); autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura, immune-mediated thrombocytopenia) Thyroiditis (Graves' disease, Hashimoto's thyroiditis, juvenile lymphoid thyroiditis, atrophic thyroiditis); diabetes mellitus, immune-mediated kidney disease (glomerulonephritis, tubulointerstitial nephritis); central and peripheral nervous system Demyelinating diseases such as multiple sclerosis, idiopathic demyelinating polyneuropathy or Guillain-Barre syndrome, and chronic inflammatory demyelinating polyneuropathy; hepatobiliary diseases such as infectious hepatitis (type A B, C, D, hepatitis E and other non-hepatotropic viruses), autoimmune chronic active hepatitis, primary biliary cirrhosis, granulomatous hepatitis, and sclerosing cholangitis; inflammatory bowel Diseases (ulcerative colitis: Crohn's disease); gluten-sensitive enteropathy and Whipple disease; bullous skin disease, erythema multiforme and contact dermatitis, autoimmune or immune-mediated skin diseases including psoriasis; allergic Diseases such as asthma, allergic rhinitis, atopic dermatitis, food hypersensitivity and urticaria; lung immune diseases such as eosinophilic pneumonia, idiopathic pulmonary fibrosis and hypersensitivity pneumonia; or graft rejection and graft 68. The method of claim 67, wherein the method is a transplant-related disease including host disease.   68. The method of claim 67, wherein the bone metabolism disorder or disease is arthritis, osteoporosis, or marble bone disease.   Physiological characteristics of non-human transgenic animals compared to gender-matched wild-type littermates: increased anxiety-like response during open field test; decreased anxiety-like response during open field activity test; Abnormal circadian rhythm during home cage activity test, including decrease; increased exploratory activity during open field test; increased stress-induced hyperthermia; increased motor coordination during reverse screen test; Impairment of motor coordination between; increased retinal artery twist; retinal degeneration characterized by retinal vascular attenuation; ophthalmic abnormalities; increased mean systolic blood pressure; increased mean fasting serum blood glucose; Decreased value; increased average serum cholesterol level; increased average serum triglyceride level; decreased average serum cholesterol level; average serum triglyceride level Increased glucose tolerance; impaired glucose tolerance; increased mean serum insulin levels; decreased mean serum insulin levels; increased uric acid levels; decreased serum phosphate levels; increased alkaline phosphatase levels and alanine amino groups Increased transferase levels; liver disease; increased average percentage of CD25 + in both spleen and lymph nodes; decreased average percentage of natural killer cells; decreased average percentage of CD21HiCD23Med cells in spleen and lymph nodes; average percentage of CD4 cells And increase in mean percentage of B cells; increase in mean percentage of CD8 + cells; increase in mean percentage of eosinophils; decrease in mean serum IgG1 response to ovalbumin antigen administration; mean serum IgG2a response to ovalbumin antigen administration Decrease; mean serum Ig to ovalbumin challenge 1 decreased response; increased mean serum IgG2a response to ovalbumin challenge; increased mean serum MCP-1 response to LPS challenge; increased mean serum TNF-α response to LPS challenge; mean serum MCP to LPS challenge -1 decreased response; decreased mean serum IL-6 response to LPS challenge; decreased TNFα response to LPS challenge; increased mean serum IL6 response to LPS challenge; increased mean platelet count; mean total white blood cell (WBC) ) Decrease in number; Decrease in absolute lymphocyte count; Decrease in absolute monocyte count; Decrease in dermal fibroblast proliferation; Increase in dermal fibroblast proliferation; Increase in total fat and average percentage of total fat mass; Increased; increased average physical condition; increased organ weight; increased total tissue mass (TTM); increased lean body mass (LBM); whole body, thigh And increased bone mineral density (BMD) of the vertebrae; increased bone mineral density (BMC) of the whole body, femur and vertebrae; increased volumetric bone density (vBMD) of the whole body, femur and vertebrae; Increased thickness and cross-sectional area; increased average vertebral trabecular volume, number and connectivity density; increased average fat and average percentage of total fat mass; decreased average body weight; decreased average body length; total tissue mass (TTM) Decrease; Decrease of lean body mass (LBM); Decrease of bone density (BMD) of femur and vertebra; Decrease of bone mineral density (BMC) of whole body, femur and vertebra; Volumetric bone of whole body, femur and vertebra Decreased density (vBMD); decreased average femoral cortical thickness and cross-sectional area; decreased average vertebral trabecular volume, number and connectivity density; severe depletion of abdominal and subcutaneous body fat deposition; decreased organ weight; Growth retardation; hydrocephalus; sebaceous hyperplasia and growth retardation; 68. The method of claim 67, wherein the method exhibits at least one of apoptosis of optic nerve epithelial cells; lymphoid hyperplasia and tissue inflammation; developmental abnormality; male infertility; growth delay with reduced survival; and embryonic mortality.   68. An agent identified by the method of claim 67.   PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 90. The agent of claim 86, wherein the agent is an agonist or antagonist of a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.   Agonist is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 90. The agent according to claim 87, which is an antibody.   The antagonists are anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 90. The agent according to claim 87, which is an antibody.   68. A therapeutic agent identified by the method of claim 67. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 A method of identifying an agent that modulates expression of a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, comprising:
(A) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1270 Contacting a test agent with a host cell expressing a PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide;
(B) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO10013, PRO1103, PRO10013, PRO1413, RO1213, PRO1413, PRO1413 , Determining whether to modulate expression of a PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.   92. A drug identified by the method of claim 91.   PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 94. The agent of claim 92, wherein the agent is an agonist or antagonist of a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.   Agonist is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 94. The agent according to claim 93, which is an antibody.   The antagonists are anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 94. The agent according to claim 93, which is an antibody. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 A method of evaluating a therapeutic agent capable of affecting symptoms associated with disruption of a gene encoding a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide comprising:
(A) PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO11513, PRO1270 Providing a non-human transgenic animal whose genome comprises a disruption of a gene encoding a PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide;
(B) measuring the physiological properties of the non-human transgenic animal of (a);
(C) comparing the measured physiological properties of (b) with those of wild-type animals of matched gender, where the physiological properties of the non-human transgenic animal differ from those of the wild-type animals. Identified as a symptom resulting from gene disruption in a human transgenic animal;
(D) administering a test agent to the non-human transgenic animal of (a);
(E) assessing the effect of the test agent on the identified symptoms associated with gene disruption in the non-human transgenic animal.   99. The method of claim 96, wherein the symptom is neuropathy; cardiovascular, endothelial or angiogenic disease; ocular abnormality; immune disease; oncological disease; bone metabolism disorder or disease; lipid metabolism disease; .   99. A therapeutic agent identified by the method of claim 96.   PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 99. The therapeutic agent of claim 98, wherein the therapeutic agent is an agonist or antagonist of a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.   Agonist is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 The therapeutic agent according to claim 99, which is an antibody.   The antagonists are anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 The therapeutic agent according to claim 99, which is an antibody.   99. A pharmaceutical composition comprising the therapeutic agent according to claim 98.   PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 Neuropathy associated with disruption of the gene encoding PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide; cardiovascular, endothelial or angiogenic disease; immune disease; oncological disease; Treat or prevent or ameliorate disease or embryonic lethality 95. The method of claim 94, wherein the method is a therapeutically effective amount for a patient who already has or is prone to have the disease or in need of treatment for which the disease is prevented. A method comprising administering an agent, or an agonist or antagonist thereof, thereby effectively treating or preventing or ameliorating the disease.   104. The method of claim 103, wherein the neurological disorder is an increased anxiety-like response during an open field activity test.   104. The method of claim 103, wherein the neurological disorder is a reduced anxiety-like response during an open field activity test.   104. The method of claim 103, wherein the neurological disorder is an abnormal circadian rhythm during a home cage activity test.   104. The method of claim 103, wherein the neurological disorder is increased motor coordination during an inverted screen test.   104. The method of claim 103, wherein the neurological disorder is impaired motor coordination during an inverted screen test.   The neurological disorder is depression, generalized anxiety disorder, attention deficit disorder, sleep disorder, hyperactivity disorder, obsessive compulsive disorder, schizophrenia, cognitive dysfunction, hyperalgesia or sensory organ disorder. Method.   104. The method of claim 103, wherein the eye abnormality is a retinal abnormality.   104. The method of claim 103, wherein the eye abnormality is visual impairment or blindness.   111. The method of claim 110, wherein the retinal abnormality is consistent with retinitis pigmentosa.   111. The method of claim 110, wherein the retinal abnormality is characterized by retinal degeneration or retinal dysplasia.   Retinal abnormalities are retinal dysplasia, various retinopathy including retinopathy of prematurity, post lens fibroproliferation, neovascular glaucoma, age-related macular degeneration, diabetic macular edema, corneal neovascularization, corneal transplant angiogenesis, corneal transplant rejection , Retinal / choroidal neovascularization, angle angiogenesis (rubeosis), ocular neovascular disease, vascular restenosis, arteriovenous malformation (AVM), meningioma, hemangioma, hemangiofibroma, thyroid hyperplasia (including Graves' disease) ), Transplantation of cornea and other tissues, retinal artery injury or occlusion; retinal degeneration causing secondary atrophy of retinal vasculature, retinitis pigmentosa, macular atrophy, Stargardt disease, congenital static night blindness, congenital Choroidal deficiency, rotational atrophy of the brain, Labor congenital cataract, retinal segregation, Wagner syndrome, Usher syndrome, Zerweger syndrome, Sardino-Mainser syndrome, senior loken Symptoms, Bardeaux-Biddle syndrome, Alport syndrome, Alstrem syndrome, Cocaine syndrome, congenital spinal dysplasia, Flynn-Eyed syndrome, Friedreich ataxia, Hullgren's syndrome, Marshall syndrome, Albers-Schonberg disease, Refsum disease, Keynes Saier Syndrome, Wardenburg Syndrome, Alagille Syndrome, Myotonic Dystrophy, Olive Bridge Cerebellar Atrophy, Pierre-Marie Syndrome, Stickler Syndrome, Carotinemia, Cystine Accumulation, Wolfram Syndrome, Bassen-Kornzweig Syndrome, No β 111. The method of claim 110, consistent with lipoproteinemia, dystaxia, Batten disease, mucopolysaccharidosis, homocystinuria, or mannosidosis.   104. The method of claim 103, wherein the eye abnormality is cataract.   Cataract is a systemic disease such as human Down syndrome, Hallerman-Streff syndrome, Rho syndrome, galactosemia, Marfan syndrome, trisomy 13-15, Alport syndrome, myotonic dystrophy, Fabry disease, hypoparathyroidism or 116. The method of claim 115, consistent with Conradi syndrome.   104. The method of claim 103, wherein the developmental abnormality comprises embryonic lethality or reduced survival.   Cardiovascular, endothelial or angiogenic disease is an arterial disease such as diabetes mellitus; congestive nipple; optic nerve atrophy; atherosclerosis; angina; myocardial infarction such as acute myocardial infarction, cardiac hypertrophy, and heart failure such as congestive heart failure Hypertension; inflammatory vasculitis; Raynaud's disease and Raynaud's phenomenon; aneurysms and arterial restenosis; venous and lymphatic diseases such as thrombophlebitis, lymphangitis, and lymphedema; peripheral vascular disease; cancer such as blood vessels Tumors such as hemangiomas (capillary and spongy), glomus tumors, peripheral vasodilation, bacterial hemangiomatosis, vascular endothelial tumors, hemangiosarcomas, angioderma, Kaposi's sarcoma, lymphangioma, and lymphangiosarcoma Tumor angiogenesis; trauma such as wounds, burns and other damaged tissues, graft fixation, scars; ischemic reperfusion injury; rheumatoid arthritis; cerebrovascular disease; Failure, or osteoporosis, The method of claim 103.   Immune diseases are systemic lupus erythematosus; rheumatoid arthritis; juvenile rheumatoid arthritis; spondyloarthropathy; systemic scleroderma (scleroderma); idiopathic inflammatory myopathy (dermatomyositis, polymyositis); Sjogren's syndrome; Sarcoidosis; autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria); autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura, immune-mediated thrombocytopenia) Thyroiditis (Graves' disease, Hashimoto's thyroiditis, juvenile lymphoid thyroiditis, atrophic thyroiditis); diabetes mellitus, immune-mediated kidney disease (glomerulonephritis, tubulointerstitial nephritis); central and peripheral nervous system Demyelinating diseases such as multiple sclerosis, idiopathic demyelinating polyneuropathy or Guillain-Barre syndrome, and chronic inflammatory demyelinating polyneuropathy; hepatobiliary diseases such as infectious hepatitis (type A B, C, D, hepatitis E and other non-hepatotropic viruses), autoimmune chronic active hepatitis, primary biliary cirrhosis, granulomatous hepatitis, and sclerosing cholangitis; inflammatory bowel Diseases (ulcerative colitis: Crohn's disease); gluten-sensitive enteropathy and Whipple disease; bullous skin disease, erythema multiforme and contact dermatitis, autoimmune or immune-mediated skin diseases including psoriasis; allergic Diseases such as asthma, allergic rhinitis, atopic dermatitis, food hypersensitivity and urticaria; lung immune diseases such as eosinophilic pneumonia, idiopathic pulmonary fibrosis and hypersensitivity pneumonia; or graft rejection and graft 104. The method of claim 103, wherein the method is a transplantation-related disease including host disease.   104. The method of claim 103, wherein the bone metabolism disorder or disease is arthritis, osteoporosis or marble bone disease. PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide-related neurological disorders; cardiovascular, endothelial or angiogenic diseases; ocular abnormalities; immune disorders; oncological disorders; Bone metabolism disorder or disease; lipid metabolism disorder; or developmental disorder A method of identifying a remission or modulate drug,
(A) providing a non-human transgenic animal cell culture, each cell of which is PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or the PR0179 polypeptide
(B) administering a test agent to the cell culture;
(C) the test drug is neuropathy in the cell culture; cardiovascular, endothelial or angiogenic disease; ocular abnormality; immune disease; oncological disease; bone metabolism abnormality or disease; lipid metabolism disease; Determining whether to ameliorate or regulate.   122. The method of claim 121, wherein the neurological disorder is an increased anxiety-like response during an open field activity test.   122. The method of claim 121, wherein the neurological disorder is a reduced anxiety-like response during an open field activity test.   122. The method of claim 121, wherein the neurological disorder is an abnormal circadian rhythm during a home cage activity test.   122. The method of claim 121, wherein the neurological disorder is increased motor coordination during an inverted screen test.   122. The method of claim 121, wherein the neurological disorder is impaired motor coordination during an inverted screen test.   122. The neurological disorder is depression, generalized anxiety disorder, attention deficit disorder, sleep disorder, hyperactivity disorder, obsessive compulsive disorder, schizophrenia, cognitive dysfunction, hyperalgesia or sensory organ disorder. Method.   122. The method of claim 121, wherein the eye abnormality is a retinal abnormality.   122. The method of claim 121, wherein the eye abnormality is visual impairment or blindness.   129. The method of claim 128, wherein the retinal abnormality is consistent with retinitis pigmentosa.   129. The method of claim 128, wherein the retinal abnormality is characterized by retinal degeneration or retinal dysplasia.   Retinal abnormalities are retinal dysplasia, various retinopathy including retinopathy of prematurity, post lens fibroproliferation, neovascular glaucoma, age-related macular degeneration, diabetic macular edema, corneal neovascularization, corneal transplant angiogenesis, corneal transplant rejection , Retinal / choroidal neovascularization, angle angiogenesis (rubeosis), ocular neovascular disease, vascular restenosis, arteriovenous malformation (AVM), meningioma, hemangioma, hemangiofibroma, thyroid hyperplasia (including Graves' disease) ), Transplantation of cornea and other tissues, retinal artery injury or occlusion; retinal degeneration causing secondary atrophy of retinal vasculature, retinitis pigmentosa, macular atrophy, Stargardt disease, congenital static night blindness, congenital Choroidal deficiency, rotational atrophy of the brain, Labor congenital cataract, retinal segregation, Wagner syndrome, Usher syndrome, Zerweger syndrome, Sardino-Mainser syndrome, senior loken Symptoms, Bardeaux-Biddle syndrome, Alport syndrome, Alstrem syndrome, Cocaine syndrome, congenital spinal dysplasia, Flynn-Eyed syndrome, Friedreich ataxia, Hullgren's syndrome, Marshall syndrome, Albers-Schonberg disease, Refsum disease, Keynes Saier Syndrome, Wardenburg Syndrome, Alagille Syndrome, Myotonic Dystrophy, Olive Bridge Cerebellar Atrophy, Pierre-Marie Syndrome, Stickler Syndrome, Carotinemia, Cystine Accumulation, Wolfram Syndrome, Bassen-Kornzweig Syndrome, No β 129. The method of claim 128, consistent with lipoproteinemia, dyschromia, Batten's disease, mucopolysaccharidosis, homocystinuria, or mannosidosis.   122. The method of claim 121, wherein the eye abnormality is cataract.   Cataract is a systemic disease such as human Down syndrome, Hallerman-Streff syndrome, Rho syndrome, galactosemia, Marfan syndrome, trisomy 13-15, Alport syndrome, myotonic dystrophy, Fabry disease, hypoparathyroidism or 143. The method of claim 133, consistent with Conradi syndrome.   122. The method of claim 121, wherein the developmental abnormality comprises embryonic lethality or reduced survival.   Cardiovascular, endothelial or angiogenic disease is an arterial disease such as diabetes mellitus; congestive nipple; optic nerve atrophy; atherosclerosis; angina; myocardial infarction such as acute myocardial infarction, cardiac hypertrophy, and heart failure such as congestive heart failure Hypertension; inflammatory vasculitis; Raynaud's disease and Raynaud's phenomenon; aneurysms and arterial restenosis; venous and lymphatic diseases such as thrombophlebitis, lymphangitis, and lymphedema; peripheral vascular disease; cancer such as blood vessels Tumors such as hemangiomas (capillary and spongy), glomus tumors, peripheral vasodilation, bacterial hemangiomatosis, vascular endothelial tumors, hemangiosarcomas, angioderma, Kaposi's sarcoma, lymphangioma, and lymphangiosarcoma Tumor angiogenesis; trauma such as wounds, burns and other damaged tissues, graft fixation, scars; ischemic reperfusion injury; rheumatoid arthritis; cerebrovascular disease; Failure, or osteoporosis, The method of claim 121.   Immune diseases are systemic lupus erythematosus; rheumatoid arthritis; juvenile rheumatoid arthritis; spondyloarthropathy; systemic scleroderma (scleroderma); idiopathic inflammatory myopathy (dermatomyositis, polymyositis); Sjogren's syndrome; Sarcoidosis; autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria); autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura, immune-mediated thrombocytopenia) Thyroiditis (Graves' disease, Hashimoto's thyroiditis, juvenile lymphoid thyroiditis, atrophic thyroiditis); diabetes mellitus, immune-mediated kidney disease (glomerulonephritis, tubulointerstitial nephritis); central and peripheral nervous system Demyelinating diseases such as multiple sclerosis, idiopathic demyelinating polyneuropathy or Guillain-Barre syndrome, and chronic inflammatory demyelinating polyneuropathy; hepatobiliary diseases such as infectious hepatitis (type A B, C, D, hepatitis E and other non-hepatotropic viruses), autoimmune chronic active hepatitis, primary biliary cirrhosis, granulomatous hepatitis, and sclerosing cholangitis; inflammatory bowel Diseases (ulcerative colitis: Crohn's disease); gluten-sensitive enteropathy and Whipple disease; bullous skin disease, erythema multiforme and contact dermatitis, autoimmune or immune-mediated skin diseases including psoriasis; allergic Diseases such as asthma, allergic rhinitis, atopic dermatitis, food hypersensitivity and urticaria; lung immune diseases such as eosinophilic pneumonia, idiopathic pulmonary fibrosis and hypersensitivity pneumonia; or graft rejection and graft 122. The method of claim 121, wherein the method is a transplantation-related disease including host versus host disease.   122. The method of claim 121, wherein the bone metabolism disorder or disease is arthritis, osteoporosis or marble bone disease.   122. A therapeutic agent identified by the method of claim 121.   PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 140. The therapeutic agent of claim 139, which is an agonist or antagonist of a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide.   Agonist is anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 The therapeutic agent according to claim 140, which is an antibody.   The antagonists are anti-PRO196, anti-PRO217, anti-PRO231, anti-PRO236, anti-PRO245, anti-PRO246, anti-PRO258, anti-PRO287, anti-PRO328, anti-PRO344, anti-PRO357, anti-PRO526, anti-PRO724, anti-PRO731, anti-PRO732, anti-PRO732, anti-PRO1003 Anti-PRO1104, anti-PRO1151, anti-PRO1244, anti-PRO1298, anti-PRO1313, anti-PRO1570, anti-PRO1886, anti-PRO1891, anti-PRO4409, anti-PRO5725, anti-PRO5994, anti-PRO6097, anti-PRO7425, anti-PRO10102, anti-PRO10279, anti-PRO6779 The therapeutic agent according to claim 140, which is an antibody.   122. A therapeutic agent identified by the method of claim 121.   PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 A method of modulating a phenotype associated with disruption of a gene encoding a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, wherein the phenotype already exists or has a phenotype To patients who are prone to phenotype or whose phenotype is prevented Administered drug, or an agonist or antagonist of claim 46 in an effective amount, a method comprising adjusting the phenotypic effectively thereby.   PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 A method of modulating a physiological property associated with the disruption of a gene encoding a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, which already has or is physiological Tend to have properties or physiology To a patient nature is prevented, the method comprising administering the agent according, or the agonist or antagonist to claim 52 in an effective amount, to adjust thereby the physiological properties effectively.   PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213 A method of modulating a behavior associated with disruption of a gene encoding a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, which already has or has a behavior Effective doses for patients who are prone or whose behavior is prevented An agent according to claim 63, or a method of administering the agonist or antagonist comprises adjusting thereby the action effectively.   PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 A method of modulating the expression of a polypeptide of PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779, comprising the above-mentioned PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO 28, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, PRO1151, PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO59725, PRO9725, PRO9725, PRO9725 94. A method comprising administering to a host expressing a peptide an effective amount of the agent of claim 92, or an agonist or antagonist thereof, thereby effectively modulating expression of said polypeptide.   PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 A method of modulating symptoms associated with disruption of a gene encoding a PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide, having or having a symptom Therapeutically effective in patients who have or are symptomatic The therapeutic agent of claim 98, or administering the agonist or antagonist, the method thereby comprising modulating the symptoms effectively.   PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1104, RO11513, PRO1213, PRO1213, PRO1213, PRO1213, PRO1213 Neuropathy associated with the disruption of the gene encoding PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, PRO61709 or PRO779 polypeptide; cardiovascular, endothelial or angiogenic disease; immune disease; oncological disorder; Treat or prevent or ameliorate disease or embryonic lethality Non-human transgenic animal cell cultures, ie PRO196, PRO217, PRO231, PRO236, PRO245, PRO246, PRO258, PRO287, PRO328, PRO344, PRO357, PRO526, PRO724, PRO731, PRO732, PRO1003, PRO1100, PRO1 , PRO1244, PRO1298, PRO1313, PRO1570, PRO1886, PRO1891, PRO4409, PRO5725, PRO5994, PRO6097, PRO7425, PRO10102, PRO10282, a disruption of a gene encoding a gene encoding the therapeutic, 95. An effective amount of the agent of claim 94, The method of an agonist or antagonist administered, thereby treating or preventing or ameliorating the disease effectively.

Images