KR102426421B1 - A novel recombinant endolysin and use thereof - Google Patents

Abstract

The present invention provides a novel recombinant endolysin derived from bacteriophage that effectively inhibits Staphylococcus aureus due to its excellent antibacterial activity by combining a specific part of the previously reported endolysin.

Description

A novel recombinant endolysin and use thereof

The present invention relates to a novel recombinant endolysin, and more particularly, to a novel recombinant endolysin derived from bacteriophage and uses thereof.

Staphylococcus aureus is a gram-positive bacterium that is carried on the skin or nasal surfaces of healthy individuals. It produces exotoxin, causes food poisoning, and secretes toxins (leukosidine), hemolysin, and coagulase that kill phagocytes, thereby destroying infected host cells. It breaks free from resistance and causes purulent infections. Recently, the incidence of methicillin resistance Staphylococcus aureus (MRSA), which is resistant to most antibiotics, is increasing. The MRSA is resistant to antibiotics such as penicillin, which have been used for about 50 years as a prescription drug for bacterial infections. It is transmitted through the lungs, and if it becomes infected through trauma after surgery or causes pneumonia, it is dangerous enough to endanger life. In order to effectively control this, the development of alternatives to antibiotics is in progress, and bacteriophage with strain specificity is attracting attention as a promising alternative. Bacteriophage amplifies genetic material inside the host, then proliferates into new individuals, dissolves the host cell wall and elutes to the outside. At this time, a protein called endolysin is used to dissolve the cell wall. do. Endolysin is an enzyme produced by bacteriophage to dissolve the cell wall of the host bacteria to release virions. Highly evolved to be able to attack. Not all bacteriophages synthesize endolysin, and some single-stranded DNA or RNA phages lyse the host cell wall by producing a membrane protein that activates the host's autolysin. Therefore, there is a need to develop a method for inhibiting bacterial Staphylococcus aureus by utilizing endolysin that can replace the effect of conventional antibiotic-resistant strains. In this regard, Korean Patent Registration No. 2097128 discloses a chimeric endolysin Lys109 that is effective in controlling Staphylococcus aureus.

However, in the case of the prior art, there is a problem in that it does not exhibit sufficient antibacterial activity to be applied to antibiotic-resistant strains.

The present invention is to solve various problems, including the above problems, by combining a specific part of endolysin previously reported to effectively inhibit Staphylococcus aureus due to excellent antibacterial activity. It aims to provide lysine. However, these problems are exemplary, and the scope of the present invention is not limited thereto.

According to one aspect of the present invention, a recombinant endolysin is provided, consisting of the amino acid sequence of any one of SEQ ID NOs: 1 to 3.

According to another aspect of the present invention, comprising the recombinant endolysin as an active ingredient, Staphylococcus aureus ( S. aureus ) An antibacterial composition for controlling is provided.

According to another aspect of the present invention, there is provided a pharmaceutical composition for treating Staphylococcus aureus infection comprising the recombinant endolysin as an active ingredient.

According to another aspect of the present invention, there is provided a feed additive composition comprising the recombinant endolysin as an active ingredient.

The novel recombinant endolysin of the present invention made as described above can be used as a biological modulator that can effectively inhibit cocci and their biofilms due to high antibacterial activity that specifically inhibits cocci, and Since it can be used extensively for the treatment of diseases caused by infection, it can be used as an alternative to conventional antibiotics. Of course, the scope of the present invention is not limited by these effects.

1 is a schematic diagram schematically showing the structure of a lysine ( Staphylococcus phage qdsa002, a) and PlySs2 family phage lysine ( Streptococcus suis, b) previously selected to prepare a bacteriophage-derived recombinant endolysin (endolysin).
Figure 2 is a schematic diagram schematically showing the structure of nine recombinant endolysin constructs prepared according to an embodiment of the present invention.
3 is a schematic diagram schematically showing the structure of an expression vector into which the recombinant endolysin of the present invention is inserted through cloning.
Figure 4 is a photograph of observing the antibacterial activity of nine recombinant proteins of the present invention against Staphylococcus aureus ( S. aureus ).
5 is a graph showing the results of performing a turbidity reduction assay using recombinant endolysin LB-SAL03, LB-SAL05 and LB-SAL09 of the present invention.

Definition of Terms:

"Bacteriophage" as used in this document is a compound word combining 'bacteria' meaning 'bacteria' and 'phage' meaning 'eat'. In other words, it means a virus that eats (kills) bacteria. The existence of bacteriophages was discovered in 1915 by British bacteriologist Frederick W. Twort.

As used herein, "endolysin" is also known as lysin or murein hydrolase, and is produced by bacteriophage and is produced by the host at the end of the lytic cycle. It is an enzyme that hydrolyzes the peptidoglycan layer in the cell wall of phosphorus bacteria. Endolysin of double-stranded DNA phage is a protein with a size of generally 25-40 kDa, and is a monomeric protein composed of two domains. Endolysin of Gram-positive bacteria consists of a catalytic domain that degrades peptidoglycan at the amino terminus (N-terminal) and a cell-binding domain at the carboxyl terminus (C-terminal). .

As used herein, " Staphylococcus aureus " is one of the staphylococci that resides in the skin and digestive tract of humans or animals. Staphylococcus is named after the shape of the fungus forming the cluster resembles a bunch of grapes, and aureus means gold.

DETAILED DESCRIPTION OF THE INVENTION:

According to one aspect of the present invention, a recombinant endolysin is provided, consisting of the amino acid sequence of any one of SEQ ID NOs: 1 to 3.

According to another aspect of the present invention, comprising the recombinant endolysin as an active ingredient, Staphylococcus aureus ( S. aureus ) An antibacterial composition for controlling is provided.

In the antimicrobial composition, the Staphylococcus aureus may be methicillin-resistant S. aureus (MRSA) or methicillin-sensitive S. aureus (MSSA).

According to another aspect of the present invention, there is provided a pharmaceutical composition for treating Staphylococcus aureus infection comprising the recombinant endolysin as an active ingredient.

In the pharmaceutical composition, the Staphylococcus aureus may be methicillin-resistant Staphylococcus aureus (MRSA).

According to another aspect of the present invention, there is provided a feed additive composition comprising the recombinant endolysin as an active ingredient.

The pharmaceutical composition of the present invention may vary depending on the type of the patient's affected part, the application site, the number of times of treatment, the treatment time, the dosage form, the patient's condition, the type of adjuvant, and the like. The amount used is not particularly limited, but may be 0.01 μg/kg/day to 10 mg/kg/day. The daily dose may be administered once a day, or divided into 2 to 3 times a day at an appropriate interval, or may be administered intermittently at intervals of several days.

In the pharmaceutical composition of the present invention, the compound may be administered orally or parenterally, and preferably, parenteral administration includes intravenous injection, subcutaneous injection, intraventricular injection, intracerebroventricular injection, and intracerebrospinal fluid injection. , intramuscular injection and intraperitoneal injection.

The pharmaceutical composition of the present invention may further include suitable carriers, excipients and diluents commonly used in the preparation of pharmaceutical compositions. In addition, additives for solid or liquid formulations may be used in the preparation of the pharmaceutical composition. The additive for formulation may be either organic or inorganic. Examples of the excipient include lactose, sucrose, sucrose, glucose, cornstarch, starch, talc, sorbit, crystalline cellulose, dextrin, kaolin, calcium carbonate and silicon dioxide. Examples of the binder include polyvinyl alcohol, polyvinyl ether, ethyl cellulose, methyl cellulose, gum arabic, tragacanth, gelatin, shellac, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, calcium citrate, dextrin and pectin. Examples of the lubricant include magnesium stearate, talc, polyethylene glycol, silica, and hydrogenated vegetable oil. As a coloring agent, if it is permitted to be added to pharmaceuticals normally, all can be used. These tablets and granules may be suitably coated with sugar coatings, gelatin coatings, or other needs. In addition, preservatives, antioxidants, etc. may be added as needed. In addition, when the pharmaceutical composition is a pharmaceutical, it may additionally include one or more selected from a filler, an anti-aggregant, a lubricant, a wetting agent, a fragrance, an emulsifier, or a preservative. On the other hand, the dosage form of the pharmaceutical composition of the present invention may be in a preferred form depending on the method of use, and in particular, a method known in the art is adopted to provide rapid, sustained or delayed release of the active ingredient after administration to a mammal. It is better to formulate it. Examples of specific formulations include PLASTERS, GRANULES, LOTIONS, LINIMENTS, LEMONADES, POWDERS, SYRUPS, LIQUIDS AND SOLUTIONS), Aerosols, EXTRACTS, ELIXIRS, FLUIDEXTRACTS, Emulsions, EMULSIONS, Suspensions, DECOCTIONS, INFUSIONS, Tablets (TABLETS), suppositories (SUPPOSITORIES), injections (INJECTIONS), spirits (SPIRITS), cataplasmase (CATAPLSMA), capsules (CAPSULES), troches (TROCHES), tinctures (TINCTURES), pastas (PASTES), It may be any one selected from pills (PILLS), soft or hard gelatin capsules.

The pharmaceutical composition of the present invention may further include components commonly used in the composition, for example, conventional adjuvants such as stabilizers, solubilizers and fragrances, and carriers.

The feed additive composition of the present invention may contain the endolysin of the present invention with respect to the total weight of the composition, and if the content is less than 0.001% by weight based on the total weight of the composition, the antibacterial effect cannot be sufficiently exhibited, and the stability and safety of the formulation It is preferred not to exceed 1.0% by weight. The composition is mixed with a conventional compound feed and fed by oral administration, and there is almost no problem of tolerance or side effects such as immunosuppression even when continuously administered or overdosed.

Staphylococcus aureus infects humans and animals, leading to serious diseases such as postoperative infections, abscesses, endocarditis and toxin syndrome. Because it is created, it is not easily killed and may cause serious food poisoning. Antibiotics have been used to control Staphylococcus aureus, but the widespread use of antibiotics has caused a problem in generating bacteria that are resistant to antibiotics, such as methicillin-resistant S. aureus . In the infected area, sometimes there is mucus, which is a colony of bacteria covered with a polymer matrix. The mucous bacterial complex formed by bacteria is called a biofilm. That is, the biofilm is a complex composed of a bacterial colony, which is a solid biological surface, and an outer membrane, which is a non-biological surface. Therefore, the biofilm means the whole including the outer membrane and the bacterial colonies contained therein. Biofilm can be said to be a small city made of bacteria, in which bacteria communicate with each other and defend against the outside world. Due to this, the biofilm makes it possible for bacteria to survive under various environmental stresses including antibiotics. On the other hand, antibiotics that were effective against planktonic bacteria that were floating separately also tend to lose efficacy when the bacteria form a biofilm. When bacteria form a biofilm, antibodies cannot penetrate the outer membrane present in the biofilm, and the resistance of the bacteria to antibiotics can be increased by about 1,000 times, thereby incapacitating the host's immune system. For these reasons, when a biofilm is formed, the action of antibiotics widely used to treat infections becomes difficult, and as a result, the therapeutic effect of antibiotics is weakened. Therefore, in order to prevent the neutralization of antibiotic treatment due to the formation of such a biofilm, develop a new antibiotic that can remove the biofilm even if the biofilm is formed, or destroy the outer membrane existing in the biofilm so that the existing antibiotic can exert its efficacy Ingredients that can help should be used together with existing antibiotics.

Therefore, the present inventors pay attention to endolysin derived from bacteriophage that targets Staphylococcus aureus to solve the above problem, and select two lysines through the database of NCBI to produce recombinant endolysin, and then select the gene sequence After obtaining and synthesizing it, a total of 9 recombinant endolysins were prepared through PCR and recombinant PCR by combining a specific portion of endolysin previously reported based on the synthesized gene. In the case of the previously reported bacteriophage-derived endolysin capable of killing Staphylococcus aureus, the structure is known to be modular, so the present inventors combine a specific part of the previously reported endolysin with each other (CHAP-EAD-CBD) Recombinant endolysin was developed, and as a result of investigation of its antibacterial activity, it was confirmed that it exhibited high antibacterial activity compared to the previously reported endolysin. Therefore, the recombinant endolysin of the present invention can be utilized as an alternative to the conventionally used antibiotics.

Hereinafter, the present invention will be described in more detail through examples. However, the present invention is not limited to the embodiments disclosed below, but can be implemented in a variety of different forms. It is provided to fully inform

Endolysine structure

The present inventors have selected two conventional endolysin to prepare a bacteriophage-derived recombinant endolysin (endolysin). Specifically, lysine ( Staphylococcus phage qdsa002, Sequence ID: ARQ96041.1) and PlySs2 family phage lysine ( Streptococcus suis, Sequence ID: WP_002937838.1) were selected. The structure of the Staphylococcus phage qdsa002-derived endolysin consists of 495 amino acids and 3 domains (FIG. 1a). The structure of the PlySs2 family phage lysine derived from Streptococcus suis is 245 amino acids. and is composed of two domains (Fig. 1b).

Recombinant Endolysin Preparation

The present inventors prepared a total of 9 recombinant endolysins, including the two selected endolysins, for the preparation of the novel recombinant endolysin of the present invention. First, lysine ( Staphylococcus phage qdsa002) and PlySs2 family phage lysine ( Streptococcus suis ) gene sequences were obtained through the database of the National Center for Biotechnology Information (NCBI) in the United States, and gene synthesis (bioneer) was performed based on this. Then, a total of 9 desired genes were obtained through PCR and recombinant PCR based on the synthesized gene. Specifically, PCR was performed using the synthesized lysine ( Staphylococcus phage qdsa002) as a template to secure LB-SAL01 (SEQ ID NO: 4), LB-SAL02 (SEQ ID NO: 5) and LB-SAL03 (SEQ ID NO: 1) genes, and PlySs2 family phage Lysine ( Streptococcus suis ) The LB-SAL05 (SEQ ID NO: 2) gene was obtained by performing PCR using the gene as a template. In addition, the PlySs2 family phage lysine ( Streptococcus suis ) using the S-1 (SEQ ID NO: 14), S-2 (SEQ ID NO: 15) primers using the gene as a template to secure the CHAP site, and lysine ( Staphylococcus phage qdsa002) as a template S-3 (SEQ ID NO: 16), SAL (B) (SEQ ID NO: 11) The SH3b portion of the lysine gene region was secured using a primer. Recombinant PCR was performed using the obtained two fragments as a template using S-1 (SEQ ID NO: 14) and SAL (B) (SEQ ID NO: 11) primers to obtain the final SAL06 (SEQ ID NO: 6) gene. Each of the remaining LB-SAL08 to LB-SAL10 genes was obtained through the same recombinant PCR as the method for securing the LB-SAL06 gene. In addition, in the case of the LB-SAL07 (SEQ ID NO: 7) gene, LB-SAL10 (SEQ ID NO: 9) was used as a template, and the CHAP portion of lysine and AD2 using S-1 (SEQ ID NO: 14), S-9 (SEQ ID NO: 22) primers The portion was first secured, and the SH3b portion of the lysine was amplified with S-10 (SEQ ID NO: 23) and S-8 (SEQ ID NO: 21), and then the final LB-SAL07 gene was obtained using the CHAP-AD2 fragment obtained above as a template. was secured (FIG. 2). Information on the primers used in the PCR is summarized in Table 1 below.

Primer sequence information Primer name Base sequence (5'→3') restriction enzyme SEQ ID NO: SAL(F) ATGCATGCTAAGACTCAAGCAG Nsi I 10 SAL(B) CTCGAGTTTGAATACTCCCCAAG Xho I 11 AD2(B) CTCGAGTACTGGATTAAATCCTG Xho I 12 CHAP(B) CTCGAGCTCAATAAAATGAGTTAATC Xho I 13 S-1 ATGCATACAACAGTAAAT Nsi I 14 S-2 CAAATGTGCATTTTCCGGGGGTGCTGACTGTGCGACCGT 15 S-3 ACGGTCGCACAGTCAGCACCCCCGGAAAATGCAACATTTG 16 S-4 TATCCATTGTATAGTTAATGGGTGCTGACTGTGCGACCGT 17 S-5 ACGGTCGCACAGTCAGCACCCATTAACTATACAATGGATA 18 S-6 TGTGCGACCGTGCCAGGCGGCTCAATAAAATGAGTTAATC 19 S-7 GATTAACTCATTTTATTGAGCCGCCTGGCACGGTCGCACA 20 S-8 CTCGAG TTTAAATGTAC Xho I 21 S-9 ACTGTGCGACCGTGCCAGGCGGTACTGGATTAAATCCTGT 22 S-10 ACAGGATTTAATCCAGTACCGCCTGGCACGGTCGCACAGT 23

cloning

The present inventors cloned the gene obtained in the above example into an expression vector. Specifically, the obtained LB-SAL01 to LB-SAL10 were first subcloned into a T/A vector and then treated with Nsi I and Xho I restriction enzymes to obtain LB-SAL01 to LB-SAL10 gene fragments. After that, it was inserted into the same restriction enzyme site of the expression vector pET31b(+) vector and transformed into the E. coli BL21(DE3)pLysS strain (FIG. 3).

Expression confirmation and purification

The present inventors inoculated the 9 transformed recombinant strains with 1% in LB medium (1% tryptone, 0.5% yeast extract, 0.5% NaCl) and cultured at 37°C and 250 rpm to OD ₆₀₀ = 0.6-0.8. After addition of 1 mM IPTG, expression was induced by culturing at 18° C. for 20 hours to induce expression in a soluble form.

Experimental Example 1: Confirmation of antibacterial activity

The present inventors inoculated 1% of Staphylococcus aureus ( S. aureus ) in LB medium (1% tryptone, 0.5% yeast extract, 0.5% NaCl) in order to confirm the antibacterial activity of the nine purified recombinant proteins, and inoculated at 37 ° C. , incubated up to OD ₆₀₀ =0.6 under the conditions of 250 rpm. After that, 100 μl of the culture medium was added to an agar solution (agar 1%) at 50° C., and then poured into a pre-prepared and hardened LB agar plate (1% tryptone, 0.5% yeast extract, 0.5% NaCl, agar 1.5%) and hardened. Incubated at ℃ for 18 hours. Then, all of the purified recombinant proteins were diluted to a concentration of 100 μg/ml using PBS buffer, and 5 μl of the diluted recombinant proteins were added dropwise to S. aureus cultured agar medium. After 1 hour, clear zone (clear zone) zone), it was observed whether S. aureus was killed or not.

As a result, the antibacterial activity according to the killing effect of S. aureus of LB-SAL03 (SEQ ID NO: 1), LB-SAL05 (SEQ ID NO: 2) and LB-SAL09 (SEQ ID NO: 3) among the nine purified recombinant proteins was very high. appeared (Fig. 4).

Experimental Example 2: Turbidity Reduction Analysis

The present inventors performed a turbidity reduction assay using LB-SAL03, LB-SAL05 and LB-SAL09, which were shown to have high antibacterial activity in Experimental Example 1. Specifically, 1% of S. aureus was inoculated in LB medium (1% tryptone, 0.5% yeast extract, 0.5% NaCl) and then cultured to OD ₆₀₀ = 0.6 at 37°C and 250 rpm, and then 1 ml of the culture solution obtained and resuspended in 1 ml of PBS. After that, it was obtained again and resuspended by adding 0.95 ml of PBS. Then, LB-SAL03, LB-SAL05, and LB-SAL09 were diluted to 200 μg/ml using PBS buffer, respectively, and 50 μl (10 μg) was added to 0.95 ml of PBS. Human corporation X-ma 1000 spectrophotometer Values were measured every 5 minutes at OD ₆₀₀ using

As a result, compared with the control group, LB-SAL03, LB-SAL05 and LB-SAL09 of the present invention all showed inhibitory activity against S. aureus , and among them, LB-SAL09 was 15 minutes compared to LB-SAL03 and LB-SAL05. It was confirmed that it exhibited the lowest turbidity in the first time and exhibited the highest antibacterial activity (FIG. 5). The result is that the recombinant endolysin of the present invention kills S. aureus at the fastest rate. This suggests that it exhibits excellent inhibitory activity.

Although the present invention has been described with reference to the above-described embodiment, it will be understood that this is merely exemplary, and that those skilled in the art can make various modifications and equivalent other embodiments therefrom. Therefore, the true technical protection scope of the present invention should be determined by the technical spirit of the appended claims.

<110> LYSINBIO CO., LTD. <120> A novel recombinant endolysin and use thereof <130> PD20-6037 <160> 23 <170> KoPatentIn 3.0 <210> 1 <211> 504 <212> PRT <213> Artificial Sequence <220> <223> LB- SAL03 <400> 1 Met His Ala Lys Thr Gln Ala Glu Ile Asn Lys Arg Leu Asp Ala Tyr 1 5 10 15 Ala Lys Gly Thr Val Asp Ser Pro Tyr Arg Ile Lys Lys Ala Thr Ser 20 25 30 Tyr Asp Pro Ser Phe Gly Val Met Glu Ala Gly Ala Ile Asp Ala Asp 35 40 45 Gly Tyr Tyr His Ala Gln Cys Gln Asp Leu Ile Thr Asp Tyr Val Leu 50 55 60 Trp Leu Thr Asp Asn Lys Val Arg Thr Trp Gly Asn Ala Lys Asp Gln 65 70 75 80 Ile Lys Gln Ser Tyr Gly Thr Gly Phe Lys Ile His Glu Asn Lys Pro 85 90 95 Ser Thr Val Pro Lys Lys Gly Trp Ile Ala Val Phe Thr Ser Gly Ser 100 105 110 Tyr Gln Gln Trp Gly His Ile Gly Ile Val Tyr Asp Gly Gly Asn Thr 115 120 125 Ser Thr Phe Thr Ile Leu Glu Gln Asn Trp Asn Gly Tyr Ala Asn Lys 130 135 140 Lys Pro Thr Lys Arg Val Asp Asn Tyr Tyr Gly Leu Thr His Phe Ile 145 150 155 160 Glu Ile Pro Val Lys Ala Gly Thr Thr Val Lys Lys Glu Thr Ala Lys 165 170 175 Lys Ser Ala Ser Lys Thr Pro Ala Pro Lys Lys Lys Lys Ala Thr Leu Lys 180 185 190 Val Ser Lys Asn His Ile Asn Tyr Thr Met Asp Lys Arg Gly Lys Lys 195 200 205 Pro Glu Gly Met Val Ile His Asn Asp Ala Gly Arg Ser Ser Gly Gln 210 215 220 Gln Tyr Glu Asn Ser Leu Ala Asn Ala Gly Tyr Ala Arg Tyr Ala Asn 225 230 235 240 Gly Ile Ala His Tyr Tyr Gly Ser Glu Gly Tyr Val Trp Glu Ala Ile 245 250 255 Asp Ala Lys Asn Gln Ile Ala Trp His Thr Gly Asp Gly Thr Gly Ala 260 265 270 Asn Ser Gly Asn Phe Arg Phe Ala Gly Ile Glu Val Cys Gln Ser Met 275 280 285 Ser Ala Ser Asp Ala Gln Phe Leu Lys Asn Glu Gln Ala Val Phe Gln 290 295 300 Phe Thr Ala Glu Lys Phe Lys Glu Trp Gly Leu Thr Pro Asn Arg Lys 305 310 315 320 Thr Val Arg Leu His Met Glu Phe Val Pro Thr Ala Cys Pro His Arg 325 330 335 Ser Met Val Leu His Thr Gly Phe Asn Pro Val Thr Gln Gly Arg Pro 340 345 350 Ser Gln Ala Ile Met Asn Lys Leu Lys Asp Tyr Phe Ile Lys Gln Ile 355 360 365 Lys Asn Tyr Met Asp Lys Gly Thr Ser Ser Ser Ser Thr Val Val Lys Asp 370 375 380 Gly Lys Thr Ser Ser Ala Ser Thr Pro Ala Thr Arg Pro Val Thr Gly 385 390 395 400 Ser Trp Lys Lys Asn Gln Tyr Gly Thr Trp Tyr Lys Pro Glu Asn Ala 405 410 415 Thr Phe Val Asn Gly Asn Gln Pro Ile Val Thr Arg Ile Gly Ser Pro 420 425 430 Phe Leu Asn Ala Pro Val Gly Gly Asn Leu Pro Ala Gly Ala Thr Ile 435 440 445 Val Tyr Asp Glu Val Cys Ile Gln Ala Gly His Ile Trp Ile Gly Tyr 450 455 460 Asn Ala Tyr Asn Gly Asn Arg Val Tyr Cys Pro Val Arg Thr Cys Gln 465 470 475 480 Gly Val Pro Pro Asn His Ile Pro Gly Val Ala Trp Gly Val Phe Lys 485 490 495 Leu Glu His His His His His His 500 <210> 2 <211> 254 <212> PRT <213> Artificial Sequence < 220> <223> LB-SAL05 <400> 2 Met His Thr Thr Val Asn Glu Ala Leu Asn Asn Val Arg Ala Gln Val 1 5 10 15 Gly Ser Gly Val Ser Val Gly Asn Gly Glu Cys Tyr Ala Leu Ala Ser 20 25 30 Trp Tyr Glu Arg Met Ile Ser Pro Asp Ala Thr Val Gly Leu Gly Ala 35 40 45 Gly Val Gly Trp Val Ser Gly Ala Ile Gly Asp Thr Ile Ser Ala Lys 50 55 60 Asn Ile Gly Ser Ser Tyr Asn Trp Gln Ala Asn Gly Trp Thr Val Ser 65 70 75 80 Thr Ser Gly Pro Phe Lys Ala Gly Gln Ile Val Thr Leu Gly Ala T hr 85 90 95 Pro Gly Asn Pro Tyr Gly His Val Val Ile Val Glu Ala Val Asp Gly 100 105 110 Asp Arg Leu Thr Ile Leu Glu Gln Asn Tyr Gly Gly Lys Arg Tyr Pro 115 120 125 Val Arg Asn Tyr Tyr Ser Ala Ala Ser Tyr Arg Gln Gln Val Val His 130 135 140 Tyr Ile Thr Pro Pro Gly Thr Val Ala Gln Ser Ala Pro Asn Leu Ala 145 150 155 160 Gly Ser Arg Ser Tyr Arg Glu Thr Gly Thr Met Thr Val Thr Val Asp 165 170 175 Ala Leu Asn Val Arg Arg Ala Pro Asn Thr Ser Gly Glu Ile Val Ala 180 185 190 Val Tyr Lys Arg Gly Glu Ser Phe Asp Tyr Asp Thr Val Ile Ile Asp 195 200 205 Val Asn Gly Tyr Val Trp Val Ser Tyr Ile Gly Gly Ser Gly Lys Arg 210 215 220 Asn Tyr Val Ala Thr Gly Ala Thr Lys Asp Gly Lys Arg Phe Gly Asn 225 230 235 240 Ala Trp Gly Thr Phe Lys Leu Glu His His His His His His His 245 250 <210> 3 <211> 268 <212> PRT <213> Artificial Sequence <220> <223> LB-SAL09 <400> 3 Met His Ala Lys Thr Gln Ala Glu Ile Asn Lys Arg Leu Asp Ala Tyr 1 5 10 15 Ala Lys Gly Thr Val Asp Ser Pro Tyr Arg Ile Lys Lys Ala Thr Ser 20 25 30 Tyr Asp Pro Ser Phe Gly Val Met Glu Ala Gly Ala Ile Asp Ala Asp 35 40 45 Gly Tyr Tyr His Ala Gln Cys Gln Asp Leu Ile Thr Asp Tyr Val Leu 50 55 60 Trp Leu Thr Asp Asn Lys Val Arg Thr Trp Gly Asn Ala Lys Asp Gln 65 70 75 80 Ile Lys Gln Ser Tyr Gly Thr Gly Phe Lys Ile His Glu Asn Lys Pro 85 90 95 Ser Thr Val Pro Lys Lys Gly Trp Ile Ala Val Phe Thr Ser Gly Ser 100 105 110 Tyr Gln Gln Trp Gly His Ile Gly Ile Val Tyr Asp Gly Gly Asn Thr 115 120 125 Ser Thr Phe Thr Ile Leu Glu Gln Asn Trp Asn Gly Tyr Ala Asn Lys 130 135 140 Lys Pro Thr Lys Arg Val Asp Asn T yr Tyr Gly Leu Thr His Phe Ile 145 150 155 160 Glu Pro Gly Thr Val Ala Gln Ser Ala Pro Asn Leu Ala Gly Ser 165 170 175 Arg Ser Tyr Arg Glu Thr Gly Thr Met Thr Val Thr Val Asp Ala Leu 180 185 190 Asn Val Arg Arg Ala Pro Asn Thr Ser Gly Glu Ile Val Ala Val Tyr 195 200 205 Lys Arg Gly Glu Ser Phe Asp Tyr Asp Thr Val Ile Ile Asp Val Asn 210 215 220 Gly Tyr Val Trp Val Ser Tyr Ile Gly Gly Ser Gly Lys Arg Asn Tyr 225 230 235 240 Val Ala Thr Gly Ala Thr Lys Asp Gly Lys Arg Phe Gly Asn Ala Trp 245 250 255 Gly Thr Phe Lys Leu Glu His His His His His His His 260 265 <210> 4 <211> 169 < 212> PRT <213> Artificial Sequence <220> <223> LB-SAL01 <400> 4 Met His Ala Lys Thr Gln Ala Glu Ile Asn Lys Arg Leu Asp Ala Tyr 1 5 10 15 Ala Lys Gly Thr Val Asp Ser Pro Tyr Arg Ile Lys Lys Ala Thr Ser 20 25 30 Tyr Asp Pro Ser Phe Gly Val Met Glu Ala Gly Ala Ile Asp Ala Asp 35 40 45 Gly Tyr Tyr His Ala Gln Cys Gln Asp Leu Ile Thr Asp Tyr Val Leu 50 55 60 Trp Leu Thr Asp Asn Lys Val Arg Thr Trp Gly Asn Ala Lys Asp Gln 65 70 75 80 Ile Lys Gln Ser Tyr Gly Thr Gly Phe Lys Ile His Glu Asn Lys Pro 85 90 95 Ser Thr Val Pro Lys Lys Gly Trp Ile Ala Val Phe Thr Ser Gly Ser 100 105 110 Tyr Gln Gln Trp Gly His Ile Gly Ile Val Tyr Asp Gly Gly Asn Thr 115 120 125 Ser Thr Phe Thr Ile Leu Glu Gln Asn Trp Asn Gly Tyr Ala Asn Lys 130 135 140 Lys Pro Thr Lys Arg Val Asp Asn Tyr Tyr Gly Leu Thr His Phe Ile 145 150 155 160 Glu Leu Glu His His His His His His 165 <210> 5 <211> 355 <212> PRT <213> Artificial Sequence <220> <223> LB-SAL02 <400> 5 Met His Ala Lys Thr Gln Ala Glu Ile Asn Lys Arg Leu Asp Ala Tyr 1 5 10 15 Ala Lys Gly Thr Val Asp Ser Pro Tyr Arg Ile Lys Lys Ala Thr Ser 20 25 30 Tyr Asp Pro Ser Phe Gly Val Met Glu Ala Gly Ala Ile Asp Ala Asp 35 40 45 Gly Tyr Tyr His Ala Gln Cys Gln Asp Leu Ile Thr Asp Tyr Val Leu 50 55 60 Trp Leu Thr Asp Asn Lys Val Arg Thr Trp Gly Asn Ala Lys Asp Gln 65 70 75 80 Ile Lys Gln Ser Tyr Gly Thr Gly Phe Lys Ile His Glu Asn Lys Pro 85 90 95 Ser Thr Val Pro Lys Lys Gly Trp Ile Ala Val Phe Thr Ser Gly Ser 100 105 110 Tyr Gln Gln Trp Gly His Ile Gly Ile Val Tyr Asp Gly Gly Asn Thr 115 120 125 Ser Thr Phe Thr Ile Leu Glu Gln Asn Trp Asn Gly Tyr Ala Asn Lys 130 135 140 Lys Pro Thr Lys Arg Val Asp Asn Tyr Tyr Gly Leu Thr His Phe Ile 145 150 155 160 Glu Ile Pro Val Lys Ala Gly Thr Thr Val Lys Lys Glu Thr Ala Lys 165 170 175 Lys Ser Ala Ser Lys Thr Pro Ala Pro Lys Lys Lys Ala Thr Leu Lys 180 185 190 Val Ser Lys Asn His Ile Asn Tyr Thr Met Asp Lys Arg Gly Lys Lys 195 200 205 Pro Glu Gly Met Val Ile His Asn Asp Ala Gly Arg Ser Ser Gly Gln 210 215 220 Gln Tyr Glu Asn Ser Leu Ala Asn Ala Gly Tyr Ala Arg Tyr Ala Asn 225 230 235 240 Gly Ile Ala His Tyr Tyr Gly Ser Glu Gly Tyr Val Trp Glu Ala Ile 245 250 255 Asp Ala Lys Asn Gln Ile Ala Trp His Thr Gly Asp Gly Thr Gly Ala 260 265 270 Asn Ser Gly Asn Phe Arg Phe Ala Gly Ile Glu Val Cys Gln Ser Met 275 280 285 Ser Ala Ser Asp Ala Gln Phe Leu Lys Asn Glu Gln Ala Val Phe Gln 290 295 300 Phe Thr Ala Glu Lys Phe Lys Glu Trp Gly Leu Thr Pro Asn Arg Lys 305 310 315 320 Thr Val Arg Leu His Met Glu Phe Val Pro Thr Ala Cys Pro His Arg 325 330 335 Ser Met Val Leu His Thr Gly Phe Asn Pro Val Leu Glu His His His 340 345 350 His His His 355 <210> 6 <211> 249 <212> PRT <213 > Artificial Sequence <220> <223> LB-SAL06 <400> 6 Met His Thr Thr Val Asn Glu Ala Leu Asn Asn Val Arg Ala Gln Val 1 5 10 15 Gly Ser Gly Val Ser Val Gly Asn Gly Glu Cys Tyr Ala Leu Ala Ser 20 25 30 Trp Tyr Glu Arg Met Ile Ser Pro Asp Ala Thr Val Gly Leu Gly Ala 35 40 45 Gly Val Gly Trp Val Ser Gly Ala Ile Gly Asp Thr Ile Ser Ala Lys 50 55 60 Asn Ile Gly Ser Ser Tyr Asn Trp Gln Ala Asn Gly Trp Thr Val Ser 65 70 75 80 Thr Ser Gly Pro Phe Lys Ala Gly Gln Ile Val Thr Leu Gly Ala Thr 85 90 95 Pro Gly Asn Pro Tyr Gly His Val Val Ile Val Glu Ala Val Asp Gly 100 105 110 Asp Arg Leu Thr Ile Leu Glu Gln Asn Tyr Gly Gly Lys Arg Tyr Pro 115 120 125 Val Arg Asn Tyr Tyr Ser Ala Ala Ser Tyr Arg Gln Gln Val Val His 130 135 140 Tyr Ile Thr Pro Pro Gly Thr Val Ala Gln Ser Ala Pro Pro Glu Asn 145 150 155 160 Ala Thr Phe Val Asn Gly Asn Gln Pro Ile Val Thr Arg Ile Gly Ser 165 170 175 Pro Phe Leu Asn Ala Pro Val Gly Gly Asn Leu Pro Ala Gly Ala Thr 180 185 190 Ile Val Tyr Asp Glu Val Cys Ile Gln Ala Gly His Ile Trp Ile Gly 195 200 205 Tyr Asn Ala Tyr Asn Gly Asn Arg Val Tyr Cys Pro Val Arg Thr Cys 210 215 220 Gln Gly Val Pro Pro Asn His Ile Pro Gly Val Ala Trp Gly Val Phe 225 230 235 240 Lys Leu Glu His His His His His His 245 <210> 7 <211> 414 <212> PRT <213 > Artificial Sequence <220> <223> LB-SAL07 <400> 7 Met His Thr Thr Val Asn Glu Ala Leu Asn Asn Val Arg Ala Gln Val 1 5 10 15 Gly Ser Gly Val Ser Val Gly A sn Gly Glu Cys Tyr Ala Leu Ala Ser 20 25 30 Trp Tyr Glu Arg Met Ile Ser Pro Asp Ala Thr Val Gly Leu Gly Ala 35 40 45 Gly Val Gly Trp Val Ser Gly Ala Ile Gly Asp Thr Ile Ser Ala Lys 50 55 60 Asn Ile Gly Ser Ser Tyr Asn Trp Gln Ala Asn Gly Trp Thr Val Ser 65 70 75 80 Thr Ser Gly Pro Phe Lys Ala Gly Gln Ile Val Thr Leu Gly Ala Thr 85 90 95 Pro Gly Asn Pro Tyr Gly His Val Val Ile Val Glu Ala Val Asp Gly 100 105 110 Asp Arg Leu Thr Ile Leu Glu Gln Asn Tyr Gly Gly Lys Arg Tyr Pro 115 120 125 Val Arg Asn Tyr Tyr Ser Ala Ala Ser Tyr Arg Gln Gln Val Val His 130 135 140 Tyr Ile Thr Pro Pro Gly Thr Val Ala Gln Ser Ala Pro Ile Asn Tyr 145 150 155 160 Thr Met Asp Lys Arg Gly Lys Lys Pro Glu Gly Met Val Ile His Asn 165 170 175 Asp Ala Gly Arg Ser Ser Gly Gln Gln Tyr Glu Asn Ser Leu Ala Asn 180 185 190 Ala Gly Tyr Ala Arg Tyr Ala Asn Gly Ile Ala His Tyr Tyr Gly Ser 195 200 205 Glu Gly Tyr Val Trp Glu Ala Ile Asp Ala Lys Asn Gln Ile Ala Trp 210 215 220 His Thr Gly Asp Gly Thr Gly Ala Asn Ser Gly Asn Phe Arg Phe Ala 225 230 235 240 Gly Ile Glu Val Cys Gln Ser Met Ser Ala Ser Asp Ala Gln Phe Leu 245 250 255 Lys Asn Glu Gln Ala Val Phe Gln Phe Thr Ala Glu Lys Phe Lys Glu 260 265 270 Trp Gly Leu Thr Pro Asn Arg Lys Thr Val Arg Leu His Met Glu Phe 275 280 285 Val Pro Thr Ala Cys Pro His Arg Ser Met Val Leu His Thr Gly Phe 290 295 300 Asn Pro Val Pro Pro Gly Thr Val Ala Gln Ser Ala Pro Asn Leu Ala 305 310 315 320 Gly Ser Arg Ser Tyr Arg Glu Thr Gly Thr Met Thr Val Thr Val Asp 325 330 335 Ala Leu Asn Val Arg Arg Ala Pro Asn Thr Ser Gly Glu Ile Val Ala 340 345 350 Val Tyr Lys Arg Gly Glu Ser Phe Asp Tyr Asp Thr Val Ile Ile Asp 355 360 365 Val Asn Gly Tyr Val Trp Val Ser Tyr Ile Gly Gly Ser Gly Lys Arg 370 375 380 Asn Tyr Val Ala Thr Gly Ala Thr Lys Asp Gly Lys Arg Phe Gly Asn 385 390 395 400 Ala Trp Gly Thr Phe Lys Leu Glu His His His His His His 405 410 <210> 8 <211 > 454 <212> PRT <213> Artificial Sequence <220> <223> LB-SAL08 <400> 8 Met His Ala Lys Thr Gln Ala Glu Ile Asn Lys Arg Leu Asp Ala Tyr 1 5 10 15 Ala Lys Gly Thr Val Asp Ser Pro Tyr Arg Ile Lys Lys Ala Thr Ser 20 25 30 Tyr Asp Pro Ser Phe Gly Val Met Glu Ala Gly Ala Ile Asp Ala Asp 35 40 45 Gly Tyr Tyr His Ala Gln Cys Gln Asp Leu Ile Thr Asp Tyr Val Leu 50 55 60 Trp Leu Thr Asp Asn Lys Val Arg Thr Trp Gly Asn Ala Lys Asp Gln 65 70 75 80 Ile Lys Gln Ser Tyr Gly Thr Gly Phe Lys Ile His Glu Asn Lys Pro 85 90 95 Ser Thr Val Pro Lys Lys Gly Trp Ile Ala Val Phe Thr Ser Gly Ser 100 105 110 Tyr Gln Gln Trp Gly His Ile Gly Ile Val Tyr Asp Gly Gly Asn Thr 115 120 125 Ser Thr Phe Thr Ile Leu Glu Gln Asn Trp Asn Gly Tyr Ala Asn Lys 130 135 140 Lys Pro Thr Lys Arg Val Asp Asn Tyr Tyr Gly Leu Thr His Phe Ile 145 150 155 160 Glu Ile Pro Val Lys Ala Gly Thr Thr Val Lys Lys Glu Thr Ala Lys 165 170 175 Lys Ser Ala Ser Lys Thr Pro Ala Pro Lys Lys Lys Ala Thr Leu Lys 180 185 190 Val Ser Lys Asn His Ile Asn Tyr Thr Met Asp Lys Arg Gly Lys Lys 195 200 205 Pro Glu Gly Met Val Ile His Asn Asp Ala Gly Arg Ser Ser Gly Gln 210 215 220 Gln Tyr Glu Asn Ser Leu Al a Asn Ala Gly Tyr Ala Arg Tyr Ala Asn 225 230 235 240 Gly Ile Ala His Tyr Tyr Gly Ser Glu Gly Tyr Val Trp Glu Ala Ile 245 250 255 Asp Ala Lys Asn Gln Ile Ala Trp His Thr Gly Asp Gly Thr Gly Ala 260 265 270 Asn Ser Gly Asn Phe Arg Phe Ala Gly Ile Glu Val Cys Gln Ser Met 275 280 285 Ser Ala Ser Asp Ala Gln Phe Leu Lys Asn Glu Gln Ala Val Phe Gln 290 295 300 Phe Thr Ala Glu Lys Phe Lys Glu Trp Gly Leu Thr Pro Asn Arg Lys 305 310 315 320 Thr Val Arg Leu His Met Glu Phe Val Pro Thr Ala Cys Pro His Arg 325 330 335 Ser Met Val Leu His Thr Gly Phe Asn Pro Val Pro Gly Thr Val 340 345 350 Ala Gln Ser Ala Pro Asn Leu Ala Gly Ser Arg Ser Tyr Arg Glu Thr 355 360 365 Gly Thr Met Thr Val Thr Val Asp Ala Leu Asn Val Arg Arg Ala Pro 370 375 380 Asn Thr Ser Gly Glu Ile Val Ala Val Tyr Lys Arg Gly Glu Ser Phe 385 390 395 400 Asp Tyr Asp Thr Val Ile Ile Asp Val Asn Gly Tyr Val Trp Val Ser 405 410 415 Tyr Ile Gly Gly Ser Gly Lys Arg Asn Tyr Val Ala Thr Gly Ala Thr 420 425 430 Lys Asp Gly Lys Arg Phe Gly Asn Ala Trp Gly Thr Phe Lys Leu Glu 435 440 445 His His His His His His 450 <210> 9 <211> 464 <212> PRT <213> Artificial Sequence <220> <223> LB-SAL10 <400> 9 Met His Thr Thr Val Asn Glu Ala Leu Asn Asn Val Arg Ala Gln Val 1 5 10 15 Gly Ser Gly Val Ser Val Gly Asn Gly Glu Cys Tyr Ala Leu Ala Ser 20 25 30 Trp Tyr Glu Arg Met Ile Ser Pro Asp Ala Thr Val Gly Leu Gly Ala 35 40 45 Gly Val Gly Trp Val Ser Gly Ala Ile Gly Asp Thr Ile Ser Ala Lys 50 55 60 Asn Ile Gly Ser Ser Tyr Asn Trp Gln Ala Asn Gly Trp Thr Val Ser 65 70 75 80 Thr Ser Ser Gly Pro Phe Lys Ala Gly Gln Ile Val Thr Leu Gly Ala Thr 85 90 95 Pro Gly Asn Pro Tyr Gly His Val Val Ile Val Glu Ala Val Asp Gly 100 105 110 Asp Arg Leu Thr Ile Leu Glu Gln Asn Tyr Gly Gly Lys Arg Tyr Pro 115 120 125 Val Arg Asn Tyr Tyr Ser Ala Ala Ser Tyr Arg Gln Gln Val Val His 130 135 140 Tyr Ile Thr Pro Pro Gly Thr Val Ala Gln Ser Ala Pro Ile Asn Tyr 145 150 155 160 Thr Met Asp Lys Arg Gly Lys Lys Pro Glu Gly Met Val Ile His Asn 165 170 175 Asp Ala Gly Arg Ser Ser Gly Gln Gln Tyr Glu Asn Ser Leu Ala Asn 180 185 190 Ala Gly Tyr Ala Arg Tyr Ala Asn Gly Ile Ala His Tyr Tyr Gly Ser 195 200 205 Glu Gly Tyr Val Trp Glu Ala Ile Asp Ala Lys Asn Gln Ile Ala Trp 210 215 220 His Thr Gly Asp Gly Thr Gly Ala Asn Ser Gly Asn Phe Arg Phe Ala 225 230 235 240 Gly Ile Glu Val Cys Gln Ser Met Ser Ala Ser Asp Ala Gln Phe Leu 245 2 50 255 Lys Asn Glu Gln Ala Val Phe Gln Phe Thr Ala Glu Lys Phe Lys Glu 260 265 270 Trp Gly Leu Thr Pro Asn Arg Lys Thr Val Arg Leu His Met Glu Phe 275 280 285 Val Pro Thr Ala Cys Pro His Arg Ser Met Val Leu His Thr Gly Phe 290 295 300 Asn Pro Val Thr Gln Gly Arg Pro Ser Gln Ala Ile Met Asn Lys Leu 305 310 315 320 Lys Asp Tyr Phe Ile Lys Gln Ile Lys Asn Tyr Met Asp Lys Gly Thr 325 330 335 Ser Ser Ser Thr Val Val Lys Asp Gly Lys Thr Ser Ser Ala Ser Thr 340 345 350 Pro Ala Thr Arg Pro Val Thr Gly Ser Trp Lys Lys Asn Gln Tyr Gly 355 360 365 Thr Trp Tyr Lys Pro Glu Asn Ala Thr Phe Val Asn Gly Asn Gln Pro 370 375 380 Ile Val Thr Arg Ile Gly Ser Pro Phe Leu Asn Ala Pro Val Gly Gly 385 390 395 400 Asn Leu Pro Ala Gly Ala Thr Ile Val Tyr Asp Glu Val Cys Ile Gln 405 410 415 Ala Gly His Ile Trp Ile Gly Tyr Asn Ala Tyr Asn Gly Asn Arg Val 420 425 430 Tyr Cys Pro Val Arg Thr Cys Gln Gly Val Pro Pro Asn His Ile Pro 435 440 445 Gly Val Ala Trp Gly Val Phe Lys Leu Glu His His His His His His 450 455 460 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223 > SAL(F) <400> 10 atgcatgcta agactcaagc ag 22 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SAL(B) <400> 11 ctcgagtttg aatactcccc aag 23 <210 > 12 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> AD2(B) <400> 12 ctcgagtttg aatactcccc aag 23 <210> 13 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> CHAP(B) <400> 13 ctcgagctca ataaaatgag ttaatc 26 <210> 14 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> S-1 <400> 14 atgcata caa cagtaaat 18 <210> 15 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> S-2 <400> 15 caaatgttgc attttccggg ggtgctgact gtgcgaccgt 40 <210> 16 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> S-3 <400> 16 acggtcgcac agtcagcacc cccggaaaat gcaacatttg 40 <210> 17 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> S-4 < 400> 17 tatccattgt atagttaatg ggtgctgact gtgcgaccgt 40 <210> 18 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> S-5 <400> 18 acggtcgcac agtcagcacc cattaactat acaatggata 40 <210> 19 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> S-6 <400> 19 tgtgcgaccg tgccaggcgg ctcaataaaa tgagttaatc 40 <210> 20 <211> 40 <212> DNA <213> Artificial Sequence <220> <223 > S-7 <400> 20 gattaactca ttttattgag ccgcctggca cggtcgcaca 40 <210> 21 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> S-8 <400> 21 ctcgagttta aatgtac 17 <210> 22 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> S-9 <400> 22 actgtgcgac cgtgccaggc ggtactggat taaatcctgt 40 < 210> 23 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> S-10<400> 23 acaggattta atccagtacc gcctggcacg gtcgcacagt 40

Claims (6)

Consisting of the amino acid sequence of SEQ ID NO: 3, recombinant endolysin. An antibacterial composition for controlling Staphylococcus aureus ( S. aureus ) comprising the recombinant endolysin of claim 1 as an active ingredient. 3. The method of claim 2,
The Staphylococcus aureus is methicillin-resistant Staphylococcus aureus (Methicillin-resistant S. aureus , MRSA) or methicillin-sensitive Staphylococcus aureus (Methicillin-sensitivity S. aureus , MSSA), the antimicrobial composition. A pharmaceutical composition for treating Staphylococcus aureus infection comprising the recombinant endolysin of claim 1 as an active ingredient. 5. The method of claim 4,
The Staphylococcus aureus is methicillin-resistant Staphylococcus aureus (MRSA), a pharmaceutical composition. A feed additive composition comprising the recombinant endolysin of claim 1 as an active ingredient.

Images