JP2003529324A - Secreted and transmembrane polypeptides and nucleic acids encoding them - Google Patents

Abstract

The present invention is directed to novel polypeptides and to nucleic acid molecules encoding those polypeptides. Also provided herein are vectors and host cells comprising those nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides of the present invention fused to heterologous polypeptide sequences, antibodies which bind to the polypeptides of the present invention and to methods for producing the polypeptides of the present invention.

Description

Detailed Description of the Invention

FIELD OF THE INVENTION The present invention relates generally to the identification and isolation of novel DNA and recombinant production of novel polypeptides.

BACKGROUND OF THE INVENTION Extracellular proteins play a particularly important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, such as proliferation, migration, differentiation or interaction with other cells, is typically governed by information received from other cells and / or their immediate environment. This information is often transmitted by secreted polypeptides (e.g., mitogens, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones), which in turn are received by various cellular receptors or membrane-bound proteins. Be interpreted. These secreted polypeptides or signaling molecules normally pass through the cell secretory pathway and reach their site of action in the extracellular environment. Secreted proteins have a variety of industrial applications including pharmaceuticals, diagnostics, biosensors and bioreactors. Most protein drugs currently available, such as thrombolytic agents, interferons, interleukins, erythropoietin, colony stimulating factors, and various other cytokines, are secreted proteins. Its receptor, a membrane protein, also has potential as a therapeutic or diagnostic agent. Efforts are being made by both industry and academia to identify novel native secreted proteins. Much effort has been devoted to screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Examples of screening methods and techniques are described in the literature [eg Klein et al.
, Proc. Natl. Acad. Sci. 93; 7108-7113 (1996); US Pat. No. 5,536,637].

Membrane-bound proteins and receptors play important roles, among other things, in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, such as proliferation, migration, differentiation or interaction with other cells, is typically governed by information received from other cells and / or their immediate environment. This information is often transmitted by secreted polypeptides (eg, mitogens, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones), which in turn are received by various cellular receptors or membrane-bound proteins. Be interpreted. Such membrane-bound proteins and cellular receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatases, receptors involved in cell-cell interactions, and cell adhesion such as selectins and integrins. Contains molecules. For example, the transduction of signals that regulate cell growth and differentiation are regulated in part by phosphorylation of various cellular proteins. Protein tyrosine kinase, the enzyme that catalyzes that process, can also act as a growth factor receptor. Specific examples include fibroblast growth factor and nerve growth factor receptor. Membrane-bound proteins and receptor molecules have various industrial applications, including pharmaceuticals and diagnostics. For example, receptor immunoadhesins can be used as therapeutic agents to block receptor-ligand interactions. Membrane-bound proteins can also be used to screen peptides or small molecule inhibitors for potential related receptor / ligand interactions. Efforts have been made by both industry and academia to identify novel native receptors or membrane-bound proteins. Much effort has been devoted to screening mammalian recombinant DNA libraries to identify coding sequences for novel receptors or membrane-bound proteins.

1. PRO196 The abbreviations "TIE" or "tie" are acronyms, meaning "tyrosine kinase-containing Ig and EGF homology domains", which are almost exclusively expressed in vascular endothelial cells and early hematopoietic cells, and EGF-like domains, and It has been engineered to represent a novel family of receptor tyrosine kinases characterized by the presence of extracellular folding units stabilized by intrachain disulfide bonds, commonly referred to as "immunoglobulin (IG) -like" folds. Tyrosine kinase homologue cDNA fragments from human leukemia cells (tie) are described in Partanen et al., Proc. Natl. Acad. Sci. USA 87, 8913-8917 (1990). This human "tie" receptor mRNA was detected in all human fetal and mouse embryonic tissues and reported to be localized to cardiac and vascular endothelial cells. Korhonen et al., Blood 80, 2548-2555 (1992); PCT application publication WO 93/14124 (19).
(Published July 22, 1993). The rat homologue of human tie is called "tie-1" and is known as Maiso
npierre et al., Oncogene 8, 1631-1637 (1993). "Tie-2"
Another tie receptor, referred to as, was first identified in the rat (Dumont et al., Oncog.
ene 8, 1293-1301 (1993)), a human homologue of tie-2 called "ork" is described in US Pat. No. 5,447,860 (Ziegler). The mouse homologue of tie-2 was initially named "tek". Mouse ti from a brain capillary cDNA library
Cloning of the e-2 receptor is described in PCT application publication WO 95/13387 (published May 18, 1995). The TIE receptor is actively involved in angiogenesis and is thought to play a role in hematopoiesis. Expression cloning of human TIE-2 ligand is described in PCT application publication WO 96/11269 (199
(Published April 18, 2006) and US Pat. No. 5,521,073 (issued May 28, 1996). The vector designated λgt10, which encodes the TIE-2 ligand referred to as "htie-2 ligand 1" or "hTL1", is ATCC Accession No. 7592.
Deposited at 8. Another TIE named "htie-22" or "hTL2"
A plasmid encoding the -2 ligand is available under ATCC Accession No. 75928. This second ligand has been described as an antagonist of the TAI-2 receptor. Identification of secreted human and mouse ligands for the TIE-2 receptor has been reported in Davis et al., Cell 87, 1161-1169 (1996). Reflecting its role in angiogenesis and its potential effect on hematopoiesis, "Angiopoietin-1 (Angiopoietin-1
The human ligand named "-1)" is the same ligand as variously referred to as "htie-21" or "hTL-1" in WO 96/11269.
Angiopoietin-1 has been described to later play a role in angiogenesis and is distinct from VEGF (Suri et al., Cell 87, 1171-1180 (1996)). Since TIE-2 is clearly upregulated during pathological angiogenesis required for tumor growth (
Kaipainen et al., Cancer Res. 54, 6571-6577 (1994)), angiopoietin-1 was suggested to be more useful for specifically targeting tumor blood vessels (Davis et al., Supra).

2. PRO444 Efforts are being undertaken by both industry and academia to identify novel, native secreted proteins. Many efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins.
We describe here the identification and isolation of a cDNA molecule encoding a novel secreted polypeptide, herein designated PRO444 polypeptide.

3. PRO183 Efforts are being undertaken in both industry and academia to identify novel, native secreted proteins. Many efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins.
We describe here the identification and isolation of a cDNA molecule that encodes a novel secreted polypeptide, designated herein as PRO183 polypeptide.

[0007] 4. PRO185 Efforts are being undertaken by both industry and academia to identify novel, native secreted proteins. Many efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins.
We describe here the identification and isolation of a cDNA molecule that encodes a novel secreted polypeptide, herein designated PRO185 polypeptide.

5. PRO210 and PRO217 Epidermal Growth Factor (EGF) is a common mitogen that stimulates proliferation of various cell types including epithelial cells and fibroblasts. EGF is an EGF receptor (EG
FR) and activates it, which initiates intracellular signaling and subsequent effects. EGFR is expressed in neurons of the cerebral cortex, cerebellum, and hippocampus, in addition to other areas of the central nervous system (CNS). EGF is also expressed in various regions of the CNS. Therefore, EGF acts not only on mitotic cells but also on postmitotic neurons. In fact, in many studies E
It has been shown that GF has neurotrophic and neuromodulatory effects on various types of neurons in the CNS. For example, EGF acts directly on cultured cerebral cortex and cerebellar neurons to enhance neurite outgrowth and survival. On the other hand, EGF also acts indirectly through glial cells on other cell types including septal cholinergic and midbrain dopaminergic neurons. Evidence for the effects of EGF on neurons in the CNS is accumulating, but the mechanism of action remains essentially unknown. EGF-induced signaling in mitotic cells is better understood than in postmitotic neurons. Cloned pheochromocytoma P
Studies of cerebral cortical neurons cultured with C12 cells have shown that EGF-induced neurotrophic effects are EGFR and mitogen-activated protein kinases in response to EGF.
It has been suggested to be mediated by sustained activation of (MAPK). Sustained intracellular signaling correlates with a reduced rate of EGFR down-regulation, which may determine the response of neuronal cells to EGF. EGF is likely a pluripotent growth factor that acts on various types of cells, including mitotic cells and postmitotic neurons. EGF is made by the salivary glands and the Brunnard glands of the kidney, pancreas, thyroid gland, pituitary gland, nervous system and gastrointestinal system, and includes body fluids such as saliva, blood, cerebrospinal fluid (CSF), urine,
It is found in amniotic fluid, prostatic fluid, pancreatic juice, and breast milk. Plata-Salaman, Peptides 12
: 653-663 (1991). EGF is mediated by its membrane-specific receptors, which include the endogenous tyrosine kinase. Stoscheck CM et al., J. Cell Biochem. 31: 135-152 (1986). EGF is believed to function by binding to the extracellular portion of its receptor, which triggers a transmembrane signal that activates an endogenous tyrosine kinase. Purification and sequence analysis of the EGF-like domain revealed the presence of 6 conserved cysteine residues that cross-link to create 3 peptide loops. Savage CR
Et al., J. Biol. Chem. 248: 7669-7672 (1979). It is now common that some other peptides may react with EGF receptors sharing the same generalized motif XnCX7CX4 / 5CX10CXCX5GX2CXn, where X represents any non-cysteine amino acid and n is a variable repeat number. Known to be. Non-isolated peptides with this motif include TGF-α, amphiregulin, schwannoma-derived growth factor (SDGF), heparin-binding EGF-like growth factor and certain viral encoded peptides (eg vaccinia virus, Reisner, AH, Nature 313: 801-803 (1
985), Shope fibroma virus, Chang W. et al., Mol Cell Biol. 7: 535-540 (198).
7), Molluscum contagiosum, Porter CD and Archard, LC, J. Gen. Virol. 68: 673-682 (
1987), and myxoma virus, Upton C et al., J. Virol. 61: 1271-1275 (1987), Pr.
Including igent SA and Lemoine, NR, Prog. Growth Factor Res .. 4: 1-24 (1992). The EGF-like domain is not restricted to growth factors and has been observed on various cell surface and extracellular proteins with interesting properties in cell adhesion, protein-protein interactions and development. Laurence DJR and Gusterson BA, Tumor Bi
ol. 11: 229-261 (1990). These proteins are blood coagulation factors (factor VI, IX
, X, XII, protein C, protein S, protein Z, tissue plasminogen activator, urokinase), extracellular matrix components (laminin, cytotactin, entactin), cell surface receptors (LDL receptor, thrombomodulin receptor) and immune related proteins (Complement C1r, uromodulin). Even more interesting, the general structural pattern of EGF-like precursors is conserved throughout lower organisms as well as mammalian cells. Many genes with developmental advantages have been identified in invertebrates with EGF-like repeats. For example, the Drosophila notch gene has 36 tandemly arranged 4 homologies to EGF.
It encodes 0 amino acid repeats. Wharton W et al., Cell 43: 557-581 (1985).
The hydropathy plot shows a putative transmembrane spanning domain, the EDF-related sequences of which are located extracellularly of the membrane. Other homeotic genes with EGF-like repeats were identified using Notch-based probes, delta, 95F and 5ZD.
, And the nematode gene Lin-12, which encodes a putative receptor for developmental signals transmitted between two identified cells. In particular, EGF preserves and maintains gastrointestinal mucosa and repairs acute and chronic mucosal pathologies, Kont
urek, PC et al., Eur. J. Gastroenterol Hepatol. 7 (10), 933-37 (1995). Sullivan, Eur. J. Gastroenterol Hepatol, 7 (10), 94
It has been shown to have potential in the treatment of 5-50 (1995). Also, EGF
Is hair follicle differentiation; CL du Cros, J. Invest. Dermatol. 101 (1 Suppl.), 106S-11
3S (1993), SG Hillier, Clin. Endocrinol. 33 (4), 427-28 (1990); Renal function, L
.L. Hamm et al., Semin. Nephrol. 13 (1): 109-15 (1993), RC Harris, Am. J. Kidn
ey Dis. 17 (6): 627-30 (1991); Tear fluid, GB van Settent et al., Int. Ophthalmol 1
5 (6); 359-62 (1991); Vitamin K-mediated blood coagulation, J. Stenflo et al., Blood 78 (7): 1
Was involved in 637-51 (1991). EGF has also been implicated in various skin diseases characterized by aberrant keratinocyte differentiation such as psoriasis, epithelial cancers such as lung squamous cell carcinoma, vulvar epidermal cancer and glioma. King, LE, etc., Am. J. Med.
Sci. 296: 154-158 (1998). Of great interest is evidence that genetic alterations in growth factor signaling pathways are closely associated with developmental disorders and chronic diseases including cancer. Aaronson SA,
Science 254: 1146-1153 (1991). For example, the protooncogene c-erb-2 (also known as HER-2), which has close structural similarity to the EGF receptor protein, is overexpressed in human breast cancer. King et al., Science 229: 97.
4-976 (1985); Gullick, WJ, Hormones and their actions, Cooke BA et al., Eds,
Amsterdam, Elsevier, pp349-360 (1986).

[0009] 6. PRO215 protein-protein interactions involve receptor and antigen complexes and signaling mechanisms. As is well known for the structural and functional mechanisms underlying protein-protein interactions, protein-protein interactions are more easily engineered to regulate specific outcomes of protein-protein interactions. be able to. Therefore, the underlying mechanisms of protein-protein interactions are of interest to the scientific and medical community. All proteins, including leucine-rich repeats, are believed to be involved in protein-protein interactions. Leucine-rich repeats are short sequence motifs present in many proteins with diverse functions and cellular locations. The crystal structure of the ribonuclease inhibitor protein revealed that leucine-rich repeats correspond to β-α structural units. These units are arranged to form parallel β-sheets with one surface exposed to the solvent, and the protein has acquired an unusual non-spherical shape. These two features have been shown to be due to the protein binding function of proteins containing leucine rich repeats. Kobe and Deisenhofer, Tre
See nds Biochem. Sci., 19 (10): 415-421 (Oct. 1994). Studies have been reported on leucine-rich proteoglycans that act as tissue organizers that orient and direct collagen fibrils during ontogeny and are involved in pathological processes such as wound healing, tissue repair, and tumor stroma formation. Iozzo,
RV, Crit. Rev. Biochem. Mol. Biol., 32 (2): 141-174 (1997). Other studies showing the involvement of leucine-rich proteins in wound healing and tissue repair have been reported by De La Salle,
C. et al., Vouv. Rev. Fr. Hematol. (Germany), 37 (4): 215-222 (1995), who reported a mutation in the leucine-rich motif in the complex associated with the bleeding disorder Bernard-Soulier syndrome. Chlemetson, KJ, Thromb. Haemost. (Germany), 74 (1)
: 111-116 (July 1995) report that platelets have leucine rich repeats. Other proteins reported to have leucine-rich repeats have been reported to be useful in the treatment of neurodegenerative diseases such as Alzheimer's disease, nerve damage such as Parkinson's disease, and for the diagnosis of cancer. SLI
T protein, Artavanistsakonas, S. from Yale University and W from Rothberg, JM
See O9210518-A1. Other studies reporting the biological function of proteins with leucine-rich repeats include: Tayar, N. et al., Mol. Cell Endocrinol., (Ire
land), 125 (1-2): 65-70 (Dec. 1996) (Gonadotropin receptor related); Miura, Y.
Et al, Nippon Rinsho (Japan), 54 (7): 1784-1789 (July 1996) (apoptosis related)
; Harris, PC et al., J. Am. Soc. Nephrol., 6 (4): 1125-1133 (Oct. 1995) (related to renal diseases)
); And WO 9110727 of Ruoslahti, EI et al. Of La Jolla Cancer Research Foundation.
-A (decorin bound to transforming growth factor β is involved in cancer treatment, wound healing and scarring).

7. PRO242, PRO1318 and PRO1600 Leukocytes, including monocytes, macrophages, basophils and eosinophils, play important roles in the immune response. These cells are important in the mechanism initiated by T and / or B lymphocytes and secrete a range of cytokines that recruit and activate other inflammatory cells and contribute to tissue destruction. Therefore, it is important to study the regulatory processes by which leukocytes migrate to their appropriate destinations and interact with other cells. It is currently believed that white blood cells migrate to damaged or inflamed tissue by rolling along the endothelial cells of the blood vessel wall. This transfer is mediated by a transient interaction between selectin and its ligand. The white blood cells must then migrate along the vessel wall and into the tissue.
This blood leakage and extravasation process also involves cell activation that promotes more stable leukocyte-endothelial cell interactions mediated by integrins and their ligands. Chemokines are a large family of structurally related polypeptide cytokines. These molecules stimulate leukocyte movement and explain leukocyte information exchange in different inflammatory situations. Chemokines mediate the expression of specific adhesion molecules on endothelial cells, which create chemoattractants that activate specific cell types. Chemokines also stimulate proliferation and regulate activation of specific cell types. In both of these activities, chemokines show a high degree of target cell specificity. The chemokine family is divided into two subfamilies based on whether the two amino terminal cysteine residues are immediately adjacent (C-C) or separated by one amino acid (C-X-C). The C—X—C family of chemokines generally activates neutrophils and fibroblasts, while the C—C chemokines are a broader group including monocytes / macrophages, basophils, eosinophils and T lymphocytes. Acts on target cells. Known chemokines of both subfamilies are Thomson A. (1994) The
Synthesized by many diverse cell types, as outlined in the Cytokine Handbook, 2nd Ed. Academic Press, NY. Known chemokines include macrophage inflammatory proteins alpha and beta (
MIP-1 alpha and beta), I-309, RANTES, and monocyte chemoattractant protein (MCP-1). MIP-1 alpha and MIP-1 beta were initially purified from a stimulated mouse macrophage cell line and elicited an inflammatory response when injected into normal tissue. M
IP-1 alpha and MIP-1 beta consist of 68-69 amino acids and share about 70% identity in their mature secreted form. Both are mitogens, anti
-Expressed on CD3 and endotoxin stimulated monocytes and T cells, B cells, both polypeptides bind heparin to stimulate monocytes. MIP-1 alpha acts as a chemoattractant for the CD-8 subset of T lymphocytes and eosinophils, while MIP-1 beta chemoattracts the CD-4 subset of T lymphocytes. Also, these proteins are known to stimulate myelopoiesis in mice. RANTES is regulated by interleukin-1 and -4, transforming nerve factors and interferon-gamma, and is expressed on T cells, platelets, stimulated rheumatoid synovial fibroblasts, and some tumor cell lines. RANTES affects lymphocytes, monocytes, basophils and eosinophils. Expression of RANTES is significantly reduced upon stimulation of T cells. Monocyte chemoattractant protein (MCP-1) is a 76 amino acid protein that appears to be expressed in almost all cells and tissues upon stimulation with various agents. However, the target of MCP-1 is restricted to monocytes and basophils. In these cells, MCP-1 triggers the MCP-1 receptor. Two related proteins, MCP-2 and MCP-3, are 62% and 73% respectively MCP-1 and
, Which share their chemoattractant specificity and monocytes. Current techniques for diagnosing abnormalities in inflamed or diseased tissues rely primarily on observation of clinical signs or serological examination of body tissues or fluids for hormones, polypeptides or various metabolites. is doing. The problem lies in these diagnostics.
First, patients will show no clinical signs in the early stages of the disease. Second, serological tests do not always distinguish between invasive disease and genetic syndrome. Therefore, identification of expressed chemokines is important as an aid to new diagnostics, development of effective therapeutics, and understanding of molecular pathogenicity. Chemokine molecule is Schall TJ (1994) Chemotactic Cytokines: Targets for Ther
apeutic Development. International Business Communications, Southborough
Mass. Pp180-270; and Paul WE (1993) Fundamental Immunology, 3rd Ed. Raven.
Outlined in Press, NY pp822-826.

8. Control of cell number in PRO288 mammals is believed to be determined in part by the balance between cell proliferation and cell death. One form of cell death, often referred to as necrotic cell death, is typically characterized as the pathological form of cell death that results from some type of trauma or cell injury. In contrast, there are other "physiological" forms of cell death that usually proceed in a regular or controlled manner. This regular or controlled form of cell death is often referred to as "apoptosis" [eg Barr et al., Bio / Technology, 12: 487-493 (1994); Steller et al., Science, 267.
: 1445-1449 (1995)]. Apoptotic cell death occurs naturally in many physiological processes including clonal selection in the immune system and embryonic development [Itoh et al.,
Cell, 66: 233-243 (1991)]. Decreased levels of apoptotic cell death are associated with cancer,
Associated with various pathological conditions including lupus and herpes virus infection [Thompson
, Science, 267: 1456-1462 (1995)]. Increased levels of apoptotic cell death are associated with AIDS, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, multiple sclerosis, retinitis pigmentosa, cerebellar degeneration, aplastic anemia, myocardial infarction, stroke, and relapse. It is associated with perfusion injury and various other pathological conditions, including toxin-induced liver disease [Thom, supra.
See pson]. Typically, apoptotic cell death includes one or more characteristic morphological and biochemical changes within the cell, such as cytoplasmic aggregation, loss of plasma membrane microvilli,
It is accompanied by nuclear segmentation, degradation of chromosomal DNA or loss of mitochondrial function. Various extrinsic and endogenous signals are believed to cause or induce such morphological and biochemical cellular changes [Raff, Nature, 356: 397-400 (1992); Stelle.
r, supra; Sachs et al., Blood, 82:15 (1993)]. For example, it can be caused by hormone stimulation, such as withdrawal of glucocorticoid hormones on immature thymocytes, as well as certain growth factors [Watanabe-Fukunaga et al., Nature, 356: 314-317 (1992).
]. Also, some identified oncogenes, such as myc, rel, and E1.
It has also been reported that A and tumor suppressors, such as p53, have a role in inducing apoptosis. It has also been found that certain chemotherapeutic agents and certain radiations also have apoptosis-inducing activity [Thompson
, Above].

[0012] Various molecules such as tumor necrosis factor-α (“TNF-α”), tumor necrosis factor-β (“T
NF-β "or" lymphotoxin "), CD30 ligand, CD27 ligand, C
D40 ligand, OX-40 ligand, 4-1BB ligand, Apo-1 ligand (
Fas ligand or CD95 ligand) and Apo-2 ligand (
(Also referred to as TRAIL) has been identified as a member of the tumor necrosis factor (“TNF”) family of cytokines [eg, Gruss and Dower, Blood, 8
5: 3378-3404 (1995); Wiley et al., Immunity, 3: 673-682 (1995); Pitti et al., J. Bio.
Chem., 271: 12687-12690 (1996)]. Among these molecules, TNF-α, TNF-β, CD30 ligand, 4-1BB ligand, Apo-1 ligand, and Apo-2 ligand (TRAIL) have been reported to be involved in apoptotic cell death. ing. Both TNF-α and TNF-β have been reported to induce apoptotic death in susceptible tumor cells [Schmid et al., Proc. Na.
tl. Acad. Sci., 83: 1881 (1986); Dealtry et al., Eur. J. Immunol., 17: 689 (198).
7)]. Zheng et al. Reported that TNF-α is involved in post-stimulation apoptosis of CD8 + T cells [Zheng et al., Nature, 377: 348-351 (1995)]. Other investigators have reported that CD30 ligand is involved in the loss of autoreactive T cells in the thymus [Amakawa et al., Cold Spring Harbor Institute Symposium on Programmed Cell Death, Proceedings, Vol. Volume 10, (1995)]. Mutations in the mouse Fas / Apo-1 receptor or ligand genes (referred to as lpr and gld, respectively) have been associated with several autoimmune diseases, with Apo-1 ligand clonal deletion of peripheral autoreactive lymphocytes. Have been shown to play a role in controlling loss [Krammer et al., Curr. Op. Immunol., 6: 279-28.
9 (1994); Nagata et al., Science, 267: 1449-1456 (1995)]. Apo-1 ligand has also been reported to induce post-stimulation apoptosis in CD4-positive T lymphocytes and B lymphocytes and is involved in the removal of activated lymphocytes when their function is no longer required. [Krammer et al., Supra; Nagata et al., Supra]. Ap
An agonist mouse monoclonal antibody that specifically binds to the o-1 receptor is
It has been reported to show cell-killing activity comparable to or similar to TNF-α [Yon
Ehara et al., J. Exp. Med., 169: 1747-1756 (1989)].

It is believed that such induction of various cellular responses mediated by TNF family cytokines is initiated by binding to specific cell receptors.
Two different TNF receptors have been identified, approximately 55-kDa (TNFR1) and 75-kDa (TNFR2) [Hohman et al., J. Biol. Chem., 264: 14927-14934 (198).
9); Brockhaus et al., Proc. Natl. Acad. Sci., 87: 3127-3131 (1990); March 1991 2
EP417,563 published on 0th day, human and mouse c corresponding to both receptor types c
DNA has been isolated and characterized [Loetscher et al., Cell, 61: 351 (1990);
Schall et al., Cell, 61: 361 (1990); Smith et al., Science, 248: 1019-1023 (1990); L.
Ewis et al., Proc. Natl. Acad. Sci., 88: 2830-2834 (1991); Goodwin et al., Mol. Cel.
l. Biol., 11: 3020-3026 (1991)]. A wide range of polymorphisms are associated with both TNF receptor genes [eg Takao et al., Immunogenetics, 37: 199-203 (1993).
.]. Both TNFRs share the typical structure of cell surface receptors, including extracellular, transmembrane and intracellular regions. The extracellular portions of both receptors are also naturally found as soluble TNF binding proteins [Nophar, Y et al., EMBO J., 9: 3.
269 (1990); and Kohno, T. et al., Proc. Natl. Acad. Sci. USA, 87: 8331 (1990).
]. More recently, cloning of recombinant soluble TNF receptors has been reported by Hale.
[J. Cell. Biochem. Supplement 15F, 1991, p.113 (P424)]. The extracellular part of type 1 or type 2 TNFRs (TNFR1 and TNFR2) consists of four cysteine-rich domains (CRD), which are numbered 1 to 4, starting from the NH ₂ terminus.
Containing a repeating amino acid sequence pattern of. Each CRD is about 40 amino acids long and contains 4-6 cysteine residues in well conserved positions [Schall et al.
Listed above: Loetscher et al., Listed above: Smith, etc. listed above; Nophar etc. listed above; Kohno et al. Listed above]
. In TNFR1, the approximate boundaries of the four CRDs are: CR
D1-14 to about 53 amino acids; CRD2-about 54 to about 97 amino acids; CRD3-about 98 to about 138 amino acids; CRD4-about 139 to about 1
Up to 67 amino acids. In TNFR2, CRD1 has amino acids 17 to about 54, CRD2 has amino acids 55 to 97, CRD3 has amino acids 98 to 140, and CRD4 has amino acids 141 to 179. Include [Banner et al., Cell, 73: 431-435 (1993)]. Also, the possible role of CRD in ligand binding has been described by Banner et al., Supra.

A similar repetitive pattern for CRD is the p75 nerve growth factor receptor (NGFR) [
Johnson et al., Cell, 47: 545 (1986); Radeke et al., Nature, 325: 593 (1987)], B cell antigen CD40 [Stamenkovic et al., EMBO J., 8: 1403 (1989)], T cell antigen OX.
40 [Mallet et al., EMBO J., 9: 1063 (1990)] and Fas antigen [Yonehara et al., Supra, and Itoh et al., Cell, 66: 233-243 (1991)], including several other cell surfaces. Present in protein. In addition, CRD has been found in soluble TNFR (sTNFR) -like T2 proteins of Shope and myxoma poxvirus [Up.
ton et al., Virology, 160: 20-29 (1987); Smith et al., Biochem. Biophys. Res. Commu.
n., 176: 335 (1991); Upton et al., Virology, 184: 370 (1991)]. Optimal alignment of these sequences indicates that the position of cysteine residues is well conserved. These receptors are often collectively referred to as members of the TNF / NGF receptor superfamily. Recent studies on p75NGFR have demonstrated a deletion of CRD1 in this domain [Welcher, AA et al., Proc. Natl.
Acad. Sci. USA, 88: 159-163 (1991)] or insertion of a 5-amino acid [Yan. H and Chao.
, MV, J. Biol. Chem., 266: 12099-12104 (1991)] have been shown to have little or no effect on NGF binding [Yan. H and Chao, MV, supra]. . p
75NGFR is not involved in NGF binding, with about 60 between its CRD4 and transmembrane region.
Containing proline-rich extensions of the amino acids of [Peetre, C et al., Eur. J. Hematol., 4
1: 414-419 (1988); Seckinger, P. et al., J. Biol. Chem., 264: 11966-11973 (1989).
Yan. H and Chao, MV, supra]. A similar proline-rich region was found in TNFR2 but not in TNFR1. Itoh et al. Disclose that the Apo-1 receptor can signal apoptotic cell death similar to that signaled by the 55-kDa TNFR1 [Itoh et al., Supra]. It has also been reported that Apo-1 antigen expression is down-regulated with that of TNFR1 when cells are treated with TNF-α or anti-Apo-1 mouse monoclonal antibodies [Krammer et al., Supra. ; N
agata et al., supra]. Therefore, some researchers have hypothesized that cell lines that co-express both Apo-1 and TNF-R1 receptors mediate cell death through a common signaling pathway [Id.]. The TNF family of ligands identified to date is lymphotoxin-
Except for α, it is a type II transmembrane protein whose C-terminus is extracellular. In contrast, the TNF receptor (TNFR) family of receptors identified to date are type I transmembrane proteins. However, in both the TNF ligand and receptor families, the identified homologies between family members are found primarily in the extracellular domain ("ECD"). TNF
Some of the TNF family cytokines, including -α, Apo-1 ligand and CD40 ligand, are proteolytically cleaved at the cell surface; Form a trimeric molecule. In addition, proteins of the TNF receptor family are usually proteolytically cleaved to release the soluble receptor ECD, which may function as an inhibitor of the cognate cytokine.

Recently, other members of the TNFR family have been identified. In Marsters et al., Curr. Biol., 6: 750 (1996), researchers showed similarity to the TNFR family in extracellular cysteine-rich repeats, and included TNFR1 and CD95 in that they contained cytoplasmic death domain sequences. And describes a full-length human polypeptide native sequence, referred to as Apo-3 [Marsters et al., Curr. Biol., 6
: 1669 (1996) also]. According to other researchers, Apo-3 is DR
3, also referred to as wsl-1 and TRAMP [Chinnaiyan et al., Science, 274.
: 990 (1996); Kitson et al., Nature, 384: 372 (1996); Bodmer et al., Immunity, 6:79.
(1997)]. Pan et al. Disclose another member of the TNF receptor family called "DR4" [Pan et al., Science, 276: 111-113 (1997)]. DR4 is reported to contain a cytoplasmic death domain that activates the cell suicide device. Pan et al. Disclose that DR4 is believed to be a receptor for the ligand known as Apo-2 ligand or TRAIL. Sheridan et al., Science, 277: 818-821 (1997) and Pan et al., Science, 277: 815-818 (
1997) described other molecules believed to be receptors for the Apo-2 ligand (TRAIL). The molecule is called DR5 (also called Apo-2). Similarly, DR4, DR5 contain cytoplasmic death domains and have been reported to be capable of signaling apoptosis. In Sheridan et al., Supra, a receptor called DcR1 (or Apo-2DcR) is a possible decoy receptor for Apo-2 ligand (TRAIL).
r) is disclosed. Sheridan et al. Report that DcR1 can inhibit the function of Apo-2 ligand in vitro. See also Pan et al., Supra, for disclosure of a decoy receptor termed TRID. As is now understood, the cell death program includes at least three key elements-activators, inhibitors and effectors; in C. elegans, these components each contain three genes, Ced-. 4, Ced-9 and Ced
-3 coded [Steller, Science, 267: 1445 (1995); Chinnaiya
n et al., Science, 275: 1122-1126 (1997); Wang et al., Cell, 90: 1-20 (1997)]. TNF
Two members of the R family, TNFR1 and Fas / Apol (CD95), can activate apoptotic cell death [Chinnaiyan and Dixit, Current Biology,
6: 555-562 (1996); Fraser and Evan, Cell, 85: 781-784 (1996)]. Also, TN
FR1 is also known to mediate the activation of the transcription factor NF-κB [Tarta
Glia et al., Cell, 74: 845-853 (1993); Hsu et al., Cell, 84: 299-308 (1996)]. In addition to some ECD homology, these two receptors share homology at the intracellular domain (ICD) of the oligomerization interface known as the death domain [Tartaglia, supra; Nagata, Cell, 88. : 355 (1997)]. The death domain also regulates apoptosis in several metazoan proteins: Drosophila protein, Reaper, and FADD / MORT1, TRADD and R.
It has also been found in a mammalian protein designated IP [Cleaveland and Ihle, Cell, 81: 479-482 (1995)]. Raven et al. Reported the identification of a protein, wsl-1, that binds to the TNFR1 death domain using a yeast-double hybrid system [Raven et al., Programmed Cell Death Meeting, September 20-24, 1995. , 12
7 page summary; Raven et al., European Cytokine Network, 7: 210 page summary 82 (1996 4-
June); Also, Kitson et al., Nature, 384: 372-375 (1996)]. The wsl-1 protein is homologous to TNFR1 (48% identity) and has been described as having a restricted tissue distribution. According to Raven et al., The tissue distribution of wsl-1 differs significantly from the TNFR1 binding protein, TRADD.

Upon ligand binding and receptor clustering, TNFR1 and CD95
Is believed to recruit FADD to the death-inducing signaling complex.
It is said that CD95 binds directly to FADD while TNFR1
Binds to FADD indirectly via TRADD [Chinnaiyan et al., Cell, 81:
505-512 (1995); Boldin et al., J. Biol. Chem., 270: 387-391 (1995); Hsu et al., Supra; Chinnaiyan et al., J. Biol. Chem., 271: 4961-4965 (1996). ]. FADD is Ce
It has been reported that the d-3-related protease, MACHα / FLICE (caspase 8), is supplied as an adapter protein that recruits to the death signaling complex [Boldin et al., Cell, 85: 803-815 (1996). Muzio et al., Cell, 85: 817-827 (
1996)]. MACHα / FLICE is an interleukin-1β converting enzyme (ICE) and CPP32 / Ya that may carry out some important aspects of the cell death program.
It is clear that it is a trigger that triggers a cascade of apoptotic proteases including ma [Fraser and Evan, supra]. Programmed cell death depends on nematode cell death gene, ced-3, and mammalian IL-
It has recently been disclosed that it is involved in the activity of the 1-converting enzyme, a member of the cysteine protease family related to ICE. ICE and CPP32 / Yama
The activity of proteases can be inhibited by the product of the cowpox virus gene, crmA [Ray et al., Cell, 69: 597-604 (1992); Tewari et al., Cell, 81: 801-809 (1995)].
. Recent studies have shown that CrmA can inhibit TNFR1- and CD95-induced cell death [Enari et al., Nature, 375: 78-81 (1995); Tewari et al., J. Bi.
ol. Chem., 270: 3255-3260 (1995)]. As recently reviewed by Tewari et al., TNFR1, TNFR2 and CD40 modulate the expression of pro- and co-stimulatory cytokines, cytokine receptors, and cell adhesion molecules by activation of transcription factors, NF-κB. [
Tewari et al., Curr. Op. Genet. Develop., 6: 39-44 (1996)]. NF-κB is the prototype of a family of dimeric transcription factors whose subunits contain a conserved Rel region [Verma et al., Genes Develop., 9: 2723-2735 (1996); Baldwin, Ann. Rev. Immuno.
l., 14: 649-681 (1996)]. In its latent form, NF-κB is complexed with members of the IκB-inhibitor family; upon inactivation of IκB in response to a given stimulus, the released NF-κB is associated with a specific DNA sequence. It translocates to the associated nucleus and activates gene transcription. See Gruss and Dower, supra for a review of the TNF family of cytokines and their receptors.

9. A polypeptide such as PRO365 human 2-19 protein functions as a cytokine. Cytokines are low molecular weight proteins that function to stimulate or inhibit the differentiation, proliferation or function of immune cells. Cytokines often act as intercellular messengers and have multiple physiological effects. Given the physiological importance of the immune system in vivo, efforts are currently underway to identify new, native proteins that affect the immune system. We describe here the identification of a novel polypeptide with homology to the human 2-19 protein.

10. PRO1361 Efforts are being undertaken in both industry and academia to identify novel, native transmembrane receptor proteins. Many efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel receptor proteins. We describe here the identification and characterization of a novel transmembrane polypeptide, designated herein as the PRO1361 polypeptide.

11. PRO1308 follistatin is a secreted protein that regulates the secretion of pituitary follicle stimulating hormone (FSH). It functions by binding to and thereby inhibiting proteins such as activin and other members of the transforming growth factor beta (TGFβ) family that stimulate the production and secretion of FSH from the anterior pituitary. Follistatin is also involved in mechanisms that control basal development, including induction of neural development. In addition, follistatin is especially basic fibroblast growth factor (
bFGF) and exhibits angiogenic properties. Thus, there is a strong interest in identifying novel members of the follistatin family of proteins. The identification and characterization of follistatin is the subject of the following references, which are incorporated herein by reference: Sugino et al., J. Med Invest (1997) 44: (1-2): 1-14; Math.
er et al., Proc. Soc. Exp. biol. Med. (1997) 215 (3): 209-222; Thomsen, GH, Tr.
ends Genet (1997) 13 (6): 209-211; DePaolo, LV, Proc. Soc. Exp. biol. Me
d. (1997) 214 (4): 328-339; Peng et al., Biol. Signals (1996) 5 (2): 81-89, and Hal.
Vorson et al., Fertil Steril (1996) 65 (3): 459-469.

12. PRO1183 protoporphyrinogen oxidase is the last to two in the heme biosynthetic pathway.
Catalyze the second step. The lack of activity of this enzyme results in the human genetic disease polymorphic porphyria. Thus, there is interest in protoporphyrinogen oxidases and molecules associated with or regulating these oxidases. Moreover, oxidases and related molecules are of general interest. In addition, oxidase is at least Birchfield et al., Biochemistry, 37 (19): 6905-6910 (1998);
r et al., Cancer Res., 57 (20): 4551-4556 (1997); Arnould et al., Biochemistry, 36 (3).
3): 10178-10184 (1997); and Dailey and Dailey, Cell Mol. Biol., 43 (1): 67-.
73 (1997).

13. The PRO1272 cement gland is an ectodermal organ in the head of the frog fetus and is located anterior to all neural tissue. Like neural tissue, cement glands have been found to be induced by dorsal mesoderm. XAG-1 is a cement gland-specific protein that is useful as a marker for the induction of cement glands during development. Sive et al., Cell, 58 (1): 171
-180 (1989); Itoh et al., Development, 121 (12): 3979-3988 (1995). Other proteins involved in XAG-2 and the XAG family are Aberger
Et al., Mech. Dev., 72 (1-2): 115-130 (1998) and Gammill and Sive, Development,
124 (2): 471-481 (1997). Therefore, there is interest in novel polypeptides having sequence identity with the XAG protein.

14. PRO1419 Efforts are being undertaken in both industry and academia to identify novel, native secreted proteins. Many efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins.
We describe here the identification and characterization of a novel secreted polypeptide, herein designated the PRO1419 polypeptide.

15. PRO4999 uromodulin is synthesized in the kidney and is the most abundant protein in normal human urine. The amino acid sequence encoded by one of the exons of the uromodulin gene shares homology with the low density lipoprotein receptor and epidermal growth factor precursor. Pennica et al., Science 236: 83-88 (1987). The function of uromodulin is not known; however, because it binds IL-1, IL-2 and TNF with high affinity, it is a unique kidney that specifically binds many potent cytokines and regulates their circulatory activity. It can function as a regulatory glycoprotein. Hession et al., Science 237: 1479-1484 (
1987). Su et al. Suggest that uromodulin plays an important role in the innate immunity of the urinary system and that the immunostimulatory activity of uromodulin is potentially useful for immunotherapy. Su et al., J. Immunology, 158: 3449-3456 (
1997). We describe the identification and characterization of a novel polypeptide with a sequence similar to uromodulin, designated herein as PRO4999 polypeptide.

16. PRO7170 Efforts are being undertaken by both industry and academia to identify novel, native secreted proteins. Many efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins.
We describe here the identification and characterization of a novel secreted polypeptide, herein designated the PRO7170 polypeptide.

17. The PRO248 cytokine is implicated in the pathogenesis of many brain disorders in which neurological dysfunction results from altered metabolism of amino acid neurotransmitters. In particular, members of transforming growth factor β (TGFβ) are involved. Transforming growth peptides are small polypeptides initially identified by their ability to induce growth and transformation of non-cancerous cells in culture. Initially defined as a growth factor, TGFβ also inhibits proliferation of epithelial, endothelial, lymphocyte and hematopoietic cells. This cytokine plays an important role in regulating the duration of the inflammatory response and can accelerate the healing process. It is also a potent immunomodulator and has many pleiotropic effects, including the regulation of many other cytokines. Basic myelin proteins (BMP-2, BMP-4,
BMP-5, BMP-6, BMP-7), activin A and B, decapentaplegic (dpp), 60A, OP-2, dorsalin, growth differentiation factors (GDFs) 1, 3 and 9, nodal, MIS, inhibin α, transforming growth factor beta (TGF-β1, TGF-β2, TGF-β3,
TGF-β5) and glial cell-derived neurotrophic factor (GDNF). Atrisano
Et al., J. Biochemica et Biophysica Acta. 1222: 71-80 (1994). Of particular interest are growth differentiation factors, as their name implies, because these factors are involved in cell differentiation. Thus, the identification of proteins with homology to members of the TGFβ family, particularly growth differentiation factor (GDF) 3, is important to the medical community and industry. In general, proteins that are homologous to each other have similar functions. It is also interesting to show that certain structural motifs identify non-functional information, such as locality of function, if the proteins with homology do not have similar functions.

18. The PRO353 complement protein comprises a large group of several serum proteins that act in an enzymatic cascade to produce effector molecules associated with inflammation. Complement proteins have particular importance in regulating the function and movement of cells involved in inflammation. Given the physiological importance of inflammation and related mechanisms in vivo, efforts are being made to identify novel native proteins involved in inflammation. We describe here the identification and characterization of a novel polypeptide with homology to complement proteins, herein designated as PRO353 polypeptide.

19. PRO533 growth factor is a molecular signal or mediator that enhances cell growth or proliferation alone or in cooperation by binding to a specific cell surface receptor, but when expressed by a growth factor, it is a cellular response other than only growth. There is. As a result, growth factors are better characterized as multifunctional and potent cellular regulators. Its biological effects include proliferation, chemotaxis and stimulation of extracellular matrix production. Growth factors can have both stimulatory and inhibitory effects. For example, transforming growth factor
(TGF-β) is highly pleiotropic, stimulating proliferation in some cells, especially connective tissue, while being a potent inhibitor of proliferation in others, such as lymphocytes and epithelial cells. The physiological effects of growth factor stimulation or inhibition by growth factors depend on the state of development and differentiation of the target tissue. Local cell regulation by classical endocrine molecules involves understanding the autocrine (same cell), juxtacrine (neighboring cells), and paracrine (adjacent cell) pathways. Peptide growth factors are elements of a complex biological language that provide the basis for cell-cell information exchange. They allow cells to carry information to each other, mediate interactions between cells, and alter gene expression. The effects of these multifunctional and pleiotropic factors depend on the presence or absence of other peptides. Fibroblast growth factors (FGFs) are a family of potent mitogens that are heparin-binding to both normal diploid fibroblasts and established cells. Godpodar
owicz, D et al., (1984), Proc. Natl. Acad. Sci. USA 81: 6963. The FGF family includes, inter alia, acidic FGF (FGF-1), basic FGF (FGF-2), INT-2 (F
GF-3), K-FGF / HST (FGF-4), FGF-5, FGF-6, KGF (F
GF-7) and AIGF (FGF-8) are included. All FGFs have two conserved cysteine residues and share 30-50% sequence homology at the amino acid level.
These factors include granulosa cells, adrenal cortex cells, chondrocytes, myoblasts, cornea and vascular endothelial cells (bovine or human), vascular smooth muscle cells, lens, retina and prostate epithelial cells, oligodendrocytes, astrocytes. , Mitogenic for a variety of normal diploid mesoderm and neural crest derived cells, including chrondocytes, myoblasts and osteoblasts. Fibroblast growth factor can also stimulate numerous cell types in a non-mitogenic manner. These activities are due to the fact that fibroblast growth factor also promotes cell migration to the wound area (chemotactic effect), initiates new blood vessel formation (angiogenesis), modulates nerve regeneration and survival (neurotrophism). , Modulation of endocrine function, and stimulation or inhibition of specific cellular protein expression, extracellular matrix production and cell survival. Bair
d, A. & Bohlen, P., Handbook of Exp. Pharmacol. 95 (1): 369-418, (1990).
These properties provide the basis for using fibroblast growth factor in therapeutic approaches to accelerate wound healing, nerve repair, collateral angiogenesis, etc. For example, it has been suggested that fibroblast growth factor minimizes myocardial damage in heart disease and surgery (USP 4,378,437). Here we describe the identification and characterization of a novel polypeptide with homology to FGF, designated PRO533 polypeptide.

20. The widespread occurrence of the PRO301 cancer prompted considerable resources and dedication to discovering new treatments. One particular method involves the creation of tumor- or cancer-specific monoclonal antibodies (mAbs) that are specific for tumor antigens. Such mAbs that are able to distinguish between normal and cancer cells are useful in the diagnosis, prevention and treatment of disease. Certain antigens are known to be associated with neoplastic diseases such as colorectal cancer. One particular antigen, the A33 antigen, is expressed in primary or metastatic colon cancer as well as in 90% or more of normal colon epithelia. Since colon cancer is a widespread disease,
Early diagnosis and treatment are important medical goals. Diagnosis and treatment of colorectal cancer can be performed using monoclonal antibodies (mAbs) specific for it with fluorescent, nuclear or radioactive tags. Radioactive gene, toxin and / or drug tag mAbs can be used for in situ treatment with minimal patient prescription. mAbs can also be used in the diagnosis and diagnosis of colorectal cancer. For example, if serum levels of the A33 antigen are elevated in some patients, a drop in post-operative levels indicates successful tumor resection. On the other hand, the subsequent elevation of serum A33 antigen level after surgery indicates that metastasis of the original tumor occurred or a new primary tumor appeared. Such monoclonal antibodies can be used instead of or concurrently with surgery and / or chemotherapy. For example USP4,579,827 and USSN4
24,991 (EP199,141) relates to therapeutic administration of monoclonal antibodies, the latter to the application of anti-A33 mAb. Many cancers of epithelial origin carry the adenovirus receptor. In fact, adenovirus-derived vectors have been proposed as a means of inserting antisense nucleic acids into tumors (USP 5,518,885). Therefore, binding of viral receptors to neoplastic tumors is not unexpected. We describe here the identification and characterization of a novel polypeptide with homology to certain cancer-associated antigens, herein termed PRO301 polypeptide.

21. PRO187 growth factor is a molecular signal or mediator that enhances cell growth or proliferation, either alone or in concert, by binding to specific cell surface receptors. However, there is a cellular response other than only growth when expressed on growth factors. As a result, growth factors are better characterized as multifunctional and potent cellular regulators. Its biological effects include proliferation, chemotaxis and stimulation of extracellular matrix production. Growth factors can have both stimulatory and inhibitory effects. For example, transforming growth factor (TGF-β) is highly pleiotropic and stimulates proliferation in some cells, especially connective tissue, while being a potent inhibitor of proliferation in others, such as lymphocytes and epithelial cells. . The physiological effects of growth factor stimulation or inhibition by growth factors depend on the state of development and differentiation of the target tissue. Mechanisms of local cell regulation by classical endocrine molecules include understanding of the autocrine (same cell), juxtacrine (neighboring cells), and paracrine (adjacent cell) pathways. Peptide growth factor is a component of a complex biological language,
It provides the basis for exchanging information between cells. They allow cells to carry information to each other, mediate interactions between cells, and alter gene expression. The effects of these multifunctional and pleiotropic factors depend on the presence or absence of other peptides. FGF-8 is a family of potent heparin-binding mitogens for both normal diploid fibroblasts and established cells, fibroblast growth factor (FGF).
s) is a member. Gospodarowicz et al., (1984), Proc. Natl. Acad. Sci. USA
81: 6963. The FGF family includes acidic FGF (FGF-1) and basic FGF (FGF).
-2), INT-2 (FGF-3), K-FGF / HST (FGF-4), FGF-5, F
It includes GF-6, KGF (FGF-7), and AIGF (FGF-8). All FGFs have two conserved cysteine residues and share 30-50% sequence homology at the amino acid level. These factors include granulosa cells, adrenal cortex cells, chondrocytes, myoblasts, cornea and vascular endothelial cells (bovine or human), vascular smooth muscle cells, lens, retina and prostate epithelial cells, oligodendrocytes, astrocytes. , Clonde Site
They are mitogenic for a wide range of normal diploid mesoderm- and neural crest-derived cells, including chrondocytes, myoblasts and osteoblasts. Fibroblast growth factor can also stimulate numerous cell types in a non-mitogenic manner. These activities promote cell migration to the wound area (chemotactic), initiate new blood vessel formation (angiogenesis), modulate nerve regeneration and survival (neurotrophism).
phism)), modulation of endocrine function, and specific cellular protein expression, extracellular matrix production and stimulation or inhibition of cell survival. Baird & Bohlen, Handbook of
Exp. Pharmacol. 95 (1): 369-418, Springer, (1990). These properties provide the basis for using fibroblast growth factor in therapeutic approaches to accelerate wound healing, nerve repair, collateral angiogenesis, etc. For example, it has been suggested that fibroblast growth factor minimizes myocardial damage in heart disease and surgery (USP
4,378,347). EGF-8, also known as androgen-induced growth factor (AIGF), is FG
It is a 215 amino acid protein that shares 30-40% sequence homology with other members of the F family. It has been proposed that FGF-8 is under androgen regulation and induction in mouse breast cancer cell line SC3. Tanaka et al., Proc. Natl
Acad. Sci. USA 89: 8928-8932 (1992); Sato et al., J. Steroid Biochem. Molec.
. Biol. 47: 91-98 (1993). As a result, FGF-8 may have a local role in the prostate, which is known to be an androgen responsive organ. FGF-8
Can also be carcinogenic as it exhibits transforming activity when transfected into NIH-3T3 fibroblasts. Kouhara et al., Oncogene 9 455-462 (1994). F
While GF-8 has been detected in heart, brain, lung, kidney, testis, prostate and ovary, expression was also detected in the absence of exogenous androgens. Schmitt
Et al., J. Steroid Biochem. Mol. Biol. 57 (3-4): 173-78 (1996). FGF-8 shares the property of being expressed at various stages of mouse embryogenesis with several other FGFs, which have different and possibly coordinated roles for various EGFs in differentiation and embryogenesis. Supports the theory. Furthermore, FGF-
8 has also been identified as a proto-oncogene that associates with Wnt-1 in the process of breast tumorigenesis (Shackleford et al., Proc. Natl. Acad. Sci. USA 90, 740-7.
44 (1993); Heikinheimo et al., Mech. Dev. 48: 129-138 (1994)). In contrast to other FGFs, FGF-8 exists as three Protein Isoforms as a result of alternative splicing of the primary transcript, Ta, supra.
naka etc. Although normal adult expression of FGF-8 is weakly confined to gonadal tissue, Northern blot analysis showed that FGF-8 mRNA showed 10 to 12 days of gestation in mice.
It is present for a day, suggesting that FGF-8 is important for normal development. Heikinheimo et al., Mech Dev. 48 (2): 129-38 (1994). Further in situ hybridization assays between 8 and 16 days of gestation showed early expression in the superficial ectoderm of the first bronchial arch, the frontal nasal process, the forebrain and the midbrain-hindbrain transition. At 10-12 days, FGF-8 was expressed in the surface ectoderm of forelimb and hindlimb buds, nasal and nasopharynx, funnel and telencephalon, diencephalon and hindbrain. Expression continues in the developing hind limb at day 13 of gestation but is undetectable thereafter. This result suggests that FGF-8 has a unique temporal and spatial pattern in embryogenesis,
The role of this growth factor in multiple regions of ectodermal differentiation in postcystic embryos is suggested. Here we describe the identification of novel polypeptides with homology to FGF-8 and have named these polypeptides herein PRO187 polypeptides.

22. The development of neurons in PRO337 higher vertebrates is characterized by a process that must successfully route a distinct cellular environment along the way to its synaptic target. The result is a functionally accurate formation of neural circuits. Accuracy is believed to derive from the mechanism that regulates growth cone pathway discovery and target recognition, followed by refinement of the latter and remodeling of such protrusions by a phenomenon requiring neuronal activity. Goodman and Shatz, Cell / Neuron [Suppl.] 72 (10): 77-98 (1993). In addition, different neurons extend biochemically distinct nerve fibers and rely on specific guidance cues provided by cell-cell, cell-matrix, and chemotactic interactions to determine their proper synapses. It is clear to reach the target. Goodman et al., Listed above. One particular way in which neuronal cell surface diversity is created is through the differential expression of cell surface proteins called cell adhesion molecules (CAMs).
Neuronically expressed CAMs are involved in a wide range of developmental processes, including migration of neurons along radial glial cells, provide an acceptable or repulsive substrate for neurite outgrowth, and in the protrusion pathway. It is involved in promoting selective bundling of axons. Jessel, Neuron 1: 3-13 (1998); Edelman and Crossin, An
nu. Rev. Biochem. 60: 155-190 (1991). Interactions between CAMs residing on the growth cone and opposing molecules on the cell membrane or in the extracellular matrix are thought to provide specific guidance cues that direct the growth of nerve fibers along appropriate protrusion pathways. Has been. Such interactions appear to result in activation of various second messenger systems within the growth cone that regulate neurite outgrowth. Doherty and W
alsh, Curr. Opin. Neurobiol. 2: 595-601 (1992). In higher vertebrates, most neural CAMs have been found to be members of three major structural families of proteins: integrins, cadherins, and immunoglobulin gene superfamily (IgSF). Jessel, supra; Tak
eichi, Annu. Rev. Biochem. 59: 237-252 (1990); Reichardt and Tomaselli, Annu.
Rev. Neurosci. 14: 531-570 (1991). The cell adhesion molecules of IgSF (or Ig-CAMs), in particular, constitute a large family of proteins often involved in neural cell interactions and nerve fiber growth during development. Salzer and Colman, Dev.Ne
urosci. 11: 377-390 (1989); Bruemmendorf and Rathjen, J. Neurochem. 61: 1207.
-1219 (1993). However, the vast majority of mammalian Ig-CAMs are so widely expressed that they seem unable to identify channel-determining or synaptic targets, and other CAMs that have not yet been identified are associated with these more selective interactions of neurons. Is suggested to play a role in.

Many of the known neural Ig-CAMs are glycosylphosphatidylinositol (G
It has been found to be bound to the plasma membrane via a (PI) anchor. Also,
Many studies have shown that GPI-anchored proteins are involved in providing specific guidance cues during the growth of neurons in specific pathways. In a study of the grasshopper nervous system, treatment of the fetus with phosphatidylinositol-specific phospholipase C (PIPLC), which selectively removes GPI-anchored proteins from the surface of cells, resulted in the development of a subset of growth cones. Misguided and false route decisions and inhibitory migration patterns of a subset of early neurons. Chang et al., Devel.
114: 507-519 (1992). Projection of retinal fibers into the tectum is partially due to 33 kDa GPI
Although it appears to depend on the anchor protein, the exact nature of this protein is unknown. Stahl et al., Neuron 5: 735-743 (1990). Expression of various GPI-anchored proteins has been characterized in different rat populations of dorsal root ganglion primary rat neurons, cervical ganglion sympathetic neurons, superior cervical ganglion sympathetic neurons, and cerebellar granule neurons. . Rosen et al., J. Cell Biol
. 117: 617-627 (1992). In contrast to the similar pattern of expression of total membrane proteins by these different types of neurons, significant differences were found in G between these neurons.
It was observed in the expression of PI anchor protein. Recently, neurotrimine (n
A 65 kDa protein band known as eurotrimin) was discovered and differentially expressed by primary neurons (Rosen et al., supra), restricted to the nervous system, and CN
It was found to be the most abundant and earliest expressed GPI anchor species in S. Struyk et al., J. Neuroscience 15 (3): 2141-2156 (1995). The discovery of neurotrimine further led to the identification of a family of IgSF members, now termed IgLON, each containing an Ig-like domain that shares significant amino acid identity. Struyk et al., Supra; Pimenta et al., Gene 170 (2): 189-95 (1996). Further members of the IgLON subfamily are opiate-binding cell adhesion molecules.
(OBCAM), Schofield et al., EMBO J. 8: 489-495 (1989); limbic associated membrane protein (LAMP), Pimenta et al., Supra; CEPU-1; GP55, Wilson et al., J. Cell S.
ci. 109: 3129-3138 (1996); Eur. J. Neurosci. 9 (2): 334-41 (1997); and AvG.
p50, Hancox et al., Brain Res. Mol. Brain Res. 44 (2): 273-85 (1997).

While neurotrimin expression appears to be widespread, it appears to correlate with the development of some neural circuits. For example, between E18 and P10, expression of neurothymine mRNA in the forebrain is less intense in developing thalamus, cortical subplates, and cortical neurons, especially lamina V and VI (II, II, and IV). (With no expression and minimal expression with Lamina I). Cortical subplate neurons provide an early, temporary scaffold for thalamic afferents that extend within the cortex on its way to its final synaptic target. Allendoerfer and Sh
atz, Annu. Rev. Neurosci. 17: 185-218 (1994). Conversely, subplate neurons are required for cortical neurons from layer V to select VI to grow into the thalamus and for neurons from layer V to select their targets in the colliculus, pons, and spinal cord. Have been suggested (McConnell et al., J. Neurosci. 14: 1892-1907 (1994)). High level expression of neurotrimin in many of these protrusions suggests that it is involved in its development. In the hindbrain, high levels of neurotrimin message expression were also observed in the pontine nucleus and by Purkinje cells and internal granule cells in the cerebellum. The pons nuclei receive afferent fiber inputs from various sources, including layer V cortical pons fibers, and are the major source of afferent fiber input to granule cells via mossy fibers. Is then the main source of afferent fiber input to Purkinje cells via parallel fibers. [Palay and Chan-Palay, The cerebellar cortex: cytol
ogy and organization. New York: Springer (1974)]. The high level expression of these neurotrimin neurons suggests a strong involvement in the probabilities of these circuits. Neurotrimin also shows a gradual expression pattern in the early postnatal striatum. Increased expression of neurotrimin is found lying on the dorsolateral striatum of the rat, while lower hybridization strength is found lying on the ventral midline striatum. Struyk et al., Supra. This region of higher neurotrimine hybridization strength does not correspond to a cytostructurally distinct region, but rather to the primary region of afferent input from the VI layer of the contralateral sensorimotor cortex (Gerfen, Natur
e 311: 461-464 (1984); Donoghue and Herkenham, Brain Res. 365: 397-403 (198).
6)). In contrast, the ventral midline striatum receives most of its afferent input from the perinasal and association areas. A complementary graded pattern of LAMP expression has been observed in the striatum with the highest expression in the ventral midline region and the lowest dorsolateral expression. Levitt, Science 223: 299-301 (1985); Chesselet et al., Neuroscience 40: 725-7.
33 (1991).

23. PRO1411 Efforts are being undertaken in both industry and academia to identify novel, native secreted proteins. Many efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins.
We describe here the identification and characterization of a novel secreted protein, herein designated PRO1411.

24. PRO4356 glycosylphosphatidylinositol (GPI) -anchored proteoglycans are generally known to localize on the cell surface and are thus involved in regulating the response of cells to many growth factors, cell adhesion molecules and extracellular matrix components. The metastasis-associated GPI-anchored protein (MAGPIAP) is one of these cell surface proteins and has been shown to be involved in metastasis. Metastasis is a form of cancer in which transformed or malignant cells migrate and spread the cancer from one site to another. Therefore, the identification of polypeptides associated with metastasis and MAGPIAP is of interest.

25. The PRO246 cell surface protein HCAR is a membrane-bound protein that acts as a receptor for adenovirus subgroup C and coxsackievirus sac group B. Thus, HCAR provides the means to mediate viral infection of cells, and the presence of the HCAR receptor on the cell surface provides a binding site for viral particles, thereby facilitating viral infection. In view of the physiological importance of membrane-bound proteins, particularly those that provide cell surface receptors for viruses, efforts are currently being undertaken by both industry and academia to identify new, native membrane-bound receptor proteins. There is. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel receptor proteins. We have now found various tumor antigens and cell surface proteins HCA, including A33 and carcinoembryonic antigen.
Novel membrane-bound polypeptide having homology to R (herein PR
(Designated O246), which polypeptide may be a novel cell surface viral receptor or tumor antigen.

26. PRO265 protein-protein interactions involve receptor and antigen complexes and signaling mechanisms. As is well known for the structural and functional mechanisms underlying protein-protein interactions, protein-protein interactions are more easily engineered to regulate specific outcomes of protein-protein interactions. be able to. Therefore, the underlying mechanisms of protein-protein interactions are of interest to the scientific and medical community. All proteins, including leucine-rich repeats, are believed to be involved in protein-protein interactions. Leucine-rich repeats are short sequence motifs that are present in many proteins and cell locations with diverse functions. The crystal structure of the ribonuclease inhibitor protein revealed that leucine-rich repeats correspond to β-α structural units. These units are arranged to form parallel β-sheets with one surface exposed to the solvent, and the protein acquires an unusual non-spherical shape. These two features have been shown to be responsible for the protein binding function of proteins containing leucine rich repeats. Kobe and Deisenhofer, Trends
See Biochem. Sci., 19 (10): 415-421 (Oct. 1994). Studies have been reported on leucine-rich proteoglycans, which become tissue organizers that orient and direct collagen fibrils during ontogeny and are involved in pathological processes such as wound healing, tissue repair, and tumor stroma formation. Iozzo, RV
., Crit. Rev. Biochem. Mol. Biol., 32 (2): 141-174 (1997). Other studies showing the involvement of leucine-rich proteins in wound healing and tissue repair have been reported by De La Salle,
C. et al., Vouv. Rev. Fr. Hematol. (Germany), 37 (4): 215-222 (1995) and reported a mutation in the leucine-rich motif in the complex associated with the bleeding disorder Bernard-Soulier syndrome. Chlemetson, KJ, Thromb. Haemost. (Germany),
74 (1): 111-116 (July 1995) report that platelets have leucine rich repeats. Other proteins of particular interest that have been reported to have leucine-rich repeats may be useful in the treatment of neurodegenerative diseases such as Alzheimer's disease, nerve damage such as Parkinson's disease, and for the diagnosis of cancer. It is a reported SLIT protein. See Artavanistsakonas, S. of Yale University and WO9210518-A1 of Rothberg, JM. Other studies reporting the biological function of proteins with leucine-rich repeats include: Tayar, N. et al., Mol. Cel.
l Endocrinol., (Ireland), 125 (1-2): 65-70 (Dec. 1996) (Gonadotropin receptor related); Miura, Y. et al., Nippon Rinsho (Japan), 54 (7): 1784-1789 ( July 1996
) (Related to apoptosis); Harris, PC et al., J. Am. Soc. Nephrol., 6 (4): 1125-113
3 (Oct. 1995) (related to renal disease); and Ruosl of La Jolla Cancer Research Foundation.
ahti, EI, et al. WO 9110727-A (decorin binding to transforming growth factor beta involved in cancer treatment, wound healing and scarring). Also of interest is fibromodulin and its use to prevent or reduce skin scarring.
A study of fibromodulin is found in US Pat. No. 5,654,270 to Rouslahti et al. Thus, efforts are being made by both industry and academia to identify novel proteins with leucine-rich repeats to better understand protein-protein interactions. Of particular interest are proteins with homology to known proteins with leucine rich repeats and leucine rich repeats such as fibromodulin, SLIT protein and platelet glycoprotein V. Many efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secretory and transmembrane proteins with leucine-rich repeats. Here we describe the identification and characterization of a novel polypeptide with homology to fibromodulin, designated herein as PRO265 polypeptide.

27. PRO941 cadherin is a large family of transmembrane proteins. In Cadherin,
Virtually all of the solid tissues of multicellular organisms include a family of calcium-dependent glycoproteins that function to mediate cell-cell adhesion. At least cadherins 1-13 and B, E, EP, M, N, P and R forms have been identified and characterized. With a few exceptions, among the functions of cadherin, cadherin is known to be involved in cell aggregation and associated with cell-cell adhesion sites. Recently, all cadherins share multiple repeats of cadherin-specific motifs that are thought to correspond to extracellular domain folding, but that members of the cadherin superfamily have diverse structures and possibly functions. Has been reported. In particular, members of the cadherin superfamily have been reported to be involved in signal transduction. Suzuki, J. Cell. Biochem., 61 (
4): 531-542 (1996). Cadherin is further described by Tanihara et al., J. Cell Sci., 107 (6): 1.
697-1704 (1994), Aberle et al., J. Cell. Biochem., 61 (4): 514-523 (1996) and Tani.
Hara et al., Cell Adhes. Commun., 2 (1): 15-26 (1994). We describe here the identification and characterization of another novel polypeptide with homology to the cadherin protein, designated herein as PRO941.

28. PRO10096 interleukin-10 (IL-10) is a pleiotropic immunosuppressive cytokine,
It is implicated as an important regulator of bone marrow and lymphoid cell function. IL-1
0 has been shown to function as a potent inhibitor of synthetic activation of various inflammatory cytokines including, for example, IL-1, IL-6, IFN-γ and TNF-α (Gesser et al., Proc. Natl. Acad. Sci. USA 94: 14620-14625 (1997)). Furthermore, IL-10 has been shown to strongly inhibit some of the accessory activities of macrophages, thereby functioning as a potent suppressor of effector function of macrophages, T cells and NK cells (Kuhn et al., Cell 75. : 263-274 (1993)). Furthermore, IL-10 is strongly associated with the regulation of B cell, mast cell and thymocyte differentiation. IL-10 was independently identified from two separate experimental systems. First, mouse IL-1
A cDNA clone encoding 0 was identified based on the expression of a cytokine synthesis inhibitory factor (Moore et al., Science 248: 1230-1234 (1990)), and human IL-10 corresponding c
DNA was subsequently identified by cross-hybridization with mouse IL-10 cDNA (Viera et al., Proc. Natl. Acad. Sci. USA 88: 1172-1176 (1991)). Furthermore, IL-10 was independently identified as a B cell-derived mediator that functions to co-stimulate the active thymus (Suda et al., Cell Immunol., 129: 228 (1990)). Here, we name the PRO10096 polypeptide, IL-10.
The identification and characterization of a novel polypeptide having sequence similarity to is described.

29. PRO6003 Efforts are being undertaken in both industry and academia to identify novel, native receptors or membrane-bound proteins. Much effort has gone into screening mammalian recombinant DNA libraries to identify coding sequences for novel receptors or membrane-bound proteins. We describe here the identification and characterization of a novel polypeptide, designated herein as the PRO6003 polypeptide.

SUMMARY OF THE INVENTION In one embodiment of the invention, the invention provides a vector comprising DNA encoding any of the polypeptides described herein. Host cells comprising such vectors are also provided. By way of example, the host cell can be a CHO cell, E. coli, or yeast. Further provided is a method for producing any of the polypeptides described herein, which comprises culturing a host cell under conditions suitable for expression of the desired polypeptide, the method comprising: Comprising recovering. In another embodiment, the invention provides a chimeric molecule comprising any of the polypeptides described herein fused to a heterologous polypeptide or amino acid sequence.
Examples of such chimeric molecules include any of the polypeptides described herein fused to an immunoglobulin Fc region or epitope tag sequence. In another embodiment, the invention provides an antibody that specifically binds to any of the above or below described polypeptides. In some cases, the antibody is a monoclonal antibody,
It is a humanized antibody, an antibody fragment or a single chain antibody. In yet another embodiment, the invention provides oligonucleotide probes useful as antisense probes or for isolating genomic and cDNA nucleotide sequences, wherein the probes are any of the above or below nucleotide sequences. Can be derived from. In another embodiment, the invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a PRO polypeptide. In one aspect, the isolated nucleic acid molecule comprises (a) a full length amino acid sequence disclosed herein, an amino acid sequence lacking a signal peptide disclosed herein, a transmembrane protein disclosed herein with or without a signal peptide. A DNA molecule encoding a PRO polypeptide having the extracellular domain of, or any other specifically defined fragment of the full-length amino acid sequence disclosed herein, or the complement of the DNA molecule of (b) (a). And at least about 80% nucleic acid sequence identity, or at least about 81% nucleic acid sequence identity, or at least about 82% nucleic acid sequence identity, or at least about 83% nucleic acid sequence identity, or at least about 84%. Nucleic acid sequence identity of, or at least about 8
5% nucleic acid sequence identity, or at least about 86% nucleic acid sequence identity, or at least about 87% nucleic acid sequence identity, or at least about 88% nucleic acid sequence identity, or at least about 89% nucleic acid sequence identity. Or at least about 90% nucleic acid sequence identity, or at least about 91% nucleic acid sequence identity, or at least about 92% nucleic acid sequence identity, or at least about 93% nucleic acid sequence identity, or at least about 9
4% nucleic acid sequence identity, or at least about 95% nucleic acid sequence identity, or at least about 96% nucleic acid sequence identity, or at least about 97% nucleic acid sequence identity, or at least about 98% nucleic acid sequence identity. And / or a nucleotide sequence having at least about 99% nucleic acid sequence identity.

In another aspect, the isolated nucleic acid molecule is (a) a PR lacking the coding sequence for the full-length PRO polypeptide cDNA disclosed herein, the signal peptide disclosed herein.
O polypeptide cDNA coding sequence, extracellular domain coding sequence of a transmembrane PRO polypeptide disclosed herein with or without a signal peptide, or any other specifically defined full length amino acid sequence disclosed herein. At least about 80 relative to the DNA molecule containing the coding sequence of the fragment, or (b) the complement of the DNA molecule of (a).
% Nucleic acid sequence identity, or at least about 81% nucleic acid sequence identity, or at least about 82% nucleic acid sequence identity, or at least about 83% nucleic acid sequence identity, or at least about 84% nucleic acid sequence identity. Or at least about 85% nucleic acid sequence identity, or at least about 86% nucleic acid sequence identity, or at least about 87% nucleic acid sequence identity, or at least about 88% nucleic acid sequence identity, or at least about 89.
% Nucleic acid sequence identity, or at least about 90% nucleic acid sequence identity, or at least about 91% nucleic acid sequence identity, or at least about 92% nucleic acid sequence identity, or at least about 93% nucleic acid sequence identity. , Or at least about 94% nucleic acid sequence identity, or at least about 95% nucleic acid sequence identity, or at least about 96% nucleic acid sequence identity, or at least about 97% nucleic acid sequence identity, or at least about 98.
% Nucleic acid sequence identity, and / or nucleotide sequences having at least about 99% nucleic acid sequence identity. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by any of the human protein cDNAs deposited with the ATTC disclosed herein, or (b) of (a) At least about 80% nucleic acid sequence identity, or at least about 81% nucleic acid sequence identity, or at least about 82% nucleic acid sequence identity, or at least about 83% nucleic acid sequence identity to the complement of a DNA molecule. Sex, or at least about 84% nucleic acid sequence identity, or at least about 85% nucleic acid sequence identity, or at least about 86% nucleic acid sequence identity, or at least about 87%.
Nucleic acid sequence identity of, or at least about 88% nucleic acid sequence identity, or at least about 89% nucleic acid sequence identity, or at least about 90% nucleic acid sequence identity, or at least about 91% nucleic acid sequence identity, Or at least about 92% nucleic acid sequence identity, or at least about 93% nucleic acid sequence identity, or at least about 94% nucleic acid sequence identity, or at least about 95% nucleic acid sequence identity, or at least about 96%.
Nucleic acid sequence identity of, or at least about 97% nucleic acid sequence identity, or at least about 98% nucleic acid sequence identity, and / or at least about 99% nucleic acid sequence identity. Another aspect of the invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a PRO polypeptide having a transmembrane domain deleted or transmembrane domain inactivated, or Disclosed herein are the transmembrane domains of such polypeptides, which are complementary to such encoding nucleotide sequences. Therefore, the soluble extracellular domain of the PRO polypeptides described herein is considered.

Another embodiment is directed to fragments of the PRO polypeptide coding sequence, or the complements thereof, which, for example, encode a polypeptide which optionally comprises a binding site for an anti-PRO antibody. It finds use as a hybridization probe for the coding fragment of E. coli or as an antisense oligonucleotide probe. Such nucleic acid fragments will typically be at least about 20 nucleotides long, or at least about 30 nucleotides long, or at least about 40 nucleotides long, or at least about 50 nucleotides long, or at least about 60 nucleotides long, or at least about 70 nucleotides long, Or at least about 80 nucleotides long, or at least about 90 nucleotides long, or at least about 100 nucleotides long, or at least about 110 nucleotides long, or at least about 120 nucleotides long, or at least about 130 nucleotides long, or at least about 140 nucleotides long.
Nucleotide length, or at least about 150 nucleotides length, or at least about 1
60 nucleotides, or at least about 170 nucleotides, or at least about 180 nucleotides, or at least about 190 nucleotides, or at least about 200 nucleotides, or at least about 250 nucleotides, or at least about 300 nucleotides, or at least about 350. Nucleotides, or at least about 400 nucleotides, or at least about 450 nucleotides, or at least about 500 nucleotides, or at least about 600 nucleotides, or at least about 700 nucleotides, or at least about 800 nucleotides, or at least about 900 nucleotides. Long, and / or at least about 10
100 nucleotides in length, where the term "about" is meant to refer to a nucleotide sequence length that is plus or minus 10% of the referenced length. Novel fragments of the PRO polypeptide-encoding nucleotide sequence can be prepared by aligning the PRO polypeptide-encoding nucleotide sequence with other known nucleotide sequences using any of a number of well-known sequence alignment programs. By determining whether the PRO polypeptide-encoding nucleotide sequence fragment is novel,
It may be identified by a routine method. All such PRO polypeptide-encoding nucleotide sequences are considered herein. Also contemplated are PRO polypeptide fragments encoded by these nucleotide molecule fragments, preferably PRO polypeptide fragments that contain a binding site for an anti-PRO antibody. In another embodiment, the invention provides an isolated PRO polypeptide encoded by any of the isolated nucleic acid sequences identified above.

In one aspect, the invention features a full-length amino acid sequence disclosed herein, a full-length amino acid sequence lacking a signal peptide disclosed herein, an extracellular of a transmembrane protein disclosed herein with or without a signal peptide. At least about 80% amino acid sequence identity, or at least about 81%, to a PRO polypeptide having a domain, or any other specifically defined fragment of the full-length amino acid sequence disclosed herein.
Amino acid sequence identity of, or at least about 82% amino acid sequence identity, or at least about 83% amino acid sequence identity, or at least about 84% amino acid sequence identity, or at least about 85% amino acid sequence identity, Or at least about 8
6% amino acid sequence identity, or at least about 87% amino acid sequence identity, or at least about 88% amino acid sequence identity, or at least about 89% amino acid sequence identity, or at least about 90% amino acid sequence identity. Sex, or at least about 91% amino acid sequence identity, or at least about 92% amino acid sequence identity, or at least about 93% amino acid sequence identity, or at least about 94% amino acid sequence identity, or at least about 95. % Amino acid sequence identity, or at least about 96% amino acid sequence identity, or at least about 97% amino acid sequence identity, or at least about 98% amino acid sequence identity, and / or at least about 99% amino acid sequence identity. Isolated PRO polypeptide comprising an amino acid sequence having a sex. In a further aspect, the invention features at least about 80% amino acid sequence identity to the amino acid sequence encoded by any of the human protein cDNAs deposited with the ATCC disclosed herein, or at least about 81% amino acids. Sequence identity,
Or at least about 82% amino acid sequence identity, or at least about 83% amino acid sequence identity, or at least about 84% amino acid sequence identity, or at least about 85% amino acid sequence identity, or at least about 86%. Amino acid sequence identity, or at least about 87% amino acid sequence identity, or at least about 88% amino acid sequence identity, or at least about 89% amino acid sequence identity, or at least about 90% amino acid sequence identity, or At least about 91% amino acid sequence identity, or at least about 92% amino acid sequence identity, or at least about 93%
% Amino acid sequence identity, or at least about 94% amino acid sequence identity, or at least about 95% amino acid sequence identity, or at least about 96% amino acid sequence identity, or at least about 97% amino acid sequence identity. , Or at least about 98% amino acid sequence identity, and / or an isolated PRO polypeptide comprising an amino acid sequence having at least about 99% amino acid sequence identity. In a further aspect, the invention provides a full-length amino acid sequence disclosed herein, an amino acid sequence lacking a signal peptide disclosed herein, an extracellular domain of a transmembrane protein disclosed herein with or without a signal peptide, or disclosed herein. At least about 80% positive, or at least about 81% positive, or at least about 82% positive, or at least when compared to the amino acid sequence of a PRO polypeptide having any other specifically defined fragment of the full-length amino acid sequence About 83
% Positive, or at least about 84% positive, or at least about 85% positive, or at least about 86% positive, or at least about 87% positive, or at least about 88% positive, or at least about 89% positive, or at least about 90%. Positive, or at least about 91% positive, or at least about 92% positive, or at least about 93% positive, or at least about 94% positive, or at least about 95% positive, or at least about 96% positive, or at least about 97% positive. , Or at least about 98% positive, and / or at least about 99% positive, and an isolated PRO polypeptide comprising an amino acid sequence.

In a particular aspect, the invention provides an isolated PRO polypeptide lacking an N-terminal signal sequence and / or an initiation methionine, which is encoded by a nucleotide sequence encoding such an amino acid sequence described above. To be done. Also described herein are methods of producing this, wherein the methods culture host cells comprising a vector containing a suitable encoding nucleic acid molecule under conditions suitable for expression of the PRO polypeptide, Comprising recovering the PRO polypeptide from the culture. Another aspect of the invention provides an isolated PRO polypeptide that is either transmembrane domain-deleted or transmembrane domain-inactivated. Also described herein are methods of producing this, wherein the methods culture host cells comprising a vector containing a suitable encoding nucleic acid molecule under conditions suitable for expression of the PRO polypeptide,
Comprising recovering the PRO polypeptide from the cell culture. In yet another embodiment, the present invention relates to agonists and antagonists of the native PRO polypeptides identified herein. In a particular embodiment, the agonist or antagonist is an anti-PRO antibody or small molecule. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist to a PRO polypeptide comprising contacting the PRO polypeptide with a candidate molecule and monitoring the biological activity mediated by said PRO polypeptide. Preferably, the PRO polypeptide is a native PRO polypeptide. In yet a further embodiment, the invention relates to a composition of matter comprising a PRO polypeptide, or an agonist or antagonist of a PRO polypeptide described herein, or an anti-PRO antibody together with a carrier. In some cases, the carrier is a pharmaceutically acceptable carrier. Another embodiment of the invention is a PRO polypeptide, or an agonist or antagonist thereof as described above, or an anti-PRO antibody, of a condition responsive to the PRO polypeptide, an agonist or antagonist thereof or an anti-PRO antibody. It is intended for use in the preparation of a therapeutically useful medicament.

Detailed Description of the Preferred Embodiments I. Definitions The terms "PRO polypeptide" and "PRO" as used herein refer to
Immediately after it refers to various polypeptides where there is a numerical code, the complete code (e.g.,
PRO / number) refers to the particular polypeptide sequence described herein. As used herein, the terms "PRO / number polypeptide" and "PRO / number", where "number" is given as the actual numerical symbol used herein, refer to native sequence polypeptides and polypeptide variants. (Defined in more detail here). The PRO polypeptides described herein may be isolated from a variety of sources, such as human tissue types or other sources, and may be prepared by recombinant or synthetic methods. The term "PRO polypeptide" means the individual PRO / number polypeptides described herein. All disclosures herein that refer to a "PRO polypeptide" refer to each of the polypeptides individually or in combination. For example, preparation, purification, induction,
Antibody production, administration, compositions containing it, treatment of diseases therewith, etc. are each associated with each polypeptide of the invention. The term "PRO polypeptide" also includes variants of the PRO / number polypeptides disclosed herein. A "native sequence PRO polypeptide" comprises a polypeptide having the same amino acid sequence as the corresponding PRO polypeptide of natural origin. Such native sequence PRO polypeptides can be isolated from nature or can be produced by recombinant or synthetic means. The term “native sequence PRO polypeptide” specifically refers to naturally occurring truncated or secreted forms of a particular PRO polypeptide (eg,
Extracellular domain sequences), naturally-occurring mutant forms (eg, alternatively spliced forms) and naturally-occurring allelic variants of the polypeptide. In various embodiments of the invention, the native sequence PRO polypeptide is a mature or full length native sequence polypeptide comprising the full length amino acid sequence shown in the accompanying figures. Start and stop codons are shown in bold and underlined in the figure. However, the PRO polypeptides disclosed in the accompanying figures are shown to begin with a methionine residue, designated herein as amino acid 1 in the figures, although other polypeptides located upstream or downstream of amino acid position 1 in the figures may be used. It is also possible and possible to use a methionine residue as the starting amino acid residue of the PRO polypeptide. The PRO polypeptide "extracellular domain" or "ECD" refers to a form of the PRO polypeptide that is substantially free of transmembrane and cytoplasmic domains. Usually PRO
The polypeptide ECD has less than 1% of their transmembrane and / or cytoplasmic domains,
Preferably it has less than 0.5% of such domains. It will be appreciated that any transmembrane domain identified for a PRO polypeptide of the invention will be identified according to the criteria routinely used in the art to identify that type of hydrophobic domain. . The exact boundaries of the transmembrane domain may vary, but are likely not to exceed about 5 amino acids from either end of the first identified domain. Thus, the extracellular domain of a PRO polypeptide optionally contains no more than about 5 amino acids from either side of the transmembrane and / or extracellular domain boundaries as identified in the Examples or specification. Those polypeptides and nucleic acids encoding them, which may be included, with or without a signal peptide, are contemplated by the present invention.

Suitable positions for the “signal peptides” of the various PRO polypeptides disclosed herein are shown herein and / or in the accompanying drawings. However, as noted, the C-terminal boundary of the signal peptide may vary, but most likely it is less than about 5 amino acids on either side of the signal peptide C-terminal boundary, as originally defined herein. High, the C-terminal boundary of the signal peptide may be identified according to the criteria routinely used to identify such types of amino acid sequence components (eg, Nielsen et al., Pr.
ot. Eng. 10: 1-6 (1997) and von Heinje et al., Nucl. Acids. Res. 14: 4683-4690.
(1986)). Furthermore, it is also recognized that in some cases cleavage of the signal peptide from the secreted polypeptide is not completely homogeneous, resulting in one or more secreted species. These mature polypeptides in which the signal peptide is cleaved within less than about 5 amino acids on either side of the C-terminal boundary of the signal peptide identified herein,
And polynucleotides encoding them are contemplated by the present invention. “PRO polypeptide variant” refers to a full length native sequence PRO polypeptide sequence disclosed herein, a full length native sequence PRO polypeptide sequence lacking the signal peptide disclosed herein, as defined above or below. An active PRO poly having at least about 80% amino acid sequence identity with the extracellular domain of PRO disclosed herein with or without a signal peptide, or any other fragment of the full-length PRO polypeptide disclosed herein. Means peptide. Such PRO polypeptide variants include, for example, PRO polypeptides in which one or more amino acid residues have been added or deleted at the N- or C-terminus of the full-length native amino acid sequence. Generally, a PRO polypeptide variant is a full length native sequence polypeptide sequence disclosed herein, a PRO polypeptide sequence lacking the signal peptide disclosed herein, a PRO polypeptide disclosed herein with or without a signal peptide. At least about 80% amino acid sequence identity, or at least about 81% amino acid sequence identity with the extracellular domain of, or any other specifically defined fragment of the full-length PRO polypeptide sequence disclosed herein, or At least about 82% amino acid sequence identity, or at least about 83% amino acid sequence identity, or at least about 84%
Amino acid sequence identity of, or at least about 85% amino acid sequence identity, or at least about 86% amino acid sequence identity, or at least about 87% amino acid sequence identity, or at least about 88% amino acid sequence identity, Or at least about 8
9% amino acid sequence identity, or at least about 90% amino acid sequence identity, or at least about 91% amino acid sequence identity, or at least about 92% amino acid sequence identity, or at least about 93% amino acid sequence identity. Or at least about 94% amino acid sequence identity, or at least about 95% amino acid sequence identity, or at least about 96% amino acid sequence identity, or at least about 97% amino acid sequence identity, or at least about 98. % Amino acid sequence identity, and / or at least about 99% amino acid sequence identity. Generally, a PRO variant polypeptide is at least about 10 amino acids long, or at least about 20 amino acids long, or at least about 30 amino acids long, or at least about 40 amino acids long, or at least about 50 amino acids long, or at least about 60 amino acids long. , Or at least about 70 amino acids long, or at least about 80 amino acids long, or at least about 90 amino acids long.
Amino acids long, or at least about 100 amino acids long, or at least about 150 amino acids long, or at least about 200 amino acids long, or at least about 300 amino acids long, or longer.

“Percent (%) amino acid sequence identity” to a PRO polypeptide sequence identified herein, aligns the sequences and introduces gaps, if necessary, to obtain the maximum percent sequence identity, regardless of conservation. Substitutions are also defined as the percentage of amino acid residues in a candidate sequence that are identical to the amino acid residues in a particular PRO polypeptide sequence, without considering them as part of sequence identity. Alignment for the purpose of determining percent amino acid sequence identity is performed by a variety of methods within the skill of the art.
This can be accomplished by using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. One of ordinary skill in the art can determine the appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. However, for the purposes herein, the% amino acid sequence identity values are set forth in the sequence comparison computer program ALIGN-, whose complete source code for the ALIGN-2 program is given in Table 1, as described below. 2
Is obtained by using. The ALIGN-2 sequence comparison computer program was written by Genentech, Inc. and the source code shown in Table 1 is the US Copyright Office, Washington DC.
., 20559 filed with user documentation and registered under US Copyright Registration Number TXU510087. The ALIGN-2 program is Genentech, South San Francisco
, Publicly available through California, or may be compiled from the source code given in Table 1. The ALIGN-2 program is compiled for use with a UNIX® operating system, preferably Digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not change.

In the context where ALIGN-2 is used for amino acid sequence comparisons, the% amino acid sequence identity of a given amino acid sequence A with a given amino acid sequence B or to it.
(Alternatively, it may be referred to as a given amino acid sequence B, or a given amino acid sequence A having or having a certain% amino acid sequence identity therewith)
Is calculated as: 100 times the fraction X / Y, where X is the number of amino acid residues in the score that were matched by the A and B program alignments of the sequence alignment program ALIGN-2. Yes,
Y is the total number of amino acid residues of B. It will be appreciated that if the length of amino acid sequence A differs from the length of amino acid sequence B, then the% amino acid sequence identity of A to B is different than the% amino acid sequence identity of B to A. As an example of calculating% amino acid sequence identity, Tables 2 and 3 show that the "amino acid sequence" referred to as "comparative protein"
Figure 3 shows a method of calculating% amino acid sequence identity to an amino acid sequence referred to as "PRO", where "PRO" represents the amino acid sequence of a hypothetical PRO polypeptide of interest and "comparative protein" is the "PRO" polypeptide of interest. Represents the amino acid sequence of the polypeptide for which it is compared and "X", "Y" and "Z" represent different hypothetical amino acid residues, respectively. Unless otherwise noted, all% amino acid sequence identity values used herein are obtained using the ALIGN-2 computer program as described above. However,
% Amino acid sequence identity is determined by the WU-BLAST-2 computer program (Altschul et al., Met.
It can also be obtained by using hods in Enzymology 266: 460-480 (1996)) as described below. Most WU-BLAST-2 search parameters are set to default values. Not set to default values, ie adjustable parameters set to the following values:
Overlap span = 1, overlap fraction = 0.125, word threshold (T) = 11, and scoring matrix = BLOSUM62. When using WU-BLAST-2, the% amino acid sequence identity value is (a) an amino acid sequence of the PRO polypeptide of interest having a sequence derived from the native PRO polypeptide and a comparative amino acid sequence of interest (ie, The sequence of identical amino acid residues as determined by WU-BLAST-2 between the PRO polypeptide of interest and the sequence which may be the PRO polypeptide variant with which it is compared (b) the PRO of interest. It is determined by the quotient divided by the total number of residues in the polypeptide. For example, "at least 80% of amino acid sequence B
The expression "a polypeptide comprising an amino acid sequence A having or having the amino acid sequence identity of" means that the amino acid sequence A is the comparative amino acid sequence of interest,
Amino acid sequence B is the amino acid sequence of the PRO polypeptide of interest.

Also, the percent amino acid sequence identity is determined by the sequence comparison program NCBI-BLAST2 (Alts
Chul et al., Nucleic Acids Res. 25: 3389-3402 (1997)).
The NCBI-BLAST2 sequence comparison program can be downloaded from http://ww.ncbi.nlm.nih.gov or obtained from the National Institutes of Health, Bethesda, MD. NCBI-
BLAST2 uses several search parameters, all of which are set to default values, eg unmask = ok, chains = all, expected occurrences = 10,
Minimum low composite length = 15/5, multipath e-value = 0.01, multipath constant = 2
5, including final gap alignment drop-off = 25, and scoring matrix = BLOSUM62. In the situation where NCBI-BLAST2 is used for amino acid sequence comparisons, the% amino acid sequence identity of a given amino acid sequence A to, or to a given amino acid sequence B (or with a given amino acid sequence B, or On the other hand, a certain percentage
A given amino acid sequence A which has or contains amino acid sequence identity can also be calculated as follows: 100 times the fraction X / Y, where X is A in the sequence alignment program NCBI-BLAST2. And B is the number of amino acid residues in the score that were matched by the program alignment to be the same, and Y is the total number of amino acid residues in B. The length of amino acid sequence A is amino acid sequence B
The% amino acid sequence identity of A to B will be evaluated to be different from the% amino acid sequence identity of B to A if they differ in length from.

By “PRO variant polynucleotide” or “PRO variant nucleic acid sequence” is meant a nucleic acid molecule that encodes an active PRO polypeptide as defined below, the full length native sequence PRO polypeptide disclosed herein. Sequence, full length native sequence PRO polypeptide sequence lacking the signal peptide disclosed herein, PRO polypeptide extracellular domain with or without the signal peptide disclosed herein, or full length P disclosed herein.
Nucleic acid sequence identity of at least about 80% with a nucleic acid sequence encoding any other fragment of the RO polypeptide sequence. Generally, a PRO variant polynucleotide is a full length native sequence PRO polypeptide sequence disclosed herein, a full length native sequence PRO polypeptide sequence lacking the signal peptide disclosed herein, a PRO polypeptide with or without the signal peptide disclosed herein. At least about 80% nucleic acid sequence identity with the nucleic acid sequence encoding the peptide extracellular domain, or any other fragment of the full-length PRO polypeptide sequences disclosed herein, or at least about 81% nucleic acid sequence identity, or at least About 82% nucleic acid sequence identity, or at least about 83% nucleic acid sequence identity, or at least about 84% nucleic acid sequence identity, or at least about 85% nucleic acid sequence identity, or at least about 86% nucleic acid sequence. Identity, or at least about 8
7% nucleic acid sequence identity, or at least about 88% nucleic acid sequence identity, or at least about 89% nucleic acid sequence identity, or at least about 90% nucleic acid sequence identity, or at least about 91% nucleic acid sequence identity. Or at least about 92% nucleic acid sequence identity, or at least about 93% nucleic acid sequence identity, or at least about 94% nucleic acid sequence identity, or at least about 95% nucleic acid sequence identity, or at least about 9
Have 6% nucleic acid sequence identity, or at least about 97% nucleic acid sequence identity, or at least about 98% nucleic acid sequence identity, and / or at least about 99% nucleic acid sequence identity. Variants do not include the native nucleotide sequence. Generally, a PRO variant polynucleotide is at least about 30 nucleotides long, or at least about 60 nucleotides long, or at least about 90 nucleotides long, or at least about 120 nucleotides long, or at least about 150 nucleotides long, or at least about 180 nucleotides long. Or at least about 210 nucleotides long, or at least about 240 nucleotides long, or at least about 270 nucleotides long, or at least about 300 nucleotides long, or at least about 45.
It is 0 nucleotides long, or at least about 600 nucleotides long, or at least about 900 nucleotides long, or longer.

“Percent (%) nucleic acid sequence identity” to a PRO polypeptide-encoding nucleic acid sequence identified herein refers to the alignment of the sequences and the introduction of gaps if necessary to achieve maximal percent sequence identity. And is defined as the percentage of nucleotides in the candidate sequence that are identical to the nucleotides of the PRO nucleic acid sequence of interest. Alignments for the purpose of determining percent nucleic acid sequence identity can be made by a variety of methods within the skill of the art, including publicly available BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. This can be achieved by using computer software. However, for the purposes herein, the% nucleic acid sequence identity values are set forth in the sequence comparison computer program ALIGN-, whose complete source code for the ALIGN-2 program is given in Table 1, as described below. Obtained using 2. ALIGN-2
The sequence comparison computer program was written by Genentech, Inc. and the source code shown in Table 1 has been submitted to the US Copyright Office, Washington DC, 20559 with user documentation and registered under US Copyright Registration Number TXU510087. . The ALIGN-2 program is publicly available through Genentech, Inc., South San Francisco, California and may be compiled from the source code given in Table 1. AL
The IGN-2 program is a UNIX operating system, preferably digital UNIX.
Compiled for use with V4.0D. All sequence comparison parameters are ALIGN
-2 Set by the program and does not change.

In the context where ALIGN-2 is used for nucleic acid sequence comparisons, the% nucleic acid sequence identity of a given nucleic acid sequence C with or to a given nucleic acid sequence D (or given nucleic acid sequence D , Or a given amino acid sequence C with or containing some% nucleic acid sequence identity thereto) is calculated as: 100 times the fraction W / Z where , W is the number of nucleotides in the score that were matched as identical by the C and D program alignments of the sequence alignment program ALIGN-2,
Z is the total number of nucleotides in D. If the length of the nucleic acid sequence C differs from the length of the nucleic acid sequence D, the% nucleic acid sequence identity of C to D will be evaluated as different from the% nucleic acid sequence identity of D to C. As an example of calculating% nucleic acid sequence identity, Tables 4 and 5 show methods of calculating% nucleic acid sequence identity of a nucleic acid sequence referred to as "comparative DNA" to a nucleic acid sequence referred to as "PRO-DNA". And here "PRO-D
"NA" represents the hypothetical PRO-encoding nucleic acid sequence of interest, "comparative DNA" is compared to the "PRO-DNA" nucleic acid molecule of interest and represents the nucleotide sequence of the nucleic acid molecule for which "N", "L" and "V" represents different hypothetical nucleotides. Unless otherwise indicated, all% nucleic acid sequence identity values herein are ALIG as described above.
Obtained using the N-2 sequence comparison computer program. However,% nucleic acid sequence identity is determined by the WU-BLAST-2 computer program (Altschul et al., Methods in En.
It can also be obtained by using zymology 266: 460-480 (1996)) as described below. Most WU-BLAST-2 search parameters are set to default values. Not set to default values, ie adjustable parameters set to the following values: overlap span = 1, overlap fraction = 0.125, word threshold (T) =
11, and scoring matrix = BLOSUM62. When using WU-BLAST-2,%
A nucleic acid sequence identity value is (a) a nucleic acid sequence of a PRO polypeptide-encoding nucleic acid molecule of interest having a sequence derived from a native sequence PRO polypeptide-encoding nucleic acid,
WU-BLAST- between a comparative nucleic acid sequence of interest (ie, a sequence which may be a mutant PRO polypeptide with which the PRO polypeptide-encoding nucleic acid sequence of interest is compared).
The number of matching identical nucleotides determined by 2 is determined by the quotient divided by (b) the total number of nucleotides of the PRO polypeptide-encoding nucleic acid molecule of interest. For example, in the expression "an isolated nucleic acid molecule comprising a nucleic acid sequence A having or having at least 80% nucleic acid sequence identity to nucleic acid sequence B", nucleic acid sequence A is of interest to a comparative nucleic acid sequence. And nucleic acid sequence B is the nucleic acid sequence of the PRO polypeptide-encoding nucleic acid molecule of interest.

In addition, the percent nucleic acid sequence identity was determined using the sequence comparison program NCBI-BLAST2 (Altschul
Et al., Nucleic Acids Res. 25: 3389-3402 (1997)). NCBI
-The BLAST2 sequence comparison program can be downloaded from http://ww.ncbi.nlm.nih.gov or obtained from the National Institutes of Health, Bethesda, MD. NCBI-BLAS
T2 uses several search parameters, all of which are set to default values, eg unmask = ok, chains = all, expected occurrence = 10, minimum low compound length = 15/5, multi Path e-value = 0.01, multipath constant = 25,
Includes final gap alignment drop-off = 25, and scoring matrix = BLOSUM62. In the context where NCBI-BLAST2 is used for sequence comparisons, the% nucleic acid sequence identity of a given nucleic acid sequence C to, or to a given nucleic acid sequence D (to a given nucleic acid sequence D, or to it A given nucleic acid sequence C with or including some degree of nucleic acid sequence identity can also be calculated) as: 100 times the fraction W / Z, where W is the sequence alignment program. NCBI-BLAST2 is the number of nucleotides with a score that was matched by the C and D program alignments, and Z is the total number of nucleotides in D. If the length of the nucleic acid sequence C differs from the length of the nucleic acid sequence D, the% nucleic acid sequence identity of C to D will be evaluated as different from the% nucleic acid sequence identity of D to C.

In another embodiment, the PRO variant polypeptide nucleotides encode an active PRO polypeptide, preferably under stringent hybridization and wash conditions.
Nucleic acid molecules that hybridize to the nucleotide sequences encoding the full-length PRO polypeptides disclosed herein. The PRO variant polypeptide may be one encoded by the PRO variant polynucleotide.

The term “positive” refers to a residue in a sequence comparison performed as described above that is not identical but has similar properties in the compared sequences (eg, conservative As a result of the substitution, include Table 6 below). For the purposes here,
The percent positive value is (a) the PRO polypeptide amino acid sequence of interest having a sequence derived from the native PRO polypeptide and the comparative amino acid sequence of interest (ie, PR
BLOSUM6 of WU-BLAST-2 between
2 Determined by the quotient of the number of positively assigned amino acid residues in the matrix divided by (b) the total number of amino acid residues of the PRO polypeptide of interest. Unless otherwise stated, positive% values are calculated as described in the paragraph immediately above. However, amino acid sequence identities performed as described above for ALIGN-2 and NCBI-BLAST2 include amino acid residues in sequences that have similar as well as similar properties in sequence comparisons. An amino acid residue that is positive for an amino acid residue of interest is one that is identical to the amino acid residue of interest or is a preferred substitution (as defined in Table 6 below) for the amino acid residue of interest. . In the amino acid sequence comparison using ALIGN-2 or NCBI-BLAST2, the positive% value of the given amino acid sequence A with or against the given amino acid sequence B (or with the given amino acid sequence B, Or a given amino acid sequence A which has or contains some% amino acid sequence identity thereto) is calculated as: 100 times the fraction X / Y, where X Is A and B of the sequence alignment program ALIGN-2 or NCBI-BLAST2
Is the number of amino acid residues in the score that are considered positive by the alignment, and Y is the total number of amino acid residues in B. If the length of amino acid sequence A is not equal to the length of amino acid sequence B, then the% positivity of A to B will be evaluated as different from the% positivity of B to A.

“Isolated”, when used to describe the various polypeptides disclosed herein, refers to the polypeptides identified, separated and / or recovered from the components of their natural environment. means. Contaminant components of its natural environment are materials that typically interfere with diagnostic or therapeutic uses for the polypeptide, and include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes. In a preferred embodiment, the polypeptide is (1) sufficient to obtain an N-terminal or internal amino acid sequence of at least 15 residues by using a spinning cup sequenator, or (2) Coomassie blue or It is preferably purified to homogeneity by SDS-PAGE under non-reducing or reducing conditions using silver staining. Isolated polypeptide includes polypeptide in situ within recombinant cells, since at least one component of the PRO polypeptide natural environment will not be present. Ordinarily, however, isolated polypeptide will be prepared by at least one purification step. An "isolated" PRO polypeptide-encoding nucleic acid or other polypeptide-encoding nucleic acid has been identified and separated from at least one contaminating nucleic acid molecule that is normally associated with the natural source of the PRO polypeptide-encoding nucleic acid. It is a nucleic acid molecule. An isolated PRO polypeptide-encoding nucleic acid molecule is in a form or setting other than that found in nature. Thus, an isolated PRO polypeptide-encoding nucleic acid molecule
It is distinguished from the particular PRO polypeptide-encoding nucleic acid molecule as it exists in natural cells. However, an isolated PRO polypeptide-encoding nucleic acid molecule includes, for example, a polypeptide-encoding nucleic acid molecule contained in a cell that normally expresses a polypeptide whose nucleic acid molecule is in a chromosomal location different from that of natural cells. The term "control sequence" refers to a DNA sequence necessary for the expression of an operably linked coding sequence in a particular host organism. The control sequences that are suitable for prokaryotes, for example, include a promoter, optionally an operator sequence, and a ribosome binding site. Eukaryotic cells are known to utilize promoters, polyadenylation signals and enhancers. Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, if the DNA of the presequence or secretory leader is expressed as a preprotein that participates in the secretion of the polypeptide, the DNA of that polypeptide
Is operably linked to; a promoter or enhancer is operably linked to the coding sequence if it affects the transcription of the sequence; or the ribosome binding site is such that it facilitates translation. Is operably linked to the coding sequence. Generally, "operably linked" means that D is bound to
It means that the NA sequences are contiguous and, in the case of a secretory leader, contiguous and in the reading phase. However, enhancers do not necessarily have to be in close proximity. Binding is accomplished by ligation at convenient restriction sites. If such sites do not exist, then synthetic oligonucleotide adapters or linkers are used in accord with conventional practice.

The term “antibody” is used in the broadest sense, eg, a single anti-P
RO monoclonal antibody (including agonist, antagonist, and neutralizing antibody),
Anti-PRO antibody composition having multi-epitope specificity, single chain anti-PRO antibody, and anti-PRO antibody
-Including fragments of the PRO antibody (see below). The term “monoclonal antibody” as used herein refers to a substantially homogeneous population of antibodies, ie, the individual antibodies that make up the population are identical except for the naturally occurring mutations that may be present in small amounts. The antibody obtained from a population of The "stringency" of a hybridization reaction is readily determined by one of ordinary skill in the art and is an empirical calculation that generally depends on probe length, wash temperature, and salt concentration. In general, longer probes have higher temperatures for proper annealing and shorter probes have lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment near, but below their melting temperature. The higher the degree of desired homology between the probe and the hybridizable sequence, the higher the relative temperature that can be used. As a result, higher relative temperatures make the reaction conditions more stringent, while lower temperatures reduce stringency.
Further details and explanations of the stringency of the hybridization reaction can be found in Ausubel et al., Current P.
See rotocols in Molecular Biology, Wiley Interscience Publishers, (1995). "Stringent conditions" or "highly stringent conditions" as defined herein means (1) low ionic strength and high temperature for washing, eg, 0.015M sodium chloride / 0.0015M at 50 ° C. Using sodium citrate / 0.1% sodium dodecyl sulfate; (2) Denaturants such as formamide during hybridization, eg 50% (v / v) formamide and 0.1% bovine serum albumin at 42 ° C. / 0
． 1% Ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer pH 6.5, and 750 mM sodium chloride, 75 mM sodium citrate; or (3) 50% formamide at 42 ° C., 5
xSSC (0.75M NaCl, 0.075M sodium citrate), 50m
M sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5x Denhardt's solution, sonicated salmon sperm DNA (50 μg / ml), 0.1% SDS, and 10% dextran sulfate, Specified by using a high stringency wash consisting of a wash in 0.2xSSC (sodium chloride / sodium citrate) at 42 ° C and 50% formamide at 55 ° C followed by 0.1xSSC with EDTA at 55 ° C. “Moderate stringency conditions” are described in Sambrook et al., Molecular Cloning: A Laboratory.
Manual, New York: Cold Spring Harbor Laboratory Press, 1989, wash solutions and hybridization conditions specified below and less stringent.
(Eg temperature, ionic strength and% SDS). Examples of moderate stringency conditions are 20% formamide, 5xSSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate pH 7.6, 5x Denhardt's solution, 10% dextran sulfate, and 20 mg / mL denatured sheared salmon sperm DNA
Incubation in a solution containing at 37 ° C. overnight followed by 37-in 1 × SSC.
The condition is that the filter is washed at 50 ° C. One of ordinary skill in the art will recognize how to adjust temperature, ionic strength, etc. as needed to accommodate factors such as probe length.

The term “epitope tag,” as used herein, refers to a chimeric polypeptide comprising a PRO polypeptide fused to a “tag polypeptide”. The tag polypeptide has sufficient residues to provide an epitope against which the antibody can be produced, but its length is short enough so as not to interfere with the activity of the polypeptide with which it is fused. Also, the tag polypeptide is preferably fairly unique so that the antibody does not substantially cross-react with other epitopes. Suitable tag polypeptides generally have at least 6 amino acid residues, usually from about 8 to about 50 amino acid residues.
(Preferably about 10 to about 20 amino acid residues). The term “immunoadhesin” as used herein refers to antibody-like molecules that combine the binding specificity of a heterologous protein (“adhesin”) with the effector functions of immunoglobulin constant domains. Structurally, an immunoadhesin comprises a fusion of an immunoglobulin constant domain sequence with an amino acid sequence that has the desired binding specificity and is other than the antigen recognition and binding site of an antibody (i.e., "heterologous"). . The adhesin portion of the immunoadhesin molecule is typically a contiguous amino acid sequence containing at least the binding site for the receptor or ligand. The immunoglobulin constant domain sequence of the immunoadhesin has IgG-1, IgG-2, IgG-3 or IgG-4 subtype, Ig
It can be obtained from any immunoglobulin such as A (including IgA-1 and IgA-2), IgE, IgD or IgM. The term "active" and "activity" as used herein mean P or P that occurs naturally or naturally.
Refers to a form of the PRO polypeptide that retains the biological and / or immunological activity of RO, and "biological" activity refers to the biology (inhibitory or stimulatory) produced by a natural or naturally occurring PRO. Functionally, excluding the ability to generate antibodies against the antigenic epitopes of natural or naturally occurring PRO, and "immunological" activity is the antigen of natural or naturally occurring PRO. Refers to the ability to generate antibodies against the sex epitope. The term "antagonist" is used in its broadest sense and includes any molecule that partially or completely blocks, inhibits, or neutralizes the biological activity of the native PRO polypeptide disclosed herein. Similarly, the term "agonist" is also used in its broadest sense and includes any molecule that mimics the biological activity of a native PRO polypeptide disclosed herein. Suitable agonist or antagonist molecules include in particular agonist or antagonist antibodies or antibody fragments, fragments or amino acid sequence variants of the native PRO polypeptide, peptides, antisense oligonucleotides, small organic molecules and the like. A method of identifying an agonist or antagonist of a PRO polypeptide comprises contacting the PRO polypeptide with a candidate antagonist or agonist and measuring a detectable change in one or more biological activities normally associated with the PRO polypeptide. sell.

As used herein, “treatment” refers to both curative treatment, prophylactic therapy and preventative therapy, the purpose of which is to prevent or reduce (reduce) the targeted pathological condition or disease. Especially. Those in need of treatment include those already with the disorder as well as those prone to have the disorder or those in whom the disorder is to be prevented. By "chronic" administration is meant administration of the drug in a continuous manner as opposed to an acute manner, maintaining the initial therapeutic effect (activity) over an extended period of time. “Intermittent” administration is a treatment that is of a periodic nature rather than continuous without interruption. "Mammal" for purposes of treatment is classified as a mammal, including humans, domestic and agricultural animals, zoos, sports, or pet animals, such as dogs, cats, cows, horses, sheep, pigs, goats, rabbits, etc. Means any animal that is. Preferably the mammal is a human. Administration "in combination" with one or more therapeutic agents includes simultaneous (concurrent) and sequential administration in any order. As used herein, "carrier" includes a pharmaceutically acceptable carrier, excipient, or stabilizer and is nontoxic to cells or mammals exposed to them at the dosages and concentrations employed. . The physiologically acceptable carrier is often an aqueous pH buffered solution. Examples of physiologically acceptable carriers are phosphate, citrate, and other organic acid salt buffers; antioxidants including ascorbic acid; low molecular weight (about 1
<0 residues) polypeptide; protein such as serum albumin, gelatin, or immunoglobulin; hydrophilic polymer such as polyvinylpyrrolidone; amino acid,
For example, glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates including glucose, mannose or dextrin; E
Chelating agents such as DTA; sugar alcohols such as mannitol or sorbitol; salt forming counterions such as sodium; and / or nonionic surfactants such as TWEEN ^T.
M , polyethylene glycol (PEG), and PLURONICS ^™ .

An “antibody fragment” comprises a portion of an intact antibody, preferably the antigen binding or variable region of the intact antibody. Examples of antibody fragments are Fab, Fab ′, F (ab ′) ₂ and Fv fragments; diabodies; linear antibodies (Zapata et al., Protein Eng. 8 (10): 10).
57-1062 [1995]); single-chain antibody molecules; and multispecific antibodies formed from antibody fragments. Papain digestion of antibodies produces two identical antibody-binding fragments, called "Fab" fragments, each of which has a single antigen-binding site and the rest "Fc", reflecting its ability to crystallize readily. Named Fragment. Pepsin treatment yields an F (ab ′) ₂ fragment that has two antigen-combining sites and is still capable of cross-linking antigen. "Fv" is the minimum antibody fragment that contains a complete antigen recognition and binding site. This region consists of a dimer of one heavy chain and one light chain variable region in close, non-covalent association. In this configuration, the three CDRs of each variable domain interact to determine the antigen binding site on the surface of the _VH - _VL dimer. Collectively, the six CDRs provide the antigen binding specificity for the antibody. However, even a single variable domain (or half of an Fv that comprises only three CDRs specific for an antigen) has a lower affinity than the entire binding site but still has the ability to recognize and bind the antigen. . The Fab fragment also contains the constant domain of the light chain and the first constant domain (CH
Also includes 1). Fab fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH1 domain including one or more cysteines from the antibody hinge region. Here, Fab′-SH represents Fab ′ in which the cysteine residue of the constant domain has a free thiol group. F (ab ′) ₂ antibody fragments originally were produced as pairs of Fab ′ fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known. The "light chains" of antibodies (immunoglobulins) from any vertebrate species are classified into one of two distinct types, called kappa and lambda, based on the amino acid sequences of their constant domains. Depending on the amino acid sequence of the constant domain of their heavy chains, immunoglobulins can be classified into different classes. Five major classes of immunoglobulins: IgA, I
There are gD, IgE, IgG and IgM, some of which are further subclasses (isotypes) such as IgG1, IgG2, IgG3, IgG4, IgA and I.
It is classified as gA2.

A “single chain Fv” or “sFv” antibody fragment contains the V _H and V _L domains of the antibody, and these domains are present in a single polypeptide chain. Preferably, the Fv polypeptide further comprises a polypeptide linker between the _VH and _VL domains, which enables the sFV to form the desired structure for antigen binding. For an overview of sFv, see The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg.
And Moore, Ed., Springer-Verlag, New York, pp. 269-315 (1994), Pluckthun. The term "diabodies" refers to small antibody fragments that have two antigen binding sites, which fragments are within the same polypeptide chain ( _VH - _VL ) in the light chain variable domain.
It comprises a heavy chain variable domain (V _H ) linked to (V _L ). By using a linker that is too short to pair between two domains on the same chain, the domains are forced to pair with the complementary domains on the other chain, creating two antigen binding sites. Diabodies are described, for example, in EP 404,097; WO 93/11161; and Hollinger et al., Proc. Natl. Acad.
Sci. USA, 90: 6444-6448 (1993). An "isolated" antibody is one that has been identified and separated and / or recovered from a component of its natural environment. Contaminant components of its natural environment are materials that would interfere with its diagnostic or therapeutic use for the antibody, including enzymes, hormones, and other proteinaceous or nonproteinaceous solutes. In a preferred embodiment, the antibody is (1) the Lory method (L
More than 95% by weight of the antibody, most preferably more than 99% by weight, as determined by the owry method), and (2) using the spinning cup sequenator to obtain an N-terminal or internal amino acid sequence of at least 15 residues. Or to (3) homogeneity by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or preferably silver staining. Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step. The term "label" as used herein refers to a detectable compound or composition which is conjugated directly or indirectly to the antibody to produce a "labeled" antibody. The label may itself be detectable (e.g., a radioactive or fluorescent label), or in the case of an enzymatic label,
It may catalyze a chemical change in a detectable substrate compound or composition. By "solid phase" is meant a non-aqueous matrix to which the antibodies of the invention can adhere. Examples of solid phases included herein include those formed partly or wholly from glass (eg, controlled pore glass), polysaccharides (eg, agarose), polyacrylamide, polystyrene, polyvinyl alcohol and silicone. In some embodiments, depending on the context, the solid phase can comprise the wells of an assay plate; in others it can be a purification column (eg, an affinity chromatography column). The term also includes a discontinuous solid phase of discrete particles, such as those described in US Pat. No. 4,275,149. "Liposomes" are small vesicles composed of various types of lipids, phospholipids, and / or surfactants, which are useful for delivery of drugs (such as PRO polypeptides or their antibodies) to mammals. The components of the liposome are commonly arranged in a bilayer formation, similar to the lipid arrangement of biological membranes. A "small molecule" is defined herein as having a molecular weight of less than about 500 Daltons. “FGFR-1”, “FGFR-2”, “FGFR-3” and “FGFR-4” are described in Isacchi et al., Nuc. Acids Res. 18 (7): 1906 (1990), Dionne et al., EMBO J.9. (9): 2
685-2692 (1990), Keegan et al., Proc. Natl. Acad. Sci. USA 88: 1095-1099 (1991).
And Partanen et al., EMBO J. 10 (6): 1347-1354 (1991), refer to fibroblast growth factor receptors 1, 2, 3 and 4, respectively.

[0062]

[0063]

II. Compositions and Methods of the Invention A. Full Length PRO Polypeptides The present invention provides newly identified and isolated nucleotide sequences that encode a polypeptide designated herein as a PRO polypeptide. In particular, cDNAs encoding various PRO polypeptides, as described in further detail in the Examples below.
Was identified and isolated. It should be noted that although the proteins produced in separate expression rounds are given different PRO numbers, the UNQ numbers are unique for all given DNA and encoding proteins and do not change. However,
For simplicity, herein, the proteins encoded by the full-length natural nucleic acid molecules disclosed herein, as well as additional natural homologues and variants included within the definition of PRO above, are independent of their source or format of preparation. Instead, it is referred to as “PRO / number”. Various cDNA clones have been deposited with the ATCC, as disclosed in the Examples below. The exact nucleotide sequences of these clones can be readily determined by sequencing the deposited clones using methods routine in the art. The predicted amino acid sequence can be determined from the nucleotide sequence using routine skill. For the PRO polypeptides and encoding nucleic acids described herein,
Applicants have identified what is believed to be the reading frame that best matches the currently available sequence information.

1. Full Length PRO196 Polypeptide The present invention provides a newly identified and isolated nucleotide sequence encoding a polypeptide referred to in this application as PRO196. In particular, Applicants have identified and isolated cDNA encoding a PRO196 polypeptide, as disclosed in further detail in the Examples below. Using the BLAST and FastA sequence alignment computer programs, Applicants have determined that the cDNA encoding the full-length native sequence PRO196
It has been found that the NA sequence encodes a polypeptide having an amino acid sequence with identity to the amino acid sequences of various TIE ligand polypeptides.

2. The full-length PRO444 polypeptide DNA26846-1397 clone was isolated from a human fetal lung library using a capture technique that selects for nucleotides encoding secreted proteins. Thus, the DNA26846-1397 clone encodes a secretory factor. To the best of our knowledge, the DNA26846-1397 sequence encodes a novel element designated herein as PRO444. The WU-BLAST2 sequence alignment computer program was used to reveal some degree of sequence identity with known proteins.

3. The full-length PRO183 polypeptide DNA28498 clone was isolated from a human tissue library. To the best of our knowledge, the DNA28498 sequence encodes a novel element designated herein as PRO183. The WU-BLAST2 sequence alignment computer program was used to reveal some degree of sequence identity with known proteins.

4. The full-length PRO185 polypeptide DNA28503 clone was isolated from a human tissue library. To the best of our knowledge, the DNA28503 sequence encodes a novel element designated herein as PRO185. The WU-BLAST2 sequence alignment computer program was used to reveal some degree of sequence identity with known proteins.

5. Full Length PRO210 and PRO217 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding the polypeptides referred to in this application as PRO210 and PRO217. In particular, Applicants have identified PRO210 and P210 as disclosed in further detail in the Examples below.
The cDNA encoding the RO217 polypeptide was identified and isolated. BLAST (FastA
Format) Sequence Alignment Using a computer program, Applicants have used the cDNA encoding the full length native sequence PRO210 and PRO217 polypeptides.
It was found that the A sequence has homology to a known protein having an EGF-like domain. Therefore, the PRO 210 and P disclosed in this application are now
RO217 is a newly identified member of the EGF-like family and is believed to have properties typical of the EGF-like protein family.

6. Full-Length PRO215 Polypeptide The present invention provides newly identified and isolated nucleotide sequences that encode a polypeptide referred to in this application as PRO215. In particular, Applicants have identified and isolated cDNA encoding a PRO215 polypeptide, as disclosed in further detail in the Examples below. Using the BLAST and FastA sequence alignment computer programs, Applicants have shown that the cDNA sequence encoding the full-length native sequence PRO215 (shown in Fig11 and SEQ ID NO: 16) has an amino acid sequence with identity to the amino acid sequence of the SLIT protein precursor. Was found to encode a polypeptide having PRO215 also has identity with leucine-rich repeat proteins.

7. Full Length PRO242 Polypeptides The present invention provides newly identified and isolated nucleotide sequences that encode a polypeptide referred to in this application as PRO242. In particular, Applicants have identified and isolated cDNA encoding a PRO242 polypeptide, as disclosed in further detail in the Examples below. Using the BLAST and FastA sequence alignment computer programs, Applicants have shown that the cDNA sequence encoding the full-length native sequence PRO242 (shown in Figure 15 and SEQ ID NO: 23) is human macrophage inflammatory protein 1-alpha, rabbit macrophage inflammatory protein 1-alpha. It was found to have amino acid sequence identity with 1-beta, human LD78 and rabbit immune activation gene 2. Therefore, it is now believed that the PRO242 polypeptides disclosed in this application are newly identified members of the chemokine family and possess properties typical of the chemokine family.

8. Full Length PRO288 Polypeptides The present invention provides newly identified and isolated PRO288 polypeptides.
In particular, Applicants have identified and isolated various human PRO288 polypeptides. The properties and characteristics of some of these PRO288 polypeptides are described in further detail in the Examples below. Based on the properties and characteristics of the PRO288 polypeptides disclosed herein, Applicants believe that PRO288 is a member of the TNFR, particularly the receptor for Apo-2 ligand.

9. Full Length PRO365 Polypeptide The present invention provides newly identified and isolated nucleotide sequences that encode a polypeptide referred to in this application as PRO365. In particular, Applicants have identified and isolated cDNA encoding a PRO365 polypeptide, as disclosed in further detail in the Examples below. Using the BLAST and FastA sequence alignment computer programs, Applicants have found that various portions of the PRO365 polypeptide share significant homology with the human 2-19 protein. Therefore, it is now believed that the PRO365 polypeptides disclosed in this application are newly identified members of the human 2-19 protein family.

10. The full-length PRO1361 polypeptide DNA60783-1611 clone was isolated from a human B cell library. To the best of our knowledge, the DNA60783-1611 sequence encodes a novel factor referred to herein as PRO1361; using the WU-BLAST2 sequence alignment computer program, it was revealed that there is no sequence identity with any known protein. It was

11. Full Length PRO1308 Polypeptide WU-BLAST2 Sequence Alignment Using the computer program, PRO13
It has been found that 08 shares some amino acid sequence identity with the amino acid sequence of the follistatin protein designated "S55369" in the Dayhoff database. Therefore, it is now believed that PRO1308 disclosed in this application is a newly identified member of the follistatin protein family and possesses the typical activity or properties of the protein family.

12. Full Length PRO1183 Polypeptide WU-BLAST2 Sequence Alignment Using the computer program, the full length native sequence PRO1183 (shown in Figure 26 and SEQ ID NO: 52) has some amino acid sequence identity with protoporphyrinogen oxidase. I found it. Therefore, it is now believed that PRO1183 disclosed in this application is a newly identified member of the oxidase family and possesses enzymatic activity typical of oxidases.

13. Full Length PRO1272 Polypeptide WU-BLAST2 Sequence Alignment Using the computer program, the full length native sequence PRO1272 (shown in Figure 28 and SEQ ID NO: 54) has some amino acid sequence identity with the cement gland specific protein from Xenopus laevis. It has been found that there is a property. Therefore, PRO1272 disclosed in the present application is now a newly identified member of the XAG family, and XAG
It is believed to share at least one mechanism with proteins.

14. Full Length PRO1419 Polypeptide To the best knowledge, the DNA71290-1630 sequence encodes a novel factor designated herein PRO1419. The WU-BLAST2 sequence alignment computer program was used to reveal minimal sequence identity with known proteins.

15. Full Length PRO4999 Polypeptide Using the ALIGN-2 sequence alignment computer program cited above,
The full length native sequence PRO4999 (shown in Figure 32 and in SEQ ID NO: 55) is UROM_H
It was found to have some degree of amino acid sequence identity with UMAN. Accordingly, the PRO4999 polypeptides disclosed in the present application are now a newly identified member of the uromodulin protein family, and one or more of the biological and / or immunological typical of the protein family. Believed to have activity or properties.

16. The full-length PRO7170 polypeptide DNA108722-2743 clone was isolated from a human library as described in the Examples below. As far as I can tell, DNA108722-274
The 3 nucleotide sequence encodes a novel element designated herein as PRO7170;
The ALIGN-2 sequence alignment computer program was used to reveal no significant sequence identity with any known proteins.

17. Full Length PRO248 Polypeptide The present invention provides a newly identified and isolated nucleotide sequence encoding a polypeptide referred to in this application as PRO248. In particular, Applicants have identified and isolated cDNA encoding a PRO248 polypeptide, as disclosed in further detail in the Examples below. Using known programs, such as the BLAST and FastA sequence alignment computer programs, Applicants have determined that the full-length native sequence PRO2
CDNA encoding 48 (amino acid sequence shown in FIG. 36 and SEQ ID NO: 65)
It was found that the sequence has some amino acid sequence identity with growth differentiation factor 3 from mouse and Homo sapiens. Therefore, it is now believed that the PRO248 polypeptide disclosed in this application is a newly identified member of the transforming growth factor β family and has the growth and differentiation abilities typical of this family.

18. Full Length PRO353 Polypeptide The present invention provides newly identified and isolated nucleotide sequences that encode a polypeptide referred to in this application as PRO353. In particular, Applicants have identified and isolated cDNA encoding a PRO353 polypeptide, as disclosed in further detail in the Examples below. Using the BLAST and FastA sequence alignment computer programs, Applicants have found that various portions of the PRO353 polypeptide share some homology with human and mouse complement proteins.
Thus, the PRO353 polypeptides disclosed in the present application are now a newly identified member of the complement protein family and have the ability to influence inflammatory processes as is typical of complement family proteins. Believe that

19. Full Length PRO1318 and PRO1600 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding the polypeptides referred to in this application as PRO1318 and PRO1600. In particular, Applicants have identified PRO 1318 as disclosed in further detail in the Examples below.
And cDNA encoding the PRO1600 polypeptide have been identified and isolated. BLAS
Using known programs, such as the T and FastA sequence alignment computer programs, Applicants have shown that the full-length native sequences PRO1318 and PRO1600 (shown in Figure 40 and SEQ ID NO: 78, and Figure 42 and SEQ ID NO: 80, respectively).
It has been found that the cDNA sequence encoding) has amino acid sequence identity with one or more chemokines. Therefore, the PRO13 disclosed in this application is now
The 18 and PRO1600 polypeptides are newly identified members of the chemokine family and are believed to have activity typical of the chemokine family.

20. Full Length PRO533 Polypeptide The present invention provides newly identified and isolated nucleotide sequences that encode a polypeptide referred to in this application as PRO533. In particular, Applicants have identified and isolated cDNA encoding a PRO533 polypeptide, as disclosed in further detail in the Examples below. Using the BLAST and FastA sequence alignment computer programs, Applicants have shown that the full-length native sequence PRO533 (shown in Figure 46 and SEQ ID NO: 86) has fibroblast growth factor (FGF) and a Blast score of 509 and an amino acid sequence of 53%. We have found that they have identity. Accordingly, PRO533, as disclosed in the present application, is now believed to be a newly identified member of the fibroblast growth factor family and possess activity typical of such polypeptides.

21. Full-Length PRO301 Polypeptide The present invention provides newly identified and isolated nucleotide sequences that encode a polypeptide referred to in this application as PRO301. In particular, the applicant is
A cDNA encoding a PRO301 polypeptide was identified and isolated, as disclosed in further detail in the Examples below. Using the BLAST and FastA sequence alignment computer programs, Applicants have determined that the full-length native sequence PRO301 (shown in Figure 48 and SEQ ID NO: 91) corresponds to 30% amino acid sequence identity with the human A33 antigen precursor. It was found to have a Blast score. Therefore,
It is now believed that PRO301 disclosed in this application is a newly identified member of the A33 antigen protein family and may be expressed in human neoplastic diseases such as colorectal cancer.

22. Full Length PRO187 Polypeptides The present invention provides newly identified and isolated nucleotide sequences that encode a polypeptide referred to in this application as PRO187. In particular, the applicant is
A cDNA encoding a PRO187 polypeptide was identified and isolated, as disclosed in further detail in the Examples below. Using the BLAST and FastA sequence alignment computer programs, Applicants have found that the full-length native sequence PRO187 (shown in Figure 50) has 74% amino acid identity with various androgen-induced growth factors and FGF-8 and a BLAST score of 310. I found out that Accordingly, the PRO187 polypeptides disclosed in the present application are now believed to be newly identified members of the FGF-8 protein family, with activities or properties typical of the FGF-8-like protein family.

23. Full Length PRO337 Polypeptide The present invention provides newly identified and isolated nucleotide sequences that encode a polypeptide referred to in this application as PRO337. In particular, Applicants have identified and isolated cDNA encoding a PRO337 polypeptide, as disclosed in further detail in the Examples below. Using the BLAST, BLAST-2 and FastA sequence alignment programs, Applicants have shown that the full-length native sequence PRO337 has 97% sequence identity with rat neurotrimin, 85% sequence identity with chicken CEPU, chicken G55 and 73. % Sequence identity, 59% homology with human LAMP, and human OPC
It was found to have 84% homology with AM. Therefore, it is now believed that PRO337 disclosed in this application is a newly identified member of the IgLON subfamily of the immunoglobulin superfamily and possesses neurite outgrowth and differentiable properties.

24. Full Length PRO1411 Polypeptide To the best of our knowledge, the DNA59212-1627 sequence encodes a novel factor designated herein as PRO1411. However, the WU-BLAST2 sequence alignment computer program was used to reveal some degree of sequence identity with known proteins.

25. Full Length PRO4356 Polypeptide WU-BLAST2 Sequence Alignment Using the computer program, the full length native sequence PRO4356 (shown in Figure 56 and SEQ ID NO: 108) is transferred to the metastasis associated GPI.
It was found to have some degree of amino acid sequence identity with the anchor protein. Therefore, it is now believed that PRO4356 disclosed in this application is a newly identified member of the family and shares a similar mechanism.

26. Full Length PRO246 Polypeptide The present invention provides newly identified and isolated nucleotide sequences that encode a polypeptide referred to in this application as PRO246. In particular, the applicant is
A cDNA encoding a PRO246 polypeptide was identified and isolated, as disclosed in further detail in the Examples below. Using the BLAST and FastA sequence alignment computer programs, Applicants have found that a portion of the PRO246 polypeptide has significant homology to the human cell surface protein HCAR. Therefore, it is now believed that the PRO246 polypeptides disclosed in this application are newly identified membrane-bound viral receptors or tumor cell-specific antigens.

27. Full Length PRO265 Polypeptide The present invention provides a newly identified and isolated nucleotide sequence encoding a polypeptide referred to in this application as PRO265. In particular, the applicant is
A cDNA encoding a PRO265 polypeptide was identified and isolated, as disclosed in further detail in the Examples below. Using programs such as the BLAST and FastA sequence alignment computer programs, Applicants have determined that various portions of the PRO265 polypeptide have significant homology to fibromodulin protein and fibromodulin precursor protein. I found it. The Applicant is also PRO
We have found that the DNA encoding the 265 polypeptide has significant homology with platelet glycoprotein V, a member of the leucine-rich repeat protein family involved in skin and wound repair. Accordingly, the PRO265 polypeptide disclosed in the present application is now a newly identified member of the leucine-rich repeat protein family, has the protein-protein binding capacity typical of this family, and is responsible for skin and wound repair. Believed to be involved.

28. Full Length PRO941 Polypeptides The present invention provides newly identified and isolated nucleotide sequences that encode a polypeptide referred to in this application as PRO941. In particular, Applicants have identified and isolated cDNA encoding a PRO941 polypeptide, as disclosed in further detail in the Examples below. Using the BLAST and FastA sequence alignment computer programs, Applicants have found that PRO941 polypeptides have significant similarity to one or more cadherin proteins. Therefore, it is now believed that the PRO941 polypeptides disclosed in this application are newly identified cadherin homologs.

29. Full Length PRO10096 Polypeptides Using the ALIGN-2 sequence alignment computer program cited above, the full length native sequence PRO10096 (shown in Figure 64 and SEQ ID NO: 126) is
It has been found to have some degree of amino acid sequence identity with various interleukin-10 related molecules. Therefore, the PRO10096 disclosed in this application is now
It is believed that the polypeptide is a newly identified IL-10 homolog and possesses one or more biological and / or immunological activities or properties typical of the protein.

30. The full-length PRO6003 polypeptide DNA83568-2692 clone was isolated from a human fetal kidney library as described in the Examples below. As far as I can tell, DNA83568-2
The 692 nucleotide sequence encodes a novel factor referred to herein as PRO6003; using the ALIGN-2 sequence alignment computer program, it was revealed that there was no significant sequence identity with any known protein.

B. PRO Polypeptide Variants In addition to the full-length native sequence PRO polypeptides described herein, PRO variants could also be prepared. PRO variants can be prepared by introducing appropriate nucleotide changes into PRO DNA, or by synthesizing the desired PRO polypeptide. One of ordinary skill in the art will appreciate that amino acid changes, such as changes in the number or position of glycosylation sites or changes in membrane anchoring properties, can alter post-translational processes of PRO. Mutations in the native full-length sequence PRO or in various domains of the PROs described herein can be made using any technique and guideline for conservative and non-conservative mutations described, for example, in US Pat. No. 5,364,934. it can. Mutation is the native sequence P
It may be a substitution, deletion or insertion of one or more codons encoding PRO which will result in a change in the amino acid sequence of PRO compared to RO. In some cases, the mutation is the replacement of at least one amino acid with any other amino acid in one or more domains of PRO. The guideline for which amino acid residue is inserted, substituted or deleted without adversely affecting the desired activity is to compare the sequence of PRO with that of a known homologous protein molecule and to show a region of high homology. It is found by minimizing the number of amino acid sequence changes made. Amino acid substitutions can be the result of substitutions of one amino acid for another amino acid with similar structural and / or chemical properties, eg, replacement of leucine with serine, a conservative amino acid substitution. Insertions and deletions can optionally be in the range of about 1 to 5 amino acids. Permissible mutations are determined by systematically making amino acid insertions, deletions or substitutions in the sequence and testing the resulting mutants for the activity exhibited by the full-length or mature native sequence.

PRO polypeptide fragments are provided herein. Such fragments may be truncated at the N-terminus or C-terminus, or may lack internal residues, for example, when compared to the full length native protein. Certain fragments lack amino acid residues that are not essential for the desired biological activity of the PRO polypeptide. PRO fragments can be prepared by any of many common techniques. The desired peptide fragment may be chemically synthesized. Alternative methods include enzymatic digestion, for example by treating the protein with enzymes known to cleave the protein at sites defined by specific amino acid residues, or by digesting the DNA with appropriate restriction enzymes. Including the generation of PRO fragments by isolating the fragments. Yet another suitable technique involves isolating and amplifying a DNA fragment encoding the desired polypeptide fragment by polymerase chain reaction (PCR). Oligonucleotides that define the desired ends of the DNA fragments are used in the 5'and 3'primers of PCR.
Preferably, PRO polypeptide fragments share at least one biological and / or immunological activity with the native PRO polypeptide disclosed herein. In particular embodiments, conservative substitutions of interest are shown in Table 6 under the heading of preferred substitutions. If such a substitution results in a change in biological activity, a more substantial change is introduced and the product screened, designated as a substitution example in Table 6 or as further described below with respect to amino acid classification. To be done.

Substantial modification of the function or immunological identity of a PRO polypeptide can be accomplished by (a) structure of the polypeptide backbone of the substitution region, eg sheet or helical arrangement, (b) charge or hydrophobicity of the molecule at the target site. , Or (c) while maintaining the bulk of the side chains, by selecting substituents that are substantially different in their effect. Naturally occurring residues can be grouped based on common side chain properties: (1) hydrophobicity: norleucine, met, ala, val, leu, ile; (2) neutral hydrophilicity: cys, ser, thr; (3) Acidity: asp, glu; (4) Basicity: asn, gln, his, lys, arg; (5) Residues affecting chain orientation: gly, pro; and (6) aromatic : Trp, tyr, phe. Non-conservative substitutions will entail exchanging a member of one of these classes for another class. Residues so substituted can also be introduced at conservative substitution sites, preferably left-over (non-conserved) sites. Mutations can be made using techniques known in the art such as oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed mutagenesis [Carter et al., Nucl. Acids Res.
, 13: 4331 (1986); Zoller et al., Nucl. Acids Res., 10: 6487 (1987)], cassette mutagenesis [Wells et al., Gene, 34: 315 (1985)], restriction selective mutagenesis [W.
ells et al., Philos. Trans. R. Soc. London SerA, 317: 415 (1986)] or other well known techniques can be performed on the cloned DNA to produce PRO mutant DNA. Also, scanning amino acid analysis can be used to identify one or more amino acids along a flanking sequence. The preferred scanning amino acids are relatively small, neutral amino acids. Such amino acids include alanine, glycine,
Contains serine and cysteine. Alanine is typically the preferred scanning amino acid in this group because it excludes side chains above the beta carbon and does not alter the backbone structure of the mutant [Cuningham and Wells, Science, 244: 1081-1085]. (198
9)]. Also, alanine is typically preferred because it is the most common amino acid. Moreover, it is often found in both buried and exposed locations [Crei
ghton, The Proteins, (WH Freeman & Co., NY); Chothia, J. Mol. Biol.,
150: 1 (1976)]. If alanine substitution does not yield a sufficient amount of variant, an isoteric amino acid can be used.

C. Modifications of PRO Covalent modifications of PRO are included within the scope of this invention. One type of covalent modification involves reacting a targeted amino acid residue of a PRO polypeptide with an organic derivatizing reagent capable of reacting with a selected side chain of PRO or an N- or C-terminal residue.
Derivatization with a bifunctional reagent is useful, for example, to crosslink PRO to a water-insoluble support matrix or surface for use in a method of purifying anti-PRO antibodies or vice versa. A commonly used cross-linking agent is, for example, 1,1-bis (diazoacetyl) -2
-Homobifunctional imide esters, including phenylethane, glutaraldehyde, N-hydroxysuccinimide esters such as 4-azidosalicylic acid, disuccinimidyl esters such as 3,3'-dithiobis (succinimidyl propionate), bis -N-maleimide-1,2-functional maleimides such as 8-octane, and methyl-
Includes reagents such as 3-[(p-azidophenyl) -dithio] propioimidate. Other modifications include deamination of glutaminyl and asparaginyl residues to the corresponding glutamyl and aspartyl residues, hydroxylation of proline and lysine,
Phosphorylation of hydroxyl group of ceryl or threonyl residue, lysine, arginine,
And histidine side chain α-amino group methylation [TE Creighton, Proteins: Stru
cture and Molecular Properties, WH Freeman & Co., San Francisco, pp.79
-86 (1983)], acetylation of N-terminal amines, and amidation of optional C-terminal carboxyl groups.

Other types of covalent modifications of the PRO polypeptide included within the scope of this invention include:
Includes alteration of the native glycosylation pattern of the polypeptide. By "altering the native glycosylation pattern" is intended for this purpose the deletion of one or more carbohydrate moieties found in the native sequence PRO (elimination of existing glycosylation sites or chemical and / or enzymatic). And / or by the addition of one or more glycosylation sites not present in the native sequence PRO.
In addition, this clause includes qualitative changes in glycosylation of native proteins, including changes in the properties and properties of the various carbohydrate moieties present. Addition of glycosylation sites to the PRO polypeptide may be accomplished by altering the amino acid sequence. This modification may be made, for example, by the addition or substitution of one or more serine or threonine residues to the native sequence PRO (O-linked glycosylation site). The PRO amino acid sequence may optionally have changes at the DNA level, especially
It may be altered through mutating the DNA encoding the PRO polypeptide at preselected bases to produce codons which are translated into the desired amino acid.

Another means of increasing the number of carbohydrate moieties on the PRO polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide. Such methods are described in the art, for example WO 87/05330, published September 11, 1987, and Aplin.
And Wriston, CRC Crit. Rev. Biochem., Pp. 259-306 (1981). Removal of carbohydrate moieties present on the PRO polypeptide may be accomplished chemically or enzymatically, or by mutational substitution of codons encoding amino acid residues presented as targets for glycosylation. Chemical deglycosylation techniques are known in the art, eg Hakimuddin et al., Arch. Biochem. Biophys., 259: 5.
2 (1987) and by Edge et al., Anal. Biochem., 118: 131 (1981). Enzymatic cleavage of carbohydrate moieties on polypeptides is described by Thotakura et al., Meth.
This is accomplished by using various endo and exoglycosidases, as described in Enzymol. 138: 350 (1987). Another type of covalent modification of PRO is US Pat. No. 4,640,835 to PRO polypeptides to one of a variety of non-proteinaceous polymers such as polyethylene glycol (PEG), polypropylene glycol, or polyoxyalkylenes. ; 4,496
, 689; No. 4,301,144; No. 4,670,417; No. 4,791,192 or No. 4,179,337.

The PROs of the invention may also be modified in a way to form chimeric molecules containing the PRO fused to another heterologous polypeptide or amino acid sequence. In one embodiment, such a chimeric molecule comprises a fusion of PRO with a tag polypeptide that provides an epitope to which an anti-tag antibody can selectively bind. The epitope tag is generally located at the amino or carboxyl terminus of PRO. The presence of such epitope-tagged forms of PRO can be detected using an antibody against the tag polypeptide. Also, provision of the epitope tag allows the PRO to be readily purified by affinity purification using an anti-tag antibody or another type of affinity matrix that binds to the epitope tag. Various tag polypeptides and their respective antibodies are well known in the art. An example is poly-histidine (poly
-his) or poly-histidine-glycine (poly-his-gly) tag; flu HA tag polypeptide and its antibody 12CA5 [Field et al., Mol. Cell. Biol., 8: 2159-2165 (1988).
)]; C-myc tag and its corresponding 8F9, 3C7, 6E10, G4, B7 and 9
E10 antibody [Evan et al., Molecular and Cellular Biology, 5: 3610-3616 (1985)]
And herpes simplex virus glycoprotein D (gD) tag and its antibody [Paborsky et al.
, Protein Engineering, 3 (6): 547-553 (1990)]. Other tag polypeptides are flag peptides [Hopp et al., BioTechnology, 6: 1204-1210 (1988)]; KT
3-epitope peptide [Martin et al., Science, 255: 192-194 (1992)]; α-tubulin epitope peptide [Skinner et al., J. Biol. Chem., 266: 15163-15166 (19)
91)]; and T7 gene 10 protein peptide tag [Lutz-Freyermuth et al., Proc
Natl. Acad. Sci. USA, 87: 6393-6397 (1990)]. In an alternative embodiment, the chimeric molecule may comprise a fusion of PRO with an immunoglobulin or a particular region of an immunoglobulin. For the bivalent form of the chimeric molecule (also referred to as the "immunoadhesin"), such a fusion is an F molecule of an IgG molecule.
It can be the c region. The Ig fusion preferably solubilizes the PRO polypeptide in place of at least one variable region within the Ig molecule (transmembrane domain deletion or inactivation).
Including morphology. In a particularly preferred embodiment, the immunoglobulin fusion comprises the hinge, CH2 and CH3, or hinge, CH1, CH2 and CH3 regions of an IgG1 molecule. See US Pat. No. 5,428,130 issued Jun. 27, 1995 for the preparation of immunoglobulin fusions.

D. Preparation of PRO The following description primarily relates to methods of producing PRO by culturing cells transformed or transfected with a vector containing PRO nucleic acid. Of course, it is contemplated that PRO may be prepared using other methods well known in the art. For example, the PRO sequence, or a portion thereof, may be produced by direct peptide synthesis using solid phase techniques [eg, Stewart et al., Solid-Phase Pepti.
de Synthesis, WH Freeman Co., San Francisco, CA (1969); Merrifield, J.
Am. Chem. Soc., 85: 2149-2154 (1963)]. In vitro protein synthesis may be performed by manual techniques or by automation. Automated synthesis may be performed, for example, using an Applied Biosystems Peptide Synthesizer (Foster City, CA) according to the manufacturer's instructions. Various portions of PRO may be chemically synthesized separately and combined using chemical or enzymatic methods to produce full-length PRO.

1. Isolation of PRO-encoding DNA PRO-encoding DNA can be obtained from a cDNA library prepared from tissue that possesses PRO mRNA and is suspected of expressing it at detectable levels. Therefore, human PRO DNA can be conveniently obtained from a cDNA library prepared from human tissue, as described in the Examples. In addition, PRO-encoding genes can be prepared from genomic libraries or by known synthetic methods (
For example, it can also be obtained by automated nucleic acid synthesis). The library can be screened with probes (such as antibodies to PRO or oligonucleotides of at least about 20-80 bases) designed to identify the gene of interest or the protein encoded by the gene.
Screening of cDNA or genomic libraries with selected probes is described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Col.
d Spring Harbor Laboratory Press, 1989) can be carried out using standard procedures. Another method for isolating the gene encoding the PRO polypeptide is by using the PCR method [Sambrook et al., Supra; Dieffenbach et al.
, PCR Primer: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1
995)].

The examples below describe techniques for screening a cDNA library. The oligonucleotide sequence selected as a probe should be of sufficient length and sufficiently unambiguous that false positives are minimized. The oligonucleotide is
Preferably it is detectably labeled upon hybridisation with the DNA in the library to be screened. Methods of labeling are well known in the art and include the use of radiolabels such as ³² P labeled ATP, biotinylation or enzyme labeling. Hybridization conditions, including moderate and high stringency, are given in Sambrook et al., Supra. Sequences identified in such library screening methods are Genban
It can be compared and aligned with known sequences that have been deposited in public databases such as k or private sequence databases and are available to the public. Sequence identity (either at the amino acid or nucleotide level) within a determined region or over the entire length of a molecule can be determined using methods known in the art and described herein. . A nucleic acid having a protein coding sequence was used for the first time in the deduced amino acid sequence disclosed herein and, if necessary, in Sambrook et al. Obtained by screening the selected cDNA or genomic library using conventional primer extension methods as described.

2. Selection and Transformation of Host Cells Host cells are transfected or transformed with the expression or cloning vectors described herein for the production of PRO, inducing promoters, selecting transformants, or encoding the desired sequences. The cells are cultured in a conventional nutrient medium which has been appropriately modified to amplify the gene. Culture conditions such as medium, temperature, pH, etc. can be selected by those skilled in the art without undue experimentation. In general, principles, protocols, and practical techniques for maximizing cell culture productivity are described in Mammalian Cell Biotechnology: a
Practical Approach, edited by M. Butler (IRL Press, 1991) and Sambrook et al., Supra. How prokaryotic cell transfection and eukaryotic cell transformation, e.g., CaCl _2, CaPO _4, liposome-mediated and electroporation are known to those skilled in the art. Depending on the host cell used, transformation is done using standard methods appropriate to the cell. Calcium treatment with calcium chloride or electroporation as described in Sambrook et al., Supra, is generally used for prokaryotes. Infection by Agrobacterium tumefaciens was reported by Shaw et al., Ge
ne, 23: 315 (1983) and WO 89/05859 published June 29, 1989 and used for the transformation of certain plant cells. For such mammalian cells without a cell wall, the calcium phosphate precipitation method of Graham and van der Eb, Virology, 52: 456-457 (1978) can be used. General aspects of mammalian cell host system transformations have been described in US Pat. No. 4,399,216. Transformation into yeast is typically performed by Van Solingen et al., J. Bact., 130: 946 (1977) and Hsiao.
Et al., Proc. Natl. Acad. Sci. USA, 76: 3829 (1979).
However, other methods of introducing DNA into cells, such as nuclear microinjection, electroporation, intact cells, or bacterial protoplast fusion using polycations such as polybrene, polyornithine and the like can also be used. See Keown for various techniques for transforming mammalian cells.
Et al., Methods in Enzymology, 185: 527-537 (1990) and Mansour et al., Nature, 336.
: 348-352 (1988).

Suitable host cells for cloning or expressing the DNA in the vectors described herein are prokaryote, yeast, or higher eukaryote cells. Suitable prokaryotes include, but are not limited to, eubacteria, such as Gram-negative or Gram-positive organisms, for example, Enterobacteriaceae such as E. coli. Various E. coli strains are publicly available, for example E. coli K12 strain MM294 (ATCC31,446); E. coli X1776 (A
TCC31,537); E. coli strains W3110 (ATCC27,325) and K5772 (ATCC53,635). Other preferred prokaryotic host cells are E. coli, such as E. coli, Enterobacter, Erwinia, Klebsiella, Proteu.
s), Salmonella, for example, Salmonella typhimurium, Serratia, for example, Serratia marcescans, and Shigella, and bacilli, such as B. subtilis and B. licheniformis (for example,
Basiliricheniformis 41P described in DD 266,710 issued on April 12, 1989)
, Pseudomonas, for example, Pseudomonas aeruginosa and Enterobacteriaceae such as Streptomyces. These examples are illustrative rather than limiting. Strain W3110 is one particularly preferred host or parent host as it is a common host strain for recombinant DNA production and publishing. Preferably, the host cell secretes a minimal amount of proteolytic enzyme. For example, strain W3110 may be modified to make a genetic mutation in a gene encoding a protein that is foreign to the cell, and an example of such a host is the complete genotype t.
E. coli W3110 strain 1A2 with onA; complete genotype tonA ptr3
E. coli W3110 strain 9E4; complete genotype tonA prt3 ph
oA E15 (argF-lac) 169 degP ompT kan ^r E. coli W3110 strain 27C7 (ATCC 55,244); complete genotype tonA pt
r3 phoA E15 (algF-lac) 169 degP ompT r
coli W3110 strain 37D6 having Bs7ilvGkan ^r; a and 1990 August 7 issued U.S. Patent mutant periplasmic protease disclosed in US 4,946,783; non kanamycin resistant degP deletion E. coli W3110 strain mutation is 37D6 strain with 40B4 E. coli strains that have. Alternatively, in vitro methods of cloning such as PCR or other nucleic acid polymerase reactions are preferred.

In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for PRO polypeptide-encoding vectors. Saccharomyces cerevisiae is a commonly used lower eukaryotic host microorganism. In addition, Schizosaccharomyces prombe (Beach and Nurs
e, Nature, 290: 140 [1981]; EP 139,383 published May 2, 1985; Kluveromyces hosts (U.S. Pat. No. 4,943,529; Fleer et al., Bio / Technol).
ogy, 9: 968-975 (1991)), for example K. lactis (MW98-8C, CBS683).
, CBS4574; Louvencourt et al., J. Bacteriol. 154 (2): 737-742 [1983]), K.
K. fragilis (ATCC 12,424), K. bulgaricus (
ATCC 16,045), K. wickeramii (ATCC 24,178), K. waltii (ATCC 56,500), K. drosophilarum (A.
TCC 36,906; Van den Berg et al., Bio / Technology, 8: 135 (1990)), K. themotolerans and K. marxianus; yarrowia (EP 402,226); pitcher path Tris (Pichia pastoris) (EP 183,0
70; Sheekrishna et al., J. Basic Microbiol, 28: 265-278 [1988]); Candida; Trichodel Malaysia (reesia) (EP 244, 234); Panax mold (Case et al., Proc. Natl.
Acad. Sci. USA, 76: 5259-5263 [1979]); schwanniomyce
s), for example Schwanniomyces occidentalis (October 31, 1990).
EP 394,538); and filamentous fungi, such as Neurospora, Penicillium, Tolypocladium (WO 91/00357, published January 10, 1991); Ballance et al., Biochem. Biophys. Res. Commun
., 112: 284-289 [1983]; Tilburn et al., Gene, 26: 205-221 [1983]; Yelton et al., P.
roc. Natl. Acad. Sci. USA, 81: 1470-1474 [1984]) and black mold (Kelly and Hy.
nes, EMBO J., 4: 475-479 [1985]). Preferred methylotropic yeasts here consist of, but are not limited to, Hansenula, Candida, Kloeckera, Pichia, Saccharomyces, Torulopsis, and Rhodotorula. It includes a yeast capable of growing in methanol selected from the genus. A list of specific species that are exemplary of this yeast class is set forth in C. Anthony, The Biochemistry of Methylotrophs, 269 (1982).

Suitable host cells for the expression of glycosylated PRO are derived from multicellular organisms.
Examples of invertebrate cells include insect cells such as Drosophila S2 and Spodaspera Sf9, as well as plant cells. Examples of useful mammalian host cell lines include Chinese Hamster Ovary (CHO) and COS cells. Many specific examples are monkey kidney CV1 strains transformed with SV40 (COS-7, ATCC CRL 1651);
Human embryonic kidney strain (293 or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen Virol., 36:59 (1977)); Chinese hamster ovary cells / -DHFR (CHO , Urlaub and Chasin, Proc. Natl. Acad. Sci. USA, 77: 4216 (
1980)); mouse Sertoli cells (TM4, Mather, Biol. Reprod., 23: 243-251 (1980)
)) Human lung cells (W138, ATCC CCL 75); human hepatocytes (Hep G2, HB 8065); and mouse breast tumor cells (MMT 060562, ATTC CCL51). Selection of an appropriate host cell is
Within the common general knowledge of this field.

3. Selection and Use of Replicable Vectors A nucleic acid encoding PRO (eg, cDNA or genomic DNA) is inserted into a replicable vector for cloning (amplification of DNA) or expression. Various vectors are publicly available. The vector can be in the form of, for example, a plasmid, cosmid, viral particle, or phage. The appropriate nucleic acid sequence is
It is inserted into the vector by various techniques. Generally, the DNA is inserted into the appropriate restriction endonuclease sites using techniques well known in the art. Vector components generally include, but are not limited to, one or more signal sequences, origins of replication, one or more marker genes, enhancer elements, promoters, and transcription termination sequences. Construction of suitable vectors containing one or more of these components employs standard ligation techniques known to those of ordinary skill in the art. PRO is not only directly produced by recombinant techniques, but also as a fusion peptide with a heterologous polypeptide which is a signal sequence or a mature protein or another polypeptide having a specific cleavage site at the N-terminus of the polypeptide. Is also produced. Generally, the signal sequence is a component of the vector or part of the PRO-encoding DNA that is inserted into the vector. The signal sequence may be, for example, a prokaryotic signal sequence selected from the group of alkaline phosphatase, penicillinase, lpp or thermostable enterotoxin II leaders. For yeast secretion, the signal sequence is a yeast invertase leader, alpha factor leader (including yeast (Saccharomyces) and Kluyveromyces alpha factor leaders, the latter being described in U.S. Pat.No. 5,010,182). , Or acid phosphatase leader, white body (C. albicans) glucoamylase leader (EP362 published April 4, 1990).
179), or the signal described in WO 90/13646 published on November 15, 1990. In mammalian cell expression, mammalian signal sequences may be used for the direct secretion of proteins such as signal sequences from secreted polypeptides of the same or related species, as well as viral secretory leaders.

Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells. Such sequences are common to many bacteria,
It is well known for yeasts and viruses. The origin of replication derived from plasmid pBR322 is suitable for most Gram-negative bacteria, the 2μ plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are mammalian. It is useful as a cloning vector in animal cells. Expression and cloning vectors typically contain a selection gene, also termed a selectable marker. Typical selection genes are (a) ampicillin, neomycin,
Not resistant to antibiotics or other toxins such as methotrexate or tetracycline, (b) supplementing auxotrophic defects, or (c) obtained from complex media such as the gene code D-alanine racemase for Bacillus It encodes a protein that supplies important nutrients. Examples of suitable selectable markers for mammalian cells are those that can identify cellular components capable of incorporating PRO-encoding nucleic acid, such as DHFR or thymidine kinase. Suitable host cells using wild type DHFR are:
CHO cell lines deficient in DHFR activity prepared and propagated as described by Urlaub et al., Proc. Natl. Acad. Sci. USA, 77: 4216 (1980). A preferred selection gene for use in yeast is the trp1 gene present in the yeast plasmid YRp7 [Stinchcomb et al., Nature, 282: 39 (1979); Kingman et al.,
Gene, 7: 141 (1979); Tschemper et al., Gene, 10: 157 (1980)]. The trp1 gene provides a selectable marker for mutant strains of yeast lacking the ability to grow in tryptophan, such as ATCC No. 44076 or PEP4-1 [Jones, Genetics, 85:12 (1977)].

Expression and cloning vectors usually contain a promoter operably linked to the PRO-encoding nucleic acid sequence to control mRNA synthesis. Promoters recognized by a variety of possible host cells are known. Suitable promoters for use in prokaryotic hosts include the β-lactamase and lactose promoter systems [Cahng et al., Na
ture, 275: 615 (1978); Goeddel et al., Nature, 281: 544 (1979)], alkaline phosphatase, tryptophan (trp) promoter system [Goeddel, Nucleic Acids Re
s., 8: 4057 (1980); EP 36,776], and hybrid promoters such as ta.
c promoter [deBoer et al., Proc. Natl. Acad. Sci. USA, 80: 21-25 (1983)]
including. Promoters used in bacterial systems also have a Shine-Dalgarno (SD) sequence operably linked to the DNA encoding PRO. Examples of suitable promoter sequences for use with yeast hosts include 3-phosphoglycerate kinase [Hitzeman et al., J. Biol. Chem., 255: 2073 (1980)] or other glycolytic enzymes [Hess et al., J. Adv. Enzyme Reg., 7: 149 (1968); Holland, Biochem
istry, 17: 4900 (1978)], for example, enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, Pyruvate kinase, trioselate isomerase, phosphoglucose isomerase, and glucokinase are included. Other yeast promoters are inducible promoters that have the additional effect of transcription being regulated by growth conditions, such as alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, metallothionein, glycerin. There are promoter regions for aldehyde-3-phosphate dehydrogenase and enzymes that control the utilization of maltose and galactose. Vectors and promoters suitable for expression in yeast are further described in EP 73,657. PRO transcription from a vector in mammalian host cells can be performed, for example, by polyomavirus, infectious epithelioma virus (UK 2,211,504 published July 5, 1989), adenovirus (eg adenovirus 2), bovine papilloma virus, avian virus. Sarcoma virus,
Cytomegalovirus, retrovirus, hepatitis B virus and simian virus 4
0 (SV40), a promoter derived from the genome of a virus, a heterologous mammalian promoter such as an actin promoter or an immunoglobulin promoter,
And promoters derived from heat shock promoters, as long as such promoters are compatible with the host cell line.

Transcription of the DNA encoding the desired PRO by higher eukaryotes can be enhanced by inserting an enhancer sequence into the vector. Enhancers, usually about 10 to 300 base pairs, are cis-acting elements of DNA that act on promoters to enhance their transcription. Many enhancer sequences from mammalian genes are currently known (globin, elastase, albumin, α-fetoprotein and insulin). However, typically enhancers from eukaryotic viruses will be used. Examples include the SV40 enhancer on the late side of the replication origin (100-270 base pairs), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and the adenovirus enhancer. The enhancer can be spliced into the vector at the 5'or 3'positions of the PRO coding sequence, but is preferably located 5'from the promoter. Expression vectors for use in eukaryotic host cells (yeast, fungi, insects, plants, animals, humans, or nucleated cells from other multicellular organisms) also include termination of transcription and mRNA.
It also contains the sequences required for the stabilization of Such sequences are used in eukaryotic or viral DNs.
It can be obtained from the A or cDNA, usually 5'and sometimes 3'untranslated regions. These regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding PRO. Other methods suitable for adapting the synthesis of PRO in recombinant vertebrate cell culture,
Vectors and host cells are described in Gething et al., Nature, 293: 620-625 (1981); Mantei et al.,
Nature, 281: 40-46 (1979); EP 117,060; and EP 117,058.

4. Detection of Gene Amplification / Expression Amplification and / or expression of a gene can be carried out using appropriately labeled probes based on the sequence provided herein, for example, conventional Southern blotting, Northern quantifying mRNA transcription. Blotting [Thomas, Proc. Natl. Acad. Sci. USA, 77:52
01-5205 (1980)], the dot blot method (DNA analysis), or the in situ hybridization method, and can be directly measured in the sample. Alternatively, DNA
It is also possible to use an antibody capable of recognizing a specific double strand, including a double strand, an RNA double strand and a DNA-RNA hybrid double strand or a DNA-protein double strand. The antibody can then be labeled and the assay performed, wherein the duplex is surface bound, such that the antibody bound to the duplex at the time of surface duplex formation. Presence can be detected. Alternatively, gene expression can also be measured by immunological methods that directly quantitate the expression of the gene product, such as immunohistochemical staining of cells or tissue sections and cell culture or body fluid assays. Antibodies useful for immunohistochemical staining and / or assay of sample fluids may be monoclonal or polyclonal and can be prepared in any mammal. Conveniently, the antibody is directed against the native sequence PRO polypeptide, or against a synthetic peptide based on the DNA sequences provided herein, or fused to PRO DNA and the exogenous sequence encoding a specific antibody epitope. Can be prepared for.

5. Purification of Polypeptides Forms of PRO can be recovered from culture medium or lysates of host cells. If membrane-bound, it can be detached from the membrane using a suitable wash (eg Triton-X100) or enzymatic cleavage. The cells used to express PRO can be disrupted by various chemical or physical means such as freeze-thaw cycling, sonication, mechanical disruption, or cell lysing agents. It may be desirable to purify PRO from recombinant cell proteins or polypeptides. Purified by the following procedure, which is an example of a suitable purification procedure: Fractionation on an ion exchange column; ethanol precipitation; reverse phase HPLC; chromatography on silica or cation exchange resins such as DEAE; chromatofocusing; SDS.
-PAGE; ammonium sulfate precipitation; gel filtration using eg Sephadex G-75; Protein A Sepharose column to remove contaminants such as IgG; and PR
Metal chelation column that binds the epitope-tagged form of O. Known in the art, eg Deutcher, Methodes in Enzymology, 182 (1990); Scopes, Pr
otein Purification: Principles and Practice, Springer-Verlag, New York (
Many protein purification methods described in 1982) can be used. The purification process chosen will depend, for example, on the production method used and the nature of the particular PRO produced.

E. Uses of PRO Nucleotide sequences encoding PRO (or their complements) have been used in a variety of areas in molecular biology, including use as hybridization probes, in chromosome and gene mapping, and in the production of antisense RNA and DNA. Has uses. In addition, PRO nucleic acid is also a PR produced by the recombinant techniques described herein.
It may be useful in the preparation of O polypeptides. The full-length native sequence PRO gene, or a portion thereof, may be the isolation of full-length PRO cDNA or other genes having the desired sequence identity to the PRO sequences disclosed herein (eg, naturally occurring variants of PRO or other Can be used as a hybridization probe for a cDNA library for the isolation of (PRO encoding from species). In some cases, the length of the probe is about 20 to about 50 bases. Hybridization probes may be derived, at least in part, from novel regions of the full-length native nucleotide sequence, which regions, without undue experimentation, contain the genome of the promoter, enhancer component and intron of native sequence PRO. It can be derived from the sequence. For example, a screening method involves isolating the coding region of the PRO gene using known DNA sequences to synthesize a selected probe of about 40 bases. Hybridization probes can be labeled with a variety of labels, including radioactive nucleotides such as ³² P or ³⁵ S, or enzyme labels such as alkaline phosphatase attached to the probe via the avidin / biotin binding system. The labeled probe having a sequence complementary to the PRO gene of the present invention includes human cDNA and genomic DN.
It can be used to screen a library of A or mRNA and determine which members of that library hybridize to the probe. Hybridization techniques are described in further detail in the examples below.

Any EST sequence disclosed in this application can be used as a probe in the methods described herein. Other useful fragments of PRO nucleic acid include target PRO mRNA (sense) or PRO D
Antisense or sense oligonucleotides, including antisense or sense oligonucleotides containing single-stranded nucleic acid sequences (either RNA or DNA) capable of binding to NA (antisense) sequences, according to the invention, code for PRO DNA. Includes a fragment of the activated region. Such fragments generally contain at least about 14 nucleotides, preferably about 14 to 30 nucleotides. The ability to induce antisense or sense oligonucleotides, based on the cDNA sequence encoding a given protein, has been described, for example, by Stein and Cohen (Cancer Res. 48: 2659: 1988) and va.
n der Krol et al. (BioTechniques 6: 958, 1988). Binding of the antisense or sense oligonucleotide to the target nucleic acid sequence results in the formation of a duplex, which is one of several methods including promoting duplex degradation, premature termination of transcription or translation, or Other methods prevent transcription or translation of the target sequence. Thus, antisense oligonucleotides are used to block the expression of PRO proteins. Antisense or sense oligonucleotides are modified sugars
-Further comprising an oligonucleotide having a phosphodiester backbone (or other sugar bond, such as those described in WO 91/06629), such sugar bond being resistant to an endogenous nuclease. Oligonucleotides with such resistant sugar bonds are stable in vivo (ie, can withstand enzymatic degradation) but retain sequence specificity for binding to the target nucleotide sequence.

Other examples of sense or antisense oligonucleotides are organic moieties, such as those described in WO 90/10048, and other moieties that enhance the affinity of the oligonucleotide for the target nucleic acid sequence, eg It contains an oligonucleotide covalently linked to poly- (L-lysine). Furthermore, an intercalating agent such as ellipticine, an alkylating agent, or a metal working substance may be bound to the sense or antisense oligonucleotide to modify the binding specificity of the antisense or sense oligonucleotide to the target nucleotide sequence. Antisense or sense oligonucleotides can be prepared, for example, by CaPO ₄ -mediated D
By any gene conversion method including NA transfection, electroporation, or by using a gene conversion vector such as Epstein-Barr virus
It is introduced into cells containing the target nucleic acid sequence. In a preferred method, the antisense or sense oligonucleotide is inserted into a suitable retroviral vector. Cells containing the target nucleic acid sequence are contacted with the recombinant retroviral vector in vivo or ex vivo. Suitable retroviral vectors include, but are not limited to, those derived from the murine retrovirus M-MuLV, N2 (retrovirus derived from M-MuLV), or double named DCT5A, DCT5B and DCT5C. Includes a copy vector (see WO 90/13641). The sense or antisense oligonucleotides may also be introduced into cells containing the target nucleotide sequence by forming a complex with a ligand binding molecule, as described in WO 91/04753. Suitable ligand binding molecules include, but are not limited to, cell surface receptors, growth factors, other cytokines, or other ligands that bind to cell surface receptors. Preferably, the complexing of the ligand-binding molecule substantially limits the ability of the ligand-binding molecule to bind to its corresponding molecule or receptor, or prevent the sense or antisense oligonucleotide or complex thereof from entering the cell. Do not block. Alternatively, sense or antisense oligonucleotides may be introduced into cells containing the target nucleic acid sequence by formation of an oligonucleotide-lipid complex, as described in WO 90/10448. The sense or antisense oligonucleotide-lipid complex is preferably degraded intracellularly by endogenous lipase.

Antisense or sense RNA or DNA molecules generally have a length of at least about 5 bases, about 10 bases, about 15 bases, about 20 bases, about 25 bases, about 30 bases, about 35 bases. Long, about 40 bases, about 45 bases, about 50 bases, about 55 bases, about 60 bases, about 65 bases, about 70 bases, about 75 bases, about 80 bases,
It is about 85 bases long, about 90 bases long, about 95 bases long, about 100 bases long, or longer. The probe can also be used in PCR techniques to generate a pool of sequences for the identification of closely related PRO coding sequences. The nucleotide sequence encoding PRO can also be used to make hybridization probes for mapping the gene encoding the PRO and for genetic analysis of individuals with genetic disorders. The nucleotide sequences provided herein can be mapped to chromosomes and specific regions of chromosomes using well-known techniques such as in situ hybridization, binding analysis for known chromosomal markers, and hybridization screening in libraries. . When the PRO coding sequence encodes a protein that binds to another protein
If (eg, PRO is a receptor), PRO can be used in an assay to identify other proteins or molecules involved in the binding interaction. By such a method, inhibitors of receptor / ligand binding interactions can be identified. Proteins involved in such binding interactions can also be used to screen peptides or small molecule inhibitors or agonists of binding interactions. The receptor PRO can also be used to isolate related ligands. Screening assays are designed for the discovery of lead compounds that mimic the biological activity of native PRO or a receptor for PRO. Such screening assays are also used in high throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates. Small molecules considered include synthetic organic or inorganic compounds. The assays are performed in a variety of formats including protein-protein binding assays, biological screening assays, immunoassays and cell-based assays that are well known and characterized in the art.

Nucleic acids encoding PRO or any modified form thereof can also be used to produce transgenic or "knockout" animals, which are useful in the development and screening of therapeutically useful reagents. is there. A transgenic animal (eg, mouse or rat) is an animal that has cells that contain the transgene introduced prenatally, eg, at the embryonic stage, into the animal or an ancestor of the animal. What is a transgene?
It is DNA that has been integrated into the genome of the cell in which a transgenic animal develops.
In one embodiment, the PRO-encoding cDNA is prepared by established techniques.
, And the genomic sequence can be used to produce transgenic animals having cells expressing PRO-encoding DNA. Methods for producing transgenic animals, especially certain animals such as mice or rats, are routine in the art and are described, for example, in US Pat. Nos. 4,736,866 and 4,870,009. Typically, particular cells are targeted for the introduction of the PRO transgene with tissue-specific enhancers. Transgenic animals containing a copy of the PRO-encoded transgene introduced into the germline of the animal at the embryonic stage can be used to investigate the effects of increased expression of DNA encoding PRO. Such animals can be used, for example, as tester animals for reagents that would provide protection against pathological conditions associated with their overexpression. In this aspect of the invention, treatment of an animal with a reagent and a lower incidence of the pathological condition as compared to untreated animals carrying the transgene indicates a potential therapeutic treatment for the pathological condition. . Alternatively, the non-human homolog of PRO is a defective PRO encoding by homologous recombination between a modified genomic DNA encoding PRO introduced into an animal embryonic stem cell and an endogenous gene encoding PRO. Alternatively, it can be used to create PRO "knockout" animals with altered genes. For example, c that encodes PRO
The DNA can be used to clone genomic DNA encoding PRO according to established techniques. A portion of the genomic DNA encoding PRO may be deleted or replaced with another gene, such as the gene encoding the selectable marker used to monitor integration. Vectors typically contain unchanged flanking DNA (both at the 5'and 3'ends) for several kilobases [eg, for homologous recombination vectors, Thomas and Capecchi, Cell, 51: 503 (1987). checking]. The vector is introduced into embryonic stem cells (eg by electroporation) and cells in which the introduced DNA is homologously recombined with the endogenous DNA are selected [eg Li
, Cell, 69: 915 (1992)]. The selected cells are then injected into the blastocyst of an animal (eg mouse or rat) to form an assembled chimera [eg Bradley, Tera
tocarcinomas and Embryonic Stem Cells: A Practical Approach, EJ Rober
tson, ed. (IRL, Oxford, 1987), pp. 113-152]. The chimeric embryos are then transplanted into a suitable pseudopregnant female nanny and at intervals, "knockout" animals are created. Offspring with DNA that has been homologously recombined into germ cells are identified by standard techniques and can be used to breed animals in which all cells of the animal contain homologously recombined DNA. . Knockout animals are characterized by the ability to protect against certain pathological conditions and the progression of that pathological condition due to the absence of PRO polypeptide.

Nucleic acids encoding PRO polypeptides can also be used in gene therapy. In gene therapy applications, for example, to replace a defective gene, the gene is introduced to achieve in vivo synthesis of a therapeutically effective amount of the gene product. "Gene therapy"
The term includes both conventional gene therapy in which a single treatment achieves a continuous effect and administration of a gene therapeutic agent including single or repeated administration of therapeutically effective DNA or mRNA. Antisense RNA and DNA can be used as therapeutic agents to block the in vivo expression of certain genes. It has already been shown that a short antisense oligonucleotide can be transferred into cells where it acts as an inhibitor despite low intracellular concentrations due to restricted uptake by the cell membrane.
(Zamecnik et al., Proc. Natl. Acad. Sci. USA 83: 4143-4146 [1986]). Oligonucleotides may be modified to facilitate uptake, for example by replacing their negatively charged phosphodiester groups with uncharged groups. There are various techniques for introducing nucleic acids into viable cells. These techniques will vary depending on whether the nucleic acid is transferred to cultured cells in vitro or in vivo in the cells of the intended host. Suitable methods for transferring nucleic acids into mammalian cells in vitro include liposomes, electroporation, microinjection, cell fusion, DEAE-dextran, calcium phosphate precipitation and the like. Presently preferred in vivo gene transfer techniques are transfection with viral (typically retroviral) vectors and viral coat protein-liposome mediated transfection (Dzau et al., Trends, in Biotechnology 11, 205-210 [1993]). . In some situations, the nucleic acid source may be a cell surface membrane protein or an antibody specific for the target cell,
It is desirable to provide with a drug that targets the target cell, such as a ligand for a receptor on the target cell. When liposomes are used, proteins that bind to cell surface membrane proteins with endocytosis, for example, capsid proteins or fragments thereof that are tropic for certain cell types, antibodies to proteins that undergo internalization in the cycle, intracellular localization Proteins that target intracellular and improve intracellular half-life are used for targeting and / or facilitating uptake. Techniques for receptor-mediated endocytosis are described, for example, in Wu et al., J. Biol. Chem. 262, 4429-4432 (1987).
And Wagner et al., Proc. Natl. Acad. Sci. USA 87, 3410-3414 (1990). See Anderson et al., Science 256, 808-813 (1992) for a review of gene marking and gene therapy protocols.

The PRO polypeptides described herein may be used as molecular weight markers for protein electrophoresis purposes, and the isolated nucleic acid sequences may be used to recombinantly express the markers. Nucleic acid molecules encoding the PRO polypeptides or fragments thereof described herein are useful for chromosome identification. In this respect, there is a need for the identification of novel chromosomal markers, as chromosomal marking reagents based on actual sequences are scarcely available. Each PRO nucleic acid molecule of the present invention can be used as a chromosomal marker. The PRO polypeptides and nucleic acid molecules of the invention can also be used for tissue typing,
The PRO polypeptides of the invention are differentially expressed in one tissue as compared to the other.
PRO nucleic acid molecules will find use for generating probes for PCR, Northern, Southern and Western analyses. The PRO polypeptides described herein may be used as therapeutic agents. P of the present invention
The RO polypeptide is formulated according to known methods for preparing pharmaceutically useful compositions, whereby the PRO product is mixed with a pharmaceutically acceptable carrier medium. Therapeutic formulations may be prepared by mixing the active ingredient with the desired degree of purification with any pharmaceutically acceptable carrier, excipient or stabilizer in the form of a lyophilized formulation or aqueous solution ( Remington's Pharmaceutical Sciences, 16th editi
on, A. Osol, Ed., (1980)), prepared and stored. Acceptable carriers, excipients or stabilizers are non-toxic to recipients at the doses and concentrations used, and buffers such as phosphoric acid, citric acid and other organic acids; antioxidants including ascorbic acid. Agents; low molecular weight (less than 10 residues) polypeptides; proteins such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; glycine,
Amino acids such as glutamine, asparagine, arginine or lysine; glucose,
Monosaccharides such as mannose or dextrin, disaccharides or other carbohydrates; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt forming counterions such as sodium; and / or such as TWEEN ^™ , PLURONICS ^™ or PEG Contains a nonionic surfactant.

The formulations used for in vivo administration must be sterile. This is easily accomplished by filtration through sterile filter membranes, either before or after lyophilization and reconstitution. Here, the therapeutic composition is generally placed in a container having a sterile access port, such as an intravenous bag or vial having a stopper pierceable by a hypodermic injection needle. The route of administration is by well-known methods, such as injection or infusion by intravenous, intraperitoneal, intracerebral, intramuscular, intraocular, intraarterial or intralesional routes, local administration, or sustained release system. The dosage and desired drug concentration of the pharmaceutical compositions of the present invention will vary depending on the particular intended use. Determination of the proper dosage or route of administration is within the skill of the ordinary physician. Animal studies provide reliable guidance on the determination of effective doses for human therapy. Toxicokinetics and New Dru
g Development, Yacobi et al., ed., Pergamon Press, New York 1989, pp. 42-96, M.
ordenti, J. and chappell, W. `` The use of interspecies scaling in toxico
kinetics ”. When in vivo administration of a PRO polypeptide or agonist or antagonist thereof is used, a normal dose is 1 per mammal body weight, depending on the route of administration.
From about 10 ng / kg to 100 mg / kg daily, preferably about 1 μg / kg / day
It is 10 mg / kg / day from the day. Guidance on specific doses and delivery methods is given in the literature; eg, US Pat. Nos. 4,657,760, 5,206,344, or 5,225,21.
See No. 2. That different formulations are effective for different therapeutic compounds and different diseases,
For example, it is expected that targeted administration to one organ or tissue will require delivery in a different manner than other organs or tissues. Microencapsulation of PRO polypeptide is contemplated when sustained release of PRO polypeptide is desired in a formulation with release characteristics suitable for the treatment of any disease or disorder that requires administration of PRO polypeptide. Microencapsulation of recombinant proteins for sustained release has been demonstrated by human growth hormone (rhGH), interferon (
rhIFN-), interleukin-2, and MNrgp120 have been successfully implemented. Johnson et al., Nat. Med., 2: 795-799 (1996); Yasuda, Biomed. Ther.
, 27: 1221-1223 (1993); Hora et al., Bio / Technology, 8: 755-758 (1990); Clela
nd, `` Design and Production of Single Immunization Vaccines Using Polyac
tide Polyglycolide Microsphere Systems '' Vaccine Design: The Subunit and
Adjuvant Approach, Powell and Newman, (Plenum Press: New York, 1995),
p. 439-462; WO 97/03692, WO 96/40072, WO 96/07399; and U.S. Pat.
No. 010.

Sustained release formulations of these proteins include poly-lactic-coglycolic acid (PLGA)
Developed with polymers, based on their biocompatibility and wide range of biodegradable properties. The degradation products of PLGA, lactic acid and glycolic acid, are immediately cleared within the human body. Furthermore, the degradability of this polymer can be adjusted from months to years depending on the molecular weight and composition. Lewis, `` Controlled release of bioactive agent
s from lactide / glycolide polymer '': M. Chasin and R. Langer (ed.), Biodeg
radable Polymers as Drug Delivery Systems (Marcel Dekker: New York, 1990
), pp. 1-41. The invention also includes methods of screening compounds to identify those that are similar to PRO polypeptides (agonists) or that inhibit the effects of PRO polypeptides (antagonists). Screening assays for antagonist candidate drugs include compounds that bind to or complex the PRO polypeptide encoded by the genes identified herein, or compounds that inhibit the interaction of other encoded polypeptides with other cellular proteins. Designed to identify. Such screening assays include those applicable to high throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates. This assay is performed in a variety of formats, including those known in the art for protein-protein binding assays, biochemical screening assays, immunoassays, and cell-based assays. All assays for antagonists require that they contact the candidate drug with the PRO polypeptide encoded by the nucleic acid identified herein under conditions and for a time sufficient for these two components to interact. Is common in doing.

In binding assays, the interaction is binding and the complex formed is either isolated or detected in the reaction mixture. In a particular embodiment, the PRO polypeptide or candidate drug encoded by the gene identified herein is immobilized covalently or non-covalently on a solid phase, eg, a microtiter plate. Non-covalent attachment generally is accomplished by coating the solid surface with a solution of the polypeptide and drying. Alternatively, an immobilized antibody specific for the PRO polypeptide to be immobilized, eg a monoclonal antibody, can be used to anchor it to a solid surface.
The assay is performed by adding the non-immobilized component, which may be labeled with a detectable label, to the immobilized component, eg, the coated surface containing the anchored component. When the reaction is complete, unreacted components are removed, for example by washing, and the complex adhered to the solid surface is detected. When the first non-immobilized component carries a detectable label, detection of the label immobilized on the surface indicates that complex formation has occurred. If the first non-immobilized component has no label, complex formation can be detected, for example, by a labeled antibody that specifically binds to the immobilized complex. Specific PRs that interact with candidate compounds but are encoded by the gene identified here
If it does not bind to O polypeptide, its interaction with the polypeptide is
-It can be assayed by well-known methods for detecting protein interactions. Such assays include traditional techniques such as cross-linking, co-immunoprecipitation, and co-purification through gradients or chromatographic columns. In addition, protein-protein interactions are described by Fields and coworkers [Fiels and Song, Nature.
(London) 340, 245-246 (1989); Chien et al., Proc. Natl. Acad. Sci. USA 88, 957.
8-9582 (1991)] by using the yeast-based gene system described in Che.
It can be monitored using the yeast-based system disclosed in vray and Nathans, Proc. Natl. Acad. Sci. USA 89, 5789-5793 (1991). Many transcriptional activators, such as yeast GAL4, consist of two physically distinct modular domains,
One acts as a DNA binding domain and the other functions as a transcriptional activation domain. The yeast expression system described in the previous literature (generally referred to as the "2-hybrid system") takes advantage of this property and uses two hybrid proteins, while the target protein is the DNA binding domain of GAL4. On the other hand, the candidate activating protein is fused to the activation domain. GAL1-l
Expression of the acZ reporter gene under the control of the GAL4-activated promoter depends on the reconstitution of GAL4 activity via protein-protein interactions. Colonies containing interacting polypeptides are detected with a chromogenic substance for β-galactosidase. A complete kit (MATCHMAKER ^™ ) for identifying protein-protein interactions between two specific proteins using the 2-hybrid technique is commercially available from Clontech. This system can be extended to the mapping of protein domains involved in a particular protein interaction, as well as the identification of amino acid residues important for this interaction.

Compounds that inhibit the interaction of the genes encoding the PRO polypeptides identified herein with intracellular or extracellular components can be tested as follows: Usually, the reaction mixture is the gene product and extracellular components. Alternatively, the intracellular component is prepared under conditions and for a time when the two products interact and bind. To test the ability of a candidate compound to inhibit binding, the reaction is performed in the absence and presence of the test compound.
In addition, placebo may be added to the third reaction mixture to provide a positive control. The binding (complex formation) between the test compound and intracellular or extracellular components present in the mixture is monitored as described above. The formation of the complex in the control reaction but not in the reaction mixture containing the test compound indicates that the test compound inhibits the interaction of the test compound with its binding partner. To assay an antagonist, a PRO polypeptide may be added with a compound that is screened for a particular activity, the ability of the compound to inhibit the activity of interest in the presence of the PRO polypeptide is that the compound is an antagonist of the PRO polypeptide. Indicates that. Alternatively, the antagonist may be detected by binding the PRO polypeptide and a potential antagonist with the membrane-bound PRO polypeptide receptor or recombinant receptor under conditions suitable for competitive inhibition assays. The PRO polypeptide can be labeled, such as radioactively, and the number of PRO polypeptides bound to the receptor can be used to determine the efficacy of a potential antagonist. The gene encoding the receptor can be identified by many methods known to those of skill in the art, such as ligand panning and FACS sorting. Coligan, etc.,
Current Protocols in Immun., 1 (2): Chapter 5 (1991). Preferably, expression cloning is used, polyadenylated RNA is prepared from cells responsive to PRO polypeptide, and a cDNA library generated from this RNA is distributed into pools, COS cells or other non-PRO polypeptide responsive Used for transfection of cells. Transfected cells grown on glass slides are exposed to labeled PRO polypeptide. PRO polypeptides can be labeled by a variety of means including iodination or the inclusion of recognition sites for site-specific protein kinases. After fixation and incubation, slides are subjected to autoradiographic analysis. Positive pools are identified and subpools are prepared and retransfected using an interactive subpooling and rescreening step, resulting in the generation of a single clone encoding the putative receptor.

As an alternative method for receptor identification, labeled PRO polypeptide can be photoaffinity-linked with cell membrane or extract preparations that express the receptor molecule. The crosslinked material is dissolved in PAGE and exposed to X-ray film. The labeled complex containing the receptor can be excited, separated into peptide fragments and subjected to protein microsequencing. The amino acid sequence obtained from microsequencing is used to design a set of degradable oligonucleotide probes that screen a cDNA library to identify genes encoding putative receptors. In another assay for antagonists, mammalian cells expressing the receptor or a membrane preparation are incubated with labeled PRO polypeptide in the presence of the candidate compound. The ability of the compound to enhance or block this interaction is then measured. More particular examples of potential antagonists are oligonucleotides that bind to fusions of immunoglobulins and PRO polypeptides, particularly but not limited to polypeptide- and monoclonal antibodies and antibody fragments, single chain antibodies, anti-antibodies. -Idiotypic antibodies, and chimeric or humanized forms of these antibodies or fragments, as well as antibodies, including human antibodies and antibody fragments. Alternatively, the potential antagonist recognizes closely related proteins, eg, receptors, but has no effect, and thus PR
It may be a mutated form of PRO polypeptide that competitively inhibits the action of O polypeptide. Other potential PRO polypeptide antagonists are antisense RNA or DNA constructs prepared using antisense technology, eg, antisense RNA or DNA hybridizes to a target mRNA to interfere with protein translation. This acts to directly block the translation of mRNA. Antisense technology can be used to control gene expression through triple helix formation or antisense DNA or RNA, both of which methods are based on the binding of polynucleotides to DNA or RNA. For example, the 5'coding portion of the polynucleotide sequence encoding the mature PRO polypeptide herein is used to design an antisense RNA oligonucleotide of about 10 to 40 base pairs in length. DNA oligonucleotides are designed to be complementary to regions of the gene involved in transcription (Triple Helix-Lee et al., Nucl, Acid Res., 6: 3073 (1979); Cooney et al.,
Science, 241: 456 (1988); Dervan et al., Science, 251: 1360 (1991)), thereby preventing transcription and production of PRO polypeptides. Antisense RNA oligonucleotides hybridize to mRNA in vivo and block translation of mRNA molecules into PRO polypeptides (Antisense-Okano, Neurochem., 56.
: 560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expr
ession (CRC Press: Boca Raton, FL, 1988)). The above oligonucleotide is
When delivered to cells and expressed antisense RNA or DNA in vivo, PR
It can also inhibit the production of O polypeptides. When antisense DNA is used, the translation initiation site, eg, -10 to +10 of the target gene nucleotide sequence.
Oligodeoxyribonucleotides derived from between positions are preferred.

Potential antagonists are small molecules that bind to the active site, receptor binding site, or growth factor or other related binding site of a PRO polypeptide, thereby blocking the normal biological activity of the PRO polypeptide. Including. Examples of small molecules include, but are not limited to, small peptides or peptide-like molecules, preferably soluble peptides, and synthetic non-peptide organic or inorganic compounds. Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. Ribozymes act by sequence-specific hybridization to complementary target RNA, followed by endonucleolytic cleavage. Specific ribozyme cleavage sites within potential RNA targets can be identified by known techniques. Further details can be found in, for example, Rossi, Current B
See Biology 4: 469-471 (1994) and PCT publication, number WO 97/33551 (published September 18, 1997). Nucleic acid molecules in triple-helix formation used to inhibit transcription are single-stranded and composed of deoxynucleotides. The basic composition of these oligonucleotides is designed to promote triple helix formation via Hoogsteen base pairing rules,
It generally requires resizable extension of purines or pyrimidines on one strand of the duplex. For further details, see, for example, PCT publication, number WO 97/33551, supra. These small molecules can be identified by any one or more of the screening assays discussed above and / or by any other screening technique well known to those of skill in the art. The uses of the molecules disclosed herein are based on the success of the positive functional assays disclosed and described below. Methods based on the success of the assay are also included in the invention.

F. Anti-PRO Antibodies The present invention further provides anti-PRO antibodies. Examples of antibodies include polyclonal, monoclonal, humanized, bispecific and heteroconjugate antibodies.

1. Polyclonal Antibodies Anti-PRO antibodies include polyclonal antibodies. Methods of preparing polyclonal antibodies are known to those of skill in the art. Polyclonal antibodies in mammals can be generated by one or more injections of, for example, an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and / or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections. The immunizing agent may include the PRO polypeptide or a fusion protein thereof. It is useful to conjugate the immunizing agent to a protein known to be immunogenic in the immunized mammal. Examples of such immunogenic proteins include, but are not limited to, keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin and soybean trypsin inhibitor. Examples of adjuvants that may be used include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl lipid A, synthetic trehalose dicorynomycolate). The immunization protocol will be selected by one of ordinary skill in the art without undue experimentation.

2. Monoclonal Antibody Alternatively, the anti-PRO antibody may be a monoclonal antibody. Monoclonal antibodies can be prepared using the hybridoma method as described by Kohler and Milstein, Nature, 256: 495 (1975). In the hybridoma method, mice, hamsters or other suitable host animals are typically immunized with an immunizing agent to produce lymphocytes that produce or are capable of producing antibodies that specifically bind to the immunizing agent. Induce. The lymphocytes can also be immunized in vitro. The immunizing agent will typically include the PRO polypeptide or a fusion protein thereof.
Generally, peripheral blood lymphocytes ("PBLs") are used when cells of human origin are desired, or spleen cells or lymph node cells are used when non-human mammalian sources are desired. The lymphocytes are then fused with an immortalized cell line using a suitable fusing agent such as polyethylene glycol to form hybridoma cells [Goding,
Monoclonal Antibodies: Principles and Practice, Academic Press, (1986) p
p. 59-103]. Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine, and human origin. Usually, rat or mouse myeloma cell lines are used. The hybridoma cells are preferably cultured in a suitable medium that contains one or more substances that inhibit the survival or growth of the unfused, immortalized cells. For example, when the parental cell lacks the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT), the hybridoma's medium typically contains hypoxatin, aminoputilin and thymidine ("HAT medium").
, This substance blocks the growth of HGPRT-deficient cells. Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. A more preferred immortalized cell line is the mouse myeloma line, which is available, for example, from the Salk Institute Cell Distribution Center in San Diego, Calif. And the American Type Culture Collection in Manassas, Virginia. Human myeloma and mouse for producing human monoclonal antibodies
-Human xenomyeloma cell lines have also been disclosed [Kozbor, J. Immunol., 133: 3001 (
1984), Brodeur et al., Monoclonal Antibody Production Techniques and Applicat.
ions, Marcel Dekker, Inc., New York, (1987) pp. 51-63].

The culture medium in which the hybridoma cells are cultured is then assayed for the presence of monoclonal antibodies against PRO. Preferably, the binding specificity of the monoclonal antibody produced by the hybridoma cells is measured by immunoprecipitation or an in vitro binding assay such as radioimmunoassay (RIA) or enzyme-linked immunoassay (ELISA). Such techniques and assays are known in the art. The binding affinity of a monoclonal antibody is, for example, Munson and Pollard, Anal. Biochem.,
It can be measured by the Scatchard analysis method according to 107: 220 (1980). After the desired hybridoma cells have been identified, clones can be subcloned by a limiting dilution step and grown by standard methods [Goding, supra].
Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium. Alternatively, the hybridoma cells can be grown in vivo as ascites in a mammal. The monoclonal antibody secreted by the subclone is, for example, protein A
-Isolated or purified from culture medium or ascites fluid by conventional immunoglobulin purification methods such as Sepharose method, hydroxylapatite chromatography method, gel electrophoresis method, dialysis method or affinity chromatography. Monoclonal antibodies are also prepared by recombinant DNA methods, such as US Pat. No. 4,816,567.
It can be prepared by the method described in No. The DNA encoding the monoclonal antibody of the present invention can be easily prepared using a conventional method (for example, using an oligonucleotide probe capable of specifically binding to the genes encoding the heavy and light chains of mouse antibody). Can be isolated and sequenced. The hybridoma cells of the invention are a preferred source of such DNA. Once isolated, DNA
Can be placed in an expression vector, which is transfected into a host cell, such as monkey COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not produce immunoglobulin proteins, resulting in recombinant host cell Monoclonal antibody can be synthesized with. The DNA may also be non-immunized with immunoglobulin coding sequences, eg, by substituting the coding sequences for human heavy and light chain constant domains in place of homologous mouse sequences [US Pat. No. 4,816,567; Morrison et al., Supra]. It can be modified by covalently linking part or all of the coding sequence for the globulin polypeptide. Such non-immunoglobulin polypeptides can be substituted for the constant domain of the antibodies of the invention or for the variable domain of one of the antigen binding sites of the antibodies of the invention to produce chimeric bivalent antibodies. The antibody may be a monovalent antibody. Methods for preparing monovalent antibodies are well known in the art. For example, one method involves recombinant expression of immunoglobulin light chain and modified heavy chain. The heavy chain is truncated generally at any point in the Fc region so as to prevent heavy chain crosslinking. Alternatively, the relevant cysteine residue is replaced or deleted with another amino acid residue to prevent cross-linking. In vitro methods are also suitable for preparing monovalent antibodies. Generation of fragments thereof, particularly Fab fragments, by digestion of the antibody can be accomplished using conventional techniques known in the art.

3. Human and Humanized Antibodies The anti-PRO antibodies of the present invention further include humanized antibodies or human antibodies. Humanized forms of non-human (eg, murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (eg, Fv, Fab, Fab ′, F (ab ′) ₂ or other antigen-binding subsequences of antibodies). It contains a minimal sequence derived from non-human immunoglobulin. Humanized antibodies have residues in the complementarity determining region (CDR) of the recipient
It includes human immunoglobulins (recipient antibodies) replaced by residues in the CDRs of a non-human species (donor antibody) with the desired specificity, affinity and potency, such as mouse, rat or rabbit. In some examples, human immunoglobulin Fv framework residues are replaced by corresponding non-human residues. Humanized antibodies may also contain residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. Generally, a humanized antibody has at least one, and typically no, at least one, where all or almost all CDR regions correspond to those of a non-human immunoglobulin and all or almost all FR regions are of human immunoglobulin consensus sequences. Contains substantially all of the two variable domains. A humanized antibody optimally comprises at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et al., Nature, 321: 522-525 (
1986); Riechmann et al., Nature, 332: 323-329 (1988); and Presta, Curr. Op Str.
uct. Biol., 2: 593-596 (1992)]. Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues of non-human origin introduced. These non-human amino acid residues are often referred to as "import" residues, which typically result from an "import" variable domain. Humanization is basically a matter of winter and collaborators [
Jones et al., Nature, 321: 522-525 (1986); Riechmann et al., Nature, 332: 323-327 (1).
988); Verhoeyen et al., Science, 239: 1534-1536 (1988)] by replacing the rodent CDRs or CDR sequences with the corresponding sequences of human antibodies. Thus, such "humanized" antibodies are chimeric antibodies in which substantially less than the intact human variable domain is replaced with the corresponding sequence from a non-human species (US Pat.
, 816, 567). In practice, humanized antibodies are typically human antibodies in which some CDR residues and optionally some FR residues have been replaced by residues from similar sites in rodent antibodies.

Human antibodies are also available in phage display libraries [Hoogenboom and Wint.
er, J. Mol. Biol., 227: 381 (1992); Marks et al., J. Mol. Biol., 222: 581 (1991).
)], And various methods known in the art can be used. In addition, techniques such as Cole and Boerner can also be used for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Lis.
sp77 (1985) and Boerner et al., J. Immunol., 147 (1): 86-95 (1991)]. Similarly, human antibodies can be produced by introducing human immunoglobulin loci into transgenic animals, eg, mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon administration, production of human antibodies is observed that is very similar to that found in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in US Pat. No. 5,545,807.
No. 5,545,806; No. 5,569,825; No. 5,625,126; No. 5,633,425;
No. 5,661,016 and the following scientific publications: Marks et al., Bio / Technology 10, 779-783.
(1992); Lonberg et al., Nature 368 856-859 (1994); Morrison, Nature 368, 812.
-13 (1994); Fishwild et al., Nature Biotechnology 14, 845-51 (1996); Neuberge
r, Nature Biotechnology 14, 826 (1996); Lonberg and Huszar, Intern. Rev.
Immunol. 13 65-93 (1995). The antibody may also be affinity matured using the known selection and / or mutagenesis methods described above. Preferred affinity matured antibodies have a 5-fold, more preferably 10-fold, more preferably 20- or 30-fold affinity than the starting antibody (generally murine, humanized or human) from which the matured antibody is prepared. .

4. Bispecific Antibodies Bispecific antibodies are monoclonal antibodies, preferably human or humanized antibodies, that have binding specificities for at least two different antigens. In the case of the present invention, one of the binding specificities is for PRO, the other one is any other antigen,
Preferred is for cell surface proteins or receptors or receptor subunits. Methods of making bispecific antibodies are well known in the art. Traditionally, recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy chain / light chain pairs, where the two heavy chains have different specificities [Milstein and Cuello, Nature,
305: 537-539 (1983)]. Due to the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of 10 different antibody molecules, of which only one has the correct bispecific structure. Purification of the correct molecule is usually accomplished by affinity chromatography steps. A similar procedure is described in WO 93/08829 published May 13, 1993, and Traunecker et al., EMBO J., 10: 3655-3.
656 (1991). Antibody variable domains with the desired binding specificities (antibody-antigen combining sites) can be fused to immunoglobulin constant domain sequences. The fusion is preferably with an immunoglobulin heavy chain constant domain, comprising at least the hinge region, and portions of the CH2 and CH3 regions. It is preferred to have the first heavy-chain constant region (CH1) containing the site necessary for light-chain binding present in at least one of the fusions. The DNA encoding the immunoglobulin heavy chain fusion, and, if desired, the immunoglobulin light chain, are inserted into separate expression vectors and cotransfected into a suitable host organism. For further details on making bispecific antibodies, see, eg, Suresh et al., Methods in Enzymology, 121: 210 (1986).

According to another method described in WO96 / 27011, the interface between a pair of antibody molecules can be engineered to maximize the proportion of xenodimers recovered from recombinant cell culture.
The preferred interface comprises at least part of the CH3 region of an antibody constant domain. In this method, one or more small amino acid side chains from the interface of the first antibody molecule are replaced with larger side chains (eg tyrosine or tryptophan). Complementary "cavities" of the same or similar size as the large side chains, smaller large amino acid side chains
Created at the interface of the second antibody molecule by substituting (eg alanine or threonine). This provides a mechanism to increase the yield of heterodimers relative to unwanted other end products such as homodimers. Bispecific antibodies can be prepared as full length antibodies or antibody fragments (eg F (ab ′) ₂ bispecific antibodies). Techniques for producing bispecific antibodies from antibody fragments have also been described in the literature. For example, chemical coupling can be used to prepare bispecific antibodies. Brennan et al., Science, 229: 81 (1985) describe a procedure for the proteolytic cleavage of intact antibodies to produce F (ab ') ₂ fragments. These fragments are
Dithiol complexing agent Reduces in the presence of sodium arsenite to stabilize vicinal dithiols and prevent intermolecular disulfide formation. The Fab 'fragments produced are then converted to thionitrobenzoate (TNB) derivatives. One of the Fab'-TNB derivatives is then reconverted to Fab'-thiol by reduction with mercaptoethylamine and mixed with an equimolar amount of another Fab'-TNB derivative to form the bispecific antibody. The produced bispecific antibody can be used as a drug for selective immobilization of an enzyme. Fab 'fragments can be directly recovered from E. coli and chemically coupled to form bispecific antibodies. Shalaby et al., J. Exp. Med., 175: 217-225 (1992).
Describes the preparation of fully humanized bispecific antibody F (ab ′) ₂ molecules.
Each Fab 'fragment is separately secreted from E. coli and undergoes directed chemical coupling in vitro to form the bispecific antibody. The bispecific antibody thus formed is
Capable of binding to normal human T cells and cells that overexpress the ErbB2 receptor,
It triggers the cytolytic activity of human cytotoxic lymphocytes against human breast tumor targets.

Various methods for making and isolating bispecific antibody fragments directly from recombinant cell culture have also been described. For example, bispecific antibodies have been produced using leucine zippers. Kostelny et al., J. Immunol. 148 (5): 1547-1553 (1992). Leucine zipper peptides from the Fos and Jun proteins are linked by gene fusion to the Fab ′ portions of two different antibodies. The antibody homodimer is reduced at the hinge region to form a monomer and then reoxidized to form the antibody heterodimer. This method can also be used for the production of antibody homodimers. Hollinge
The "diabody" technology described by R et al., Proc. Natl. Acad. Sci. USA, 90: 6444-6448 (1993) provided another mechanism for making bispecific antibody fragments. Fragments consist of a heavy chain variable domain ( _VH ) linked to a light chain variable domain ( _VL ) with a linker short enough to allow pairing between two domains on the same chain. Thus, the V _H and V _L domains of one fragment are forced to pair with the complementary V _L and V _H domains of the other fragment, forming two antigen binding sites. Single chain Fv (s
Other strategies for producing bispecific antibody fragments by the use of Fv) dimers have also been reported. See Gruber et al., J. Immunol. 152: 5368 (1994). Antibodies with more than two valencies are possible. For example, trispecific antibodies can be prepared. Tutt et al. J. Immunol. 147: 60 (1991). Exemplary bispecific antibodies can bind to two different epitopes of the PRO polypeptide provided herein. Alternatively, the arm of the anti-PRO polypeptide is
In order to concentrate the cell defense mechanism on a specific PRO polypeptide-expressing cell,
Trigger molecules on leukocytes such as T cell receptor molecules (eg CD2, CD3, CD28, or B7), or FcγRI (CD64), FcγRII (CD32) and F
It can bind to an arm that binds the Fc receptor for IgG (FcγR) such as cγRIII (CD16). Bispecific antibodies can also be used to localize cytotoxic drugs to cells expressing a particular PRO polypeptide. These antibodies include PRO binding arms and cytotoxic agents or radiochelators such as EOTUBE.
, DPTA, DOTA, or TETA. Other bispecific antibodies of interest bind to the PRO polypeptide and also to tissue factor (TF).

5. Heteroconjugate Antibodies Heteroconjugate antibodies are also within the scope of the present invention. Heteroconjugate antibodies are composed of two covalently joined antibodies. Such antibodies may be used, for example, to target immune system cells to unwanted cells [US Pat. No. 4,676,980] and for the treatment of HIV infection [WO 91/00360; WO 92/200373; EP 03089]. Proposed. It is believed that this antibody can be prepared in vitro using known methods in synthetic protein chemistry, including those associated with cross-linking agents. For example, immunotoxins can be made using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate, and for example US Pat. No. 4,676,980.
Include those disclosed in the issue.

6. Effector Function Processing It is desirable to modify the antibody of the present invention with respect to effector function, eg to improve the effectiveness of the antibody in treating cancer. For example, cysteine residue (s) may be introduced in the Fc region, thereby allowing interchain disulfide bond formation in this region. The homodimeric antibody thus produced has improved internalization capacity and / or
Or it may have increased complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC). Caron et al., J. Exp. Med. 176: 1191-1195 (1992) and Shopes, J. Immuno.
See l. 148: 2918-2922 (1992). Allodimeric antibodies with improved anti-tumor activity can also be prepared using heterobifunctional crosslinks as described by Wolff et al., Cancer Research 53: 2560-2565 (1993). Alternatively, the antibody can be engineered to have two Fc regions, thereby improving complement lysis and ADCC capabilities. See Stevenson et al., Anti-Cancer Drug Design 3: 219-230 (1989).

7. Immune Conjugate The present invention also includes chemotherapeutic agents, cytotoxic agents such as toxins (e.g., enzymatically active toxins of bacterial, fungal, plant or animal origin, or fragments thereof), or radioisotopes (i.e.,
An immunoconjugate comprising the antibody (radioconjugated) is also included. Chemotherapeutic agents useful in the formation of such immune complexes have been described above. Enzymatically active toxins and fragments thereof that can be used include diphtheria A chain, non-binding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modexin (m
odeccin) A chain, α-sarcin, Aleurites fordii protein, dianthin protein, phytraca americana (Phyto)
laca americana protein (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin,
Includes crotin, sapaonaria officinalis inhibitor, gelonin, mitogellin, restrictocin, phenomycin, enomycin and trichothecene. Various radionucleotides are available for the production of radioconjugated antibodies. Examples ^{include 212 Bi, 131 I, 131 In} , 9 0 Y and ¹⁸⁶ Re. Conjugates of antibodies and cytotoxic agents are characterized by various bifunctional protein coupling agents, such as N-succinimidyl-3- (2-pyridyldithiol) propionate (SPDP), iminothiolane (IT), imidoester bifunctional. Derivatives (dimethyl adipimidate HCL, etc.), active esters (disuccinimidyl suberate, etc.), aldehydes (glutaraldehyde, etc.), bis-azide compounds (bis (p-azidobenzoyl) hexanediamine, etc.), bis-diazonium Derivative
(Bis- (p-diazoniumbenzoyl) -ethylenediamine, etc.), diisocyanate (
Triene 2,6-diisocyanate, etc.) and a bis-active fluorine compound (1,5-difluoro-2,4-dinitrobenzene, etc.). For example, a ricin immunotoxin can be prepared as described in Vitetta et al., Science 238: 1098 (1987). Carbon-14-labeled 1-isothiocyanatobenzyl-3-methyldiethylenetriaminepentaacetic acid (MX-DTPA) is an example of a chelating agent for conjugation of radionucleotide to the antibody. See WO 94/11026. In other embodiments, the antibody may be conjugated to a "receptor" (such as streptavidin) for use in tumor pre-targeting, and the antibody-receptor complex is administered to the patient, followed by a clarifier. Used to remove unbound complex from the circulation, and then a "ligand" (such as avidin) conjugated to a cytotoxic drug (such as a radionucleotide)
Is administered.

8. Immunoliposomes The antibodies disclosed herein may also be prepared as immunoliposomes. Liposomes containing antibodies are described in Epstein et al., Proc. Natl. Acad. Sci. USA, 82: 3688 (1985).
Hwang et al., Proc. Natl. Acad. Sci. USA, 77: 4030 (1980); and U.S. Pat.
Prepared by methods known in the art, such as those described in 485,045 and 4,544,545. Liposomes with improved circulation time are disclosed in US Pat. No. 5,013,556. Particularly useful liposomes are phosphatidylcholine, cholesterol and PEG.
-Produced by the reverse phase evaporation method with a lipid composition containing derivatized phosphatidylethanolamine (PEG-PE). The liposomes are extruded through a filter of a given size to produce liposomes with the desired size. Fab ′ of the antibody of the present invention
Fragments can be conjugated to liposomes via a disulfide exchange reaction as described by Martin et al., J. Biol. Chem. 257: 286-288 (1982). A chemotherapeutic agent (such as doxorubicin) is optionally contained within the liposome. Gabizon et al., J.
See National Cancer Inst. 81 (19) 1484 (1989).

9. Pharmaceutical Compositions of Antibodies Antibodies that specifically bind to the PRO polypeptides identified herein, as well as other molecules identified in the screening assays disclosed above, may be used in pharmaceutical compositions to treat various diseases. It can be administered in the form. When the PRO polypeptide is intracellular and whole antibodies are used as inhibitors,
Internalized antibodies are preferred. However, lipofections or liposomes can also be used to introduce the antibody, or antibody fragment, into cells. When antibody fragments are used, the smallest inhibitory fragment that specifically binds to the binding domain of the target protein is preferred. For example,
Based on the variable region sequences of antibodies, peptide molecules can be designed that retain the ability to bind to target protein sequences. Such peptides can be chemically synthesized and / or
Alternatively, it can be produced by recombinant DNA technology. For example, Marasco et al., Proc. Natl. A
See cad. Sci. USA 90, 7889-7893 (1993). The formulations herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. Alternatively, or additionally, the composition comprises
It may include cytotoxic agents, cytokines, chemotherapeutic agents or growth inhibitors. These molecules are suitably present in combination in amounts that are effective for the purpose intended. Alternatively, the active ingredient may be, for example, in microcapsules prepared by coacervation techniques or by interfacial polymerization, such as hydroxymethyl cellulose or gelatin-microcapsules and poly (methyl methacrylate) microcapsules, respectively.
It may be encapsulated in a colloidal drug delivery system (eg liposomes, albumin globules, microemulsions, nanoparticles and nanocapsules) or in microemulsions. These techniques are disclosed in Remington's Pharmaceutical Science, supra.

The formulations used for in vivo administration must be sterile. This is easily accomplished by filtration through a sterile filtration membrane. Sustained-release preparations may be prepared. Suitable examples of sustained release formulations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are shaped articles,
For example, in the form of a film or microcapsules. Examples of sustained release matrices include polyesters, hydrogels (eg, poly (2-hydroxyethyl-methacrylate), or poly (vinyl alcohol)), polyactides (US Pat. No. 3,773,919),
Degradable lactic acid-glycolic acid copolymers such as L-glutamic acid and γ-ethyl-L-glutamate copolymers, non-degradable ethylene-vinyl acetate, LUPRON DEPOT ^™ (injectable globules of lactic acid-glycolic acid copolymer and leuprolide acetate) , And poly-D-(-)-3-hydroxybutyric acid. While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods. When the encapsulated antibodies remain in the body for a long time, they are denatured or aggregated by exposure to water at 37 ° C, resulting in reduced biological activity and possible altered immunogenicity. . Rational methods can be devised for stabilization depending on the mechanism involved. For example, the aggregation mechanism is intermolecular S- through thio-disulfide exchange.
If found to be S-bond formation, stabilization is by modification of sulfhydryl residues, freeze-drying from acidic solutions, control of water content, addition of suitable additives, and development of specific polymer matrix compositions. Can be achieved.

G. Uses of anti-PRO antibody The anti-PRO antibody of the present invention has various utilities. For example, anti-PRO antibodies are used in diagnostic assays for PRO, eg, detecting its expression in specific cells, tissues, or serum. Competitive binding assays, direct or indirect sandwich assays and heterogeneous or homogeneous phase immunoprecipitation assays [Zola, Monoclonal Antibodie
s: A Manual of Techniques, CRC Press, Inc. (1987) pp. 147-158], and various diagnostic assay techniques known in the art are used. The antibody used in the diagnostic assay is labeled with a detectable moiety. Detectable site, directly or indirectly,
It must produce a detectable signal. For example, the detectable moiety may be a radioisotope such as ³ H, ¹⁴ C, ³² P, ³⁵ S or ¹²⁵ I, a fluorescent or chemiluminescent compound such as fluorescein isothiocyanate, rhodamine or luciferin,
Alternatively it may be an enzyme such as alkaline phosphatase, beta-galactosidase or horseradish peroxidase. Any method known in the art for conjugating a detectable site to an antibody can be used, including Hunter et al. Nature, 1
44: 945 (1962); David et al., Biochemistry, 13: 1014 (1974); Pain et al., J. Immuno.
l. Meth., 40: 219 (1981); and Nygren, J. Histochem. and Cytochem., 30: 407.
The method described in (1982) is included. Anti-PRO antibodies are also useful for affinity purification of PRO from recombinant cell culture or natural sources. In this method, antibodies to PRO are immobilized on a suitable support such as Sephadex resin or filter paper using methods well known in the art. Next, after contacting the immobilized antibody with a sample containing PRO to be purified, a support is used with a suitable solvent that removes substantially all substances in the sample other than PRO bound to the immobilized antibody. To wash. Finally, the support is washed with another suitable solvent that will release PRO from the antibody. The following examples are provided for illustrative purposes only and are not intended to limit the scope of the invention in any way. The entirety of all patents and references cited herein are hereby incorporated by reference.

EXAMPLES All commercially available reagents referred to in the examples were used according to manufacturer's instructions unless otherwise indicated. The source of cells identified by the ATCC Registry Number throughout the examples and throughout the specification is the American Type Culture Collection of Manassas, Virginia.

Example 1: Extracellular domain homology screen to identify novel polypeptides and their encoding cDNAs Extracellular domains from approximately 950 known secreted proteins (ECD) from the Swiss-Prot public database. ) Sequences (including the secretion signal sequence, if any) were used to search the EST database. EST databases are public databases (eg D
ayhoff, GenBank) and corporate databases (eg LIFESEQ ^™ , Incyte Pharm)
aceuticals, Palo Alto, CA). The search was performed using the computer program BLAST or BLAST-2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)) as a comparison of the ECD protein sequence with a 6-frame translation of the EST sequence. Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher are those with the program "phrap" (Phil Green, University of Wash.
Washington, Seattle, WA) and assembled into consensus DNA sequences. This extracellular domain homology screen was used to construct consensus DNA sequences against other identified EST sequences using phrap. In addition, the resulting consensus DNA sequence is often (but not always) BLAST or BLAST-2 and ph.
ES extended using repeated cycles of rap and consensus sequences discussed above
The T-sequence source was used to extend as much as possible. Probes for synthesizing oligonucleotides based on the consensus sequence obtained as described above, for identifying a cDNA library containing the sequence of interest by PCR, and for isolating clones of the PRO polypeptide full-length coding sequence. Used as. Forward and reverse PCR primers are generally 2
P ranging from 0 to 30 nucleotides, often about 100-1000 bp long
Designed to give a CR product. The probe sequence is typically 40-55 bp
Be long. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1-1.5 kbp. To screen several libraries for full length clones, DNA from the libraries was
Screened by PCR with PCR primer pairs according to Bel et al., Current Protocols in Molecular Biology. The positive library, then
One of the probe oligonucleotides and the primer pair was used to isolate clones encoding the gene of interest. The cDNA library used for the isolation of the cDNA clone was Invitrogen, San
Prepared by standard methods using commercially available reagents such as those from Diego, CA. c
The DNA is primed with an oligo dT containing a NotI site, blunt-ended with a SalI hemikinase adapter, cut with NotI, appropriately sized by gel electrophoresis, and a suitable cloning vector (such as pRK5B or pRK5D; pRK5B is a precursor of pRK5D that does not contain an SfiI site; Holmes et al.,
Science, 253: 1278-1280 (1991)) at the unique XhoI and NotI sites in the desired orientation.

Example 2: Isolation of cDNA clones by amylase screening 1. Preparation of oligo dT primed cDNA library mRNA was isolated from human tissues of interest using reagents and protocols from Invitrogen, San Diego, CA (Fast Track 2). This RNA is called Life Technolog
It was used to generate oligo dT primed cDNA in vector pRK5D using reagents and protocols from ies, Gaithersburg, MD (Super Script Plasmid System). In this method, the double-stranded cDNA was size-classified to over 1000 bp and the SalI / NotI binding cDNA was cloned into the XhoI / NotI cut vector. pRK5D is sp6 transcription start site followed by Sfi
It was cloned into a vector having an I restriction enzyme site and an XhoI / NotI cDNA cloning site.

2. Preparation of Random Primed cDNA Library A secondary cDNA library was created to preferably represent the 5'end of the primary cDNA clone. Sp6 RNA was generated from the primary library (described above), and this RNA was cloned into the vector pSST-AMY. It was used to generate a random primed cDNA library using reagents and protocols from Life Technologies at 0 (Super Script Plasmid System referenced above). In this way,
Double-stranded cDNA was sized to 500-1000 bp, blunt-ended with a NotI adapter, cut at the SfiI site, and cloned into the SfiI / NotI cut vector. pSST-AMY. 0 is a cloning vector that has a yeast alcohol dehydrogenase promoter in front of the cDNA cloning site and a mouse amylase sequence (mature sequence without a secretory signal) followed by the yeast alcohol dehydrogenase transcription terminator after the cloning site. Therefore, c cloned into this vector fused in frame with the amylase sequence
The DNA directs the secretion of amylase from appropriately transfected yeast colonies.

3. Transformation and Detection DNA from the library described in paragraph 2 above was chilled on ice and electrocompetent DH10B bacteria (Life Technoligies, 20 ml) were added to it. The mixture of bacteria and vector was then electroporated as recommended by the manufacturer. SOC medium (Life Technplogies, 1 ml) was then added and the mixture was incubated at 37 ° C for 30 minutes. The transformants were then plated on 20 standard 150 mm LB plates containing ampicillin and incubated for 16 hours (
37 ° C). Positive colonies were discarded from the plate and DNA was isolated from the bacterial pellet using standard methods, eg CsCl-gradient. The purified DNA was then loaded into the following yeast protocol. Yeast methods fall into three categories: (1) transformation of yeast with plasmid / cDNA binding vectors; (2) detection and isolation of amylase-secreting yeast clones;
And (3) PCR amplification of inserts directly from yeast colonies and purification of DNA for sequencing and further analysis. The yeast strain used was HD56-5A (ATCC-90785). This strain has the following genotypes: MATα, ura3-52, leu2-3, leu2-112, his3-1.
1, his3-15, MAL ⁺ , SUC ⁺ , GAL ⁺ . Preferably, a yeast mutant having an incomplete post-translational pathway can be used. Such mutants have translocation-deficient alleles at sec71, sec72, and sec62, with truncated sec71 being most preferred. Alternatively, antagonists (including antisense nucleotides and / or ligands) that inhibit the normal manipulation of these genes, other proteins involved in this post-translational pathway (eg, SEC61p, SEC72p
, SEC62p, SEC63p, TDJ1p or SSA1p-4p) or complex formation of these proteins is also preferably used in combination with the amylase-expressing yeast. Transformation was performed based on the protocol outlined in Gietz et al., Nucl. Acid. Res., 20: 1425 (1992). Transformed cells are then agar to YEPD
The complex medium broth (100 ml) was seeded and grown at 30 ° C. overnight. YEPD Broth is a product of Kaiser et al., Methods in Yeast Genetics, Cold Spring Harbor Press, Col.
d Spring Harbor, NY, p. 207 (1994). Overnight medium was then approximately 2 × 10 ⁶ cells / m 2 in fresh YEPD broth (500 ml).
1 (about OD ₆₀₀ = 0.1) and diluted to 1 × 10 ⁷ cells / ml (about OD ₆₀₀ = 0).
． It was regrown to 4-0.5).

The cells were then harvested, transferred to a GS3 rotor bottle in a Sorval GS3 rotor at 5,000 rpm for 5 minutes, discarded for supernatant and then prepared for transformation by resuspending in sterile water and 50 ml. Again in a Beckman GS-6KR centrifuge at 3,500 rpm in a Falcon tube. Discard the supernatant and transfer the cells to LiAc / TE (10 ml,
It was subsequently washed with 10 mM Tris-HCl, 1 mM EDTA pH 7.5, 100 mM Li ₂ OOCCH ₃ ) and resuspended in LiAc / TE (2.5 ml). For the transformation, the prepared cells (100 μl) were transferred to fresh denatured single-stranded salmon sperm DNA (Lofstrand Labs, Gaitherburg, MD) and transforming DNA (1 μg) in a microtube.
vol. <10 μl). The mixture was vortexed briefly and then 40% PEG / TE (600 μl, 40% polyethylene glycol-4).
000, 10 mM Tris-HCl, 1 mM EDTA, 100 mM Li ₂ OOCCH ₃ , pH 7.5) was added. The mixture was gently agitated and incubated at 30 ° C. with agitation for 30 minutes. The cells were then heat shocked at 42 ° C for 15 minutes and the reaction vessel was placed in a microtube.
Centrifuge at 12,000 rpm for 5-10 seconds, decant and resuspend in TE (500 μl, 10 mM Tris-HCl, 1 mM EDTA pH 7.5) and then centrifuge. The cells were then diluted in TE (1 ml) and aliquots (200 μl) were spread on 150 mm growth plates (VWR) in pre-prepared selective medium. Alternatively, instead of multiple small reactions, the transformation was performed in one large reaction, but the amount of reagents was scaled up accordingly. The selection medium used was Kaiser et al., Methods in Yeast Genetics, Cold Spring Har.
Synthetic complete dextrose agar lacking uracil (SCD-Ura) prepared as described by Bor Press, Cold Spring Harbor, NY, p. 208-210 (1994). Transformants were grown at 30 ° C for 2-3 days. Detection of colonies secreting amylase was performed by the inclusion of red starch in the selective growth medium. Starch was coupled to a red dye (reactive Red-120, Sigma) according to the method described by Biely et al., Anal. Biochem., 172: 176-179 (1988). Bound starch was introduced on SCD-Ura agar plates at a final concentration of 0.15% (w / v) and buffered to pH 7.0 with potassium phosphate (final concentration 50-100 mM). Positive colonies were picked and streaked on fresh selection medium (150 mm plates) to give well isolated and identifiable single colonies. Well-isolated single colonies positive for amylase secretion were detected by direct introduction of red starch into buffered SCD-Ura agar. Positive colonies were determined by their ability to degrade starch and form visible halos directly around the positive colonies.

4. Isolation of DNA by PCR Amplification When positive colonies were isolated, a portion was picked with a toothpick and diluted in sterile water (30 μl) in a 96-well plate. At this point, positive colonies are either frozen and either stored for subsequent analysis or immediately amplified. Aliquots of cells (5 μl) were added to 0.5 μl Klentaq (Clontech, Palo Alto, CA); 4.0 μl
10 mM dNTPs (Perkin Elmer-Cetus); 2.5 μl Kentaq buffer (Clontech); 0.2
Contains 5 μl forward oligo 1; 0.25 μl reverse oligo 2; 12.5 μl distilled water
Used as template for PCR reaction in 25 μl volume. The sequence of the forward oligonucleotide 1 was: 5'-TGTAAAACGACGGCCAGT TAAATAGACCTGCAATTATTAATCT- 3 '(SEQ ID NO: 1). The sequence of the inverted oligonucleotide 2 was: 5'- CAGGAAACAGCTATGACC ACCTGCACACCTGCAAATCCATT -3 '(SEQ ID NO: 2). PCR was then performed as follows: a. Denaturation 92 ° C, 5 minutes b. 3 cycles: denaturation 92 ° C, 30 seconds Annealing 59 ° C, 30 seconds Extension 72 ° C, 60 seconds c. 3 cycles: denaturation 92 ° C, 30 seconds Annealing 57 ° C, 30 seconds Extension 72 ° C, 60 seconds d. 25 cycles: denaturation 92 ° C, 30 seconds Annealing 55 ° C, 30 seconds Extension 72 ° C, 60 seconds e. Retention 4 ° C. The underlined regions of the oligonucleotide are annealed to the ADH promoter region and the amylase region, respectively, and vector pSS if no insert is present.
T-AMY. Amplify the 307 bp region from 0. Typically, the first 18 nucleotides at the 5'end of these oligonucleotides contained the sequence primer annealing site. That is, the total product of the PCR reaction from the empty vector is 3
It was 43 bp. However, the signal sequence fusion cDNA resulted in a rather long nucleotide sequence. Following PCR, an aliquot (5 μl) of the reaction was tested by agarose gel electrophoresis using a Tris-borate-EDTA (TBE) buffer system in a 1% agarose gel as described by Sambrook et al., Supra. . Single and strong PC larger than 400bp
The clones yielding the R product were cloned into a 96 Qiaquick PCR clean column (Qiagen Inc., Ch
Further analysis by DNA sequence after purification at atsworth, CA).

Example 3: Isolation of cDNA Clones Using Signal Algorithm Analysis Various polypeptide-encoding nucleic acid sequences are described in Genentech, Inc. (South San
The proprietary sequence-finding algorithm developed by Francisco, CA) can be used for public (eg GenBank) and / or personal (LIFESEQ®, Incyte Pharmaceuticals,
Inc., Palo Alto, CA) database and identified by applying to EST fragments and assembled and assembled EST fragments. The signal sequence algorithm is
Calculate the secretory signal score based on the letters of the DNA nucleotides surrounding the first and optionally the second methionine codon (ATG) at the 5'-end of the sequence or sequence fragment under consideration. The nucleotides following the first ATG must encode at least 35 unambiguous amino acids with no stop codon. If the first ATG has the required amino acids, the second is not tested. If neither met the requirements, the candidate sequences were not scored. In order to determine whether the EST sequence contains an authentic signal sequence, the DNA surrounding the ATG codon and the corresponding amino acid sequence were labeled with seven sensors known to be associated with secretory signals (
Scores were assigned using a set of (evaluation parameters). The use of this algorithm has led to the identification of many polypeptide-encoding nucleic acid sequences.

Example 4: Isolation of a cDNA clone encoding PRO196 PRO196 was cloned into the computer program BLAST (Altschul et al., Methods in Enz.
ymology 266: 460-480 (1996)) and identified by screening the GenBank database. The PRO196 sequence shows homology with the known expression sequence tag (EST) sequences T35448, T11442, and W77823. None of the known EST sequences have been identified as full length sequences or described as ligands that bind to the TIE receptor. Following its identification, NL1 was cloned into Clontech, Inc (Palo A
cloned from a human fetal lung library made from mRNA purchased from Catalog # 6528-1. The library was screened by hybridization with synthetic oligonucleotide probes based on the ESTs found in the GenBank database; (a) 5'-GCTGACGAACCAAGGCAACTACAAACTCCTGGT-3 '(SEQ ID NO: 5); (b) 5'-. TGCGGCCGGACCAGTCCTCCATGGTCACCAGGAGTTTGTAG-3 '(SEQ ID NO: 6); (c) 5'-GGTGGTGAACTGCTTGCCGTTGTGCCATGTAAA-3' (SEQ ID NO: 7) The nucleotide and amino acid sequences of PRO196 are Fig1 (SEQ ID NO: 3) and Fi.
It is shown in g2 (SEQ ID NO: 4), respectively. PRO196 shows significant sequence identity with TIE1 and TIE2 ligands. The PRO196 clone is the American Type Culture Collection,
10801 University Bluebird, Manassas, Virginia 20110-2209,
It was deposited with the United States (ATCC) on September 18, 1997 in accordance with the provisions of the Budapest Treaty and was given deposit number 209280.

Example 5: Isolation of a cDNA clone encoding human PRO444 The cDNA sequence isolated in the amylase screen was designated as DNA13121, as described in Example 2 above. An oligonucleotide probe was prepared based on this sequence and used to screen a human fetal lung library (LIB25) prepared as described in paragraph 1 of Example 2 above.
The cloning vector was pRK5B (pRK5B is a precursor of pRK5D that does not contain an SfiI site; see Holmes et al., Science, 253: 1278-1280 (1991)) and the cleaved cDNA size was less than 2800 bp. A full-length clone was identified, which contains a single open reading frame, has an apparent translational initiation site at nucleotide positions 608-610, and terminates at the stop codon at nucleotide positions 959-961 (Fig3; SEQ ID NO: 8).
. The predicted polypeptide precursor is 117 amino acids long, has a calculated molecular weight of approximately 12,692 and an estimated pI of approximately 7.50. Analysis of the full length PRO444 sequence shown in Figure 4 (SEQ ID NO: 9) demonstrated the presence of a signal peptide from amino acid 1 to about amino acid 16. Dayhoff database (version 35
.45 SwissProt 35), the PRO444 amino acid sequence and the following Dayhoff sequences: CEF44D12_8, P_R88452, YNE1_CAEEL, A47312, AF009957_1, and A_06133_1.
The homology between and was proved. Clone DNA26846-1397 was deposited with the ATCC on October 27, 1998 and is assigned ATCC deposit no.

Example 6: Human PRO183, PRO185, PRO9940, PRO2630
And isolation of cDNA clones encoding PRO6309 PRO183, PRO185, PRO9940, PRO26 shown in the attached figures.
DNA molecules encoding the 30 and PRO6309 polypeptides were obtained from GenBank.

Example 7: Isolation of cDNA clones encoding human PRO210 and PRO217 A consensus DNA sequence was assembled using phrap as described in Example 1 above. In some cases, this consensus sequence is blast and phr
The consensus sequence was extended as much as possible using the source of the EST sequences described above, using a repeated cycle of ap. Based on this consensus sequence, 1
Oligonucleotides were synthesized for use)) to identify a cDNA library containing the sequence of interest by PCR and 2) to be used as a probe to isolate clones of the full length coding sequence. The library used to isolate DNA32279-1131 was fetal kidney. The cDNA clone was sequenced in its entirety. The entire nucleotide sequence of DNA32279-1131 is shown in Figure 9 (SEQ ID NO: 14), and the amino acid sequence of PRO210 is shown in Figure 10 (SEQ ID NO: 15). The entire nucleotide sequence of DNA33094-1131 is shown in Figure 13 (SEQ ID NO: 21), and the amino acid sequence of PRO217 is shown in Figure 14 (SEQ ID NO: 22).

Example 8: Isolation of a cDNA clone encoding human 215 A consensus DNA sequence was constructed against other EST sequences as described in Example 1 above and the consensus sequence was designated as DNA28748. DNA2
CDNA containing the sequence of interest by PCR based on the 8748 consensus sequence
Oligonucleotides were synthesized to identify the A library and to be used as a probe to isolate clones of the full-length coding sequence of PRO215. PCR primer pairs (forward and reverse) were synthesized: forward PCR primer: 5'-GTGGCTGGCACACAATGAGATC-3 '(SEQ ID NO: 18); and reverse PCR primer: 5'-CCAATGTGTGCAAGCGGTTGTG-3' (SEQ ID NO: 19). In addition, a synthetic oligonucleotide hybridization probe was made from the consensus DNA28748 sequence with the following nucleotide sequence: Hybridization probe: 5'-TCAAGAGCCTGGACCTCAGCCACAATCTCATCTCTGACTTTGCCTGGAGC-3 '(SEQ ID NO: 20)
. To screen several libraries for sources of full-length clones, PCR the DNA from the libraries with the PCR primer pairs identified above.
Screened by amplification. Then, the positive library
PRO215 using one of the probe oligonucleotide and PCR primer
It was used to isolate clones encoding the gene. RNA for making a cDNA library was isolated from human fetal lung tissue. c
The cDNA library used for the isolation of the DNA clone is Invitrogen, San Dieg.
o, prepared by standard methods using commercially available reagents such as those from CA. cDN
A is primed with an oligo dT containing a NotI site, blunt-ended with a SalI hemikinase adapter, cut with NotI, roughly sized by gel electrophoresis, and a suitable cloning vector (such as pRKB or pRK5D; p
RK5B is a precursor of pRK5D that does not contain an SfiI site; Holmes et al., Scie.
nce, 253: 1278-1280 (1991)) at the unique XhoI and NotI sites in the desired orientation. By DNA sequencing of the clones isolated as described above, the DNA
32288-1132 and full-length DNA sequence of PRO215 and PRO2
Fifteen derived protein sequences were obtained. The entire nucleotide sequence of DNA32288-1132 is shown in Figure 11 (SEQ ID NO: 1).
6). Clone DNA32288-1132 contains a single open reading frame, has an apparent translational initiation site at nucleotide positions 308-310, and terminates at the stop codon at nucleotide positions 1591-1593 (Fi
g11, start and stop codons are circled). The predicted polypeptide precursor is 428 amino acids long (Fig12). Clone DNA32288-1132 has been deposited with the ATCC and is assigned ATCC deposit no. Analysis of the amino acid sequence of full-length PRO215 showed that it shares homology with members of the leucine-rich repeat protein superfamily, including leucine-rich repeat proteins and SLIT proteins.

Example 9: Isolation of a cDNA clone encoding human PRO242 Expression sequence tag (EST) DNA database (LIFESEQ ^™ , Incyte Pharmaceuti
cals, Palo Alto, CA) to identify ESTs that showed homology with chemokines. Based on this sequence, oligonucleotides were synthesized to identify a cDNA library containing the sequence of interest by PCR and as a probe to isolate clones of the full length coding sequence for PRO242. A PCR primer pair (forward and reverse) was synthesized: Forward PCR primer 5'-GGATCAGGCAGGAGGAGTTTGGG-3 '(SEQ ID NO: 25) Reverse PCR primer 5'-GGATGGGTACAGACTTTCTTGCC-3' (SEQ ID NO: 26) A synthetic oligonucleotide hybridization probe was made from the consensus DNA28709 sequence with the following nucleotide sequence: Hybridization probe 5'-ATGATGGGCCTCTCCTTGGCCTCTGCTGTGCTCCTGGCCTCCCTCCTGAG-3 '(SEQ ID NO: 27). To screen several libraries against a source of full-length clones, the DNA from the libraries was treated with PC with the PCR primer pairs identified above.
Screened by R amplification. The positive library was then used to isolate clones encoding the PRO242 gene using one of the probe oligonucleotides and PCR primers. RNA for the construction of a cDNA library was isolated from human fetal lung tissue. The cDNA clone was sequenced in its entirety. The entire nucleotide sequence of DNA33785-1143 is shown in Figure 15 (SEQ ID NO: 23). Clone DNA3378
5-1143 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 333-335 and nucleotide positions 615-617.
Ends with a stop codon (Fig16; SEQ ID NO: 24). The predicted polypeptide precursor is 94 amino acids long (Fig 16). Based on BLAST (using the ALIGN computer program) and FastA sequence alignment analysis of the full-length sequence, PRO242 shows that human macrophage inflammatory protein 1-alpha, rabbit macrophage inflammatory protein 1-beta, human LD7.
8 and amino acid sequence identity with rabbit immune activation gene 2.

Example 10: Isolation of a cDNA clone encoding human PRO288 A sequence encoding the DcR1 ECD [Sheridan et al., Supra] and having the following sequence: 5'-CATAAAAGTTCCTGCACCATGACCAGAGACACAGTGTGTCAGTGTAAAGA-3 '(SEQ ID NO: 30). Was used to screen a human fetal lung cDNA library. To generate a cDNA library, mRNA was isolated from human fetal lung tissue using reagents and protocols from Invitrogen, San Diego, CA (Fast Track 2). This RNA is used in Life Technologies, Gaithersbur
g, MD (Super Script Plasmid system) and used to generate oligo dT primed cDNA in vector pRK5D using reagents and protocols.
In this method, double-stranded cDNA was size-classified to over 1000 bp and Sa
The lI / NotI binding cDNA was cloned into the XhoI / NotI cut vector. pRK5D with sp6 transcription start site followed by SfiI restriction enzyme site,
Further, it was cloned into a vector having an XhoI / NotI cDNA cloning site. A full-length clone was identified (DNA35663-1129) that contains a single open reading frame with an apparent translational initiation site at nucleotide positions 157-159 and ending at the stop codon found at nucleotide positions 1315-1317. (FIG. 17; SEQ ID NO: 28). This clone is pRK5-356
63 and is deposited as ATCC No. 209201. The predicted polypeptide precursor is 386 amino acids long and is approximately 41.8 kDa.
It has a calculated molecular weight of. Sequence analysis revealed an N-terminal signal peptide (amino acids 1-55), followed by ECD (amino acids 56-212), a transmembrane domain (amino acids 21).
3-232) and the intracellular region (amino acids 233-386) were shown (Fig 18).
The signal peptide cleavage site was confirmed by N-terminal protein sequence analysis of PRO288ECD immunoadhesin (not shown). This structure suggests that PRO288 is a type I transmembrane protein. PRO288 contains three potential N-linked glycosylation sites at amino acid positions 127, 171, and 182 (Fi
g18). TNF receptor family proteins are typically characterized by the presence of multiple (usually four) cysteine-rich domains in their extracellular region, each cysteine-rich domain being approximately 45 amino acids in length and having approximately six rules. Cysteine residues that are spatially separated. Based on the crystal structure of the type I TNF receptor, the cysteines in each domain form three disulfide bonds, with cysteines 1 and 2, 3 and 5, and 4 and 6 usually linked. Similar to DR4, DR5 and DcR1, PRO288 is an extracellular cysteine-rich pseudo-repeat (pse).
udorepeat), but other identified members of the mammalian TNFR family contain three or more such domains [Smith et al., Cell, 76: 959.
(1994)]. Based on the alignment analysis of the PRO288 sequence shown in Figure 18 (SEQ ID NO: 29), PRO288 is associated with other apoptosis-related receptors such as TNFR1.
, E4 of DR4, DR5 or DcR1 rather than Fas / Apo-1 or DR3
Showed high sequence identity to. The predicted intracellular sequence of PRO288 also shows T
It shows high homology to the corresponding region of DR4 or DR5 compared to NFR1, Fas or DR3. The intracellular region of PRO288 is about 50 residues shorter than the intracellular region identified for DR4 or DR5. PRO288 is now believed to contain a truncated death domain (amino acids 340-364), which corresponds to the carboxy-terminal portion of the death domain sequence of DR4 or DR5. Five of the 6 amino acids required for signal transduction by TNFR1 [Tartaglia et al., Supra] and retained or semi-retained in DR4 and DR5 are absent in PRO288.

Example 11: Isolation of a cDNA clone encoding human PRO365 A consensus DNA sequence was assembled with other EST sequences using phrap as described in Example 1 above. This consensus sequence is now DNA356
Name it 13. Based on the DNA35613 consensus sequence, 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) PRO
For use as a probe to isolate a clone of the 365 full length coding sequence,
Oligonucleotides were synthesized. Forward and reverse PCR primers were synthesized as follows: Forward PCR primer 5'-GGCTGGCCTGCAGAGATC-3 '(SEQ ID NO: 33) Forward PCR primer 5'-AATGTGACCACTGGACTCCC-3' (SEQ ID NO: 34) Positive Direction PCR primer 5'-AGGCTTGGAACTCCCTTC-3 '(SEQ ID NO: 35) Reverse PCR primer 5'-AAGATTCTTGAGCGATTCCAGCTG-3' (SEQ ID NO: 36) Furthermore, a synthetic oligonucleotide hybridization probe having the following nucleotide sequence was used as consensus DNA35613. Created from an array. Hybridization probe 5'-AATCCCTGCTCTTCATGGTGACCTATGACGACGGAAGCACAAGACTG-3 '(SEQ ID NO: 37) To screen several libraries for a source of full-length clones, the DNA from the library was labeled with one of the PCR primer pairs identified above. Were screened by PCR amplification. The positive library was then used to isolate clones encoding the PRO365 gene using the probe oligonucleotide and one of the PCR primer pairs. RNA for making a cDNA library was isolated from human fetal kidney tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO365 [herein designated as DNA46777-1253] (SEQ ID NO: 31) and the derived protein sequence for PRO365. The entire nucleotide sequence of DNA46777-1253 is shown in Figure 19 (SEQ ID NO: 3).
It is shown in 1). DNA46777-1253 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 15-17 and ending at the stop codon at nucleotide positions 720-722 (Fig 19). The predicted polypeptide precursor is 235 amino acids long (Figure 20). Clone DNA46
Key regions of the polypeptide sequence encoded by 777-1253 have been identified, which include: a signal peptide corresponding to amino acids 1-20, and multiple potential N-glycosylation sites. Clone DNA46777-1253 is A
Deposited with TCC and assigned ATCC deposit no. 209619. Analysis of the amino acid sequence of the full-length PRO365 polypeptide suggests that that portion has significant homology to human 2-19 protein, and PRO365
Is a novel human 2-19 protein homolog.

Example 12: Isolation of a cDNA clone encoding human PRO1361 Identification of an EST cluster sequence from the Incyte database, designated Incyte cluster number 10685, using the signal sequence algorithm described in Example 3 above. Became possible. This EST cluster sequence is then converted into a public ES
T databases (eg GenBank) and corporate EST DNA databases (LIFESE
Existing homology was identified by comparison with various expressed sequence tag (EST) databases, including Q (trade name), Incyte Pharmaceuticals, Palo Alto, CA). The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymolog.
y 266: 460-480 (1996)). BL does not code for known proteins
Comparables with an AST score of 70 (sometimes 90) or higher are programs "p
hrap "(Phil Green, University of Washington, Seattle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA58839. In view of the sequence homology between the DNA58839 sequence and the EST sequence contained within Incyte EST clone no. 2967927, Incyte EST clone no. 2967.
927 was purchased and the cDNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 21 and is herein designated as DNA60783-1611. Clone DNA60783-1611 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 142-144 and ending at the stop codon at nucleotide positions 1132-1134 (Fig21).
The predicted polypeptide precursor is 330 amino acids long (Figure 22). Fig
The full-length PRO1361 protein shown in 22 has a calculated molecular weight of approximately 36,840 daltons and a pI of approximately 4.84. Full length P shown in Fig22 (SEQ ID NO: 39)
Analysis of the RO1361 sequence revealed the presence of the following: about amino acids 1-
A signal peptide of about amino acid 23, a transmembrane domain of about amino acid 266 to about amino acid 284, a leucine zipper pattern sequence of about amino acid 155 to about amino acid 176, and about amino acid 46 to about amino acid 49, about amino acid 64 to about amino acid 6
7, about amino acid 166 to about amino acid 169 and about amino acid 191 to about amino acid 1
94 potential N-glucosylation sites. Clone DNA60783-1611 is 19
It was deposited with the ATCC on August 18, 1998 and is assigned ATCC deposit no. By analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis of the full length sequence shown in Figure 22 (SEQ ID NO: 39), the PRO1361 amino acid sequence and the following Dayhoff sequences: I50620, G64876, PMC.
Significant homology between MSG102B_2MSG104, HUMIGLVXY_1 and PH1370 was revealed.

Example 13: Isolation of a cDNA clone encoding human PRO1308 Consensus DNA sequences were assembled to other EST sequences using phrap as described in Example 1 above. The consensus sequence was extended using repeated cycles of BLAST and phrap, and the consensus sequence was extended as much as possible using the sources of EST sequences discussed above. The extended consensus sequence is now referred to as "DN
A35726 ". 1 based on the DNA35726 consensus sequence
Oligonucleotides were synthesized for use)) to identify a cDNA library containing the sequence of interest by PCR and 2) to be used as a probe to isolate clones of the full-length coding sequence of PRO1308. The following primers (forward and reverse) were synthesized: Forward PCR primer 5'-TCCTGTGAGCACGTGGTGTG-3 '(SEQ ID NO: 42) 5'-GGGTGGGATAGACCTGCG-3' (SEQ ID NO: 43) 5'-AAGGCCAAGAAGGCTGCC-3. 5'-CCAGGCCTGCAGACCCAG-3 '(SEQ ID NO: 45) Reverse PCR primer 5'-CTTCCTCAGTCCTTCCAGGATATC-3' (SEQ ID NO: 46) 5'-AAGCTGGATATCCTCCGTGTTGTC-3 '(SEQ ID NO: 45) 47) 5'-CCTGAAGAGGCATGACTGCTTTTCTCA-3 '(SEQ ID NO: 48); and 5'-GGGGATAAACCTATTAATTATTGCTAC-3' (SEQ ID NO: 49) Furthermore, a synthetic oligonucleotide hybridization probe having the following nucleotide sequence was prepared from the DNA35726 consensus sequence. did. Hybridization probe: 5'-AACGTCACCTACATCTCCTCGTGCCACATGCGCCAGGCCACCTG-3 '(SEQ ID NO: 50) To screen several libraries for the source of the full length clone, PCR with the PCR primer pairs identified above from the DNA from the libraries.
Screened by amplification. The positive library was then used to isolate clones encoding the PRO1308 gene using the probe oligonucleotide and one of the PCR primer pairs. RNA for making a cDNA library was isolated from the human SK-Lu-1 adenocarcinoma cell line. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1308 (herein designated as DNA62306-1570 [Fig23, SEQ ID NO: 40] and the derived protein sequence for PRO1308. The entire code for PRO1308. The sequence is shown in Figure 23 (SEQ ID NO: 40) Clone DNA62306-1570 contains a single open reading frame
Apparent translational initiation site at nucleotide positions 17-19, nucleotide positions 806-
It has a stop codon at 808. The predicted polypeptide precursor is 263 amino acids long. The full-length PRO1308 protein shown in Figure 24 has a calculated molecular weight of approximately 27,663 and a pI of approximately 6.77. A further feature is about amino acid 1-
A signal peptide at 20, a potential N at about amino acids 73-76 and 215-218.
-Includes a glycosylation site and a region of homology to osteonectin at about amino acids 97-129 and 169-201. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using WU-BLAST2 sequence alignment analysis of the full length sequence shown in Figure 24 (SEQ ID NO: 41) revealed significant homology between the PRO1308 amino acid sequence and the following Dayhoff sequence S55369. Became clear. In addition, the PRO1308 amino acid sequence and the following Da
yhoff array: FAS_HUMAN, P_R20063, CELT13C2_1, AGRI_RAT, p_W09406, G01639,
Homology between SC1_RAT, S60062, S51362, and IOV_CHICK was also revealed. Clone DNA62306-1570 has been deposited with the ATCC and is assigned ATCC deposit no. 203254.

Example 14: Isolation of a cDNA clone encoding human PRO1183 The use of the signal sequence algorithm described in Example 3 above enabled the identification of EST cluster sequences from the Incyte database. Then this ES
The T cluster sequences are stored in public EST databases (eg GenBank) and corporate E
STDNA database (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alt
o, CA) were compared to various expressed sequence tag (EST) databases to identify existing homologies. The homology search is performed by the computer program BLAST or BLAST2 (Alts
chul et al., Methods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher are the programs "phrap" (Phil Green, University of Washington.
(Seattle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA56037. DNA56037 sequence (from a library constructed from prostate tumor tissue)
In light of the sequence homology with the EST sequences contained within Incyte EST 1645856, EST 1645856 was purchased and the cDNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 25, where DNA62880-1513
To name. The full-length clone shown in Figure 25 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 20-22, and ending at the stop codon at nucleotide positions 1535-1537 (Fig25; SEQ ID NO: 5).
1). The predicted polypeptide precursor (Fig26, SEQ ID NO: 52) is 505 amino acids long. The signal peptide is about amino acids 1-23 of SEQ ID NO: 52. PRO1183 has a calculated molecular weight of about 56,640 daltons and an estimated p of about 6.1.
I have. Clone DNA62880-1513 was AT on August 4, 1998
Deposited to CC and designated ATCC Deposit No. 203097. By analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis of the full length sequence shown in Figure 26 (SEQ ID NO: 52), the PRO1183 amino acid sequence and the following Dayhoff sequences: MTV010_1, P_W41604.
, S54021, AOFB_HUMAN, NPAJ4683_1, S74689, GEN13608, ACHC_ACHFU, AB011173
Sequence identity between _1 and PUO_MICRU was revealed. It is believed that administration of PRO1183 or its regulators can treat certain oxidase diseases, such as polymorphic porphyria.

Example 15: Isolation of a cDNA clone encoding human PRO1272 The use of the signal sequence algorithm described in Example 3 above enabled the identification of EST cluster sequences from the Incyte database. Then this ES
The T cluster sequences are stored in public EST databases (eg GenBank) and corporate E
STDNA database (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alt
o, CA) were compared to various expressed sequence tag (EST) databases to identify existing homologies. The homology search is performed by the computer program BLAST or BLAST2 (Alts
chul et al., Methods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher are the programs "phrap" (Phil Green, University of Washington.
(Seattle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA58753. In view of the sequence homology between the DNA58753 sequence and the EST sequences contained within EST3049165, EST3049165 was included (from lung library).
The cyte clone was purchased and the cDNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 27 and is herein designated as DNA64896-1539. The full-length clone shown in Figure 27 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 58-60 and ending at the stop codon at nucleotide positions 556-558 (Fig27; SEQ ID NO: 53).
. The predicted polypeptide precursor (Fig28, SEQ ID NO: 54) is 166 amino acids long. The signal peptide is about amino acids 1-23 of SEQ ID NO: 54.
PRO1272 has a calculated molecular weight of approximately 19,171 daltons and an estimated pI of approximately 8.26.
Have. Clone DNA64896-1539 was ATC on September 9, 1998.
It has been deposited with C and is assigned ATCC deposit no. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using WU-BLAST2 sequence alignment analysis of the full length sequence shown in Figure 28 (SEQ ID NO: 54) revealed that the PRO1272 amino acid sequence and the following Dayhoff sequence (from the database introduced here) (Information): AF025474_1, D69100, AE000757_10, H69466, CELC50E3_1
2, sequence identity between XLRANBP1_1, YD67_SCHPO, B69459, H36856, and FRU40755_1 was revealed.

Example 16: Isolation of a cDNA clone encoding human PRO1419 The use of the signal sequence algorithm described in Example 3 above enabled the identification of EST cluster sequences from the Incyte database. Then this ES
The T cluster sequences are stored in public EST databases (eg GenBank) and corporate E
STDNA database (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alt
o, CA) were compared to various expressed sequence tag (EST) databases to identify existing homologies. One or more ESTs were derived from a diseased tonsil tissue library. The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al., Me.
thods in Enzymology 266: 460-480 (1996)). A comparison that does not encode a known protein and has a BLAST score of 70 (sometimes 90) or higher is the program "phrap" (Phil Green, University of Washington, Seattle,
Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA59761. In view of the sequence homology between the DNA59761 sequence and the EST sequence contained within Incyte EST3815808, a clone containing this EST was purchased, a cDNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 29 and is herein designated as DNA71290-1630. The full-length clone shown in Figure 29 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 86-88, and ending at the stop codon at nucleotide positions 341-343 (Fig29; SEQ ID NO: 55).
. The predicted polypeptide precursor (Fig30, SEQ ID NO: 56) is 85 amino acids long and the signal peptide is about amino acids 1-17 of SEQ ID NO: 56. P
RO1419 has a calculated molecular weight of about 9,700 daltons and an estimated pI of about 9.55. Clone DNA71290-1630 was cloned into ATCC on September 22, 1998.
And has been assigned ATCC deposit no. 203275. By analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis of the full length sequence shown in Figure 30 (SEQ ID NO: 56), the PRO1419 amino acid sequence and the following Dayhoff sequence (data introduced here): S07975 (B3-hordein), C48232, HOR7_HORVU, GEN11764, S14970, AF020312_
1, sequence identity between STAJ3220_1, CER07E3_1, CEY37A1B, and ATAC00423810 was revealed.

Example 17: Isolation of a cDNA clone encoding human PRO4999 A consensus DNA sequence was assembled against other EST sequences using phrap as described in Example 1 above. The consensus sequence is herein designated DNA86634. Based on the DNA86634 consensus sequence, 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) PRO499.
Oligonucleotides were synthesized for use as probes to isolate 9 full length coding sequence clones. The following primers (forward and reverse) were synthesized: Forward PCR primer 5'-CCACTTGCCATGAACATGCCAC-3 '(SEQ ID NO: 59) Reverse PCR primer 5'-CCTCTTGACAGACATAGCGAGCCAC-3' (SEQ ID NO: 60) A synthetic oligonucleotide hybridization probe with the following nucleotide sequence was made from the DNA86634 sequence. Hybridization probe: 5'-CACTCTTGTCTGTGGGAACCACACATCTTGCCACAACTGTGGC-3 '(SEQ ID NO: 61) RNA for cDNA library construction was isolated from human testis tissue. DNA sequencing of the clones isolated as described above revealed the full-length PRO4999.
Was obtained (herein designated as DNA96031-2664 [Fig31, SEQ ID NO: 57]) and the derived protein sequence of PRO4999 polypeptide. The full length clone identified above contains a single open reading frame with an apparent translational initiation site at nucleotide positions 42-44, nucleotide position 2
It has a stop codon at 283-2285 (Fig 31, SEQ ID NO: 57). The predicted polypeptide precursor is 747 amino acids long, has a calculated molecular weight of about 82,710 and an estimated pI of about 6.36. Analysis of the full-length PRO4999 sequence shown in Figure 32 (SEQ ID NO: 58) demonstrates the presence of various important polypeptide domains shown in Figure 32, and the positions assigned to those important polypeptide domains are outlined above. belongs to. Clone DNA96031-2664
Deposited with the ATCC on June 15, 1999, ATCC Deposit No. 237-PT
A was given. By analysis of the Dayhoff database (version 35.45 SwissProt 35) using the ALIGN-2 sequence alignment analysis of the full length sequence shown in Figure 32 (SEQ ID NO: 58), the PRO4999 amino acid sequence and the following Dayhoff sequence: UROM_HUMAN; FBN1_HUMA
N; GGU88872_1; S52111; GEN12408; P_R79478; P_W48756; P_R53087; P_R14584
And S78549 sequence identity was demonstrated.

Example 18: Isolation of a cDNA clone encoding human PRO7170 By using the signal sequence algorithm described in Example 3 above, where C
Incyte Pharmaceut, LIFESEQ (trade name) database, named LU57836
Identification of EST cluster sequences from icals, Palo Alto, became possible. This EST cluster sequence is then transformed into a public EST database (eg GenBank) and a corporate EST DNA database (LIFESEQ (trade name), Incyte Pharmaceuticals,
Existing homology was identified by comparison with various expressed sequence tag (EST) databases, including Palo Alto, CA). The homology search is performed by the computer program BLAST or BLA.
It was performed using ST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher can be found in the program "phrap" (Phil Green, University of Wa
shington, Seattle, Washington) were assembled to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA58756. DNA58756 sequence and LIFESEQ (trade name) database, Incyte Pharmaceut
In view of the sequence homology with the EST sequence contained within clone number 2251462 from icals, Palo Alto, clone number 2251462 was purchased and the cDNA insert was obtained and sequenced. It was found here that the cDNA insert encodes the full length protein. The sequence of this cDNA insert is shown in Figure 33 and is herein designated as DNA108722-2743. Clone DNA108722-2743 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 60-62 and ending at the stop codon at nucleotide positions 1506-1508 (Fig 33). The predicted polypeptide precursor is 482 amino acids long (Figure 34). Fig3
The full-length PRO7170 protein shown in 4 has a calculated molecular weight of about 49,060 daltons and a pI of about 4.74. Full-length PRO shown in Figure 34 (SEQ ID NO: 63)
Analysis of the 7170 sequence demonstrated the presence of various important polypeptide domains shown in Figure 34, where the positions assigned to those important polypeptide domains are outlined as described above. Clone DNA108722-2743 is 1
It was deposited with the ATCC on August 17, 1999 and was assigned ATCC deposit no. 552-PTA. By analysis of the Dayhoff database (Version 35.45 SwissProt 35) using the ALIGN-2 sequence alignment analysis of the full length sequence shown in Figure 34 (SEQ ID NO: 63), the PRO7170 amino acid sequence and the following Dayhoff sequences: P_Y12291, I47141, D88.
733_1, DMC56G7_1, P_Y11606, HWP1_CANAL, HSMUC5BEX_1, HSU78550_1, HSU7013
Sequence identity was demonstrated between 6_1 and SGS3_DROME.

Example 19: Isolation of a cDNA clone encoding human 248 The consensus DNA sequence was identified with another identified E as described in Example 1 above.
Constructed against the ST sequence, this consensus sequence was designated as DNA33481. Oligonucleotides were synthesized based on the DNA33481 consensus sequence to identify a cDNA library containing the sequence of interest by PCR and to be used as a probe to isolate clones of the PRO248 full-length coding sequence. In particular, the following primers were used: Forward primer 1: (SEQ ID NO: 66): 5'-GTCTGACAGCCACTCCAGAG-3 'Hybridization probe (SEQ ID NO: 67): 5'-TCTCCAATTTCTGGGCTTAGATAAGGCGCCTTCACCCCAGAAGTTCC-3' Reverse primer 1 ( SEQ ID NO: 68): 5'-GTCCCAGGTTATAGTAAGAATTGG-3 'forward primer 2 (SEQ ID NO: 69): 5'-GTGTTGCGGTCAGTCCCATG-3' forward primer 3 (SEQ ID NO: 70): 5'-GCTGTCTCCCATTTCCATGC-3 'reverse Directional Primer 2 (SEQ ID NO: 71): 5'-CGACTACCATGTCTTCATAATGTC-3 'To screen several libraries for the source of the full length clone, PCR the DNA from the libraries with the PCR primer pair identified above.
Screened by amplification. Then, the positive library
PRO248 with one of probe oligonucleotides and PCR primers
It was used to isolate clones encoding the gene. RNA for making a cDNA library was isolated from human fetal kidney tissue. By DNA sequencing of the clones isolated as described above, PRO248
Full-length DNA sequence [designated here as DNA35674-1142] and PRO248
Of the derived protein sequence was obtained. The entire nucleotide sequence of DNA35674-1142 is shown in Fig35 (SEQ ID NO: 6).
4). Clone DNA35674-1142 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 66-68, and ending at the stop codon at nucleotide positions 1217-1219 (Fig3.
5; SEQ ID NO: 64). The predicted polypeptide precursor is 364 amino acids long (Figure 36). Clone DNA35674-1142 is October 28, 1997.
It was deposited with the ATCC on the day and was assigned ATCC deposit no. Analysis of the amino acid sequence of full length PRO248 suggested that it has some amino acid sequence identity with growth differentiation factor 3 from human and mouse.

Example 20: Isolation of a cDNA clone encoding human PRO353 A consensus DNA sequence was assembled against other EST sequences using phrap as described in Example 1 above. This consensus sequence is now DNA363
Name it 63. The consensus DNA sequence was extended using repeated BLAST and phrap cycles and the consensus sequence was extended as much as possible using the source of the EST sequences discussed above. 1) P based on DNA36363 consensus sequence
To identify a cDNA library containing the sequence of interest by CR, and 2)
Oligonucleotides were synthesized for use as probes to isolate clones of the full-length coding sequence for PRO353. Based on the DNA36363 consensus sequence, forward and reverse PCR primers were synthesized as follows: forward PCR primer 5'-TACAGGCCCAGTCAGGACCAGGGG-3 '(SEQ ID NO: 74) reverse PCR primer 5'-CTGAAGAAGTAGAGGCCGGGCACG-3'. (SEQ ID NO: 75) Further, a synthetic oligonucleotide hybridization probe having the following nucleotide sequence was prepared from the DNA36363 consensus sequence. Hybridization probe 5'-CCCGGTGCTTGCGCTGCTGTGACCCCGGTACCTCCATGTACCCGG-3 '(SEQ ID NO: 76) To screen several libraries for a source of full-length clones, PCR from the PCR primer pairs identified above with DNA from the libraries
Screened by amplification. The positive library was then used to isolate clones encoding the PRO353 gene using the probe oligonucleotide and one of the PCR primer pairs. RNA for making a cDNA library was isolated from human fetal kidney tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO353 [herein designated as DNA41234-1242] (SEQ ID NO: 72) and the derived protein sequence for PRO353. The entire nucleotide sequence of DNA41234-1242 is shown in Fig37 (SEQ ID NO: 7).
2). Clone DNA41234-1242 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 305-307 and ending at the stop codon at nucleotide positions 1148-1150 (Figure 37).
). The predicted polypeptide precursor is 281 amino acids long (Figure 38). P
The critical region of the amino acid sequence encoded by RO353 is amino acids 1-26.
Corresponding to the signal peptide, the start of the mature protein at amino acid position 27, the potential N-glycosylation site corresponding to amino acids 93-98 and amino acids 99-281.
Corresponding to the 30 kd adipocyte complement-related protein precursor region. Clone DNA41234-1242 has been deposited with the ATCC
C deposit number 209618 has been assigned. Analysis of the amino acid sequence of the full-length PRO353 polypeptide suggests that those portions have significant homology to some of the human and mouse complement proteins, confirming that PRO353 is a novel complement protein. Shows.

Example 21: Isolation of a cDNA clone encoding human PRO1318 c corresponding to DNA73838-1674 shown in Figure 39 (SEQ ID NO: 77).
DNA molecules were obtained from Curagen, Inc.

Example 22: Isolation of a cDNA clone encoding human PRO1600 Consensus DNA sequences were assembled to other EST sequences using phrap as described in Example 1 above. This consensus sequence is now DNA755
Name it 16. The consensus DNA sequence was extended using repeated BLAST and phrap cycles and the consensus sequence was extended as much as possible using the source of the EST sequences discussed above. 1) P based on the DNA75516 consensus sequence
To identify a cDNA library containing the sequence of interest by CR, and 2)
Oligonucleotides were synthesized for use as probes to isolate clones of the PRO1600 full length coding sequence. Oligonucleotide primers were synthesized based on the DNA75516 consensus sequence as follows: 5'-AGACATGGCTCAGTCACTGG-3 '(SEQ ID NO: 81) 5'-GACCCCTAAAGGGCCATAG-3' (SEQ ID NO: 82) For the source of the full length clone. To screen several libraries, DNA from the libraries was screened with the probes identified above. RNA for making a cDNA library was isolated from human fetal heart tissue. By DNA sequencing of the clones isolated as described above, the full-length DNA sequence of PRO1600 [herein designated as DNA77503-1686] (SEQ ID NO: 79)
And the derived protein sequences of PRO1600 were obtained. The entire nucleotide sequence of DNA77503-1686 is shown in Figure 41 (SEQ ID NO: 7).
9). Clone DNA77503-1686 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 6-8 and ending at the stop codon at nucleotide positions 408-410 (Fig 41). The predicted polypeptide precursor is 134 amino acids long (Fig42). PRO1600
The important region of the amino acid sequence encoded by is shown in FIG. Clone D
NA77503-1686 has been deposited with the ATCC, ATCC Deposit No. 20336
2 was given.

Example 23: Isolation of a cDNA clone encoding human PRO533 Mouse Fibroblast Growth Factor (FG) EST Sequence Deposit No. AF007268
F-15) was used to search various public EST databases (eg GenBank, Dayhoff, etc.). The search is performed by the computer program BLAST or BLAST-2 [Altsch
ul et al., Methods in Enzymology 266: 460-480 (1996)] as a comparison of the ECD protein sequence with a 6-frame translation of the EST sequence. Search results for GenB
AnkEST AA220994 was hit and identified as Stratagene NT2 neuronal precursor 937230. Oligonucleotides were synthesized based on the GenBank EST AA220994 sequence for 1) identifying a cDNA library containing the sequence of interest by PCR, and 2) using it as a probe to isolate clones of the full length coding sequence. The forward and reverse PCR primers can range from 20 to 30 nucleotides (typically about 24) and are designed to yield PCR products 100-1000 bp in length. The probe sequence is typically 40-55 bp (typically about 50) in length. To screen several libraries for a source of full-length clones, DNA from the libraries was PCR-paired with Ausubel
Et al., Current Protocols in Molecular Biology, screened by PCR amplification. The positive library was then used to isolate clones encoding the gene of interest using one of the probe oligonucleotides and PCR primers. To screen several libraries for a source of full-length clones, PCR the DNA from the libraries with the PCR primer pairs identified above.
Screened by amplification. The positive library was then used to isolate clones encoding the PRO533 gene using probe oligonucleotides and one of the PCR primers. RNA for the construction of the cDNA library was isolated from human fetal retina. c
The cDNA library used for the isolation of the DNA clone is a commercially available reagent (for example, Invit
rogen, San Diego, CA; Clontech, etc.). The cDNA was primed with oligo dT containing a NotI site and blunt-ended with Sal.
Ligated to the I hemikinase adapter, cut with NotI, roughly sized by gel electrophoresis and labeled with an appropriate cloning vector (eg pRKB or p
RKD et al .; pRK5B is a precursor of pRK5D that does not contain the SfiI site; Ho
lmes et al., Science, 253: 1278-1280 (1991)), a unique XhoI and Not
At the I site, cloning was performed in the specified orientation. The cDNA clone was sequenced in its entirety. The full-length nucleotide sequence of PRO533 is shown in Fig45 (SEQ ID NO: 85). Clone DNA49435-121
9 contains a single open reading frame at nucleotide position 459-4
It has an apparent translational initiation site at 61 (Fig45; SEQ ID NO: 85). The predicted polypeptide precursor is 216 amino acids long. Cloned DNA47412-1
219 has been deposited with the ATCC and has been assigned ATCC deposit no. Based on BLAST-2 and FastA sequence alignment analysis of the full length sequence, PRO53
3 shows amino acid sequence identity with fibroblast growth factor (53%). The oligonucleotide sequence used in the above procedure was: FGF15.Positive: 5'-ATCCGCCCAGATGGCTACAATGTGTA-3 '(SEQ ID NO: 87); FGF15.Probe: 5'-GCCTCCCGGTCTCCCTGAGCAGTGCCAAACAGCGGCAGTGTA-3' (SEQ ID NO: 88): FGF15. Inverse: 5'-CCAGTCCGGTGACAAGCCCAAA-3 '(SEQ ID NO: 89).

Example 24: Isolation of a cDNA clone encoding human PRO301 As described in Example 1 above, phrap was used to assemble a consensus DNA sequence, herein designated DNA35936. Based on this consensus sequence, oligonucleotides were synthesized for 1) identification of a cDNA library containing the sequence of interest by PCR, and 2) use as a probe to isolate clones of the full length coding sequence. To screen several libraries for a source of full-length clones, PCR the DNA from the libraries with the PCR primer pairs identified above.
Screened by amplification. The positive library was then used to isolate clones encoding the PRO301 gene using one of the probe oligonucleotides and PCR primers. RNA for the construction of the cDNA library was isolated from human fetal kidney. The cDNA clone was sequenced in its entirety. The full-length nucleotide sequence of native sequence PRO301 is shown in Figure 47 (SEQ ID NO: 90). Clone DNA4062
8-1216 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 52-54 (Fig47; SEQ ID NO: 90). The predicted polypeptide precursor is 299 amino acids long, has a predicted molecular weight of 32,583 daltons and a pI of 8.29. Clone DNA40628-1216 is ATC
Deposited at C and assigned ATCC Deposit No. 209432. Based on BLAST and FastA sequence alignment analysis of full length sequences, PRO301
Shows amino acid sequence identity with the A33 antigen precursor (30%) and the Coxsackie and adenovirus receptor proteins (29%). The oligonucleotide sequence used in the above procedure was as follows: OLI2162 (35936.f1) 5'-TCGCGGAGCTGTGTTCTGTTTCCC-3 '(SEQ ID NO: 92) OLI2163 (35936.p1) 5'-TGATCGCGATGGGGACAAAGGCGCAAGCTCGAGAGGAAACTGTTGTGCCT-3'. (SEQ ID NO: 93) OLI2164 (35936.f2) 5'-ACACCTGGTTCAAAGATGGG-3 '(SEQ ID NO: 94) OLI2165 (35936.r1) 5'-TAGGAAGAGTTGCTGAAGGCACGG-3' (SEQ ID NO: 95) OLI2166 (35936.f3) 5'-TTGCCTTACTCAGGTGCTAC-3 '(SEQ ID NO: 96) OLI2167 (35936.r2) 5'-ACTCAGCAGTGGTAGGAAAG-3' (SEQ ID NO: 97)

Example 25: Isolation of a cDNA clone encoding human PRO187 Corporate expression sequence tag (EST) DNA database (LIFESEQ ^™ , Incyte Pharmac
euticals, Palo Alto, CA) and showed homology with fibroblast growth factor (FGF-8), which is also known as androgen-induced growth factor, (EST) (# 84319).
3) was identified. mRNA was isolated from human fetal lung tissue using reagents and protocols from Invitrogen, San Diego, CA (Fast Track 2). The cDNA library used to isolate the cDNA clones was made by standard methods using commercially available reagents (eg, Invitrogen, San Diego, CA, Life Technologies, Gaithersburg, MD). The cDNA was primed with an oligo dT containing a NotI site and blunt-ended with a SalI hemikinase adapter,
Cut with otI, size appropriately by gel electrophoresis, and Life Technologie
Reagents and protocols from s, Gaithersburg, MD (Super Script Plasmid System)
Was used to clone the cloning vector pRK5D in the defined orientation. Size the double-stranded cDNA so that it is larger than 1000 bp.
The / NotI binding cDNA was cloned into the XhoI / NotI cut vector. pRK5D is sp6 transcription initiation site followed by SfiI restriction enzyme site followed by X
It is a cloning vector having a hoI / NotI cDNA cloning site. Several libraries from various tissue sources were screened by PCR amplification with the following oligonucleotide probe: IN843193.f (OLI 315) (SEQ ID NO: 100) 5'-CAGTACGTGAGGGACCAGGGCGCCATGA-3 'IN843193.r ( OLI 317) (SEQ ID NO: 101) 5′-CCGGTGACCTGCACGTGCTTGCCA-3 ′ Then, a positive library was used to isolate a clone encoding the PRO187 gene using one of the above oligonucleotides and the following oligonucleotide probe. used. IN843193.p (OLI 316) (SEQ ID NO: 102) 5'-GCGGATCTGCCGCCTGCTCANCTGGTCGGTCATGGCGCCCT-3 'cDNA clone was sequenced in its entirety. PRO187 (DNA2786
The complete nucleotide sequence of 4-1155) is shown in FIG. 49 (SEQ ID NO: 98). Clone DNA27864-1155 contains a single open reading frame with an apparent translational initiation site at nucleotide position 1 (Figure 49; SEQ ID NO :).
98). The predicted polypeptide is 205 amino acids long. Clone DNA2
7864-1155 has been deposited with the ATCC (Nomenclature: DNA27864-1155),
ATCC Deposit No. 209375 has been assigned. Based on the full-length sequence BLAST and FastA sequence alignment analysis methods (using the ALIGN computer program), PRO187 binds to human fibroblast growth factor-8 (
Androgen-induced growth factor) and 74% amino acid sequence identity (Blast score 310)
showed that.

Example 26: Isolation of a cDNA clone encoding human PRO337 cDNA isolated in an amylase screen as described in Example 2 above.
A is designated herein as DNA42301. Phra as described in Example 1 above.
The DNA42301 sequence was compared to other EST sequences using p.
A consensus sequence designated 761 was identified. Based on this consensus sequence, oligonucleotides were synthesized for 1) identification of a cDNA library containing the sequence of interest by PCR, and 2) use as a probe to isolate clones of the full length coding sequence. To screen several libraries for a source of full-length clones, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. The positive library was then used to isolate clones encoding the PRO337 gene using the probe oligonucleotide and one of the PCR primer pairs. RNA for making a cDNA library was isolated from human fetal brain. The cDNA clone was sequenced in its entirety. DNA43316-1237
The full-length nucleotide sequence of is shown in Figure 51 (SEQ ID NO: 103). Clone DN
A43316-1237 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 134-136 (Fig51; SEQ ID NO: 103). The predicted polypeptide precursor is 344 amino acids long. Clone DNA43316-1237 has been deposited with the ATCC and is assigned ATCC deposit no. 20.
9487 was awarded. Based on BLAST-2 and FastA sequence alignment analysis of full length sequences, PRO33
7 shows amino acid sequence identity (97%) with rat neurotrimin.

Example 27: Isolation of a cDNA clone encoding human PRO1411 The use of the signal sequence algorithm described in Example 3 above enabled the identification of EST cluster sequences from the Incyte database. Then this ES
The T cluster sequences are stored in public EST databases (eg GenBank) and corporate E
STDNA database (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alt
o, CA) were compared to various expressed sequence tag (EST) databases to identify existing homologies. One or more ESTs were derived from a thyroid tissue library.
The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al., Methods
in Enzymology 266: 460-480 (1996)). A comparison that does not encode a known protein and has a BLAST score of 70 (sometimes 90) or higher is:
Program `` phrap '' (Phil Green, University of Washington, Seattle, Washi
ngton) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA56013. In view of the sequence homology between the DNA56013 sequence and the EST sequence contained in Incyte EST 1444425, a clone containing this EST was purchased, a cDNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 53 and is herein designated as DNA59212-1627. The full-length clone shown in Figure 53 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 184-186, and ending at the stop codon at nucleotide positions 1504-1506 (Fig53; SEQ ID NO: 105). . Predicted polypeptide precursor (Fig54, SEQ ID NO: 106)
Is 440 amino acids long. The signal peptide is at about amino acids 1-21 of SEQ ID NO: 106 and the cell attachment site is at about amino acids 301-303. PRO141
1 has a calculated molecular weight of about 42,208 daltons and an estimated pI of about 6.36.
Clone DNA59212-1627 was deposited with the ATCC on September 9, 1998 and was assigned ATCC deposit no. 203245. The Dayhoff database (version 35.45 SwissProt 35 using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 54 (SEQ ID NO: 106)).
), The amino acid sequence of PRO1411 and the following Dayhoff sequence (data from the database incorporated here): MTV023_19, P_R05307, P_W26348, P_P829
The sequence identity with 62, AF000949_1, EBN1_EBV, P_R95107, GRP2_PHAVU, P_R81318, and S74439_1 was revealed.

Example 28: Isolation of a cDNA clone encoding human PRO4356 A consensus DNA sequence was assembled with other EST sequences using phrap as described in Example 1 above. This consensus sequence is now referred to as "DNA80
200 ". Based on the homology observed between the DNA80200 consensus sequence and the EST sequence contained within Merck EST clone 248287, Me
The rck EST clone 248287 was purchased and its insert was obtained and sequenced, thus providing DNA86576-2595. The entire coding sequence of PRO4356 is shown in Figure 55 (SEQ ID NO: 107). Clone DNA86576-2595 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 55-57 and an apparent stop codon at nucleotide positions 808-810. The predicted polypeptide precursor is 251 amino acids long. Clone DNA86576-2595 has been deposited with the ATCC and is assigned ATCC deposit no. Full length P shown in Figure 56
The RO4356 protein has a calculated molecular weight of approximately 26,935 daltons and approximately 7.42.
Has a pI of Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis of the full length sequence shown in Figure 56 (SEQ ID NO: 108), results in the PRO4356 amino acid sequence and the following Dayhoff sequence introduced here: R
NMAGPIAN_1, UPAR_BOVIN, S42152, AF007789_1, UPAR_RAT, UPAR_MOUSE, P_W311
65, P_W31168, P_R44423 and P_W26359 were found to be homologous.

Example 29: Isolation of a cDNA clone encoding human PRO246 As described in Example 1 above, phrap was used to assemble consensus DNA sequences for other ESTs. This consensus sequence is now DNA3095
Name it 5. Based on the DNA30955 consensus sequence, 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) PRO2
For use as a probe to isolate a clone of 46 full length coding sequences,
Oligonucleotides were synthesized. A pair of PCR primers (forward and reverse) were synthesized: Forward PCR primer 5'-AGGGTCTCCAGGAGAAAGACTC-3 '(SEQ ID NO: 111) Reverse PCR primer 5'-ATTGTGGGCCTTGCAGACATAGAC-3' (SEQ ID NO: 112) A synthetic oligonucleotide hybridization probe was prepared from the consensus DNA30955 sequence with the following nucleotide sequence: Hybridization probe 5'-GGCCACAGCATCAAAACCTTAGAACTCAATGTACTGGTTCCTCCAGCTCC-3 '(SEQ ID NO: 11
3) PCR with the PCR primer pairs identified above on the DNA from the library to screen several libraries for a source of full-length clones.
Screened by amplification. The positive library was then used to isolate clones encoding the PRO246 gene using one of the probe oligonucleotides and PCR primers. RNA for the construction of the cDNA library was isolated from human fetal liver tissue. DNA sequencing of the clones isolated as described above revealed a full-length DNA sequence for PRO246 [herein designated as DNA35639-1172] (SEQ ID NO: 10
9) and the derived protein sequence of PRO246 was obtained. The entire nucleotide sequence of DNA35639-1172 is shown in Fig57 (SEQ ID NO: 1).
09). Clone DNA35639-1172 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 126-128 and ending at the stop codon at nucleotide positions 1296-1298 (F
ig57). The predicted polypeptide precursor is 390 amino acids long (Fig5
8). Clone DNA35639-1172 has been deposited with the ATCC and is assigned ATCC deposit no. 209396. Analysis of the amino acid sequence of the full-length PRO246 polypeptide indicates that it has significant homology to the human cell surface protein HCAR, thus PRO246 may be a novel cell surface viral receptor.

Example 30: Isolation of a cDNA clone encoding human PRO265 As described in Example 1 above, conrap was used to assemble consensus DNA sequences for other ESTs. This consensus sequence is now DNA3367
Name it 9. Based on the DNA33679 consensus sequence, 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) PRO2.
For use as a probe to isolate 65 full-length coding sequence clones,
Oligonucleotides were synthesized. PCR primers (two forward and one reverse) were synthesized: Forward PCR primer A: 5'-CGGTCTACCTGTATGGCAACC-3 '(SEQ ID NO: 116) Forward PCR primer B: 5'-GCAGGACAACCAGATAAACCAC-3' ( SEQ ID NO: 117) Reverse PCR primer 5'-ACGCAGATTTGAGAAGGCTGTC-3 '(SEQ ID NO: 118) Also, a synthetic oligonucleotide hybridization probe was prepared from the consensus DNA33679 sequence having the following nucleotide sequence: Hybridization probe 5'-TTCACGGGCTGCTCTTGCCCAGCTCTTGAAGCTTGAAGAGCTGCAC-3 '(SEQ ID NO: 119) To screen several libraries for the source of the full length clone, PCR with the PCR primer pair identified above from the DNA from the library
Screened by amplification. The positive library was then used to isolate clones encoding the PRO265 gene using probe oligonucleotides and one of the PCR primers. RNA for the construction of the cDNA library was isolated from a human fetal brain library. DNA sequencing of the clones isolated as described above revealed a full-length DNA sequence for PRO265 [herein designated as DNA36350-1158] (SEQ ID NO: 11
4) and the derived protein sequence of PRO265 was obtained. The entire nucleotide sequence of DNA36350-1158 is shown in Fig59 (SEQ ID NO: 1).
14). Clone DNA36350-1158 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 352-354 and ending at the stop codon at positions 2332-2334 (Fig 59).
The predicted polypeptide precursor is 660 amino acids long (Fig60). Clone DNA36350-1158 has been deposited with ATCC and is assigned ATCC deposit no. 209.
378 was awarded. Analysis of the amino acid sequence of the full-length PRO265 polypeptide reveals that part has significant homology to fibromodulin and fibromodulin precursors, thus making PRO265, particularly of the leucine-rich repeat family of fibromodulins. It is suggested that it may be a new member.

Example 31: Isolation of a cDNA clone encoding human PRO941 Consensus sequences were obtained for various EST sequences as described in Example 1 above, the resulting consensus sequences being designated herein as DNA35941. Is named.
Based on the DNA35941 consensus sequence, oligonucleotides were synthesized to 1) identify a cDNA library containing the sequence of interest by PCR and 2) to use as a probe to isolate a clone of the PRO941 full length coding sequence. did. A pair of PCR primers (forward and reverse) was synthesized: Forward PCR primer 5'-CTTGACTGTCTCTGAATCTGCACCC-3 '(SEQ ID NO: 122)
) Reverse PCR primer 5'-AAGTGGTGGAAGCCTCCAGTGTGG-3 '(SEQ ID NO: 123)
In addition, a synthetic oligonucleotide hybridization probe was made from the consensus DNA35941 sequence with the following nucleotide sequence: Hybridization probe 5'-CCACTACGGTATTAGAGCAAAAGTTAAAAACCATCATGGTTCCTGGAGCAGC-3 '(SEQ ID NO: 1
24) To screen several libraries for a source of full length clones, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. The positive library was then used to isolate clones encoding the PRO941 gene using the probe oligonucleotide and one of the PCR primer pairs. RNA for making a cDNA library was isolated from human fetal kidney tissue (LIB227). The DNA sequence of the clone isolated as described above gave the full-length DNA sequence for PRO941 [herein designated as DNA53906-1368] (SEQ ID NO: 120) and the derived protein sequence for PRO941. The entire nucleotide sequence of DNA53906-1368 is shown in Figure 61 (SEQ ID NO: 1).
20). Clone DNA53906-1368 contains a single open reading frame, has an apparent translational initiation site at nucleotide positions 37-39, and terminates at the stop codon at nucleotide positions 2353-2355 (Fig.
61). The predicted polypeptide precursor is 772 amino acids long (Fig62).
. The full-length PRO941 protein shown in Figure 62 has a calculated molecular weight of about 87,002 daltons and a pI of about 4.64. Analysis of the full-length PRO941 sequence shown in Figure 62 (SEQ ID NO: 121) reveals the presence of the following: a signal peptide of about amino acids 1 to about amino acids 21, about amino acids 57 to about amino acids 6
0, about amino acid 74 to about amino acid 77, about amino acid 419 to about amino acid 422,
About amino acid 437 to about amino acid 440, about amino acid 508 to about amino acid 511,
Potential N-glycosylation sites of about amino acids 515 to about amino acids 518, about amino acids 516 to about amino acids 519 and about amino acids 534 to about amino acids 537, cadherin cells of about amino acids 136 to about amino acids 146 and about amino acids 244 to about amino acids 254. Outer repeating domain signature sequence. Clone DNA53906
-1368 was deposited with the ATCC on April 7, 1998, and has ATCC Deposit No. 2
09747 is assigned. Analysis of the amino acid sequence of the full-length PRO941 polypeptide suggests that it has significant sequence similarity to the cadherin protein, indicating that PRO941 may be a novel cadherin protein family member. More specifically, the Dayhoff database (version 35.45 SwissProt 35) is PR
O941 amino acid sequence and the following Dayhoff sequence, I50180, CADA_CHICK, I50178, GEN
12782, CADC_HUMAN, P_W25637, A38992, P_R49731, D38992 and G02678 revealed significant homology.

Example 32: Isolation of a cDNA clone encoding human PRO10096 By using the signal sequence algorithm described in Example 3 above, 5 here.
It enabled the identification of an EST cluster sequence from the Incyte database, named 086173H1. This EST cluster sequence is then transformed into a variety of expressed sequence tags (ES
T) The existing homologies were identified by comparison with the database. The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266:
460-480 (1996)). Comparisons that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher are made by the program "phrap.
(Phil Green, University of Washington, Seattle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA110880. DNA110880 sequence and clone number 5088 from the Incyte database.
In view of sequence homology with EST sequences contained within 384, clone number 50
88384 was purchased and the cDNA insert was obtained and sequenced. The cDNA insert was found here to encode the full length protein. The sequence of this cDNA insert is shown in Figure 63 and is herein designated as DNA125185-2506. Clone DNA125185-2506 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 58-60 and ending at the stop codon at nucleotide positions 595-597 (Fig 63). The predicted polypeptide precursor is 179 amino acids long (Fig64). The full-length PRO10096 protein shown in Figure 64 has a calculated molecular weight of approximately 20,011 daltons and a pI of approximately 8.10. Full length PR shown in Figure 64 (SEQ ID NO: 126)
Analysis of the O10096 sequence demonstrated the presence of various key polypeptide domains shown in Figure 64, where the positions assigned to those key polypeptide domains are outlined as described above. Clone DNA125185-2506
Was deposited with the ATCC on Dec. 7, 1999, ATCC Deposit No. 1031-P
TA was added.

Example 33: Isolation of a cDNA clone encoding human PRO6003 A cDNA clone encoding a native human PRO6003 polypeptide (DNA
83568-2692) was identified using a yeast screen in a human fetal kidney cDNA library which predominates at the 5'end of the primary cDNA clone. Clone DNA83568-2692 contains a single open reading frame, has an apparent translational initiation site at nucleotide positions 638-640, and ends at the stop codon at nucleotide positions 2225-2227 (Figure 65).
The predicted polypeptide precursor is 529 amino acids long (Figure 66). Fig
The full-length PRO6003 protein, shown at 66, has a calculated molecular weight of approximately 59,583 and an estimated pI of approximately 6.36. Full length PR shown in Figure 66 (SEQ ID NO: 128)
Analysis of the O6003 sequence demonstrated the presence of various key polypeptide domains shown in Figure 66, where the positions assigned to those key polypeptide domains are outlined as described above. Clone DNA83568-2692 is 1
It was deposited with the ATCC on July 20, 999 and was assigned ATCC deposit no. 386-PTA. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the ALIGN-2 sequence alignment analysis of the full length sequence shown in FIG.
YKZ3_YEAST, CEK04B12_1, AB014464_1, PCU07059_1, S31213, CELF25E2_2, AF03
Sequence identity was demonstrated between 6408_1 and AB007932_1.

Example 34: Isolation of a cDNA clone encoding human PRO6004 Consensus sequences were obtained for various EST sequences as described in Example 1 above, the resulting consensus sequences being referred to herein as DNA85042. Is named.
DNA85402 consensus sequence and Incyte EST clone no. 307849
Clones were purchased and their inserts obtained and sequenced based on the homology found with the EST sequences contained within 2. The sequence of the insert is designated herein as DNA92259 and is shown in Figure 67A-B (SEQ ID NO: 129). Clone DNA92259 contains a single open reading frame,
It has an apparent translational initiation site at nucleotide positions 16-18 and terminates at the stop codon at nucleotide positions 1078-1080 (Fig67A-B). The predicted polypeptide precursor is 354 amino acids long (Fig68). The full-length PRO6004 protein shown in Figure 68 has a calculated molecular weight of approximately 38,719 daltons and a pI of approximately 6.12. Full length PR shown in FIG. 68 (SEQ ID NO: 130)
Analysis of the O6004 sequence demonstrated the presence of various important polypeptide domains shown in Figure 68, where the positions assigned to those important polypeptide domains are outlined as described above. By analysis of the Dayhoff database (version 35.45 SwissProt 35) using the ALIGN-2 sequence alignment analysis of the full length sequence shown in Figure 68 (SEQ ID NO: 130), the PRO6003 amino acid sequence and the following Dayhoff sequences: P_W05152, LAMP_HUMA.
N, P_W05157, P_W05155, I56551, OPCM_RAT, AMAL_DROME, DMU78177_1, I37246
And the sequence identity between NCA1_HUMAN was proved.

Example 35: Isolation of a cDNA clone encoding human PRO350 Consensus sequences were obtained for various EST sequences as described in Example 1 above, and the resulting consensus sequences were designated herein as DNA39493. Is named.
Oligonucleotides were synthesized based on the DNA39493 consensus sequence, 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) to be used as a probe to isolate clones of the PRO350 full-length coding sequence. . PCR primer pairs (forward and reverse) were synthesized: Forward PCR primer 5'-TCAGGGCTGCCAGGAAGGAAGAGC-3 '(SEQ ID NO: 133) Reverse PCR primer 5'-GCAGGAGGAGAAGGTCTTCCAGAAGAAG-3' (SEQ ID NO: 1)
34) Further, a synthetic oligonucleotide hybridization probe having the following nucleotide sequence was prepared from the consensus DNA39493 sequence. Hybridization probe 5'-AGAAGTTCCAGTCAGCCCACAAGATGCCATTGTCCCCCGGCCTCC-3 '(SEQ ID NO: 135) To screen several libraries for the source of the full length clone, the DNA from the library was labeled with one of the PCR primer pairs identified above. Were screened by PCR amplification. The positive library was then used to isolate clones encoding the PRO350 gene using the probe oligonucleotide and one of the PCR primer pairs. RNA for making a cDNA library was isolated from human fetal kidney tissue. By DNA sequencing of the clones isolated as described above, the full-length DNA sequence of PRO350 [herein designated as DNA44175-1314] (SEQ ID NO: 131)
And the derived protein sequences of PRO350 were obtained. The entire nucleotide sequence of DNA44175-1314 is shown in Figure 69 (SEQ ID NO: 1).
31). DNA44175-1314 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 356-358.
It terminates with a stop codon at nucleotide positions 821-823 (Fig69). The predicted polypeptide precursor is 155 amino acids long (Figure 70). The full-length PRO350 protein shown in Figure 70 has a calculated molecular weight of approximately 17,194 daltons and a pI of approximately 10.44. Full length PRO shown in Fig70 (SEQ ID NO: 132)
Analysis of the 350 sequence demonstrated the presence of various important polypeptide domains shown in Fig70.

Example 36: Use of PRO as a Hybridization Probe The following method describes the use of a nucleotide sequence encoding PRO as a hybridization probe. The DNA containing the full-length or mature PRO coding sequence disclosed herein is human tissue c
Homologous DNAs in DNA library or human tissue genomic library (
It is used as a probe for screening (such as those encoding naturally occurring variants of PRO). Hybridization and washing of filters containing either library DNA was performed under the following high stringency conditions. Hybridization of radiolabeled PRO-derived probe to the filter was performed in a solution of 50% formamide, 5xSSC, 0.1% SDS, 0.1% sodium pyrophosphate, 50 mM sodium phosphate, pH 6.8, 2x Denhardt's solution, and 10% dextran sulfate. At 42 ° C. for 20 hours. Clean the filter with 0.
It was carried out at 42 ° C. in an aqueous solution of 1 × SSC and 0.1% SDS. DNAs having the desired sequence identity with the DNA encoding the full length native sequence PRO can then be identified using standard methods known in the art.

Example 37: Expression of PRO in E. coli This example illustrates preparation of a non-glycosylated form of PRO by recombinant expression in E. coli. The DNA sequence encoding PRO was first amplified using selected PCR primers. The primer must have a restriction enzyme site corresponding to the restriction enzyme site of the selected expression vector. Various expression vectors can be used. An example of a suitable vector is pBR322 (derived from E. coli; Bolivar
Et al., Gene, 2:95 (1977)), including genes for ampicillin and tetracycline resistance. The vector is digested with restriction enzymes and dephosphorylated. The PCR amplified sequence is then ligated into the vector. The vector preferably contains an antibiotic resistance gene, a trp promoter, a polyhis leader (including the first 6 STII codons, polyhis sequences, and an enterokinase cleavage site), a PRO coding region, a lambda transcription terminator, and an argU gene. . The ligation mixture is then used to transform a selected E. coli strain using the method described by Sambrook et al., Supra. Transformants are identified by their ability to grow on LB plates and then antibiotic resistant clones are selected. Plasmid DNA is isolated and confirmed by restriction analysis and DNA sequence analysis. Selected clones can be grown overnight in liquid media such as LB broth supplemented with antibiotics. The overnight culture is subsequently used to seed large scale cultures.
The cells are then grown to optimal optical density, during which the expression promoter activates. After a further few hours of cell culture, the cells are harvested by centrifugation. The cell pellet obtained by centrifugation is solubilized using various reagents known in the art and then the solubilized PRO protein is purified using metal chelation columns under conditions that allow for tight protein binding. be able to. The following procedure may be used to express PRO in E. coli in the poly-His tagged form. DNA encoding PRO is first amplified using selected PCR primers. Primers provide restriction enzyme sites corresponding to those of the selected expression vector, and efficient and reliable translation initiation, rapid purification on metal chelate columns, and proteolytic removal with enterokinase. Includes other useful sequences. The PCR-amplified poly-His tag sequence was then ligated into the expression vector, which was used to strain 52 (W3110 fuhA (tonA) lon galE rpoHts (htpRts) clpP (lac
It was used for transformation of E. coli hosts based on Iq)). Transformants are initially 50 mg / ml
LB containing carbenicillin at 3-5 O.C. with shaking at 30.degree. D. 600
Grow until it reaches. The culture was then cultivated in CRAP medium (3.57 g (NH ₄ ) ₂ SO ₄ , 0.71 g sodium citrate 2H2O, 1.07 g KCl, 5.36 g Difco yeast extract, 5.36 g Shefield hycase SF in 500 mL water, and 110 mM MPOS, pH 7.3, 0.0.
50-100 fold (prepared by mixing 55% (w / v) glucose and 7 mM MgSO ₄ ), and allowed to grow for about 20-30 hours at 30 ° C. with shaking. Remove sample and SDS-PA
Expression was confirmed by GE analysis, and bulk cultures were centrifuged to pellet cells. The cell pellet was frozen until purification and refolding.

E. coli paste from 0.5 to 1 L of fermentation (6-10 g pellets) was treated with 7M guanidine,
Resuspended at 10 volumes (w / v) in 20 mM Tris, pH 8 buffer. Solid sodium sulfate and sodium tetrathionate were added to final concentrations of 0.1M and 0.02M, respectively, and the solution was stirred at 4 ° C overnight. This step resulted in a denatured protein with all cysteine residues blocked by sulfite. Beckman solution
Centrifuge for 30 minutes at 40,000 rpm in an Ultracentrifuge. The supernatant was diluted with 3-5 volumes of metal chelate column buffer (6 M guanidine, 20 mM Tris, pH 7.4), 0.22
Clarified by filtration through a micron filter. The clarified extract was loaded onto a 5 ml Qiagen Ni-NTA metal chelate column equilibrated with the metal chelate column buffer. The column was washed with additional buffer containing 50 mM imidazole (Calbiochem, Utrol grade), pH 7.4. The protein was eluted with a buffer containing 250 mM imidazole. Fractions containing the desired protein were pooled and stored at 4 ° C. Protein concentration is calculated using the extinction coefficient calculated based on its amino acid sequence.
Estimated by its absorption at 280 nm. The protein was diluted by gradually diluting the sample into a freshly prepared refolding buffer consisting of 20 mM Tris, pH 8.6, 0.3 M NaCl, 2.5 M urea, 5 mM cysteine, 20 mM glycine and 1 mM EDTA. Was refolded. Refolding volume is 50-100 micrograms / ml for final protein concentration
Selected to be. The refolding solution was gently stirred at 4 ° C for 12-36 hours. The refolding reaction was stopped by adding TFA to a final concentration of 0.4% (pH of about 3). Before further purifying the protein, the solution was filtered through a 0.22 micron filter and acetonitrile was added to a final concentration of 2-10%. The refolded protein was chromatographed on a Poros R1 / H reverse phase column using a migration buffer of 0.1% TFA and elution with a 10-80% acetonitrile gradient. Aliquots of fractions with A280 absorption were analyzed on SDS polyacrylamide gels and fractions containing homologous refolded proteins were pooled.
In general, the correctly refolded species of most proteins elute at the lowest concentration of acetonitrile because these species are the most compact and their hydrophobic inner surface is shielded from interaction with reverse phase resin. To be done. Aggregated species are usually eluted at higher acetonitrile concentrations. In addition to removing the misfolded form of the protein from the desired form, the reverse phase step also removes endotoxin from the sample. Fractions containing the desired folded PRO polypeptide were pooled and the acetonitrile removed using a gentle stream of nitrogen directed at the solution. Proteins were formulated in 20 mM Hepes, pH 6.8 containing 0.14 M sodium chloride and 4% mannitol by dialysis or gel filtration on G25 Superfine (Pharmacia) resin equilibrated with preparation buffer and sterile filtered. Many PRO polypeptides disclosed herein were successfully expressed as described above.

Example 38: Expression of PRO in Mammalian Cells This example illustrates preparation of a potentially glycosylated form of PRO by recombinant expression in mammalian cells. Vector pRK5 as an expression vector (see EP 307,247 published on Mar. 15, 1989)
Was used. In some cases, pRK5 with a restriction enzyme selected from PRO DNA
And PRODNA can be inserted using the ligation method as described in Sambrook et al., Supra. The resulting vector is pRK5-PR
Called O. In one embodiment, the host cell selected can be 293 cells. Human 293 cells (ATCC CCL 1573) were grown to confluence in tissue culture plates in media such as DMEM supplemented with fetal bovine serum and optionally nutrients and / or antibiotics. About 10 μg of pRK5-PRO DNA was added to about 1 μg of VARN.
A gene-encoding DNA [Thimmappaya et al., Cell, 31: 543 (1982))] and mixed with 5
It was dissolved in 00 μl of 1 mM Tris-HCl, 0.1 mM EDTA, 0.227M CaCl ₂ . To this mixture, drop-wise, 500 μl of 50 mM HEPES (pH 7.35), 280 mM NaCl, 1.5
mM NaPO ₄ was added and a precipitate was formed at 25 ° C. for 10 minutes. Suspend the precipitate,
293 cells were added and fixed at 37 ° C. for about 4 hours. Aspirate the medium and add 2 ml of 20 in PBS.
% Glycerol was added for 30 seconds. 293 cells were then washed with serum free medium,
Fresh medium was added and cells were incubated for approximately 5 days. Approximately 24 hours after transfection, the medium was removed and replaced with medium (only) or medium containing 200 μCi / ml ³⁵ S-cysteine and 200 μCi / ml ³⁵ S-methionine. After a 12 hour incubation, the conditioned medium is harvested, concentrated on a spin filter and 15% S
Added to DS gel. The treated gel was dried and exposed to film for a selected time that revealed the presence of PRO polypeptide. The medium containing the transformed cells was subjected to a further incubation (in serum-free medium) and the medium was tested in the selected bioassay. In an alternative technique, PRO is based on Somparyac et al., Proc. Natl. Acad. Sci.
., 12: 7575 (1981) and transiently introduced into 293 cells using the dextran sulfate method. 293 cells were grown to maximum density in spinner flasks,
Add 700 μg of pRK5-PRO DNA. The cells were first concentrated from the spinner flask by centrifugation and washed with PBS. The DNA-dextran precipitate was incubated on the cell pellet for 4 hours. Treat cells with 20% glycerol for 90 seconds, wash with tissue culture medium, tissue culture medium, 5 μg / ml bovine insulin and 0.1 μg / ml.
The spinner flask containing bovine transferrin was reintroduced. After about 4 days, the conditioned medium was centrifuged and filtered to remove cells and cell debris. Then expressed P
The RO-containing sample was concentrated and purified by a selected method such as dialysis and / or column chromatography. In another embodiment, PRO can be expressed in CHO cells. pRK5
-PRO is C using known reagents such as CaPO ₄ or DEAE-dextran.
HO cells can be transfected. As described above, the cell culture medium can be incubated and the medium replaced with culture medium (only) or medium containing a radiolabel such as ³⁵ S-methionine. After identifying the presence of PRO polypeptide, the medium may be replaced with serum free medium. Preferably, the medium is incubated for about 6 days and then the conditioned medium is collected. The medium containing the expressed PRO can then be concentrated and purified by any selected method. The epitope tag PRO may also be expressed in host CHO cells.
PRO may be subcloned from the pRK5 vector. The subclone insert can be subjected to PCR to fuse in frame with a selected epitope tag such as a poly-his tag in a baculovirus expression vector. The poly-his tagged PRO insert can then be subcloned into an SV40 driven vector containing a selectable marker such as DHFR for selection of stable clones. Finally, change the CHO cells to SV4
Transfection with 0-derived vector (as above). Labeling may be performed as described above to confirm expression. The medium containing the expressed poly-His tagged PRO can then be concentrated and purified by a selected method such as Ni ²⁺ -chelate affinity chromatography. Alternatively, PRO may be expressed in CHO and / or COS cells by a transient expression method and in CHO cells by another stable expression method.

Stable expression in CHO cells was performed using the following method. Proteins are coding sequences for soluble forms of each protein (e.g., extracellular domain).
Fused to an IgG1 constant region sequence containing the hinge, CH2 and CH2 domains
It was expressed as a GG construct (immunoadhesin), and / or as a poly-His tagged form. Following PCR amplification, each DNA was isolated from Ausubel et al., Current Protocols.
f Subcloned into CHO expression vector using standard techniques as described in Molecular Biology, Unit 3.16, John Wiley and Sons (1997). The CHO expression vector has restriction sites compatible with the 5'and 3'of the DNA of interest and has a cDNA
It is created so that NA can be conveniently shuttled. Vectors are Lucas et al., Nuc
SV40 early promoter / enhancer to control expression of cDNA and dihydrofolate reductase (DHFR) of interest using expression in CHO cells as described in L. Acids res. 24: 9, 1774-1779 (1996). To use. DHFR expression allows selection for stable maintenance of plasmids following transfection. Twelve micrograms of the desired plasmid DNA is transferred to the commercial transfection reagent Superfec
t® (Quiagen), Dosper® and Fugene® (Boehringer Ma
nnheim) and introduced into about 10 million CHO cells. Cells were grown as described in Lucas et al., Supra. About 3x10 ^-7 cells are frozen in an ampule for further growth and production as described below. The ampoule containing the plasmid DNA was placed in a water bath, thawed, and mixed by vortexing. The contents were pipetted into a centrifuge tube containing 10 mL of medium and centrifuged at 1000 rpm for 5 minutes. The supernatant is aspirated and cells are placed in 10 mL of selective medium (0.2 μm filtered PS20, 5%
0.2 μm diafiltered fetal bovine serum). The cells are then split into 100 ml spinners containing 90 ml of selective medium. After 1-2 days, cells were filled with 150 mL of selective medium 250
Transfer to mL spinner and incubate at 37 ° C. After 2-3 days, 250mL, 500mL
And 2000 mL of spinner were seeded at 3 × 10 ⁵ cells / mL. The cell medium was replaced with fresh medium by centrifugation and resuspended in production medium. Although any suitable CHO medium may be used, in practice the production medium described in US Pat. No. 5,122,469 issued Jun. 16, 1992 was used. A 3 L production spinner was seeded at 1.2 × 10 ⁶ cells / mL. On day 0, cell number and pH were measured. On day 1, spinners were sampled and sprayed with filtered air. On the second day, sample the spinner, change the temperature to 33 ℃, 500g /
30 mL of L glucose and 0.6 mL of 10% antifoam (eg 35% polydimethylsiloxane emulsion, Dow Corning 365 Medical Grade Emulsion). The pH was adjusted and maintained at around 7.2 throughout the production. After 10 days or until the survival rate falls below 70%,
Cell culture medium was collected by centrifugation and filtered through a 0.22 μm filter. The filtrate was either stored at 4 ° C or immediately loaded on a purification column.

For poly-His tagged constructs, proteins are purified using a Ni-NTA column (Qiagen). Prior to purification, imidazole was added to the conditioned medium to a concentration of 5 mM.
Conditioned medium containing 20 mM Hepes, pH 7 containing 0.3 M NaCl and 5 mM imidazole.
A 6 ml Ni-NTA column equilibrated with 0.4 buffer was pumped at 4 ° C at a flow rate of 4-5 ml / min. After packing, wash the column with additional equilibration buffer to remove protein.
Elution was done with equilibration buffer containing 0.25M imidazole. The highly purified protein was subsequently desalted with 25 ml G25 Superfine (Pharmacia) in a storage buffer containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol and -80 ° C.
Stored in. The immunoadhesin (Fc containing) construct was purified from conditioned medium as follows. Conditioned medium was pumped to a 5 ml Protein A column (Pharmacia) equilibrated with 20 mM sodium phosphate buffer, pH 6.8. After packing, the column was washed extensively with equilibration buffer and then eluted with 100 mM citric acid, pH 3.5. The eluted protein was immediately neutralized by collecting 1 ml fractions in a tube containing 275 μl of 1 M Tris buffer, pH 9. The highly purified protein was subsequently desalted in storage buffer as described above for poly-His tagged proteins. Homogeneity was assessed by SDS polyacrylamide gel and N-terminal amino acid sequencing by Edman degradation. Many of the PRO polypeptides disclosed herein have been successfully expressed as described above.

Example 39: Expression of PRO in yeast The following method describes recombinant expression of PRO in yeast. First, create a yeast expression vector for intracellular production or secretion of PRO from the ADH2 / GAPDH promoter. DNA encoding PRO and a promoter are inserted into the appropriate restriction enzyme sites of the selected plasmid to direct intracellular expression of PRO. A DNA encoding the ADH2 / GAPDH promoter, a native PRO signal peptide or other mammalian signal peptide, or a yeast α-factor or invertase secretion signal / leader, for example, has been selected on a plasmid in which the DNA encoding PRO has been selected for secretion. It can be cloned with the sequence and (if necessary) a linker sequence for the expression of PRO. Yeast cells, such as yeast strain AB110, can then be transformed with the expression plasmids described above and cultured in selected fermentation media. The transformed yeast supernatant can be analyzed by precipitation with 10% trichloroacetic acid and separation by SDS-PAGE, followed by staining of the gel with Coomassie blue stain. Recombinant PRO can then be isolated and purified by removing yeast cells from the fermentation medium by centrifugation and then concentrating the medium using selected cartridge filters. The concentrate containing PRO may be further purified using a selected column chromatography resin. Many of the PRO polypeptides disclosed herein have been successfully expressed as described above.

Example 40: Expression of PRO in Baculovirus-Infected Insect Cells The following method describes recombinant expression of PRO in Baculovirus-infected insect cells. The PRO coding sequence was fused upstream of an epitope tag contained in a baculovirus expression vector. Such epitope tags include poly-his tags and immunoglobulin tags (such as the Fc region of IgG). pVL1393 (Navogen
Various plasmids can be used, including plasmids derived from commercially available plasmids such as). Briefly, the desired portion of the PRO or PRO coding sequence is 5 ′ and 3 ′, such as the sequence encoding the extracellular domain of a transmembrane protein or the sequence encoding the mature protein when the protein is extracellular.
Amplified by PCR with primers complementary to the region. The 5'primer may include flanking (selected) restriction enzyme sites. The product is then digested with the selected restriction enzymes and subcloned into the expression vector. Recombinant baculovirus was obtained by using the above plasmid and BaculoGold (trade name) viral DNA (Pharmingen) in Spodoptera frugiperda (“Sf9”) cells (ATCC CRL 1
711) with lipofectin (commercially available from GIBCO-BRL). After 4-5 days of incubation at 28 ° C, released virus was collected and used for further amplification. Viral infection and protein expression are described by O'Reilley et al.,
Baculovirus expression vectors: A laboratory Manual, Oxford: Oxford Uni
Performed as described in versity Press (1994). The expressed poly-his tagged PRO is then purified as follows, eg by Ni ²⁺ -chelate affinity chromatography. Extraction is Rupert et al.,
Prepared from virus-infected recombinant Sf9 cells as described in Nature, 362: 175-179 (1993). Briefly, Sf9 cells were washed and sonicated buffer (25 mM Hepes, pH 7.9; 12.5 mM MgCl ₂ ; 0.1 mM EDTA; 10%
Glycerol; 0.1% NP-40; 0.4M KCl) and sonicated twice on ice for 20 seconds. Clarify the sonicated product by centrifugation and add the supernatant to the loading buffer.
Dilute 50-fold with (50 mM phosphate, 300 mM NaCl, 10% glycerol, pH 7.8), 0.4
It was filtered with a 5 μm filter. Ni ²⁺ -NTA agarose column (commercially available from Qiagen
Was prepared in a total volume of 5 mL, washed with 25 mL of water and equilibrated with 25 mL of loading buffer. The filtered cell extract was loaded onto the column at 0.5 mL / min. The column was washed with loading buffer to the baseline of A ₂₈₀ , which is the point where fraction collection begins. The column is then loaded with a secondary wash buffer (50 mM) that elutes non-specifically bound proteins.
Phosphate; washed with 300 mM NaCl, 10% glycerol, pH 6.0). After reaching the A ₂₈₀ baseline again, the column was developed in a secondary wash buffer with a 0 to 500 mM imidazole gradient. 1 mL fractions were collected and analyzed by SDS-PAGE and silver staining or Western blot with Ni ²⁺ -NTA conjugated to alkaline phosphatase (Qiagen). Eluted His 10 _- was dialyzed fractions containing the tagged PRO in loading buffer pool. Alternatively, purification of IgG-tagged (or Fc-tagged) PRO can be performed, for example, by protein A
Alternatively, it can be performed using a known chromatography technique including protein G column chromatography. Many of the PRO polypeptides disclosed herein have been successfully expressed as described above.

Example 41: Preparation of Antibodies that Bind PRO This example illustrates preparation of monoclonal antibodies that can specifically bind PRO. Techniques for the production of monoclonal antibodies are known in the art and are described, for example, in Goding, supra. Immunogens that can be used are purified PRO, PRO
And a fusion protein containing recombinant PRO on the cell surface. The choice of immunogen can be made by one of ordinary skill in the art without undue experimentation. Mice, such as Balb / c, are immunized with PRO immunogen emulsified in complete Freund's adjuvant and injected subcutaneously or intraperitoneally at 1-100 micrograms. Alternatively, the immunogen was replaced with MPL-TDM adjuvant (Ribi Immunochemical Researh, Hamilto
n, MT) and injected into the hind footpad of the animal. The immunized mice then
After 10 to 12 days, booster with additional immunogen emulsified in the selected adjuvant. The mice are then boosted with additional immunization injections for several weeks. Anti-PRO
Serum samples from retroorbital bleeds may be taken periodically from mice for testing in an ELISA assay for detection of antibodies. After a suitable antibody titer is detected, PR the antibody “positive” with the antibody.
The last infusion of O 2 intravenous injection can be given. After 3 to 4 days, the mice were sacrificed,
The spleen cells were removed. Then splenocytes (using 35% polyethylene glycol
), P3X63AgU.A., Available from ACTT under the number CRL1597. Fused to selected mouse myeloma cell lines such as 1. Hybridoma cells are generated by the fusion and then plated on 96-well tissue culture plates containing HAT (hypoxanthine, aminopterin, and thymidine) medium to unfuse cells, myeloma hybrids,
And inhibited the growth of spleen cell hybrids. Hybridoma cells are screened in an ELISA for reactivity against PRO. The determination of "positive" hybridoma cells secreting the desired monoclonal antibody to PRO is within the skill of the art. Positive hybridoma cells were injected intraperitoneally into syngeneic Balb / c mice to give anti-P
Ascites fluid containing RO monoclonal antibody is generated. Alternatively, hybridoma cells can be grown in tissue culture flasks or roller bottles. Purification of the monoclonal antibody produced in the ascites can be performed using ammonium sulfate precipitation followed by gel exclusion chromatography. Alternatively, affinity chromatography based on the affinity of the antibody for protein A or protein G can be used.

Example 43: Purification of PRO Polypeptides Using Specific Antibodies Native or recombinant PRO polypeptides can be purified by a variety of standard protein purification methods in the art. For example, the pro-PRO polypeptide, mature polypeptide, or pre-PRO polypeptide is purified by immunoaffinity chromatography using an antibody specific for the PRO polypeptide of interest. In general,
Immunoaffinity columns are made by covalently attaching anti-PRO polypeptide antibodies to activated chromatography resins. Polyclonal immunoglobulins are prepared from immune sera by either precipitation with ammonium sulfate or purification with immobilized Protein A (Pharmacia LKB Biotechnology, Piscataway, NJ). Similarly, monoclonal antibodies are prepared from mouse ascites fluid by ammonium sulfate precipitation or chromatography on immobilized Protein A. The partially purified immunoglobulin is covalently bound to a chromatography resin such as CnBr-activated Sepharose ^™ (Pharmacia LKB Biotechnology). The antibody is bound to the resin, the resin is blocked, and the derivative resin is washed according to the manufacturer's instructions. Such immunoaffinity columns are utilized in the purification of PRO polypeptide by preparing fractions from cells containing soluble form of PRO polypeptide. This preparation is derived by the addition of detergents or the solubilization of whole cells or subcellular fractions obtained via differential centrifugation by methods known in the art. Alternatively, soluble PRO polypeptide containing a signal sequence is secreted in useful quantity into the medium in which the cells are grown. The solubilized PRO polypeptide-containing preparation is passed through an immunoaffinity column, and the column is washed under conditions that allow for favorable adsorption of PRO polypeptide (eg, high ionic strength buffer in the presence of detergent). The column is then eluted under conditions that cleave the antibody / PRO polypeptide bond (eg, low pH, such as about 2-3, high concentrations of chaotropes such as urea or thiocyanate) and the PRO polypeptide recovered. .

Example 44: Drug Screening The present invention is particularly useful for screening compounds by using PRO polypeptides or binding fragments thereof in various drug screening techniques. The PRO polypeptide or fragment used in such a test may be free in solution, immobilized on a solid support, carried on the cell surface or located intracellularly. One method of drug screening utilizes eukaryotic or prokaryotic host cells which are stably transfected with recombinant nucleic acids expressing PRO polypeptides or fragments. Agents are screened against such transfected cells in a competitive binding assay. Such cells, either in viable or immobilized form, can be used for standard binding assays. For example, the formation of complexes between the PRO polypeptide or fragment and the reagent being tested may be measured. Alternatively, one can test the reduction in complex formation between the PRO polypeptide and its target cells caused by the reagent being tested. Thus, the invention provides a method of screening for agents or any other reagents that can affect PRO polypeptide-related diseases or disorders. These methods contact the reagent with a PRO polypeptide or fragment, (i) for the presence of a complex between the reagent and the PRO polypeptide or fragment, or (ii) between the PRO polypeptide or fragment and the cell. Assaying for the presence of the complex between by methods well known in the art. In these competitive binding assays, the PRO polypeptide or fragment is typically labeled. After appropriate incubation, the free PRO polypeptide or fragment is separated from the bound form and the amount of free or unconjugated label is such that the particular reagent binds to the PRO polypeptide or PRO polypeptide / cell complex. Is a measure of the ability to inhibit. Other techniques for drug screening provide high throughput screening for compounds with suitable binding affinity for polypeptides, 1984 9
It is described in detail in WO 84/03564 published 13th March. Briefly, a number of different small peptide test compounds are synthesized on a solid support such as plastic pins or some other surface. When applied to a PRO polypeptide, the peptide test compound is reacted with the PRO polypeptide and washed. Bound PRO polypeptide is detected by methods well known in the art. Purified PRO polypeptide can also be coated directly onto plates for use in the drug screening techniques described above. In addition, non-neutralizing antibodies can be used to capture the peptide and immobilize it on a solid support. The present invention also contemplates competitive drug screening assays in which a neutralizing antibody capable of binding to a PRO polypeptide specifically competes with a test compound for a PRO polypeptide or fragment thereof. In this way, the antibody can be used to detect the presence of any peptide in the PRO polypeptide which carries one or more antigenic determinants.

Example 45: Rational Drug Design The purpose of rational drug design is to identify biologically active polypeptides of interest (eg PR
O polypeptides) or small molecules with which they interact, eg, structural analogs of agonists, antagonists, or inhibitors. Any of these examples can be used to bind a more active and stable form of the PRO polypeptide or P in vivo.
It can be used to create drugs that improve or inhibit the function of RO polypeptides (Reference, Hod
gson, Bio / Technology, 9: 19-21 (1991)). In one method, the three-dimensional structure of a PRO polypeptide, or PRO polypeptide-inhibitor complex, is determined by x-ray crystallography, computer modeling, and most typically by a combination of the two methods. Both the shape and charge of the PRO polypeptide must be confirmed in order to elucidate the structure of the molecule and determine the active site. Although small in number, useful information regarding the structure of PRO polypeptides may sometimes be obtained by modeling based on the structure of homologous proteins. In both cases, the relevant structural information is used to design similar PRO polypeptide-like molecules or to identify effective inhibitors. Useful examples of rational drug design include molecules with improved activity or stability as shown in Braxton and Wells, Biochemistry, 31: 7796-7801 (1992), or Athauda et al., J. Biochem. , 11
3: 742-746 (1993), including molecules that act as inhibitors, agonists, or antagonists of natural peptides. It is also possible to isolate the target-specific antibody selected by the functional assay as described above and elucidate its crystal structure. This method in principle produces a pharmacore upon which subsequent drug design can be based. It is possible to bypass protein crystallography by generating anti-idiotypic antibodies (anti-ids) to functional, pharmacologically active antibodies. As a mirror image of a mirror image, the binding site of anti-ids can be expected to be an analog of the first receptor. The anti-id can then be used to identify and isolate peptides from banks of chemically or biologically produced peptides. The isolated peptide will function as the pharmacore. In accordance with the present invention, sufficient amounts of PRO polypeptides are available to carry out analytical experiments such as X-ray crystallography. Furthermore, the knowledge of the PRO polypeptide amino acid sequences provided herein provides guidance for use in computer modeling techniques in place of, or in addition to, x-ray crystallography.

Example 46: Mouse Kidney Mesangial Cell Proliferation Assay (Assay 92) In this assay certain polypeptides of the invention serve to induce mammalian kidney mesangial cell proliferation, and thus, for example, in Burger's disease. It has been shown to be useful in the treatment of renal disorders associated with reduced mesangial cell function, or other nephropathy associated with Shaneline-Henoho purpura, celiac disease, herpes dermatitis or Crohn's disease. The assay is performed as follows. On day 1, mouse kidney mesangial cells were plated on 96-well plates in growth medium (3: 1 mixture of Dulbecco's modified Eagle's medium and heme F12 medium, 95% fetal bovine serum, 5% 14 mM HEPES) and incubated. Raise in the evening. On day 2, PRO polypeptide is diluted in serum-free medium to two concentrations (1% and 0.1%) and added to cells. The control sample is serum medium only. Day 4, Cell Titer 96 Aqueous 1-liquid reagent (Progem
a) 20 μl is added to each well and the color reaction is allowed to proceed for 2 hours. The absorbance (OD) is then measured at 490 nm. A positive in the assay is one that gives an absorbance reading greater than at least 15% of the control reading. The following polypeptide tested positive in this assay: PRO1
272

Example 47: Detection of PRO Polypeptides Affecting Glucose or FFA Uptake by Primary Rat Adipocytes (Assay 94) This assay demonstrates that PRO polypeptide adipocyte glucose or FF
Designed to determine if it exhibits the ability to influence A uptake. PRO polypeptides that test positive in this assay are beneficial for either stimulating or inhibiting glucose uptake by adipocytes, including, for example, obesity, diabetes, hyper- or hypo-insulinemia. It is expected to be useful in the treatment of the diseases described. In a 96-well format, PRO polypeptide to be assayed was added to primary rat adipocytes and incubated overnight. Samples were removed at 4 and 16 hours and assayed for glycerol, glucose and FFA uptake. After 16 hours of incubation, insulin was added to the medium and incubated for 4 hours. At this point, samples were removed and measured for glycerol, glucose and FFA uptake. Medium containing insulin but no PRO polypeptide was used as a positive reference control. If the PRO polypeptide tested stimulates or inhibits glucose or FFA uptake, results are scored as positive in this assay if they are greater than 1.5 times or less than 0.5 times the insulin control. The following PRO polypeptides were added to glucose and / or FF in this assay:
Tested as positive as stimulator or inhibitor of A uptake: PRO1
96, PRO185, PRO210, PRO215, PRO242, PRO28
8, PRO1183, PRO1419, PRO9940, PRO301, PRO
337 and PRO265.

Example 48: Stimulation of Adult Cardiac Hypertrophy (Assay 2) This assay was designed to measure the ability of various PRO polypeptides to stimulate hypertrophy of the adult heart. PRO polypeptides that test positive in this assay are expected to be useful in the treatment of various cardiac dysfunction disorders. 2000 newly isolated ventricular myocytes from adult (250 g) Sprague Dawley rats / 1
Plated in 80 μl well volume. Cells were isolated and plated on day 1 with test sample containing PRO polypeptide or growth medium alone (negative control) (20 μl volume
) Was added on day 2, then cells were fixed and stained on day 5. After staining, visualize the cell size and give a value of 0.0 to cells without growth promotion compared to control cells,
A value of 0.1 is given to cells exhibiting small to moderate hypergrowth compared to control cells, and a value of 2.0 is given to cells showing large hypergrowth compared to control cells. Any degree of growth enhancement compared to negative control cells is considered positive in the assay. The following PRO polypeptides tested positive in this assay: PRO301.

Example 49: Vascular Endothelial Growth Factor (VEGF) Stimulated Proliferation Inhibition of Endothelial Cell Growth (Assay 9) The ability of various PRO polypeptides to inhibit the proliferation of VEGF stimulated endothelial cells was tested. A positive polypeptide test in this assay is useful for inhibiting mammalian endothelial cells, and such effects are beneficial, eg, inhibiting tumor growth. In particular, bovine adrenal cortical capillary endothelial (ACE) cells (up to 12-14 passages from primary medium)
) Was seeded in 96-well 100 microtiter plates at 500 cells / well. The assay medium contains low glucose DMEM, 10% bovine serum, 2 mM glutamine, 1x penicillin / streptomycin / fungizone. Control wells included: (1) ACE cells not added; (2) ACE cells alone; (3) A
CE cells plus 5 ng / ml FGF; (4) ACE cells plus 3 ng / ml VEGF; (5)
ACE cells plus 3 ng / ml VEGF plus 1 ng / ml TGF-beta; and (6) A
CE cells plus 3 ng / ml VEGF plus 5 ng / ml LIF. Then, a test sample, poly-his tagged PRO polypeptide (in 100 microtiter volume) was added to the wells.
(Diluted to 1%, 0.1% and 0.001% respectively). Cells at 37 ° C /
Incubated for 6-7 days with 5% CO ₂ . After the incubation, the well medium was aspirated and the cells were washed with 1 × PBS. Acid phosphatase reaction mixture (100 microtiter, 0.1 M sodium acetate, pH 5.5, 0.1% Triton X-100, 10 mM p
-Nitrophenyl phosphate) was added to each well. After incubation at 37 ° C. for 2 hours, the reaction was stopped by the addition of 10 microtiter 1N NaOH. Optical density (OD) was measured at 405 nm in a microplate reader. The activity of the PRO polypeptide was calculated as the percent inhibition of VEGF (3 ng / ml) stimulated growth on unstimulated cells (determined by measuring acid phosphatase activity at OD405 nm). TGF-beta increases VEGF-stimulated ACE cell proliferation 70
It blocked -90% and was used as an activity reference at 1 ng / ml. The results demonstrate the utility of PRO polypeptides in cancer therapy, particularly in inhibiting tumor angiogenesis. Numerical value (
Relative inhibition was calculated as the percent inhibition of VEGF-stimulated proliferation by PRO polypeptides on unstimulated cells, and then TGF-β at a concentration of 1 ng / ml was known to block VEGF-stimulated cell proliferation by 70-90%. It is determined by dividing the percent inhibition obtained by dividing by the percentage. Results are considered positive when the PRO polypeptide inhibits VEGF stimulation of endothelial cell growth by 30% or more (30% or more relative inhibition). The following test polypeptides were positive in this assay: PRO
301, PRO187 and PRO246.

Example 50: Stimulatory activity assay in mixed lymphocyte reaction (MLR) (Assay 2
4) This example demonstrates that certain polypeptides of the invention are active as growth stimulators of stimulated T lymphocytes. Compounds that stimulate lymphocyte proliferation are useful in treatments where an enhanced immune response is preferred. The therapeutic agent can be in the form of an antagonist of the polypeptide of the invention, eg, a mouse-human chimeric, humanized or human antibody of the polypeptide. The basic protocol for this assay is Current Protocol in Immunology, un
it3.12 ； JE Coligan, AM Kruisbeek, DH Marglies, EM Shevach, W Strober
Ed., Published by National Institutes of Health, John Wiley & Sons, Inc. In particular, in one variation of this assay, peripheral blood mononuclear cells (PBMCs) are isolated by leukopheresis from individual mammalian, eg, human, volunteers (one donor being fed with stimulant PBMCs, the other being Responder PBMC for donors
Supply). If desired, cells are frozen in fetal calf serum and DMSO after isolation. Frozen cells were thawed in assay medium (37 ° C., 5% CO ₂ ) overnight, then washed and assay medium (RPMI; 10% fetal calf serum, 1% penicillin / streptomycin, 1% glutamine, 1% HEPES). , 1% non-essential amino acids, 1% Pilbert
) To 3 × 10 ⁶ cells / ml. The stimulant PBMC is prepared by exposing the cells to light (approximately 300 rads). This assay involves plating in triplicate wells a mixture: 100: 1 diluted 1% or 0.1% test sample, stimulator cells exposed to 50: 1 light, and 50: 1 responder PBMC cells. Is prepared by. 100 microtiter cell culture medium or 100 microtiter CD4-IgG are used as controls. Then,
Wells are incubated for 4 days at 37 ° C., 5% CO ₂ . On day 5, apply tritiated thymidine (1.0 mC / well; Amersham) to each well. After 6 hours, add 3 cells
Wash twice and then assess uptake of label. In another variation of this assay, PBMCs are isolated from the spleens of Balb / c and C57B6 mice. Cells are for microscopic examination from spleens freshly collected in assay medium (RPMI; 10% fetal bovine serum, 1% penicillin / streptomycin, 1% glutamine, 1% HEPES, 1% non-essential amino acids, 1% pilbert). PMBCs were isolated by cutting them into small pieces and overlaying these cells on Lympholyte M (Organon Teknika), centrifuging at 2000 rpm for 20 minutes, collecting and washing the mononuclear cell layer in assay medium. And 1X10 ⁷ cells in assay medium
Resuspend cells to give / ml. The assay is then performed as described above. A positive is an increase over the control, an increase is considered positive, and an increase of 180% or more is preferred. However, if any value is above the control, it shows a stimulatory effect on the test protein. The following PRO polypeptides were positive in this assay: PRO533.
And PRO301.

Example 51: Proliferation of PDB12 cells (Assay 29) This example demonstrates that various PRO polypeptides have the potential to induce proliferation of PDB12 pancreatic duct cells, thus preventing diabetes and the like. It is useful for the treatment of diseases related to protein secretion by the pancreas. PDB12 pancreatic duct cells were plated at 1.5x10 ³ cells per well in 100 μL / 180 μL growth medium on 96-well plates coated with fibronectin. PR
100 μL with O polypeptide test sample or negative control lacking PRO polypeptide
Growth medium was then added to the wells to a final volume of 200 μL. Controls include growth medium containing proteins known to be inactive in this assay. Cells were incubated at 37 ° C for 4 days. Then 20 μL of Alamar Blue dye (AB) was added to each well and fluorescence readings were measured at 530 nm excitation and 590 nm emission in a microtiter plate reader 4 hours after AB addition. The standards used are cells without bovine pituitary extract (BPE) and cells with various concentrations of BPE. Controls with unknown buffer or growth medium alone are done twice in each 96-well plate. The percent increase in protein production was calculated by comparing the calculated protein concentration with Alamar Blue dye produced by negative control cells to the calculated protein concentration with Alamar Blue dye produced by PRO polypeptide treated cells. There is. A percent increase in protein production of 25% or more compared to negative control cells is considered positive. The following PRO polypeptides tested positive in this assay: PRO301.

Example 52: Guinea Pig Vascular Leakage (Assay 32) This assay is for determining whether PRO polypeptides of the present invention show the ability to induce vascular permeability. Polypeptides that test positive in this assay are useful in the treatment of medical conditions where it is beneficial to increase vascular permeability, including, for example, conditions where it is beneficial to locally enhance immune system cell invasion. Expected to be. Hairless guinea pigs weighing 350 g or more were anesthetized by intramuscular administration of ketamine (75-80 mg / kg) and 5 mg / kg of xylazine. Test samples containing physiological buffer without RO302 polypeptide or test polypeptide were injected intradermally into the dorsal skin of test animals at 100 μl per injection site. About 16- per animal
There were 24 injection sites. Then 1 ml of Evans blue dye (1% in PBS) was injected intracardially. The cutaneous vascular permeability response to the compound (ie, spots at the injection site) was scored visually by measuring the diameter (mm) of blue leakage from the injection site 1 and 6 hours after administration of the test animals. The blue diameter mm diameter of the injection site was observed and recorded along with the severity of vascular leakage. Spots with a diameter of at least 5 mm were considered positive in the assay when testing purified protein, indicating the ability to induce vascular leakage or permeability. For reactions larger than 7 mm diameter,
It is considered positive for the conditioned media sample. 0.1 μg / 100 μl
Human VEGF was used as a positive control to induce a response of 4-8 mm diameter. The following PRO polypeptide tested positive in this assay: PRO533.

Example 53: Retinal Neuron Survival (Assay 52) This example demonstrates that certain PRO polypeptides have efficacy in promoting survival of retinal neuronal cells, thus, eg, by retinitis pigmentosa, AMD, etc. It is useful in treating retinal diseases or injuries, including treating vision loss in mammals. Seven-day gestation Sprague Dawley rat fetuses (mixed population: glial and retinal neuron types) were sacrificed by CO ₂ anesthesia followed by decapitation and eyes removed under sterile conditions. The neural retina was excised from the pigment epithelium and the other ocular tissues were dissociated into single cell suspensions using 0.25% trypsin in PBS without Ca ²⁺ , Mg ²⁺ . Retina at 37 ° C for 7-
After incubating for 10 minutes, trypsin was inactivated by adding 1 ml of soybean trypsin inhibitor. Cells were plated at 100,000 cells per well in 96-well plates in DMEM / F12 with or without the specific test PRO polypeptide supplemented with N2. Cells were 5% CO ₂ for all experiments
Was grown at 37 ° C. in a water-saturated atmosphere. After 2-3 days in medium, cells were stained with calcein AM, then fixed with 4% paraformaldehyde and stained with DAPI for determination of total cell counts. Whole cells (fluorescence) are CCD camera and MacIntos
Quantification at 20X objective magnification using NIH image software for h. The field of view of the wells was randomly selected. The effect of varying concentrations of PRO polypeptide was demonstrated by the effect of calcein A on medium in 2-3 days.
The total number of M positive cells was calculated by dividing by the total number of DAPI labeled cells in medium for 2-3 days. Survival over 30% is considered positive. The following PRO polypeptides tested positive in this assay using polypeptide concentrations in the range of 0.01% to 1.0%: PRO350.

Example 54: Proliferation of Rat Vesicle Supporting Cells (Assay 54) This assay demonstrates that certain polypeptides of the present invention act as mitogens for inner ear supporting cells, which are auditory hair cell precursors, and are therefore mammalian. It is shown that it can be used for inducing regeneration of auditory hair cells and treatment of softness in animals. The assay is performed as follows. Rat UEC-4 vesicle epithelial cells are aliquoted into 96-well plates at 33 ° C. and 200 μl of serum-supplemented medium at a density of 3000 cells / well. The cells are cultured overnight and then transferred to serum-free medium at 37 ° C. Various dilutions of PRO polypeptide (or no control) are then added to the medium and the cells are then incubated for 24 hours. After 24 hours of incubation, ³ H-thymidine (1
μCi / well) and then incubated for another 24 hours. The medium is then washed to remove unincorporated radiolabel and the cells removed and the Cpm per well determined. An assay is considered positive if it has a Cpm of at least 30% or more in the PRO polypeptide treated medium compared to control medium. The following polypeptides tested positive in this assay: P
RO337.

Example 55: Rod Photoreceptor Cell Survival (Assay 56) This assay serves to enhance the survival / proliferation of rod photoreceptor cells by certain polypeptides of the present invention. , Are shown to be useful in the therapeutic treatment of retinal diseases or injuries, including treatment of visual loss in mammals due to, for example, retinitis pigmentosa, AMD and the like. Seven-day gestation Sprague Dawley rat fetuses (mixed population: glial and retinal neuronal cell types) were sacrificed by decapitation following CO ₂ anesthesia and eyes removed under sterile conditions. The neural retina was excised from pigment epithelium and other ocular tissues and then dissociated into single cell suspensions using 0.25% trypsin in PBS without Ca ²⁺ , Mg ²⁺ . The retinas were incubated at 37 ° C for 7-10 minutes, after which trypsin was inactivated by adding 1 ml of soybean trypsin inhibitor. Cells were seeded at 100,000 cells per well in 96-well plates in DMEM / F12 supplemented with N ₂ . For all experiments, cells were grown at 37 ° C. in a water saturated atmosphere of 5% CO ₂ . After 2-3 days in medium, cells were fixed with 4% paraformaldehyde and then stained with Cell Tracker Green CMFDA. Rho 4D2 (ascites or IgG1: 100), a monoclonal antibody against the visible dye rhodopsin, was used for detection of rod photoreceptors by indirect immunofluorescence. Results are calculated as% survival: total number of calcein-rhodopsin positive cells in 2-3 days in medium divided by total number of rhodopsin positive cells in 2-3 days in medium. All cells (fluorescence) are CCD camera and MacI
Quantification at 20X objective magnification using NIH image software for ntosh. The field of view of the wells was randomly selected. The following polypeptides tested positive in this assay: P
RO350.

Example 56: Cutaneous Vascular Permeability Assay (Assay 64) This assay demonstrates that certain polypeptides of the invention induce an immune response by inducing mononuclear cells, eosinophils and PMN infiltration at the injection site in animals. It is shown to induce a promoting and inflammatory response. Compounds that stimulate the immune response can be used in treatments where stimulation of the immune response is useful. This skin vascular permeability assay is performed as follows. Weight 35
Hairless guinea pigs of 0 grams or more were anesthetized by intramuscular injection (IM) of ketamine (75-80 mg / Kg) and 5 mg / Kg xylazine. A purified sample of the polypeptide of the invention or a conditioned medium test sample is injected intradermally in the back of a test animal at 100 μl per injection site. About 10-30, preferably about 16-24, per animal
It is possible to inject at any site. 1 μl of Evans blue dye (1% buffered in saline) is injected intracardially. The spots at the injection site are then measured (diameter mm) 1 and 6 hours after injection. Animals are sacrificed 6 hours after injection. Each skin injection site is biopsied and fixed with formalin. The skin is then prepared for histopathological examination. Each site is examined for inflammatory cell infiltration into the skin. Sites of visible inflammatory cells with inflammation are scored as positive. Inflammatory cells can be neutrophils, eosinophils, monocytes, lymphocytes. At least the minimal perivascular infiltration at the injection site is scored as positive and negative if there was no invasion at the injection site. The following polypeptides tested positive in this assay: P
RO301.

Example 57: Induction of Endothelial Cell Apoptosis (Assay 73) The ability of PRO polypeptides to induce apoptosis in endothelial cells was tested in human venous umbilical vein endothelial cells (HUVEC, Cell Systems). A positive result in this assay indicates that the polypeptide is useful in the treatment of tumor as well as vascular disease where induction of endothelial cell apoptosis is beneficial. The cells were added to a 96-well microtiter plate (Amersham Life Science, cytost
2x10 ⁴ per well in ar-T scintillating microplate, RPNQ160, sterile, tissue culture treated, individually wrapped) in 10% serum (CSG-vehicle, Cell Systems)
Plated in a total volume of 100 μl at the density of cells. On day two, test samples containing PRO polypeptide were added in 3 steps of 1%, 0.33% and 0.11% dilutions. Wells without cells were used as a blank and wells with cells were used as a negative control. As a positive control, a 1: 3 serial dilution of 3x stock of staurosporine 50
μl was used. The ability of PRO polypeptides to induce apoptosis has been demonstrated for detection of annexin V, a member of the calcium and phospholipid binding proteins.
Determined by processing 6 wells to detect apoptosis. 0.2 ml of annexin V-biotin stock solution (100 μg / ml) was added to 4.6 ml of 2 × C.
Diluted in a ²⁺ binding buffer and 2.5% BSA (1:25 dilution). 50 μl of diluted Annexin V-Biotin solution was added to each well (except control) to a final concentration of 1.0 μg / ml. Samples were incubated with Annexin-Biotin for 10-15 minutes prior to direct addition of ³⁵ S-streptavidin. ³⁵ S-streptavidin is 2 x C
a ²⁺ binding buffer, diluted in 2.5% BSA and added to all wells until final concentration of 3 x 10 ⁴ cpm / well. The plates were then sealed, centrifuged at 1000 rpm for 15 minutes and placed on an orbital shaker for 2 hours. Analysis is 1450 Microbeta Tr
Carried out at ilux (Wallac). The percentage above background represents the percentage amount of counts per minute above the negative control. Those above 30% above background are considered positive. The following PRO polypeptides tested positive in this assay: PRO301.

Example 58: Induction of c-fos in Cortical Neurons (Assay 83) This assay is designed to determine whether PRO polypeptides demonstrate the ability to induce c-fos in cortical neurons. .. PRO polypeptides that test positive in this assay are expected to be useful in the treatment of nervous system diseases and injuries where neuronal proliferation would be beneficial. Cortical neurons were isolated and plated in 96 well plates at 10,000 cells per well in growth medium. After approximately 2 cell divisions, cells were treated with PRO polypeptide for 30 minutes or not (negative control). Cells were then fixed with cold methanol for 5 minutes and stained with an antibody to phosphorylated CREB. mR
The level of NA was calculated using the chemiluminescence method. A positive in this assay is a factor that results in at least a 2-fold increase in c-fos message compared to the negative control. The following PRO polypeptides tested positive in this assay: PRO288.

Example 59: Induction of Pancreatic β-Cell Precursor Differentiation (Assay 89) This assay serves to induce the differentiation of some polypeptides of the invention from pancreatic β-cell precursors to mature pancreatic β-cells. And thus can be used to treat various stages of insulin deficiency in mammals including diabetes mellitus. The assay is performed as follows. The assay uses primary cultures of mouse fetal pancreatic cells, with the initial measurement being changes in expression of markers corresponding to either β-cell precursors or mature β-cells. Marker expression is determined by real-time quantitative PCR (RTQ-P
CR); the marker evaluated here is insulin. Pancreas is removed from E14 embryo (CD1 mouse). Then the pancreas is 40 at 37 ℃
From 60 min to digestion with collagenase / dispase in F12 / DMEM (collagenase / dispase, 1.37 mg / ml, Boehringer Mannheim, # 1097113). The digest is then neutralized with an equal volume of 5% BSA and the cells are washed once with RPMI1640. On day 1, cells are plated in 12-well tissue culture plates (20 μm / m in PBS).
Pre-coated with l laminin, Boehringer Mannheim, # 124317). Cells from pancreas of 1-2 embryos are distributed per well. This primary culture medium is 14F / 16
40. On day two, cultures are removed and attached cells are washed with RPMI / 1640. In addition to the protein to be tested, 2 ml minimal medium is added.
On day 4, the medium was removed and RNA was prepared from the cells and real-time quantitative R
Marker expression is analyzed by T-PCR. Associated β compared to untreated controls
-If the expression of a cell marker is increased, the protein is considered active in the assay. 14F / 1640 is RPMI1640 (Gibco) with the following additions: Group A 1: 1000 Group B 1: 1000 Recombinant human insulin 10 μg / ml Aprotinin (50 μg / ml) 1: 2000 (Boehringer manhein # 981532) Bovine pituitary extract (BPE) 60 μg / ml Gentamicin 100 ng / ml Group A: (in 10 ml PBS) Transferrin, 100 mg (Sigma T2252) Epidermal growth factor, 100 μg (BRL100004) Triiodothyronine, 10 μl 5x10 ⁻⁶ M (Sigma T5516) ) Ethanolamine, 10 ⁻¹ M 100 μl (Sigma E0135) Phosphoethanolamine, 10 ⁻¹ M 100 μl (Sigma P0503) Selenium, 10 ⁻¹ M 4 μl (Aesar # 12574) Group C: (10 ml 100% ethanol medium) hydrocortisone, 5x10 ^{-3 M} 2μl of (sigma # H0135) progesterone, 1x10 ^{-3 M} in 100 [mu] l (sigma # P6149) forskolin, 20 mM of 500μl (Calbiochem # 344270) minimal medium: RPMI1 Transferrin (10 [mu] / ml) in 40 insulin (1 [mu] g / ml), gentamicin (100 ng / ml), is added aprotinin (50μg / ml) and BPE (15μg / ml).
Fixed medium: Transferrin (10 μ / ml), insulin (1 μg / ml), gentamicin (100 ng / ml) and aprotinin (50 μg / ml) are added to RPMI1640. The following polypeptides were active in this assay: PRO11361, PRO
1308, PRO1600 and PRO4356.

Example 60: Induction of pericyte c-fos (Assay 93) This assay operates with certain polypeptides of the invention to induce the expression of c-fos in pericytes, and thus specific It is shown that not only is it useful as a diagnostic marker for various types of pericyte-associated tumors, but it also produces antagonists that are expected to be useful in the therapeutic treatment of pericyte-associated tumors. C-f in pericytes
Induction of os expression also indicated that angiogenesis was induced, and thus c-fos
It is expected that PRO polypeptides that are capable of inducing the expression of H.sub.i will be useful in the treatment of conditions in which induction of angiogenesis is beneficial, including, for example, wound healing. Especially on the first day,
Pericytes were obtained from VEC Technologies and all but 5 ml medium was removed from the flask. On day 2, pericytes were trypsinized, washed, spun and then plated in 96 well plates. On the 7th day, the medium was taken out and the pericytes were treated with 100 μl of the PRO polypeptide test sample and a control (positive control = DEM + 5% serum +/− 500 ng).
/ ml of PDGF; negative control = protein 32). Duplicates were averaged and SD / CV was determined. Fold increase over protein 32 values (buffer control) indicated by chemiluminescence unit (RLU) luminometer reading birth frequency is plotted on a histogram. A fold above the protein 32 value above is considered positive for the assay. ASY matrix: Growth medium = low glucose DMEM = 20% FBS + 1x pen strep + 1X fungizone. Assay medium = low glucose DMEM + 5% FBS. The following polypeptides tested positive in this assay: P
RO444 and PRO217.

Example 61: PR Affects Glucose or FFA Uptake in Skeletal Muscle
Detection of O Polypeptide (Assay 106) This assay is based on the fact that the PRO polypeptide is glucose or FF by skeletal muscle cells.
Designed to determine if it exhibits the ability to influence A uptake. PRO polypeptides that tested positive in this assay are disorders where either stimulation or inhibition of skeletal muscle glucose uptake is beneficial, including, for example, diabetes, hyper- or hypo-insulinemia. Is expected to be useful in the treatment of In a 96-well format, PRO polypeptide to be assayed was added to primary rat differentiated skeletal muscle and incubated overnight. Next, the PRO polypeptide and + /
-Fresh medium containing insulin was added to the wells. The sample medium was then monitored to measure glucose and FFA uptake by skeletal muscle cells. Insulin stimulated glucose and FFA uptake by skeletal muscle, and insulin in medium without PRO polypeptide served as a positive control and was used as a score limit. If the PRO polypeptide tested stimulates or inhibits glucose or FFA uptake, results are scored as positive in this assay if they are more than 1.5 times or less than 0.5 times the insulin control. . The following PRO polypeptides were added to glucose and / or FF in this assay:
Tested as positive as stimulator or inhibitor of A uptake: PRO1
96, PRO183, PRO185, PRO215, PRO288, PRO13
61, PRO1600, PRO4999, PRO7170, PRO533 and P
RO187.

Example 62: Fetal Hemoglobin Induction in the Erythroid Cell Line (Assay 107) This assay screens the ability of PRO polypeptides to induce the switch from adult hemoglobin to fetal hemoglobin in the erythroid cell line. Useful to do. Molecules that test positive in this assay are expected to be useful in therapeutically treating a variety of mammalian hemoglobin-related diseases, such as various thalassemias. This assay is performed as follows. Erythroblast cells are plated in standard growth medium at 1000 cells / well in a 96-well format. PRO polypeptide is added to the growth medium at a concentration of 0.2% or 2% and the cells are incubated at 37 ° C for 5 days. Cells are treated with 100 μM hemin as a positive control and cells are not treated as a negative control. After 5 days, cell lysates were prepared and analyzed for gamma globulin expression (fetal marker). Positive in this assay is a gamma globulin level that is at least twice that of the negative control. The following polypeptides tested positive in this assay: P
RO1419.

Example 63: Chondrocyte Redifferentiation Assay (Assay 110) This assay serves for the induction of redifferentiation of chondrocytes by certain polypeptides of the present invention, and thus in various conditions such as sports disorders and arthritis. It has been shown to be expected to be useful in the treatment of various bone and / or cartilage disorders. The assay is performed as follows. Porcine chondrocytes are isolated by overnight collagenase digestion of the articular cartilage of the metacarpophalangeal joints of 4-6 month old sows. The isolated cells are then F
25,000 cells / c in heme F-12 containing 10% BS and 4 μg / ml gentamicin
Sown with m ² . The medium was changed every 3 days and then seeded in 96 wells at 5,000 cells / well in 100 μl of the same medium without serum, 100 μl test PRO polypeptide 5 nM staurosporine (positive control) or medium alone (positive control). Negative controls) are added to give a final total volume of 200 μl / well. After 5 days of incubation at 37 ° C, each well is photographed to determine the chondrocyte differentiation status. A positive result in the assay is when chondrocyte redifferentiation was determined to be more similar to the positive control than the negative control. The following polypeptides tested positive in this assay: P
RO215, PRO353, PRO365, PRO1272, PRO301 and PRO337.

Example 64: Chondrocyte Proliferation Assay (Assay 111) This assay determines whether the PRO polypeptides of the invention show the ability to induce chondrocyte proliferation and / or redifferentiation in culture. Designed for. A positive result in this assay is expected to be useful in the treatment of various bone and / or cartilage disorders such as sports disorders and arthritis. The assay is performed as follows. Porcine chondrocytes are isolated by overnight collagenase digestion of the articular cartilage of the metacarpophalangeal joints of 4-6 month old sows. The isolated cells then contained 10% FBS.
% And gentamicin at 4 μg / ml in Heme F-12 at 25,000 cells / cm ² . The medium is changed every 3 days, and every 5 days, 25,000 cells // cm ² are replated. On day 12, plated in 96 wells at 5,000 cells / well in 100 μl of the same medium without serum, 100 μl of serum-free medium (negative control), staurosporine (final concentration 5 nM; positive control) or test PRO. Polypeptide (negative control)
Is added to give a final total volume of 200 μl / well. After 5 days of incubation at 37 ° C., 20 μl of Alamar Blue was added to each well and the plates were incubated at 37 ° C. for an additional 3 hours. Next, the fluorescence of each well was measured (
Excitation: 530 nm; Emission: 590 nm). The fluorescence of the plate containing 200 μl of serum-free medium was measured to obtain the background. A positive result in the assay is obtained when the fluorescence of the PRO polypeptide treated sample is closer to that of the positive control than the negative control. The following PRO polypeptides tested positive in this assay: PRO215, PRO217, PRO248, PRO1361, PRO14.
19, PRO533 and PRO265.

Example 65: Mouse Mesengial Cell Inhibition Assay (Assay 114) In this assay, the PRO polypeptide of the invention is mouse Mesengial in culture.
(mesengial) designed to determine whether it exhibits the ability to inhibit the growth of cells. PRO polypeptides tested positive in this assay are mesengial such as, for example, cystic renal dysplasia, polycystic kidney disease, or other kidney diseases associated with abnormal proliferation of mesengial cells, renal tumors, and the like. It is expected that inhibiting cell proliferation will be useful in treating beneficial diseases or conditions. On day 1, mouse mesengial cells were grown in growth medium (Dulbecco's modified Eagle's medium and heme F12 medium, 95%; fetal bovine serum, 5%; 14 mM HEPES in a 3: 1 mixture).
Plated on a well plate and grown overnight. On day 2, PRO polypeptide is diluted in serum-free medium to two concentrations (1% and 0.1%) and added to cells. Negative controls are growth media without the addition of PRO polypeptide. After incubating the cells for 48 hours, 20 μl of Cell Titer 96 Aqueous 1-solution reagent (Progema) is added to each well, and the color reaction is allowed to proceed for 2 hours. Then the absorbance (O
D) is measured at 490 nm. A positive in the assay gives an absorbance reading of at least 10% above the negative control. The following PRO polypeptides tested positive in this assay: PRO1318.

Example 66: Induction of Pancreatic β-Cell Progenitor Proliferation (Assay 117) This assay serves to induce an increase in large numbers of pancreatic β-cell progenitor cells by certain polypeptides of the present invention, and thus authenticity. We show that it can be used to treat various stages of insulin deficiency in mammals, including diabetes. The assay is performed as follows. The assay uses primary cultures of mouse fetal pancreatic cells, with initial measurements of β-
Altered expression of markers corresponding to either cell precursors or mature β-cells. Marker expression is measured by real-time quantitative PCR (RTQ-PCR);
The marker evaluated here is a transcription factor called Pdx1. Pancreas is removed from E14 embryo (CD1 mouse). Then the pancreas is 40 at 37 ℃
From 60 min to digestion with collagenase / dispase in F12 / DMEM (collagenase / dispase, 1.37 mg / ml, Boehringer Mannheim, # 1097113). The digest is then neutralized with an equal volume of 5% BSA and the cells are washed once with RPMI1640. On day 1, cells are plated in 12-well tissue culture plates (20μ / ml in PBS)
Pre-coated with laminin, Boehringer Mannheim, # 124317). 1-2
Cells from the embryonic pancreas are distributed per well. This primary culture medium is 14F
/ 1640. On the second day, the medium was removed and the adhered cells were RPMI / 16.
Wash at 40. In addition to the protein to be tested, 2 ml minimal medium is added. On day 4, medium is removed, RNA is prepared from cells and marker expression is analyzed by real-time quantitative RT-PCR. A protein is considered to be active in an assay if it increases the expression of the relevant β-cell marker relative to an untreated control. 14F / 1640 is RPMI1640 (Gibco) with the following additions: Group A 1: 1000 Group B 1: 1000 Recombinant human insulin 10 μg / ml Aprotinin (50 μg / ml) 1: 2000 (Boehringer manhein # 981532) Bovine pituitary extract (BPE) 60 μg / ml Gentamicin 100 ng / ml Group A: (in 10 ml PBS) Transferrin, 100 mg (Sigma T2252) Epidermal growth factor, 100 μg (BRL100004) Triiodothyronine, 10 μl of 5x10 ^-6 M (Sigma T5516) ) Ethanolamine, 10 ⁻¹ M 100 μl (Sigma E0135) Phosphoethanolamine, 10 ⁻¹ M 100 μl (Sigma P0503) Selenium, 10 ⁻¹ M 4 μl (Aesar # 12574) Group C: (10 ml 100% ethanol medium) hydrocortisone, 5x10 ^{-3 M} 2μl of (sigma # H0135) progesterone, 1x10 ^{-3 M} in 100 [mu] l (sigma # P6149) forskolin, 20 mM of 500μl (Calbiochem # 344270) minimal medium: RPMI16 To 40 is added transferrin (10 μ / ml), insulin (1 μg / ml), gentamicin (100 ng / ml), aprotinin (50 μg / ml) and BPE (15 μg / ml).
Fixed medium: Transferrin (10 μ / ml), insulin (1 μg / ml), gentamicin (100 ng / ml) and aprotinin (50 μg / ml) are added to RPMI1640. The following polypeptides tested positive in this assay: P
RO183, PRO185, PRO288.

Example 67: In Vitro Antitumor Assay (Assay 161) The antiproliferative activity of various PRO polypeptides was determined essentially by Skehan et al., J. Natl. Can.
cer Inst. 82: 1107-1112 (1990) and measured in the National Cancer Institute (NCI) experimental, disease-directed in vitro anti-cancer drug discovery assay using the sulforhodamine B (SRB) dye binding assay. The 60 tumor cell lines used in this assay (
"NCI panel"), and their maintenance and in vitro culture conditions are described in Monks
Et al., J. Natl. Cancer Inst. 83: 757-766 (1991). The purpose of this screen is to first assess the cytotoxic and / or cytostatic activity of test compounds against different types of tumors (Monks et al., Supra; Boyd, Cancer: Pr.
Inc. Pract. Oncol. Update 3 (10): 1-12 [1989]). Cells from about 60 human tumor cell lines were harvested with trypsin / EDTA (Gibco), washed once, resuspended in IMEM and their viability measured. The cell suspension was pipetted (100 μL volume) into another 96-well microtiter plate. The cell density of the 6-day incubation was smaller than that of the 2-day incubation and overgrowth was prevented. After seeding, preincubation was carried out at 37 ° C. for 24 hours for stabilization. Two-fold dilutions of the test concentration of interest were added to microtiter plate wells in 100 μl aliquots at time zero (1: 2 dilution). 5 logs of test compound
Evaluation was made by dilution (1000 to 100,000 times). Incubation was carried out for 2 days and 6 days in 5% CO ₂ atmosphere and 100% humidity. After the incubation, the medium was removed and the cells were washed with 0.1 ml of 10% trichloroacetic acid.
Fixed at 0 ° C. Plates were washed 5 times with deionized water, dried, stained with 0.1 ml of 0.4% sulforhodamine B dye (Sigma) in 1% acetic acid for 30 minutes, and washed 4 times with 1% acetic acid to unbound dye. Was removed, dried and the stain was extracted with 0.1 ml of 10 mM Tris base [Tris (hydroxymethyl) aminomethane], pH 10.5 for 5 minutes. The absorption (OD) of sulforhodamine B at 492 nm was measured using a computer-connected 96-well microtiter plate reader. A test sample is considered positive when it shows at least 50% growth inhibition at one or more concentrations. The positive results are shown in Table 7 below. The results of these assays show that PRO polypeptides are useful in inhibiting neoplastic growth in many different cell lines and can be used therapeutically. Antibodies to these PRO polypeptides are useful for affinity expansion of this useful polypeptide. Nucleic acids encoding these PRO polypeptides are useful in the recombinant preparation of these polypeptides.

Example 68: Gene Amplification in Tumors This example demonstrates that certain PRO polypeptide-encoding genes are expressed in certain human lungs,
It is shown to be amplified in the genome of the colon and / or breast cancer and / or cell line. Amplification involves the overexpression of the gene product, which makes the polypeptide useful in the therapeutic treatment of certain cancers, such as colon, lung, breast and other cancers, and in diagnosing the presence of these cancers. It is a target. The therapeutic agent can form an antagonist of the PRO polypeptide, eg, a mouse-human chimera, humanized or human antibody to the PRO polypeptide. The starting material for the screen is genomic DNA isolated from various cancers. DN
A is quantified accurately, for example fluorescently. As a negative control, D
NA was isolated from cells of 10 normal healthy individuals, pooled and used as an assay control for gene copy in healthy individuals (not shown). 5'nuclease assay (eg TaqMan ^™ ) and real-time quantitative PCR (eg ABI Prizm)
7700 Sequence Detection System (trade name) (Perkin Elmer, Applied Biosystems
Division, Foster City, CA)) was used to discover genes that are potentially amplified in certain cancers. The results were used to determine whether the DNA encoding the PRO polypeptide was overexpressed in either the primary lung or colon cancer screened or the cancer cell line or breast cancer cell line. Primary lung cancer was obtained from individuals with tumor types and stages shown in Table 8. An explanation of the abbreviations used in the representations of the primary tumors listed in Table 8 and the primary tumors and cell lines referenced throughout this example is provided below.

The TaqMan ^™ results were reported in delta (Δ) Ct units. One unit corresponds to one PCR cycle or about two-fold amplification relative to normal, two units to four-fold, three units to eight-fold amplification and so on. Quantification was obtained using primers and TaqMan ^™ fluorescent probes derived from the PRO polypeptide-encoding gene. PRO likely to contain a unique nucleic acid sequence and less likely to splice introns
Regions of the polypeptide-encoding gene are suitable for primer and probe induction, eg, the 3-untranslated region. The sequences of the primers and probes (forward, reverse and probe) used for the PRO polypeptide gene amplification analysis are as follows: PRO533 (DNA49435-1219) Forward: 5'-GGGACGTGCTTCTACAAGAACAG-3 '(SEQ ID NO: 140) Reverse: 5'-CAGGCTTACAATGTTATGATCAGACA-3 '(SEQ ID NO: 141) Probe: 5'-TATTCAGAGTTTTCCATTGGCAGTGCCAGTT-3' (SEQ ID NO: 142) PRO187 (DNA27864-1155) Forward: 5'-GGCCTTGCAGACAACCGT-3 '(SEQ ID NO: 142) SEQ ID NO: 143) Reverse direction: 5'-CAGACTGAGGGAGATCCGAGA-3 '(SEQ ID NO: 144) Probe: 5'-GCAGATTTTGAGGACAGCCACCTCCA-3' (SEQ ID NO: 145) Forward direction 2: 5'-CATCAAGCGCCTCTACCA-3 '(SEQ ID NO :) 146) Reverse 2: 5'-CACAAACTCGAACTGCTTCTG-3 '(SEQ ID NO: 147) Probe 2: 5'-CAGCTGCCCTTCCCCAACCA-3' (SEQ ID NO: 148) PRO246 (DNA35639-1172) Square : 5'-GGCAGAGACTTCCAGTCACTGA-3 '(SEQ ID NO: 149) reverse: 5'-GCCAAGGGTGGTGTTAGATAGG-3' (SEQ ID NO: 150) Probe: 5'-CAGGCCCCCTTGATCTGTACCCCA-3 '(SEQ ID NO: 151)

The 5'nuclease assay reaction is a fluorescent PCR-based technique that uses the 5'exonuclease activity of the Taq DNA polymerase enzyme for real-time amplification monitoring. Two oligonucleotide primers are used (normal [.f] and reverse [.r]) to generate apricons typical of PCR reactions. A third oligonucleotide, or probe (.p), was designed to detect the nucleotide sequence located between the two PCR primers. The probe is non-extendable by the Taq DNA polymerase enzyme and is labeled with a reporter fluorescent dye and a quencher fluorescent dye. When the two dyes are located close together on the probe, the laser-induced emission from the reporter dye is quenched by the quenching dye. During the amplification reaction, the probe is TA
It is cleaved by the Q DNA polymerase enzyme in a template-dependent manner. The resulting probe fragment dissociates in solution and the released signal from the reporter dye does not undergo the quenching effect from the second fluorophore. One molecule of reporter dye is released for each newly synthesized molecule, and detection of unquenched reporter dye provides the basis for quantitative interpretation of the data. The 5'nuclease method is used for real-time quantitative PCR such as ABI Prism 7700TM sequence detection.
It is implemented in the device. The system consists of a temperature cycler, laser, charge coupled device (CCD) camera and computer. The system amplifies samples in 96-well on a temperature cycler. During amplification, the laser-induced fluorescent signal is collected in real time in a 96-well fiber optic cable and detected by the CCD. The system includes software for instrument execution and data analysis. 5'nuclease assay data is initially expressed in Ct or border cycle. This is defined as the cycle in which the reporter signal accumulates above the fluorescent background. The ΔCt value was used as a quantitative measure of the relative starting copy number of a particular target sequence in a nucleic acid sample when comparing normal human DNA results to cancer DNA results. Table 8 describes various primary tumor stages, T stages and N stages used in the screening of PRO polypeptide compounds of the invention.

DNA preparation: DNA was prepared from cultured cell lines, primary tumors, normal human blood. Isolations were all performed using the purification kit, buffer set and protease from Quiagen according to the manufacturer's instructions and the following. Cell culture lysis: cells are washed and trypsinized at a concentration of 7.5x10 ⁸ per chip for 5 minutes at 4 ° C.
Pelletized by centrifugation at 1000 rpm and then washed with 1/2 volume PBS re-centrifuge. The pellet was washed 3 times and the suspended cells were collected and washed with 2xPBS. The cells were then suspended in 10 mL PBS. Buffer C1 was equilibrated at 4 ° C. Quiagen
Protease # 19155 was diluted with 6.25 ml cold ddH ₂ O to a final concentration of 20 mg / ml and 4
Equilibrated at ° C. 10 mL of G2 buffer was added to the Quiagen RNAse A stock (10
0 mg / ml) was prepared by diluting to a final concentration of 200 μg / ml. Buffer C1 (10 mL, 4 ° C.) and ddH ₂ O (40 mL, 4 ° C.) were then added to 10 ml cell suspension, mixed by inversion and incubated on ice for 10 minutes. Cell nuclei were pelleted by centrifugation in a Beckman swinging bucket rotor at 2500 rpm for 15 minutes at 4 ° C. Discard the supernatant and vortex the nuclei to 2 ml
Buffer C1 (4 ° C.) and 6 ml of ddH ₂ O, followed by a second centrifugation at 2500 rpm for 15 minutes at 4 ° C. The nuclei were then resuspended in the remaining buffer using 200 μl per chip. A gentle vortex was applied while adding G2 buffer (10 ml) to the suspended nuclei. When the buffer addition was complete, a strong vortex was applied for 30 seconds. Quiagen protease (200 μl, prepared as above) was added and incubated at 50 ° C. for 60 minutes. Incubation and centrifugation was repeated until the lysate was clear (eg, incubated for an additional 30-60 minutes and pelleted at 3000 xg for 10 minutes at 4 ° C).

Preparation and lysis of solid human tumor samples: Tumor samples were weighed and placed in 50 ml conical tubes and kept on ice. Processing was limited to less than 250 mg tissue per preparation (1 tip / preparation). The protease solution was freshly prepared by diluting it in 6.25 ml cold ddH ₂ O to a final concentration of 20 mg / ml at 4 ° C.
Stored in. G2 buffer (20 ml) was prepared (from 100 mg / ml stock) by diluting DNAse A to a final concentration of 200 mg / ml. Using a large Polytron tip in a laminar flow TC hood to avoid aerosol inhalation, 19 ml of tumor tissue
It homogenized in G2 buffer for 60 seconds and kept at room temperature. The polytron was cleaned between samples by spinning with ₂ L each of ddH ₂ O for 2 × 30 seconds and then with G2 buffer (50 ml). If the tissue is on the generator chip,
The device was disassembled and cleaned. Quiagen protease (prepared as above, 1.0 ml) was added, then vortexed and incubated at 50 ° C. for 3 hours. Incubation and centrifugation was repeated until the lysate was clear (eg, incubated for an additional 30-60 minutes and pelleted at 3000 xg for 10 minutes at 4 ° C). Human Blood Preparation and Lysis: Blood was drawn from healthy volunteers using standard infectious agent protocols and citrated to 10 ml samples per chip. Quiagen Protease was freshly prepared by diluting in 6.25 ml cold ddH ₂ O to a final concentration of 20 mg / ml at 4 ° C.
Stored in. G2 buffer was prepared by diluting DNAseA from a 100 mg / ml stock to a final concentration of 200 μg / ml. Blood (10 ml) was placed in a 50 ml conical tube, 10 ml of C1 buffer and 30 ml of ddH ₂ O (both previously equilibrated at 4 ° C.) were added, and the mixture was inverted and mixed on ice for 10 minutes. Held Beckman
Nuclei were pelleted in a swinging bucket rotor at 2500 rpm for 15 minutes at 4 ° C and the supernatant discarded. The nuclei were suspended in ₂ ml C1 buffer (4 ° C.) and 6 ml ddH ₂ O (4 ° C.) with vortexing. The vortex was repeated until the pellet turned white. The nuclei were then suspended in the remaining buffer using a 200 μl tip. G2 buffer (10 ml) was gently vortexed while adding to the suspension nuclei, then vortexed vigorously for 30 seconds. Add Quiagen Protease (200μl), 5
Incubated for 60 minutes at 0 ° C. The incubation and centrifugation was repeated until the lysate was clear (eg, incubated for an additional 30-60 minutes, 4
Pellet at 3000 xg for 10 minutes at 0 ° C).

Purification of clarified lysates: (1) Isolation of genomic DNA: Genomic DNA was equilibrated with 10 ml of QBT buffer (1 sample per maxichip preparation). The QF elution buffer was equilibrated at 50 ° C. The sample was vortexed for 30 seconds, then loaded onto an equilibrated tip and drained by gravity. 2x15ml tip
It was washed with QC buffer. The DNA was eluted in 30 ml silanized, autoclaved 30 ml Cortex tubes with 15 ml QF buffer (50 ° C). Isopropanol
(10.5 ml) was added to each sample, the tubes were coated with paraffin and mixed by inversion repeatedly until the DNA was precipitated. Specimen 1 at 15,000 rpm at 4 ° C on SS-34 rotor
Pelletized by centrifugation for 0 minutes. Mark the pellet position and discard the supernatant,
ml 70% ethanol (4 ° C) was added. Specimen on SS-34 rotor at 4 ° C for 10,0
Centrifuge at 00 rpm for 10 minutes and pellet again. The pellet position was marked and the supernatant was discarded. The tube was then laid on a dry shelf and dried at 37 ° C. for 10 minutes, taking care to overdry the sample. After drying, the pellet was dissolved in 1.0 ml TE (pH 8.5) and placed at 50 ° C. for 1-2 hours. The sample was kept at 4 ° C. overnight to continue lysis. The DNA solution was then transferred to a 1.5 ml tube equipped with a 26 gauge needle on a tuberculin syringe. The transfer was repeated 5x to shear the DNA. The sample was then placed at 50 ° C. for 1-2 hours.

(2) Quantification of Genomic DNA and Preparation for Gene Amplification Assay: The DNA level in each tube was determined by Beckman DU640 spectroscopy with standard A ₂₆₀ , A ₂₈₀ spectra at a 1:20 dilution (5 μl DNA + 95 μl ddH ₂ O). It was quantified using a 0.1 ml quartz cuvette in a photometer. The A ₂₆₀ / A ₂₈₀ ratio was in the range of 1.8-1.9. Each DNA sample was then diluted in TE (pH 8.5) to approximately 200 ng / ml. If the starting material was in high concentration (approximately 700 ng / μl), the material was left at 50 ° C. for several hours until resuspended. Fluorescent DNA quantification was then performed on the diluted material (20-600 ng / ml) with the manufacturer's instructions modified as follows. This was done by warming the Hoeffer DyNA Quant 200 Fluorometer for about 15 minutes. Hoechst dye working solution (# H33258, 10 μl, 12 of used)
(Prepared within time) was diluted in 100 ml of 1x TNE buffer. A 2 ml cuvette was filled with the fluorometer solution, placed on the machine and the machine was zeroed. pGEM3Zf (+) (2
μl, lot # 360851026) was added to 2 ml of fluorometer solution and calibrated to 200 units. An additional 2 μl of pGEM3Zf (+) DNA was then tested to confirm the reading at 400 +/- 10 units. Each sample was then read at least 3 times. When three samples were found to be within 10% of each other, their average was taken and this value was used as the quantification value. The concentration determined fluorometrically was then used to dilute each sample to 10 ng / μl in ddH ₂ O. This was done simultaneously for all template samples for one TaqMan plate assay, with enough material to perform the 500-1000 assay. Samples are Taqman ^™ primers and probes for B-actin and G
Both APDH were tested three times on a single plate with normal human DNA and no template control. CT value of normal human DNA subtracted from test DNA is +/-
The diluted sample was used when it was 1 Ct. Diluted, lot-qualified Genome D
NA was stored at -80 ° C in 1.0 ml aliquots. Aliquots used for subsequent gene amplification assays were stored at 4 ° C. 8-9 for each 1 ml aliquot
Sufficient for testing plates or 64. Gene Amplification Assay: PRO polypeptide compounds of the invention were screened in primary tumors
． The resulting ΔCt values of 1 or more are reported in Table 9 below.

[0225] Since the amplification of the various DNAs described above occurs in various cancer tumors and tumor cell lines derived from various human tissues, these molecules appear to play a significant role in tumorigenesis and / or growth. As a result, the amplification and / or improved expression of these molecules allows the diagnosis to be made to detect the presence of individual tumors,
Antagonists directed against the proteins encoded by the above-mentioned DNA molecules
Antibodies (eg, antibodies) are expected to have utility in treating cancer.

Example 69: Gene Expression in Bovine Pericytes (Assay 105) This assay was designed to identify the pericyte gene expression patterns induced by the hits in Assay 96 described above. Bovine pericytes were plated for 1 week in 60 mm culture dishes in growth medium. On day 1, various polypeptides were diluted (1%) and incubated with pericytes for 1, 4 and 24 hours. Cells were harvested and RNA was isolated using TRI-reagent according to the instructions included. RNA was then quantified using a spectrophotometer by reading the 260/280 OD. Gene expression analysis was performed by TaqMan reaction using Perkin Elmer reagent and specifically designed bovine probe and primers. The expression of the following genes was analyzed: GAPDH, beta-integrin, connective tissue growth factor-beta (C
TGF), ICAM-1, monocyte chemoattractant protein-1 (MCP-1), osteopontin, transforming growth factor-beta (TGF-beta), TGF-beta receptor, tissue inhibitor of metalloproteinase (TIMP), tissue factor(
TF), VEGF-α, thrombospondin, VEGF-β, angiopoietin-
2, and collagenase. Duplicates were averaged and SD was determined. Gene expression levels were then normalized to GAPDH. These were then normalized to the expression levels obtained with a protein (PIN32) that did not significantly induce gene expression in bovine pericytes when compared to untreated controls. All PRO polypeptides that gave more than 2-fold greater gene expression than the PIN32 control are considered positive. The following PRO polypeptides tested positive in this assay: PRO217.

Example 70: Cytokine Release Assay (Assay 120) This assay demonstrates that PRO polypeptides of the present invention are administered to peripheral blood mononuclear cells (PBMCs).
s) was designed to determine if it could induce the release of cytokines. PRO polypeptides capable of inducing the release of cytokines from PBMCs would be useful in the treatment of medical conditions in which enhanced release of cytokines would be beneficial and will be readily apparent to those of skill in the art. In particular, 1x10 ⁶ cells / ml of peripheral blood mononuclear cells
(PBMC) was incubated with 1% PRO polypeptide in complete RPMI medium for 3 days. Supernatants were then collected and compared to human IgG treated controls and assayed by ELISA for increasing levels of various cytokines. A positive in the assay is a 10-fold or greater increase in cytokine concentration in the PRO polypeptide treated sample as compared to the human IgG treated control. The following polypeptides tested positive in this assay: P
RO9940.

Example 71: Identification of PRO polypeptides that activate pericytes (Assay 12
5) This assay shows that certain polypeptides of the invention act to activate the proliferation of pericytes, thus not only as a diagnostic marker for certain types of pericyte-associated tumors, but also pericyte-associated It is also shown to be useful in the production of antagonists that are expected to be useful in the treatment of tumors. Moreover, activation of pericyte proliferation is also correlated with induction of angiogenesis, and thus PRO capable of inducing pericyte proliferation.
The polypeptides are expected to be useful in the treatment of conditions in which induction of angiogenesis is beneficial, including, for example, wound healing. In particular, on the first day, pericytes were transferred to VEC Technolo
Obtained from gies and removed from the flask except 5 ml of medium. On day 2, pericytes were trypsinized, washed, spun and then plated in 96 well plates.
On day 7, the medium was removed and the pericytes were treated with 100 μl of the specific PRO polypeptide or control treatment (positive control = DEM + 5% + / − PDGF @ 500 ng / ml; negative control = PIN32, no pericyte proliferation. Polypeptides determined to have no significant effect). C-fos and GAPDH gene expression levels were then measured, replication averaged and SD determined. standardize c-fos value to GAPDH,
Results are expressed as fold increase over PIN2. A reaction is considered positive if it has at least a 2-fold or more response as compared to the negative control. The following polypeptides tested positive in this assay: P
RO217.

Example 72: Identification of Receptor / Ligand Interactions In this assay, various polypeptides are assayed for their ability to bind to a panel of potential receptor or ligand molecules for the purpose of identifying receptor / ligand interactions. It The identification of a ligand for a known receptor, a receptor for a known ligand or a novel receptor / ligand pair is for example the targeting of a bioactive molecule (ligand or bound to a receptor) to a receptor or cells known to express the ligand. The use of a receptor or ligand as a reagent for detecting the presence of a receptor or ligand in a composition suspected of containing the same, wherein the composition comprises cells suspected of expressing the ligand or receptor , Modulation of growth or other biological or immunological activity of cells known to express the receptor or ligand, modulation of immune response of the cell or to cells expressing the receptor or ligand, receptor or ligand Growth of cells expressing, or biological or immune Preparation of agonists, antagonists and / or antibodies to the receptor or ligand to modulate the activity, and are useful for a variety of indications including immediately will become apparent various other adaptations by those skilled in the art. This assay is performed as follows. The PRO polypeptide of the present invention, which is believed to be a ligand for the receptor, is expressed as a fusion protein containing the Fc region of human IgG (immunoadhesin). Receptor-ligand binding is
It is detected by interacting the immunoadhesin polypeptide with cells expressing a candidate PRO polypeptide receptor (eg, Cos cells), visualizing the bound immunoadhesin with a fluorescent reagent for the Fc fusion domain, and examining by microscopy. Cells expressing candidate receptors are generated by parallel transient transfection of a defined subset of a library of cDNA expression vectors encoding PRO polypeptides that can function as receptor molecules. The cells are then incubated for 1 hour in the presence of the PRO polypeptide immunoadhesin, which is assaying for receptor binding potential. The cells were then washed and fixed with paraformaldehyde. The cells were then incubated with a fluorescent conjugated antibody to the Fc portion of the PRO polypeptide immunoadhesin (eg, FITC conjugated goat anti-human Fc antibody). The cells were then washed again and examined microscopically. Positive interactions are due to the presence of fluorescent labels in cells transfected with the cDNA encoding the particular PRO polypeptide receptor or receptor pool, as well as in similar prepared cells transfected with other cDNAs or cDNA pools. Judged by the absence of fluorescent label. If a given pool of cDNA expression vectors is determined to be positive for interaction with the PRO polypeptide immunoadhesin, then the individual cDNA species containing that pool are individually assayed (the pool is "broken"). ]), A specific cDNA encoding a receptor capable of interacting with the PRO polypeptide immunoadhesin is determined. In another embodiment of this assay, an epitope tag potential ligand PR
O polypeptide (eg, histidine “His” tag), a potential receptor PRO expressed as a fusion with the Fc domain of human IgG (immunoadhesin).
It can interact with a panel of polypeptide molecules. Epitope tag PR
Following a 1 hour co-incubation with O polypeptide, the candidate receptors were each immunoprecipitated with Protein A beads and the beads washed. Potential ligand interactions were determined by Western blot analysis of immunoprecipitated complexes with antibodies against the epitope tag. If a band of the expected molecular weight of the epitope tag protein was found by Western blot analysis with the candidate receptor and was not found to occur with other members of the panel of potential receptors, the It is judged that the action has occurred. Using these assays, the following receptor / ligand interactions were identified here: (1) PRO533 is a fibroblast growth factor receptor-4 (FGFR-4; Partanen et al., E.
MBO J. 10 (6): 1347-1354 (1991)). (2) PRO301 binds to itself and thus functions as an adhesion molecule. (3) PRO187 has a high affinity and fibroblast growth factor receptor-3 (FGFR-3; K).
eegan et al., Proc. Natl. Acad. Sci. USA 88: 1095-1099 (1991)), FGFR-1, 2 and 4 with low affinity (Isacchi et al., Nuc. Acids. Res. 18 (7, respectively). ): 1
906 (1990), Dionne et al., EMBO J. 9 (9): 2685-2692 (1990) and Partanen et al., EMBO J.
. 10 (6): 1347-1354 (1991)). (4) PRO337 binds to PRO6004. (5) PRO1411 binds to PRO4356. (6) PRO10096 binds to PRO2630. (7) PRO246 binds to itself and thus functions as an attachment molecule. (8) PRO6307 binds to PRO265. (9) PRO6003 binds to PRO941.

Material Deposits The following materials have been deposited with the American Type Culture Collection, 10801 University Boulevard, Manassas, Virginia 20110-2209, USA (ATCC): Table 10 Material ATCC Deposit No. Deposit Date DNA22779-1130 209280 1997 September 18, 1998 DNA26846-1397 203406 October 27, 1998 DNA32279-1131 209259 September 16, 1997 DNA32288-1132 209261 September 16, 1997 DNA33094-1131 209256 September 16, 1997 DNA33785-1143 209417 1997 October 28, DNA35663-1129 209201 June 18, 1997 DNA46777-1253 209619 February 5, 1998 DNA60783-1611 203130 August 18, 1998 DNA62306-1570 203254 September 9, 1998 DNA62880-1513 203097 1998 August 4, 1998 DNA64 896-1539 203238 September 9, 1998 DNA71290-1630 203275 September 22, 1998 DNA96031-2664 PTA-237 June 15, 1999 DNA108722-2743 PTA-552 August 17, 1999 DNA35674 -1142 209416 October 28, 1997 DNA41234 209618 February 5, 1998 DNA77503-1686 203362 October 20, 1998 DNA49435-1219 209480 November 21, 1997 DNA40628-1 216 209432 November 7, 1997 DNA27864-1155 209375 October 16, 1997 DNA43316-1237 209487 November 21, 1997 DNA59212-1627 203245 September 9, 1998 DNA86576-2595 203868 March 23, 1999 DNA35639- 1172 209396 October 17, 1997 DNA36350-1158 209378 October 16, 1997 DNA53906-1368 209747 April 7, 1998 DNA125185-2806 PTA-1031 December 7, 1999 DNA83568-2692 PTA-386 July 1999 The 20th

These deposits were made in accordance with the provisions of the Budapest Treaty and its Regulations (Budapest Treaty) on the international recognition of deposits of microorganisms under the patent procedure. This guarantees that the viable culture of the deposit will be maintained for 30 years from the date of deposit. The deposit may be obtained from the ATCC in accordance with the terms of the Budapest Treaty and in accordance with the agreement between Genentech and ATCC, whichever is first, at the time of issuance of the relevant U.S. patent or at any time. At the time of publication of a U.S. or foreign patent application, we ensure that the progeny of the deposited culture will be permanently and unrestrictedly available, and will be subject to United States Patent Law Section 122 and the Patent Office Commissioner's Regulations accordingly (especially reference number 886OG638
(Including 37 CFR §1.14) of this document, guaranteeing that descendants will be available to those who have been determined by the US Patent Office Commissioner to have rights. The assignee of the present application agrees that if the deposited culture dies or is lost or destroyed if cultured under the proper conditions, the material will be replaced immediately with the same at the time of notification. To do. The availability of deposited material is not to be construed as a license to practice the invention in breach of any rights granted under the authority of any government pursuant to patent law. The written specification given above is considered sufficient to enable one skilled in the art to practice the invention. The deposited embodiment is intended as an illustration of one of the aspects of the invention and any functionally equivalent construct is within the scope of the invention, so that the deposited deposits are within the scope of the invention. It is not limited. No deposit of material herein is admitted that the written description contained therein is sufficient to enable the practice of any aspect of the invention, including its best mode. It is not to be construed as limiting the scope of the claims to the particular illustrations presented. Indeed, various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims.

[Brief description of drawings]

Figure 1 shows the nucleotide sequence of the native sequence PRO196 cDNA (SEQ ID NO: 3), SEQ ID NO: 3 is the clone herein designated "DNA22779-1130".

[Figure 2] This shows the amino acid sequence (SEQ ID NO: 4) derived from the coding sequence of SEQ ID NO: 3 shown in Figure 1.

[Figure 3] shows the nucleotide sequence of the native sequence PRO444 cDNA (SEQ ID NO: 8), SEQ ID NO: 8 is the clone designated herein "DNA26846-1397".

[Figure 4] This shows the amino acid sequence (SEQ ID NO: 9) derived from the coding sequence of SEQ ID NO: 8 shown in Figure 3.

[Figure 5] Shows the nucleotide sequence of the native sequence PRO183 cDNA (SEQ ID NO: 10), SEQ ID NO: 10 is the clone designated herein "DNA28498".

[Figure 6] This shows the amino acid sequence (SEQ ID NO: 11) derived from the coding sequence of SEQ ID NO: 10 shown in Figure 5.

[Fig7] This shows the nucleotide sequence of the native sequence PRO185 cDNA (SEQ ID NO: 12), and SEQ ID NO: 12 is a clone herein designated "DNA28503".

[Figure 8] This shows the amino acid sequence (SEQ ID NO: 13) derived from the coding sequence of SEQ ID NO: 12 shown in Figure 7.

[Figure 9] This shows the nucleotide sequence (SEQ ID NO: 14) of the native sequence PRO210 cDNA, and SEQ ID NO: 14 is a clone designated herein as "DNA32279-1131".

[Figure 10] This shows the amino acid sequence (SEQ ID NO: 15) derived from the coding sequence of SEQ ID NO: 14 shown in Figure 9.

[Figure 11] This shows the nucleotide sequence (SEQ ID NO: 16) of the native sequence PRO215 cDNA, wherein SEQ ID NO: 16 is "DNA32288-1132".
Is a clone named.

[Figure 12] This shows the amino acid sequence (SEQ ID NO: 17) derived from the coding sequence of SEQ ID NO: 16 shown in Figure 11.

[Figure 13] This shows the nucleotide sequence of the native sequence PRO217 cDNA (SEQ ID NO: 21), wherein SEQ ID NO: 21 is "DNA33094-1131".
Is a clone named.

[Figure 14] This shows the amino acid sequence (SEQ ID NO: 22) derived from the coding sequence of SEQ ID NO: 21 shown in Figure 13.

[Figure 15] This shows the nucleotide sequence of the native sequence PRO242 cDNA (SEQ ID NO: 23), wherein SEQ ID NO: 23 is "DNA33785-1143".
Is a clone named.

[Figure 16] This shows the amino acid sequence (SEQ ID NO: 24) derived from the coding sequence of SEQ ID NO: 23 shown in Figure 15.

[Fig17] This shows the nucleotide sequence of the native sequence PRO288 cDNA (SEQ ID NO: 28), wherein SEQ ID NO: 28 is "DNA35663-1129".
Is a clone named.

[Figure 18] This shows the amino acid sequence (SEQ ID NO: 29) derived from the coding sequence of SEQ ID NO: 28 shown in Figure 17.

[Figure 19] This shows the nucleotide sequence (SEQ ID NO: 31) of the native sequence PRO365 cDNA, wherein SEQ ID NO: 31 is "DNA46777-1253".
Is a clone named.

[Figure 20] This shows the amino acid sequence (SEQ ID NO: 32) derived from the coding sequence of SEQ ID NO: 31 shown in Figure 19.

[Figure 21] This shows the nucleotide sequence of the native sequence PRO1361 cDNA (SEQ ID NO: 38), wherein SEQ ID NO: 38 is referred to as "DNA60783-1611".
It is a clone named.

[Figure 22] This shows the amino acid sequence (SEQ ID NO: 39) derived from the coding sequence of SEQ ID NO: 38 shown in Figure 21.

[Figure 23] This shows the nucleotide sequence of the native sequence PRO1308 cDNA (SEQ ID NO: 40), wherein SEQ ID NO: 40 is referred to herein as "DNA62306-1570".
It is a clone named.

[Figure 24] This shows the amino acid sequence (SEQ ID NO: 41) derived from the coding sequence of SEQ ID NO: 40 shown in Figure 23.

[Figure 25] This shows the nucleotide sequence of the native sequence PRO1183 cDNA (SEQ ID NO: 51), wherein SEQ ID NO: 51 is herein referred to as "DNA62880-1513".
It is a clone named.

[Figure 26] This shows the amino acid sequence (SEQ ID NO: 52) derived from the coding sequence of SEQ ID NO: 51 shown in Figure 25.

[Figure 27] This shows the nucleotide sequence of the native sequence PRO1272 cDNA (SEQ ID NO: 53), wherein SEQ ID NO: 53 is herein referred to as "DNA64896-1539".
It is a clone named.

[Figure 28] This shows the amino acid sequence (SEQ ID NO: 54) derived from the coding sequence of SEQ ID NO: 53 shown in Figure 27.

[Figure 29] This shows the nucleotide sequence of the native sequence PRO1419 cDNA (SEQ ID NO: 55), wherein SEQ ID NO: 55 is referred to herein as "DNA71290-1630".
It is a clone named.

[Figure 30] This shows the amino acid sequence (SEQ ID NO: 56) derived from the coding sequence of SEQ ID NO: 55 shown in Figure 29.

[Figure 31] This shows the nucleotide sequence of the native sequence PRO4999 cDNA (SEQ ID NO: 57), wherein SEQ ID NO: 57 is herein referred to as "DNA96031-2664.
It is a clone named.

[Figure 32] This shows the amino acid sequence (SEQ ID NO: 58) derived from the coding sequence of SEQ ID NO: 57 shown in Figure 31.

[Figure 33] This shows the nucleotide sequence of the native sequence PRO7170 cDNA (SEQ ID NO: 62), wherein SEQ ID NO: 62 is herein referred to as "DNA108722-274."
3 ”is a clone.

[Figure 34] This shows the amino acid sequence (SEQ ID NO: 63) derived from the coding sequence of SEQ ID NO: 62 shown in Figure 33.

[Figure 35] This shows the nucleotide sequence of the native sequence PRO248 cDNA (SEQ ID NO: 64), wherein SEQ ID NO: 64 is "DNA35674-1142".
Is a clone named.

[Figure 36] This shows the amino acid sequence (SEQ ID NO: 65) derived from the coding sequence of SEQ ID NO: 64 shown in Figure 35.

[Figure 37] Shows the nucleotide sequence of the native sequence PRO353 cDNA (SEQ ID NO: 72), SEQ ID NO: 72 is a clone herein designated "DNA41234".

[Figure 38] This shows the amino acid sequence (SEQ ID NO: 73) derived from the coding sequence of SEQ ID NO: 72 shown in Figure 37.

Figure 39 shows the nucleotide sequence (SEQ ID NO: 77) of the native sequence PRO1318 cDNA, wherein SEQ ID NO: 77 is set forth herein as "DNA73838-1674.
It is a clone named.

[Figure 40] This shows the amino acid sequence (SEQ ID NO: 78) derived from the coding sequence of SEQ ID NO: 77 shown in Figure 39.

[Figure 41] This shows the nucleotide sequence of the native sequence PRO1600 cDNA (SEQ ID NO: 79), wherein SEQ ID NO: 79 is referred to as "DNA77503-1686".
It is a clone named.

[Figure 42] This shows the amino acid sequence (SEQ ID NO: 80) derived from the coding sequence of SEQ ID NO: 79 shown in Figure 41.

Figure 43 shows the nucleotide sequence of the native sequence PRO9940 cDNA (SEQ ID NO: 83), SEQ ID NO: 83 is the clone designated herein "DNA92282".

[Figure 44] This shows the amino acid sequence (SEQ ID NO: 84) derived from the coding sequence of SEQ ID NO: 83 shown in Figure 43.

[Figure 45] This shows the nucleotide sequence of the native sequence PRO533 cDNA (SEQ ID NO: 85), wherein SEQ ID NO: 85 is "DNA49435-1219".
Is a clone named.

[Figure 46] This shows the amino acid sequence (SEQ ID NO: 86) derived from the coding sequence of SEQ ID NO: 85 shown in Figure 45.

[Figure 47] This shows the nucleotide sequence of the native sequence PRO301 cDNA (SEQ ID NO: 90), wherein SEQ ID NO: 90 is "DNA40628-1216".
Is a clone named.

[Figure 48] This shows the amino acid sequence (SEQ ID NO: 91) derived from the coding sequence of SEQ ID NO: 90 shown in Figure 47.

[Figure 49] This shows the nucleotide sequence of the native sequence PRO187 cDNA (SEQ ID NO: 98), wherein SEQ ID NO: 98 is "DNA27864-1155".
Is a clone named.

[Figure 50] This shows the amino acid sequence (SEQ ID NO: 99) derived from the coding sequence of SEQ ID NO: 98 shown in Figure 49.

[Figure 51] This shows the nucleotide sequence of the native sequence PRO337 cDNA (SEQ ID NO: 103), wherein SEQ ID NO: 103 is referred to herein as "DNA43316-123".
It is a clone named "7".

[Figure 52] This shows the amino acid sequence (SEQ ID NO: 104) derived from the coding sequence of SEQ ID NO: 103 shown in Figure 51.

[Figure 53] This shows the nucleotide sequence of the native sequence PRO1411 cDNA (SEQ ID NO: 105), wherein SEQ ID NO: 105 is referred to herein as "DNA59212-16".
The clone is designated as "27".

[Figure 54] This shows the amino acid sequence (SEQ ID NO: 106) derived from the coding sequence of SEQ ID NO: 105 shown in Figure 53.

[Figure 55] This shows the nucleotide sequence of the native sequence PRO4356 cDNA (SEQ ID NO: 107), wherein SEQ ID NO: 107 is herein referred to as "DNA86576-25.
The clone designated "95".

[Figure 56] This shows the amino acid sequence (SEQ ID NO: 108) derived from the coding sequence of SEQ ID NO: 107 shown in Figure 55.

[Figure 57] This shows the nucleotide sequence of the native sequence PRO246 cDNA (SEQ ID NO: 109), wherein SEQ ID NO: 109 is referred to herein as "DNA35639-117.
2 ”is a clone named.

[Figure 58] This shows the amino acid sequence (SEQ ID NO: 110) derived from the coding sequence of SEQ ID NO: 109 shown in Figure 57.

[Figure 59] This shows the nucleotide sequence of the native sequence PRO265 cDNA (SEQ ID NO: 114), wherein SEQ ID NO: 114 is "DNA36350-115".
8 ”is a clone.

[Figure 60] This shows the amino acid sequence (SEQ ID NO: 115) derived from the coding sequence of SEQ ID NO: 114 shown in Figure 59.

[Figure 61] This shows the nucleotide sequence of the native sequence PRO941 cDNA (SEQ ID NO: 120), wherein SEQ ID NO: 120 is referred to as "DNA53906-136".
8 ”is a clone.

[Figure 62] This shows the amino acid sequence (SEQ ID NO: 121) derived from the coding sequence of SEQ ID NO: 120 shown in Figure 61.

[Figure 63] Nucleotide sequence of native sequence PRO10096 cDNA (
SEQ ID NO: 125), and SEQ ID NO: 125 is herein referred to as "DNA125185-
2806 ”.

[Figure 64] This shows the amino acid sequence (SEQ ID NO: 126) derived from the coding sequence of SEQ ID NO: 125 shown in Figure 63.

Figure 65 shows the nucleotide sequence of the native sequence PRO6003 cDNA (SEQ ID NO: 127), SEQ ID NO: 127 is set forth herein as "DNA83568-26".
This is a clone designated as "92".

[Figure 66] This shows the amino acid sequence (SEQ ID NO: 128) derived from the coding sequence of SEQ ID NO: 127 shown in Figure 65.

Figure 67 shows the nucleotide sequence of the native sequence PRO6004 cDNA (SEQ ID NO: 129), SEQ ID NO: 129 is a clone herein designated "DNA92259".

[Figure 68] This shows the amino acid sequence (SEQ ID NO: 130) derived from the coding sequence of SEQ ID NO: 129 shown in Figure 67A-B.

[Figure 69] This shows the nucleotide sequence of the native sequence PRO350 cDNA (SEQ ID NO: 131), wherein SEQ ID NO: 131 is "DNA44175-131".
4 ”is a clone named.

[Figure 70] This shows the amino acid sequence (SEQ ID NO: 132) derived from the coding sequence of SEQ ID NO: 131 shown in Figure 69.

Figure 71 shows the nucleotide sequence of the native sequence PRO2630 cDNA (SEQ ID NO: 136), SEQ ID NO: 136 is a clone herein designated "DNA83551".

[Figure 72] This shows the amino acid sequence (SEQ ID NO: 137) derived from the coding sequence of SEQ ID NO: 136 shown in Figure 71.

Figure 73 shows the nucleotide sequence (SEQ ID NO: 138) of the native sequence PRO6309 cDNA, wherein SEQ ID NO: 138 is "DNA116510".
Is a clone named.

[Figure 74] This shows the amino acid sequence (SEQ ID NO: 139) derived from the coding sequence of SEQ ID NO: 138 shown in Figure 73.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) A61K 45/00 A61P 35/00 4C085 48/00 37/02 4C086 A61P 35/00 43/00 105 4H045 37 / 02 C07K 14/47 43/00 105 14/705 C07K 14/47 16/28 14/705 19/00 16/28 C12N 1/15 19/00 1/19 C12N 1/15 1/21 1/19 C12P 21 / 02 C 1/21 G01N 33/53 D 5/10 33/566 C12P 21/02 33/577 B G01N 33/53 33/58 Z 33/566 C12P 21/08 33/577 C12N 15/00 ZNAA 33 / 58 5/00 A // C12P 21/08 A61K 37/02 (31) Priority claim number 60/145, 698 (32) Priority date July 26, 1999 (July 26, 1999) (33) Priority Claiming country United States (US) (31) Priority claim number 60/149, 396 (32) Priority August 17, 1999 (August 17, 1999) (33) Priority claiming countries United States (US) (31) Priority claim number US9920111 (32) Priority date September 1, 1999 (1999.9. 1) (33) Priority claiming United States (US) (31) Priority claiming number US9920594 (32) Priority date September 8, 1999 (1999.9.8) (33) Priority claiming United States (US) ) (31) Priority claim number US9921090 (32) Priority date September 15, 1999 (September 15, 1999) (33) Priority claim country United States (US) (31) Priority claim number US9921547 (32) Priority date September 15, 1999 (September 15, 1999) (33) Priority claiming country United States (US) (31) Priority claim number US9928313 (32) Priority date November 30, 1999 (1999. 11.30) (33) Priority claiming United States (US) (31) Priority claiming number US9928301 (32) Priority date December 1, 1999 (1999.12.1) (33) Priority claiming United States (US) (31) Priority claim number U S9928565 (32) Priority date December 2, 1999 (December 2, 1999) (33) Priority claiming country United States (US) (31) Priority claim number 60 / 169,495 (32) Priority date 1999 December 7, 1999 (December 27, 1999) (33) Priority claiming country United States (US) (31) Priority claim number US0000219 (32) Priority date January 5, 2000 (2000.1.5) (33) Priority claiming United States (US) (31) Priority claiming number US0004341 (32) Priority date February 18, 2000 (February 18, 2000) (33) Priority claiming United States (US) ( 31) Priority claim number US0004342 (32) Priority date February 18, 2000 (February 18, 2000) (33) Country of priority claim United States (US) (31) Priority claim number US0004414 (32) Priority date February 22, 2000 (February 22, 2000) (33) Priority claiming country United States (US) (31) Priority claim number US0005601 (32) Priority date March 1, 2000 (2000. March. 1) (33) Priority claiming countries United States ( US) (31) Priority claim number US0005841 (32) Priority date March 2, 2000 (2000.3.2) (33) Priority claim country United States (US) (31) Priority claim number US0007377 (32) ) Priority date March 20, 2000 (March 20, 2000) (33) Priority claiming country United States (US) (31) Priority claim number US0008439 (32) Priority date March 30, 2000 (2000) 3.30) (33) Priority claiming country United States (US) (31) Priority claiming number US0013358 (32) Priority date May 15, 2000 (2000.15.2000) (33) Priority claiming country United States (US) (31) Priority claim number US0013705 (32) Priority date May 17, 2000 (May 17, 2000) (33) Priority claim country United States (US) (81) Designated country EP (AT) , BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM) ， A, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, MZ, SD, SL, SZ, TZ, UG, ZW), EA (AM , AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH, CN, CR , CU, CZ, DE, DK, DM, DZ, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ, NO, NZ, PL, PT, RO, RU, SD, SE , SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA, ZW (72) Inventor Baker, Kevin, Pee. United States Maryland 20878, Darnestown, Indian Drive 14006 (72) Inventor Botstein, David United States California 94002, Belmont, Somerset Drive 2539 (72) Inventor Desnoyer's, Luke United States California 94133, San Francisco, Stockton Strey To 2050 (72) Inventor Eaton, Dan, Elle. United States California 94901, San Rafael, Night Drive 75 (72) Inventor Ferrara, Napoleon United States California 94109, San Francisco, Pacific Avenue 2090 704 (72) Inventor von Sherman United States California 94502, Alameda, Basin Sideway 19 (72) ) Inventor Gao, Wei-Kan United States California 94404, Foster City, Pilgrim Drive 641 (72) Inventor Gerber, Hans Peter United States California 94107, San Francisco, Tennessee Street 1121 5 (72) Inventor Geritzen, Mary, E. United States California 94402, San Mateo, Parrot Drive 541 (72) Inventor Goddard, Audrey United States California 94131, San Francisco, Congo Street 110 (72) Inventor Godowski, Paul, J. United States California 94010, Burlingame, Easton Drive 2627 (72) Inventor Gurney, Austin, El. United States California 94002, Belmont, Debby Lane 1 (72) Inventor Kurjavin, Ivar, J .. United States California 94044, Pacifica, Del Rhode 811 (72) Inventor Mother, Jenny, Pea. United States California 94030, Millbrae, Laplender Drive 269 (72) Inventor Napier, Marie, A .. United States California 94010, Hillsborough, Hane Road 1015 (72) Inventor Pan, James United States California 94002, Belmont, Coronet Boulevard 2705 (72) Inventor Paoni, Nicholas, Ef. USA California 94002, Belmont, Terrace Drive 1756 (72) Inventor Roy Margaret, Ann USA California 94123, San Francisco, Webster Street 2960 4 (72) Inventor Stuart, Timothy A. United States California 94114, San Francisco, Douglas Street 465 (72) Inventor Tamas, Daniel United States California 94563, Olinda, Lae Avenue 3 (72) Inventor Watanabe, Colin, Kay. United States California 94556 Moraga, Corris Drive 128 (72) Inventor Williams, P. , Mickey USA California 94019, Half Moon Bay, Alt Avenue 509 (72) Inventor Wood, William, Ai. United States California 94010, Hillsborough, Southdown Court 35 (72) Inventor Tsang, Zemin United States California 94404, Foster City, Torus Drive 876 F Term (Reference) 2G045 BA13 BB20 CB01 CB21 DA12 DA13 DA14 DA36 FB02 FB03 FB04 FB06 FB07 4B024 AA01 AA11 AA12 BA21 BA31 BA44 BA56 BA58 BA63 CA04 DA02 DA05 DA06 DA12 EA04 GA05 GA11 GA14 HA03 HA08 HA19 4B064 AF27 AG02 AG13 AG15 AG20 AG26 AG27 CA02 CA06 CA10 CA12 CA19 CA20 CC24 CE12 DA03 DA13 4B065 AA26X AA72X A25 CAX CAACAA CAA CAY 4C084 AA02 AA06 AA07 AA13 AA17 BA01 BA08 BA22 BA23 MA01 NA14 ZB072 ZB212 ZB262 4C085 AA13 AA14 CC32. FA73 FA74

Claims (39)

[Claims] 1. Fig2 (SEQ ID NO: 4), FIG4 (SEQ ID NO: 9), Fig
6 (SEQ ID NO: 11), FIG8 (SEQ ID NO: 13), Fig10 (SEQ ID NO: 15)
, Figure12 (SEQ ID NO: 17), Figure14 (SEQ ID NO: 22), Figure16 (SEQ ID NO: 24), Figure18 (SEQ ID NO: 29), Figure20 (SEQ ID NO: 32),
Figure 22 (SEQ ID NO: 39), Figure 24 (SEQ ID NO: 41), Figure 26 (SEQ ID NO: 52), Figure 28 (SEQ ID NO: 54), Figure 30 (SEQ ID NO: 56), F
ig32 (SEQ ID NO: 58), Fig34 (SEQ ID NO: 63), Fig36 (SEQ ID NO: 65), Fig38 (SEQ ID NO: 73), Fig40 (SEQ ID NO: 78), Fi
g42 (SEQ ID NO: 80), Fig44 (SEQ ID NO: 84), Fig46 (SEQ ID NO: 86), Fig48 (SEQ ID NO: 91), Fig50 (SEQ ID NO: 99), Fig
52 (SEQ ID NO: 104), FIG54 (SEQ ID NO: 106), FIG56 (SEQ ID NO: 108), FIG58 (SEQ ID NO: 110), FIG60 (SEQ ID NO: 115)
, Figure 62 (SEQ ID NO: 121), Figure 64 (SEQ ID NO: 126), Figure 66
(SEQ ID NO: 128), FIG68 (SEQ ID NO: 130), FIG70 (SEQ ID NO :)
132), Fig72 (SEQ ID NO: 137) and Fig74 (SEQ ID NO: 139), having at least 80% nucleic acid sequence identity with a nucleotide sequence encoding an amino acid sequence selected from the group consisting of amino acid sequences. Isolated nucleic acid. 2. FIG. 1 (SEQ ID NO: 3), FIG3 (SEQ ID NO: 8), FIG.
5 (SEQ ID NO: 10), FIG7 (SEQ ID NO: 12), FIG9 (SEQ ID NO: 14),
Figure 11 (SEQ ID NO: 16), Figure 13 (SEQ ID NO: 21), Figure 15 (SEQ ID NO: 23), Figure 17 (SEQ ID NO: 28), Figure 19 (SEQ ID NO: 31), F
ig21 (SEQ ID NO: 38), Fig23 (SEQ ID NO: 40), Fig25 (SEQ ID NO: 51), Fig27 (SEQ ID NO: 53), Fig29 (SEQ ID NO: 55), Fi
g31 (SEQ ID NO: 57), Fig33 (SEQ ID NO: 62), Fig35 (SEQ ID NO: 64), Fig37 (SEQ ID NO: 72), Fig39 (SEQ ID NO: 77), Fig
41 (SEQ ID NO: 79), FIG43 (SEQ ID NO: 83), FIG45 (SEQ ID NO: 83)
85), Fig47 (SEQ ID NO: 90), Fig49 (SEQ ID NO: 98), Fig5
1 (SEQ ID NO: 103), FIG53 (SEQ ID NO: 105), FIG55 (SEQ ID NO: 107), FIG57 (SEQ ID NO: 109), FIG59 (SEQ ID NO: 114),
Figure 61 (SEQ ID NO: 120), Figure 63 (SEQ ID NO: 125), Figure 65 (
SEQ ID NO: 127), Fig67A-B (SEQ ID NO: 129), Fig69 (SEQ ID NO: 131), Fig71 (SEQ ID NO: 136) and FIG73 (SEQ ID NO: 138)
An isolated nucleic acid having at least 80% nucleic acid sequence identity with a nucleotide sequence selected from the group consisting of: 3. FIG. 1 (SEQ ID NO: 3), FIG3 (SEQ ID NO: 8), FIG.
5 (SEQ ID NO: 10), FIG7 (SEQ ID NO: 12), FIG9 (SEQ ID NO: 14),
Figure 11 (SEQ ID NO: 16), Figure 13 (SEQ ID NO: 21), Figure 15 (SEQ ID NO: 23), Figure 17 (SEQ ID NO: 28), Figure 19 (SEQ ID NO: 31), F
ig21 (SEQ ID NO: 38), Fig23 (SEQ ID NO: 40), Fig25 (SEQ ID NO: 51), Fig27 (SEQ ID NO: 53), Fig29 (SEQ ID NO: 55), Fi
g31 (SEQ ID NO: 57), Fig33 (SEQ ID NO: 62), Fig35 (SEQ ID NO: 64), Fig37 (SEQ ID NO: 72), Fig39 (SEQ ID NO: 77), Fig
41 (SEQ ID NO: 79), FIG43 (SEQ ID NO: 83), FIG45 (SEQ ID NO: 83)
85), Fig47 (SEQ ID NO: 90), Fig49 (SEQ ID NO: 98), Fig5
1 (SEQ ID NO: 103), FIG53 (SEQ ID NO: 105), FIG55 (SEQ ID NO: 107), FIG57 (SEQ ID NO: 109), FIG59 (SEQ ID NO: 114),
Figure 61 (SEQ ID NO: 120), Figure 63 (SEQ ID NO: 125), Figure 65 (
SEQ ID NO: 127), Fig67A-B (SEQ ID NO: 129), Fig69 (SEQ ID NO: 131), Fig71 (SEQ ID NO: 136) and FIG73 (SEQ ID NO: 138)
An isolated nucleic acid having at least 80% nucleic acid sequence identity with a nucleotide sequence selected from the group consisting of the full-length coding sequences of the nucleotide sequences set forth in (4). 4. An isolated nucleic acid having at least 80% nucleic acid sequence identity with the full length coding sequence of the DNA deposited under the ATCC Deposit Number shown in Table 10. 5. A vector comprising the nucleic acid according to any one of claims 1 to 4. 6. The vector of claim 5, operably linked to a control sequence recognized by a host cell transformed with the vector. 7. A host cell comprising the vector of claim 5. 8. The host cell according to claim 7, wherein the cell is a CHO cell. 9. The host cell according to claim 7, wherein the cell is Escherichia coli. 10. The host cell according to claim 7, wherein the cell is a yeast cell. 11. A PRO polypeptide comprising culturing the host cell of claim 7 under conditions suitable for expression of the PRO polypeptide, and recovering the PRO polypeptide from cell culture. Production method. 12. Fig2 (SEQ ID NO: 4), Fig4 (SEQ ID NO: 9), Fi
g6 (SEQ ID NO: 11), Fig8 (SEQ ID NO: 13), Fig10 (SEQ ID NO: 1)
5), Figure12 (SEQ ID NO: 17), Figure14 (SEQ ID NO: 22), Figure16 (
SEQ ID NO: 24), FIG18 (SEQ ID NO: 29), FIG20 (SEQ ID NO: 32)
, Figure22 (SEQ ID NO: 39), Figure24 (SEQ ID NO: 41), Figure26 (SEQ ID NO: 52), Figure28 (SEQ ID NO: 54), Figure30 (SEQ ID NO: 56),
Figure 32 (SEQ ID NO: 58), Figure 34 (SEQ ID NO: 63), Figure 36 (SEQ ID NO: 65), Figure 38 (SEQ ID NO: 73), Figure 40 (SEQ ID NO: 78), F
ig42 (SEQ ID NO: 80), FIG44 (SEQ ID NO: 84), FIG46 (SEQ ID NO: 86), FIG48 (SEQ ID NO: 91), FIG50 (SEQ ID NO: 99), Fi
g52 (SEQ ID NO: 104), FIG54 (SEQ ID NO: 106), FIG56 (SEQ ID NO: 108), FIG58 (SEQ ID NO: 110), FIG60 (SEQ ID NO: 115)
), FIG. 62 (SEQ ID NO: 121), FIG64 (SEQ ID NO: 126), FIG6
6 (SEQ ID NO: 128), FIG68 (SEQ ID NO: 130), FIG70 (SEQ ID NO: 132), FIG72 (SEQ ID NO: 137) and FIG74 (SEQ ID NO: 139)
At least 80 amino acid sequences selected from the group consisting of the amino acid sequences shown in
An isolated polypeptide having% amino acid sequence identity. 13. Fig2 (SEQ ID NO: 4), Fig4 (SEQ ID NO: 9), Fi
g6 (SEQ ID NO: 11), Fig8 (SEQ ID NO: 13), Fig10 (SEQ ID NO: 1)
5), Figure12 (SEQ ID NO: 17), Figure14 (SEQ ID NO: 22), Figure16 (
SEQ ID NO: 24), FIG18 (SEQ ID NO: 29), FIG20 (SEQ ID NO: 32)
, Figure22 (SEQ ID NO: 39), Figure24 (SEQ ID NO: 41), Figure26 (SEQ ID NO: 52), Figure28 (SEQ ID NO: 54), Figure30 (SEQ ID NO: 56),
Figure 32 (SEQ ID NO: 58), Figure 34 (SEQ ID NO: 63), Figure 36 (SEQ ID NO: 65), Figure 38 (SEQ ID NO: 73), Figure 40 (SEQ ID NO: 78), F
ig42 (SEQ ID NO: 80), FIG44 (SEQ ID NO: 84), FIG46 (SEQ ID NO: 86), FIG48 (SEQ ID NO: 91), FIG50 (SEQ ID NO: 99), Fi
g52 (SEQ ID NO: 104), FIG54 (SEQ ID NO: 106), FIG56 (SEQ ID NO: 108), FIG58 (SEQ ID NO: 110), FIG60 (SEQ ID NO: 115)
), FIG. 62 (SEQ ID NO: 121), FIG64 (SEQ ID NO: 126), FIG6
6 (SEQ ID NO: 128), FIG68 (SEQ ID NO: 130), FIG70 (SEQ ID NO: 132), FIG72 (SEQ ID NO: 137) and FIG74 (SEQ ID NO: 139)
An isolated polypeptide that exhibits a positive score of at least 80% when compared to an amino acid sequence selected from the group consisting of the amino acid sequences set forth in. 14. An isolated polypeptide having at least 80% amino acid sequence identity to the amino acid sequence encoded by the full length coding sequence of the DNA deposited at ATCC Deposit Number shown in Table 10. 15. A chimeric molecule comprising the polypeptide of any of claims 12-14 fused to a heterologous amino acid sequence. 16. The chimeric molecule according to claim 15, wherein the heterologous amino acid sequence is an epitope tag sequence. 17. The chimeric molecule according to claim 15, wherein the heterologous amino acid sequence is an immunoglobulin Fc region. 18. An antibody that specifically binds to the polypeptide according to any one of claims 12 to 14. 19. The antibody according to claim 18, wherein the antibody is a monoclonal antibody, a humanized antibody or a single chain antibody. (A) Figure 2 (SEQ ID NO: 4), Figure 4 (SEQ ID NO: 9),
Figure 6 (SEQ ID NO: 11), Figure 8 (SEQ ID NO: 13), Figure 10 (SEQ ID NO: 15), Figure 12 (SEQ ID NO: 17), Figure 14 (SEQ ID NO: 22), Figure
16 (SEQ ID NO: 24), FIG18 (SEQ ID NO: 29), FIG20 (SEQ ID NO: 29)
32), Fig22 (SEQ ID NO: 39), Fig24 (SEQ ID NO: 41), Fig2
6 (SEQ ID NO: 52), Fig28 (SEQ ID NO: 54), Fig30 (SEQ ID NO: 5)
6), Fig32 (SEQ ID NO: 58), Fig34 (SEQ ID NO: 63), Fig36 (
SEQ ID NO: 65), Figure 38 (SEQ ID NO: 73), Figure 40 (SEQ ID NO: 78)
, Fig42 (SEQ ID NO: 80), Fig44 (SEQ ID NO: 84), Fig46 (SEQ ID NO: 86), Fig48 (SEQ ID NO: 91), Fig50 (SEQ ID NO: 99),
Figure 52 (SEQ ID NO: 104), Figure 54 (SEQ ID NO: 106), Figure 56 (
SEQ ID NO: 108), FIG58 (SEQ ID NO: 110), FIG60 (SEQ ID NO: 1)
15), Fig62 (SEQ ID NO: 121), Fig64 (SEQ ID NO: 126), Fi
g66 (SEQ ID NO: 128), FIG68 (SEQ ID NO: 130), FIG70 (SEQ ID NO: 132), FIG72 (SEQ ID NO: 137) or FIG74 (SEQ ID NO: 13)
9) a nucleotide sequence which encodes the polypeptide shown in 9) and lacks its related signal peptide; (b) Fig2 (SEQ ID NO: 4), Fig4 (SEQ ID NO: 9), and Fig6 (SEQ ID NO :)
11), Fig8 (SEQ ID NO: 13), Fig10 (SEQ ID NO: 15), Fig12 (
SEQ ID NO: 17), Fig14 (SEQ ID NO: 22), Fig16 (SEQ ID NO: 24)
, Fig18 (SEQ ID NO: 29), Fig20 (SEQ ID NO: 32), Fig22 (SEQ ID NO: 39), Fig24 (SEQ ID NO: 41), Fig26 (SEQ ID NO: 52),
Figure 28 (SEQ ID NO: 54), Figure 30 (SEQ ID NO: 56), Figure 32 (SEQ ID NO: 58), Figure 34 (SEQ ID NO: 63), Figure 36 (SEQ ID NO: 65), F
ig38 (SEQ ID NO: 73), Fig40 (SEQ ID NO: 78), Fig42 (SEQ ID NO: 80), Fig44 (SEQ ID NO: 84), Fig46 (SEQ ID NO: 86), Fi
g48 (SEQ ID NO: 91), FIG50 (SEQ ID NO: 99), FIG52 (SEQ ID NO: 104), FIG54 (SEQ ID NO: 106), FIG56 (SEQ ID NO: 108),
Figure 58 (SEQ ID NO: 110), Figure 60 (SEQ ID NO: 115), Figure 62 (
SEQ ID NO: 121), FIG64 (SEQ ID NO: 126), FIG66 (SEQ ID NO: 1)
28), Figure 68 (SEQ ID NO: 130), Figure 70 (SEQ ID NO: 132), Fi
g72 (SEQ ID NO: 137) or Fig74 (SEQ ID NO: 139), which encodes the extracellular domain of the polypeptide and has a nucleotide sequence with its associated signal peptide; or (c) Fig2 (SEQ ID NO: 4), Fig4 (SEQ ID NO: 9), FIG 6 (SEQ ID NO:
11), Fig8 (SEQ ID NO: 13), Fig10 (SEQ ID NO: 15), Fig12 (
SEQ ID NO: 17), Fig14 (SEQ ID NO: 22), Fig16 (SEQ ID NO: 24)
, Fig18 (SEQ ID NO: 29), Fig20 (SEQ ID NO: 32), Fig22 (SEQ ID NO: 39), Fig24 (SEQ ID NO: 41), Fig26 (SEQ ID NO: 52),
Figure 28 (SEQ ID NO: 54), Figure 30 (SEQ ID NO: 56), Figure 32 (SEQ ID NO: 58), Figure 34 (SEQ ID NO: 63), Figure 36 (SEQ ID NO: 65), F
ig38 (SEQ ID NO: 73), Fig40 (SEQ ID NO: 78), Fig42 (SEQ ID NO: 80), Fig44 (SEQ ID NO: 84), Fig46 (SEQ ID NO: 86), Fi
g48 (SEQ ID NO: 91), FIG50 (SEQ ID NO: 99), FIG52 (SEQ ID NO: 104), FIG54 (SEQ ID NO: 106), FIG56 (SEQ ID NO: 108),
Figure 58 (SEQ ID NO: 110), Figure 60 (SEQ ID NO: 115), Figure 62 (
SEQ ID NO: 121), FIG64 (SEQ ID NO: 126), FIG66 (SEQ ID NO: 1)
28), Figure 68 (SEQ ID NO: 130), Figure 70 (SEQ ID NO: 132), Fi
an isolated sequence having at least 80% nucleic acid sequence identity with a nucleotide sequence encoding the extracellular domain of the polypeptide set forth in g72 (SEQ ID NO: 137) or FIG74 (SEQ ID NO: 139) and lacking its associated signal peptide; Nucleic acid. 21. (a) FIG2 (SEQ ID NO: 4), FIG4 (SEQ ID NO: 9),
Figure 6 (SEQ ID NO: 11), Figure 8 (SEQ ID NO: 13), Figure 10 (SEQ ID NO: 15), Figure 12 (SEQ ID NO: 17), Figure 14 (SEQ ID NO: 22), Figure
16 (SEQ ID NO: 24), FIG18 (SEQ ID NO: 29), FIG20 (SEQ ID NO: 29)
32), Fig22 (SEQ ID NO: 39), Fig24 (SEQ ID NO: 41), Fig2
6 (SEQ ID NO: 52), Fig28 (SEQ ID NO: 54), Fig30 (SEQ ID NO: 5)
6), Fig32 (SEQ ID NO: 58), Fig34 (SEQ ID NO: 63), Fig36 (
SEQ ID NO: 65), Figure 38 (SEQ ID NO: 73), Figure 40 (SEQ ID NO: 78)
, Fig42 (SEQ ID NO: 80), Fig44 (SEQ ID NO: 84), Fig46 (SEQ ID NO: 86), Fig48 (SEQ ID NO: 91), Fig50 (SEQ ID NO: 99),
Figure 52 (SEQ ID NO: 104), Figure 54 (SEQ ID NO: 106), Figure 56 (
SEQ ID NO: 108), FIG58 (SEQ ID NO: 110), FIG60 (SEQ ID NO: 1)
15), Fig62 (SEQ ID NO: 121), Fig64 (SEQ ID NO: 126), Fi
g66 (SEQ ID NO: 128), FIG68 (SEQ ID NO: 130), FIG70 (SEQ ID NO: 132), FIG72 (SEQ ID NO: 137) or FIG74 (SEQ ID NO: 13)
9) and lacking its associated signal peptide; (b) Fig2 (SEQ ID NO: 4), Figure4 (SEQ ID NO: 9), Figure6 (SEQ ID NO: 4).
11), Fig8 (SEQ ID NO: 13), Fig10 (SEQ ID NO: 15), Fig12 (
SEQ ID NO: 17), Fig14 (SEQ ID NO: 22), Fig16 (SEQ ID NO: 24)
, Fig18 (SEQ ID NO: 29), Fig20 (SEQ ID NO: 32), Fig22 (SEQ ID NO: 39), Fig24 (SEQ ID NO: 41), Fig26 (SEQ ID NO: 52),
Figure 28 (SEQ ID NO: 54), Figure 30 (SEQ ID NO: 56), Figure 32 (SEQ ID NO: 58), Figure 34 (SEQ ID NO: 63), Figure 36 (SEQ ID NO: 65), F
ig38 (SEQ ID NO: 73), Fig40 (SEQ ID NO: 78), Fig42 (SEQ ID NO: 80), Fig44 (SEQ ID NO: 84), Fig46 (SEQ ID NO: 86), Fi
g48 (SEQ ID NO: 91), FIG50 (SEQ ID NO: 99), FIG52 (SEQ ID NO: 104), FIG54 (SEQ ID NO: 106), FIG56 (SEQ ID NO: 108),
Figure 58 (SEQ ID NO: 110), Figure 60 (SEQ ID NO: 115), Figure 62 (
SEQ ID NO: 121), FIG64 (SEQ ID NO: 126), FIG66 (SEQ ID NO: 1)
28), Figure 68 (SEQ ID NO: 130), Figure 70 (SEQ ID NO: 132), Fi
g72 (SEQ ID NO: 137) or Fig74 (SEQ ID NO: 139), the extracellular domain of the polypeptide with its associated signal peptide; or (c) Fig2 (SEQ ID NO: 4), Fig4 (SEQ ID NO: 9). ), FIG6 (SEQ ID NO:
11), Fig8 (SEQ ID NO: 13), Fig10 (SEQ ID NO: 15), Fig12 (
SEQ ID NO: 17), Fig14 (SEQ ID NO: 22), Fig16 (SEQ ID NO: 24)
, Fig18 (SEQ ID NO: 29), Fig20 (SEQ ID NO: 32), Fig22 (SEQ ID NO: 39), Fig24 (SEQ ID NO: 41), Fig26 (SEQ ID NO: 52),
Figure 28 (SEQ ID NO: 54), Figure 30 (SEQ ID NO: 56), Figure 32 (SEQ ID NO: 58), Figure 34 (SEQ ID NO: 63), Figure 36 (SEQ ID NO: 65), F
ig38 (SEQ ID NO: 73), Fig40 (SEQ ID NO: 78), Fig42 (SEQ ID NO: 80), Fig44 (SEQ ID NO: 84), Fig46 (SEQ ID NO: 86), Fi
g48 (SEQ ID NO: 91), FIG50 (SEQ ID NO: 99), FIG52 (SEQ ID NO: 104), FIG54 (SEQ ID NO: 106), FIG56 (SEQ ID NO: 108),
Figure 58 (SEQ ID NO: 110), Figure 60 (SEQ ID NO: 115), Figure 62 (
SEQ ID NO: 121), FIG64 (SEQ ID NO: 126), FIG66 (SEQ ID NO: 1)
28), Figure 68 (SEQ ID NO: 130), Figure 70 (SEQ ID NO: 132), Fi
An isolated polypeptide having at least 80% nucleic acid sequence identity with the extracellular domain of a polypeptide shown in g72 (SEQ ID NO: 137) or FIG74 (SEQ ID NO: 139) and lacking its associated signal peptide. 22. A, B, C, D, E, F, G, H or I in a sample suspected of containing an A, B, C, D, E, F, G, H or I polypeptide. A method for detecting a polypeptide designated as: J, K, L, M, N, O,
Contacting with a polypeptide designated P, Q, R, S or T,
J, B / K, C / L, C / M, C / N, C / J, D / O, E / P, F / Q, G /
Measuring the formation of R, H / S or I / T polypeptide conjugates,
Wherein the formation of the conjugate is due to A, B, C, D, E, F, G, H or I in the sample.
A indicates the presence of a polypeptide, where A is the PRO533 polypeptide and B is the P
RO301 polypeptide, C is PRO187 polypeptide, D is PRO337 polypeptide, E is PRO1411 polypeptide, F is PRO10096 polypeptide, G is PRO246 polypeptide, H is PRO6307 polypeptide, I is PRO6003 polypeptide, J is FGFR-. 4 polypeptide, K is PRO30
1 polypeptide, L is FGFR-3 polypeptide, M is FGFR-1 polypeptide, N is FGFR-2 polypeptide, O is PRO6004 polypeptide, and P is PR.
O4356 polypeptide, Q is PRO2630 polypeptide, R is PRO246
The method wherein the polypeptide, S is a PRO265 polypeptide and T is a PRO941 polypeptide. 23. The method of claim 22, wherein the sample comprises cells suspected of expressing an A, B, C, D, E, F, G, H or I polypeptide. 24. The method of claim 22, wherein the J, K, L, M, N, O, P, Q, R, S or T polypeptide is labeled with a detectable label. 25. The method of claim 22, wherein the J, K, L, M, N, O, P, Q, R, S or T polypeptide is attached to a solid support. 26. J, K, L, M, N, O, P in a sample suspected of containing a J, K, L, M, N, O, P, Q, R, S or T polypeptide. , Q, R, S
Alternatively, in the method for detecting a polypeptide designated as T, the sample is labeled with A, B,
A / J, B / K, C / L, C / M, C / N, C / J in said sample is contacted with a polypeptide designated C, D, E, F, G, H or I , D / O, E / P
, F / Q, G / R, H / S or I / T polypeptide conjugates are measured, wherein the formation of said conjugates comprises J, K, L, M in said sample. , N, O,
The presence of P, Q, R, S or T polypeptides, where A is PRO533
Polypeptide, B is PRO301 polypeptide, C is PRO187 polypeptide, D is PRO337 polypeptide, E is PRO1411 polypeptide, and F is PR.
O10096 polypeptide, G is PRO246 polypeptide, H is PRO630
7 polypeptide, I is PRO6003 polypeptide, J is FGFR-4 polypeptide, K is PRO301 polypeptide, L is FGFR-3 polypeptide, and M is F.
GFR-1 polypeptide, N is FGFR-2 polypeptide, O is PRO6004 polypeptide, P is PRO4356 polypeptide, Q is PRO2630 polypeptide, R is PRO246 polypeptide, S is PRO265 polypeptide and T is P.
The method which is a RO941 polypeptide. 27. The method of claim 26, wherein said sample comprises cells suspected of expressing a J, K, L, M, N, O, P, Q, R, S or T polypeptide. 28. The method of claim 26, wherein the A, B, C, D, E, F, G, H or I polypeptide is labeled with a detectable label. 29. The method of claim 26, wherein the A, B, C, D, E, F, G, H or I polypeptide is attached to a solid support. 30. A method of binding a bioactive molecule to a cell expressing a polypeptide designated A, B, C, D, E, F, G, H or I, wherein J bound to the bioactive molecule. , K, L, M, N, O, P, Q, R, S or T is contacted with the cells, and the A, B, C, D, E, F, G, H or Binding I and said J, K, L, M, N, O, P, Q, R, S or T polypeptide to each other, thus binding said bioactive molecule to said cell, A Is PRO533 polypeptide, B is PRO301 polypeptide, C is PRO
187 polypeptide, D is PRO337 polypeptide, E is PRO1411 polypeptide, F is PRO10096 polypeptide, G is PRO246 polypeptide, H is PRO6307 polypeptide, I is PRO6003 polypeptide, J is F.
GFR-4 polypeptide, K is PRO301 polypeptide, L is FGFR-3 polypeptide, M is FGFR-1 polypeptide, N is FGFR-2 polypeptide, O is PRO6004 polypeptide, P is PRO4356 polypeptide, and Q is PRO2
The method wherein 630 polypeptide, R is PRO246 polypeptide, S is PRO265 polypeptide and T is PRO941 polypeptide. 31. The method of claim 30, wherein the bioactive molecule is a toxin, radiolabel or antibody. 32. The method of claim 30, wherein the bioactive molecule causes cell death. 33. A method of binding a bioactive molecule to a cell expressing a polypeptide designated J, K, L, M, N, O, P, Q, R, S or T, said bioactive molecule. Said cell is contacted with a polypeptide designated as A, B, C, D, E, F, G, H or I, and said A, B, C, D, E, F, G, H or I and J, K, L, M, N, O, P, Q, R, S or T are bonded to each other,
Thus comprising binding said bioactive molecule to said cell, wherein A is PRO
533 polypeptide, B is PRO301 polypeptide, C is PRO187 polypeptide, D is PRO337 polypeptide, E is PRO1411 polypeptide, F
Is PRO10096 polypeptide, G is PRO246 polypeptide, H is PRO
6307 polypeptide, I is PRO6003 polypeptide, J is FGFR-4 polypeptide, K is PRO301 polypeptide, L is FGFR-3 polypeptide,
M is FGFR-1 polypeptide, N is FGFR-2 polypeptide, O is PRO60
04 polypeptide, P is a PRO4356 polypeptide, Q is a PRO2630 polypeptide, R is a PRO246 polypeptide, S is a PRO265 polypeptide and T is a PRO941 polypeptide. 34. The method of claim 33, wherein the bioactive molecule is a toxin, radiolabel or antibody. 35. The method of claim 33, wherein the bioactive molecule causes cell death. 36. In a method of modulating at least one biological activity of a cell expressing a polypeptide designated A, B, C, D, E, F, G, H or I, J, K, L, M, N, O, P, Q, R, S or T polypeptide or anti-A, B, C, D, E, F, G, H or I polypeptide antibody and said cells And said J, K, L, M, N, O, P, Q, R, S or T polypeptide, or said anti-A, B, C, D, E, F, G, H or I polypeptide. A method comprising binding a polypeptide antibody to said A, B, C, D, E, F, G, H or I polypeptide, and thereby modulating at least one biological activity of said cell. 37. The method of claim 36, wherein the cell is killed. 38. A method of modulating at least one biological activity of a cell expressing a polypeptide designated J, K, L, M, N, O, P, Q, R, S or T. A polypeptide designated A, B, C, D, E, F, G, H or I, or an anti-J, K, L, M, N, O, P, Q, R, S or T polypeptide The antibody is contacted with the cells, and the anti-J, K, L, M, N, O, P, Q, R, S or T
Polypeptide antibody, or A, B, C, D, E, F, G, H or I polypeptide, said J, K, L, M, N, O, P, Q, R, S or T polypeptide And thereby modulating at least one biological activity of said cell. 39. The method of claim 36, wherein the cell is killed.