KR102422432B1 - silicate-shell hydrogel fiber scaffold and preparation method thereof - Google Patents

Abstract

The present invention relates to a method for producing a silicate-shelled hydrogel fibrous scaffold comprising an alginate hydrogel core and a silicate shell, and more particularly, to a gelled alginate hydrogel by injecting an aqueous alginate solution into an aqueous calcium solution, It relates to a method for preparing a silicate-shelled hydrogel fibrous scaffold by immersing the alginate hydrogel in the added silica aqueous solution and then washing.

Description

Silicate-shelled hydrogel fibrous scaffold and preparation method thereof

The present invention relates to a method for producing a silicate-shelled hydrogel fibrous scaffold comprising an alginate hydrogel core and a silicate shell, and more particularly, by injecting an alginate aqueous solution into an aqueous calcium ion aqueous solution to prepare a gelled alginate hydrogel, It relates to a method for preparing a silicate-shelled hydrogel fibrous scaffold by immersing the alginate hydrogel in an aqueous silica solution to which hydrochloric acid is added and then washing.

Angiogenesis is a major cytomorphogenetic process by which new blood vessels arise from existing blood vessels, which penetrate the 3D extracellular matrix (ECM) and generate new blood vessel growths to meet local metabolic demands (P. Carmeliet, Nature, 2005). , 438) (M. Potente et al., Cell, 2011, 146). Stimulation of angiogenesis has been emphasized as a key strategy in regenerative medicine to stimulate repair of damaged tissues such as bone, cartilage, muscle, and nerve by supplying sufficient nutrients and oxygen (H. S. Kim et al., Adv. Drug Deliv. Rev. , 2018; A. Torres et al., Biomaterials, 2018, 154; C. E. Nelson et al., Adv. Mater., 2014, 26; R. Jin et al., Chen, J. Tissue Eng., 2018; J. B. Norelli et al., J. Tissue Eng., 2018, 9) Physiologically, angiogenesis is regulated by a complex interaction of biochemical and biophysical cues including the ECM and angiogenesis (growth) factors (M. M. Martino). et al., Adv. Drug Deliv. Rev., 2015, 94; P. Carmeliet, Nat. Med., 2003, 9). Thus, biomaterials have been developed to secrete vascular growth-promoting and angiogenic factors that in turn increase their regenerative potential (N. Mitrousis et al., Nat. Rev. Mater., 2018, 3; P. S. Briquez et al., Nat. Rev. Mater., 2016, 1; A. Thakur et al., J. Tissue Eng., 2018, 9).

Among the angiogenic factors, ions were considered to be powerful factors that secrete therapeutic doses after being incorporated into biomaterials. In particular, silicate ions improved the biological functions of endothelial cells such as angiogenesis gene/protein expression, migration, homing, and tubular formation through vascular endothelial growth factor (VEGF) signal. In addition, silicate ions have the potential to enhance osteogenic differentiation of stem cells through hydroxyapatite-forming bioactivity (J.-H. Lee et al., Biomaterials, 2017, 142; J.-H. Lee et al. ., Acta Biomater., 2017, 60; P. Han et al., Biomater. Sci., 2013, 1; A. El-Fiqi et al., J. Mater. Chem. B Mater. Biol. Med., 2015 , 3;J.-J. Kim et al., ACS Applied Materials & Interfaces, 2017, 9).

On the other hand, alginate is a naturally-derived polysaccharide having properties including low toxicity and biodegradability. Polysaccharide chains can be crosslinked by molecular self-assembly through ionic or hydrogen bonding to form a hydrogel with a 3D network that can contain a large amount of water. Therefore, alginate hydrogels have been widely used for various biomedical purposes, including cell culture and drug delivery.

However, investigations into the biological effects of ions (calcium and silicate) released from alginate-silica complexes for hard tissue regeneration, in particular, secreted ions (calcium and silicate) and their therapeutic effects, have not yet been conducted. It is essential for broad application in biomedical fields (H. Lee et al., J. Mater. Chem. B Mater. Biol. Med., 2014, 2; K. Jahan et al., Biomater. Sci., 2016, 4).

Against this background, the present inventors designed a scaffold capable of enhancing the angiogenic function by silicate ions to stimulate the bone repair process. The scaffold was designed as a core-shell structure with the advantages of both the shape-forming properties of alginate hydrogels and the angiogenic and bone-bioactive abilities of silicates. A silicate coating to introduce silicate ions into the biomaterial was applied to the alginate hydrogel as a model biomaterial.

Patent Literature: Domestic Registered Patent No. 10-1850206

The present inventors have found that the advantages of both the silicate shell and the alginate hydrogel core, namely, the sustainable secretion of silicate ions that stimulate angiogenesis to stimulate the bone repair process, and the bone bioactivity (mineralization) function, processability and shape formation of the surface By preparing a silicate-shelled alginate hydrogel fibrous scaffold that can obtain advantages, the effects of promoting angiogenesis, bone formation, and hard tissue formation were confirmed, and the present invention was completed.

Therefore, the problem to be solved by the present invention is (a) preparing a gelled alginate hydrogel by injecting an aqueous alginate solution into an aqueous calcium solution; (b) the above (a) It is to provide a method for producing a silicate-shelled hydrogel fibrous scaffold comprising the step of washing after immersing the result of the.

Another problem to be solved by the present invention is to provide a silicate-shelled hydrogel fibrous scaffold comprising an alginate hydrogel core and a silicate shell prepared by the above method.

Another problem to be solved by the present invention is to provide a composition for hard tissue regeneration comprising the silicate-shelled hydrogel fibrous scaffold prepared by the above method as an active ingredient.

Another object to be solved by the present invention is to provide a method for tissue regeneration comprising the step of treating a damaged hard tissue with a silicate-shelled hydrogel fibrous scaffold prepared by the above method.

The problems to be solved by the present invention are not limited to the problems mentioned above, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.

In order to achieve the above object, in the present invention, (a) preparing a gelled alginate hydrogel by injecting an aqueous alginate solution into an aqueous calcium solution; (b) the above (a) It provides a method for producing a silicate-shelled hydrogel fibrous scaffold comprising the step of washing after immersing the result of the.

The scaffold of the present invention refers to a structure that serves to provide an environment suitable for the adhesion and differentiation of seeded cells inside and outside the structure, and the proliferation and differentiation of cells moving from the periphery of the tissue, and is an important basic element in the field of tissue regeneration engineering. one of them

The alginate aqueous solution of the present invention means a solution obtained by dissolving alginate in water, and alginate means a metal salt of alginic acid. Alginate is a naturally occurring polysaccharide with properties including low toxicity and biodegradability. Polysaccharide chains can be crosslinked by molecular self-assembly through ionic or hydrogen bonding to form a hydrogel with a 3D network that can contain a large amount of water. Therefore, alginate hydrogels have been widely used for various biomedical purposes, including cell culture and drug delivery.

According to one embodiment of the present invention, the aqueous solution of alginate of step (a) is characterized in that it is injected into the aqueous solution of calcium at a rate of 30 ~ 90ml / h. When the alginate aqueous solution is injected at a rate of less than 30 ml/h or exceeding a rate of 90 ml/h, the amount of alginate administered per hour is small or large, making it difficult to form or excessively hardening. According to another embodiment of the present invention, the aqueous alginate solution is injected into the aqueous calcium solution at a rate of 60ml/h.

According to one embodiment of the present invention, the calcium aqueous solution of step (a) is 200 ~ 400mM CaCl ₂ It is characterized in that the aqueous solution. Monovalent sodium ions of alginate can be cured by exchanging with divalent calcium ions to form a physical cross-link between alginate and calcium ions. When the concentration of calcium chloride exceeds 400mM, it can cause excessive cross-linking of alginate and can be prepared as a highly cured carrier, and when it is less than 200mM, it is difficult to maintain the shape due to insufficient cross-linking.

According to one embodiment of the present invention, the step (a) is to prepare an alginate hydrogel by injecting an aqueous alginate solution into an aqueous calcium solution and maintaining it for 1 to 15 minutes. If the holding time is less than 1 minute, crosslinking is not sufficient, making it difficult to maintain the shape, and if it is more than 15 minutes, it is highly cured due to excessive crosslinking of alginate. According to another embodiment of the present invention, an alginate hydrogel is prepared by injecting an aqueous alginate solution into an aqueous calcium solution and maintaining it for 5 minutes.

According to an embodiment of the present invention, the concentration of the aqueous silica solution is 45 to 85% (w/v). In the example of the present invention, when the concentration of the aqueous silica solution was 80% (w/v), the prepared silicate-shelled hydrogel fibrous scaffold was able to confirm not only angiogenesis but also a high osteogenic effect. When the concentration is less than 45% (w/v), the angiogenic effect is insignificant, and when the concentration is more than 85% (w/v), it is difficult to sufficiently secrete Ca ions from the hydrogel of the core, so the osteogenic effect may be low. have. According to another embodiment of the present invention, the concentration of the aqueous silica solution is 50 to 80% (w / v)

As another aspect of the present invention, there is provided a silicate-shelled hydrogel fibrous scaffold comprising an alginate hydrogel core and a silicate shell prepared by the above method.

When the alginate hydrogel of the present invention was included as a core, the loading and transport of hydrophilic drugs, proteins, growth factors, etc. were easier compared to the case in which the alginate hydrogel was shelled.

As another aspect of the present invention, there is provided a composition for hard tissue regeneration comprising the prepared silicate-shelled hydrogel fibrous scaffold as an active ingredient.

The composition for hard tissue regeneration of the present invention is in the form of a semi-solid hydrogel, which does not require a separate support and is easily molded, so that it can be transplanted to fit small or complex damaged tissues. In the case of the composition of the present invention, since it is prepared in the form of continuous semi-solid hydrogel fibers, it can be transplanted to a desired site without dilution, thereby promoting rapid engraftment into the introduced tissue. On the other hand, alginate and silicate, which are components of the core and shell of the composition according to the present invention, are biocompatible materials that do not show cytotoxicity, and are biodegradable materials, so they do not show side effects or toxicity even when transplanted into the body. is decomposed into

In the embodiment of the present invention, the angiogenesis-promoting behavior of the scaffold was tested in terms of upregulation of endothelial cell function, including expression of angiogenesis markers and in vitro tube formation and in vivo blood vessel growth, and scaffolds were tested for angiogenesis markers. Upregulation of endothelial function including expression (~20 fold) and tubular formation in vitro (~50% or more) and vascular growth in vivo (~10 fold) was confirmed. In addition, the bone bioactivity of the scaffold was confirmed through cell-free mineral (hydroxyapatite) formation and cellular bone formation tests, and the silicate/alginate scaffold was implanted in a defective bone model to promote angiogenesis and accelerated angiogenesis. Confirming hard tissue formation (~3 fold), the surface function of silicate-shelled scaffolds is highly effective in promoting bone bioactivity and ion-induced angiogenic activity at the surface, thus ultimately contributing to the repair and regeneration of hard tissue. was found to be useful.

As another aspect of the present invention, there is provided a tissue regeneration method comprising the step of treating the silicate-shelled hydrogel fibrous scaffold prepared by the above method to damaged hard tissue.

The present invention provides a silicate-shelled hydrogel fibrous scaffold comprising a silicate shell and an alginate hydrogel core having effects of promoting angiogenesis, bone formation and hard tissue formation, and a method for preparing the same.

1 shows the production process and optical image of silica-coated alginate hydrogel fibers. (a) is a schematic diagram showing a method for manufacturing an alginate hydrogel fiber scaffold. (b) shows the silica layer coating of alginate hydrogel fibers and secretion of Si ⁴⁺ and Ca ²⁺ ions from the scaffold. (c) shows the optical images before and after silicate coating of the hydrogel carrier.
2 shows the physico-chemical properties of silica-coated alginate hydrogel fibers. (a) shows the SEM and EDX results of silicate-free (Si0%) and silicate-shell (Si80%) alginate fibers, the white arrows indicate the thin silicate layer. (b) shows FTIR spectra of alginate (Si0%) and silica-shell alginate scaffolds (Si50%, Si80%). Si-O bonding is shown in the silicate coating group (Si50% and Si80%). (c) Si ⁴⁺ and Ca ²⁺ ion secretion of the scaffolds in Tris-HCl buffer at different time points during 1 week was analyzed. Ca ²⁺ was secreted at therapeutically relevant levels from all scaffolds over 1 week as a result of degradation of alginate hydrogel fibers, whereas Si ⁴⁺ was secreted from the silica group of the outer silica coating layer.
Figure 3 shows cytotoxicity and angiogenesis gene expression of silica-coated alginate hydrogel fibers indirectly cultured with endothelial cells. (a) is the result of studying the indirect effect of the scaffold on the proliferation of endothelial cells together with the transwell membrane and HUVECs for 3 days. (bf) is a result of quantitative qPCR analysis of the expression of angiogenesis-related genes including VEGF, KDR, eNOS, bFGF and HIF-1α.
Figure 4 shows the neovascularization of endothelial cells (HUVECs) in silica-coated alginate hydrogel fibers. (a) shows calcein positive green fluorescence images showing tube formation on Matrigel at 0, 7 or 12 h and live cells obtained from each group at SiO%, 50% and 80%. (b) quantified the number of circles, the number of nodes, and the total tube length).
5 shows renal angiogenesis (in vivo) after implantation of a fibrous scaffold into a rat subcutaneous tissue. (a) Histological sections were analyzed by hematoxylin and eosin staining at 2 and 4 weeks. Red arrows indicate neoplastic vessels in each group. (b) quantified comparisons between groups 4 weeks after transplantation. It shows significant vascularization around the silicate-shell scaffold (in particular, Si80%) compared to the silicate-free scaffold (scale bar=200 μm).
6 shows the ability to generate bone from acellular hydroxyapatite (HA) formation and cellular osteogenic gene expression. Cell-free HA formation was observed 14 days after the fibers were immersed in SBF. (a) confirmed the typical hydroxyapatite (HA)-like crystal morphology on the surface of the Si80% scaffold through SEM. (b) confirms the deposited HA crystals through the XRD spectrum. (c) The cellular osteogenic potential of silicate/alginate scaffolds was confirmed by enhanced expression of osteogenic genes (Col1a1, ALP and OCN) together with rMSCs.
Figure 7 shows the in vivo osteogenesis ability using the rat calvarial defect model. (a) is an image showing the new bone highlighted in red-brown color 6 weeks after transplantation. (b) shows H&E (hematoxylin and eosin) and MT (Masson's trichrome) staining at low and high magnifications. New bone (NB), old bone (OB), OB and boundary of NB (green dotted line), substance (M), blood vessel (*) are shown. (c) shows μ-CT quantitative analysis of bone volume (BV), surface (BS), surface density (BSD) and tissue volume (TV).

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and in accordance with the gist of the present invention, the scope of the present invention is not limited by these examples. It is obvious to those of ordinary skill in the art,

Example 1. Preparation and characterization of silicate-shelled hydrogels

1-1. Preparation of silicate-shelled hydrogels

In order to prepare the silicate-shelled hydrogel, tetraethyl orthosilicate (TEOS, Sigma-Aldrich) and 1N hydrochloric acid standard solution (Daejung, South Korea, 37314) were used as silicate solution reagents, and to prepare an alginate hydrogel Calcium chloride (CaCl ₂ ) (Sigma-Aldrich) and sodium alginate (Duksan, South Korea, d918) were used.

Two different concentrations of silica solutions were prepared by mixing TEOS with deionized water (DW) at concentrations of 50% and 80% w/v. Then, 2.4 ml of 0.1M HCl were added to the mixture as catalyst and stirred vigorously at 400 rpm for 2-3 hours. Sodium alginate 3% (w/v) was prepared in distilled water and placed in a water bath at 37° C. until homogeneously dissolved. First, a 3% (w/v) alginate solution concentration was chosen because of its stability to maintain the fiber morphology. On the other hand, 1% (w/v) alginate fibers were brittle and 5% (w/v) alginate fibers formed beads due to their high viscosity. A 5ml syringe loaded with sodium alginate aqueous solution is injected at a rate of 60ml/h into a 300mM CaCl ₂ solution through a 17G spinneret needle through an injection pump at a rate of 60ml/h, and the resulting fiber is maintained in the solution for 5 minutes to release calcium ions. The presence allowed the alginate polymer to crosslink. The rapid crosslinking of alginate occurred in the presence of calcium ions and allowed the fiber structure to be maintained as previously reported. After washing in DW for 2 min, the resulting fibers were immediately immersed in different TEOS solutions (50% and 80%) for 5 min and then immersed in DW 4 times to remove excess solution before other experimental procedures.

1-2. Properties of silicate-shelled hydrogel fiber scaffolds

The crosslinked fibrous scaffolds were washed in DW to remove excess calcium ions and/or silica and carefully wiped with ultra-absorbent paper before immersion in liquid nitrogen for 5 minutes. After the ultrafast freezing process, the scaffolds were cross-sectioned with a blade and freeze-dried. Then, the fiber scaffold was sputtered with platinum, and the general morphology of the microstructure was observed by a scanning electron microscope (SEM, JEOL-SEM 3000, Hitachi, Japan) equipped with an energy-dispersive X-ray spectrometer to determine the urea composition (EDS). , Oxford Instruments, UK) were analyzed. The chemical bonding structure of the freeze-dried hydrogel was confirmed by Fourier transform infrared spectroscopy (Varian 640-IR, Australia). Hydrogel diameters in aqueous solution at different fiber preparation conditions were measured optically by a microscope equipped with denaturation software (IX71; Olympus, Japan).

As a result, along with the fibrous scaffolds, sol-gel silicates were coated at various silicate concentrations (Fig. 1b). Although the silicate shell imparts some stiffness to the alginate fiber scaffolds, the shelled (Si80%) and shellless (Si0%) fiber scaffolds could be easily molded and implanted into any specific shape. As observed by SEM, the morphology of alginate fibers with and without silicate shells showed different surface textures. A dry lava-like morphology was exhibited at Si80%, and a wavy surface at Si0% (Fig. 2a). EDS with mapping confirmed that the thin outer layer of Si80% was Si-rich. FT-IR spectra are typical of silicate-related bands in silicate-shell scaffolds (Si-O-Si at 413 cm ^-1 and 418 cm ^-1 , Si-O peaks at 556 cm ^-1 , Si ^- H stretching and CH stretching at 2891 and 2874 cm ^-1 ), whereas alginate-related peaks (COH stretching at 1403 cm ^-1 , CO stretching at 1585 and 1619 cm ^-1 , OH stretching at 1010 cm ^-1 and 3000-3500 cm ^-1 ) in all groups. observed (Fig. 2b).

Example 2. Ion secretion and angiogenesis of scaffolds (in vitro)

2-1. Calcium and Silicate Ion Secretion Analysis of Scaffolds

The secretion of silicon and calcium ions from the fibrous scaffold was detected using ICP-AES (PerkinElmer, OPTIMA 4300DV). Briefly, each scaffold group (0.3 ml) was immersed in 0.1 M Tris buffer and stored at 37° C., pH 7 (Sigma-Aldrich, USA, 252859). Supernatants were collected for a specified period of time (12 hours, 1, 3 and 7 days) and then filtered through a sterile syringe filter for subsequent characterization.

As a result, during the first 12 hours of immersion, the amount of silicate ions released from Si80% was -85 ppm, doubling to -160 ppm at 24 hours. A more sustained secretion was observed at longer incubation times and reached 326 ppm at the end of the experiment on day 7. The Si0% group showed no secretion of silicate ions, whereas calcium ions were secreted higher in the Si0% group than in the Si80% group. The secretion of calcium ions is due to hydrolysis of the weak interaction between calcium and alginate monomers, and the silicate shell can reduce calcium secretion from the inner alginate hydrogel. The results for ion secretion of silicate/alginate scaffolds showed that, on average, ~47 ppm/day of silicate ions and 11-23 ppm/day of calcium ions were secreted, which in turn affects cellular responses such as angiogenesis and bone formation. suggest a possible role of ions from the alginate scaffold. It was hypothesized that the silicate coating could induce additional therapeutic ions (silicate) with minimal migration of core biomolecules/ions, and consequently accelerate biological efficacy. In particular, for bone regeneration, a large amount of silicate ions initially released from the outer surface favors the process of inducing early angiogenesis, and calcium ions released more slowly from the inner part can also support further bone formation processes.

2-2. Analysis of the angiogenic capacity of scaffolds

The angiogenic effect of scaffolds on HUVECs was evaluated by an indirect method of examining tube formation and angiogenesis genes from ions secreted from biomaterials. HUVECs (ATCC, US, PCS-100-010) were used to analyze angiogenesis in this study. HUVECs were cultured in vascular cell basal medium (ATCC, US, PCS-100-030) supplemented with Endothelial Cell Growth Kit-VEGF (ATCC, US, PCS-100-041). HUVEC cells were incubated in a humid atmosphere with 5% CO ₂ in air at 37° C. until confluent. Cell behavior was determined by an indirect culture method to analyze the effect of silicon and calcium ions released from the scaffolds. First, 3×10 ⁴ HUVECs were transferred to each well of a 24-well plate and incubated overnight. Then, 0.3 ml scaffolds (culture plates without scaffolds used as controls) were placed in transwell permeable inserts (Corning; US 353097) over aliquoted HUVEC cells with 0.5 ml of medium. Cell counting kit-8 (Dojindo Molecular Technologies, Japan, CCK-8) was used to measure cell proliferation for 1, 3 and 7 days. Briefly, for each well, the growth medium was replaced with 200 μL of medium containing 20 μL of CCK-8 solution (10:1) and incubated for 2 hours. After incubation, 100 μL of the solution was transferred to each well of a 96-well plate, and the optical density was detected by a microplate absorbance reader (iMark; BIO-RAD, US) at 450 nm. The results demonstrated that cell viability was similarly increased in the fiber group up to 3 days, suggesting that the scaffold was not toxic (Fig. 3a).

Quantitative analysis of angiogenesis-related gene expression was confirmed by quantitative real-time PCR (qPCR). A total of 1× ^{10 5} HUVECs were cultured in each 24-well plate. Trans well inserts containing 0.3 ml scaffold were applied to each well of the plate with endothelial growth medium. After 24 h exposure, total RNA was isolated from harvested cells according to the manufacturer's instructions (GeneAll, South Korea, 304-150). Reverse transcription of 2 μg mRNA was performed in a thermal cycler (HID Veriti® 96-well Thermal Cycler, Applied Biosystems, US, 4479071). Gene expression was determined by real-time PCR performed in a thermal cycler (StepOne™ Plus, Applied Biosystems, US) with RealAmp™ SYBR qPCR Master mix (GeneAll Biotechnology, South Korea, 801-051). Relative gene expression levels were calculated using the comparative Ct method (2-ΔΔCt) and normalized to endogenous human GAPDH gene expression. The primers used for angiogenesis gene amplification are shown in Table 1.

Gene Forward (5'-3') Reverse (5'-3') housekeeping
gene Rat GAPDH CAAGGATACTGAGAGCAAGAG ATGGAATTGTGAGGGAGATG Human GAPDH GATTTGGTCGTATTGGGCG CTGGAAGATGGTGATGG Angiogenic
markers VEGF TGCGGATCAAAC CTCACCA CAGGGATTTTT CTTGTCTTGC KDR GTGATCGGAA ATGACACTGGAG CATGTTGTTCAC TAACAGAAGCA HIF1α CCATGTGACCA TGAGGAAAT CGGCTAGTTAGGG TACACTT eNOS TGTCCAACATGC TGCTGGAAATTG AGGAGGTCTTCTTCCTGGTGATGCC bFGF CAATTCCCATGTGCTGTGAC ACCTGACCTCTCAGCCTCA Osteogenic
markers ALP CTCTGCCGTTGTTTCTCTAT AGGTGCTTTGGGAATCTG COL1A1 CTGGTACATCAGCCCAAAC GAACCTTCGCTTCCATACTC BSP GTACATCTGAACGGCTAAGG GTTTGGTAAAATCTGGCAACTC OCN GCTTCAGCTTTGGCTACT CGTTCCTCATCTGGACTTTAT

The expression of angiogenesis-related genes such as VEGF, HIF-1α, KDR, bFGF and eNOS was analyzed at 24 hours. As a result, the gene expression levels of VEGF and its receptor KDR were found in the silica-shell group (Si50) compared to the control cell group. % or Si80%) was significantly up-regulated from 2 to 2.5 times. In particular, the expression of other angiogenic genes such as eNOS, bFGF, and HIF1-α was higher in silica-shell fibers (Si50% or Si80%) compared to pristine fibers (Si0%, P<0.05 or P<0.001). up to 4-20 fold significantly higher (Fig. 3b-f). These results demonstrate that the silicate ions released from the fibrous scaffold, especially Si80%, have a significant effect on stimulating angiogenic gene expression. That is, the secretion of ions from the scaffold is highly effective in stimulating mRNA expression of angiogenesis markers (VEGF, KDR, eNOS, bFGF and HIF1-α) in endothelial cells (HUVECs) without negatively affecting cell proliferation. was

Tube network formation was investigated by culturing HUVECs on Matrigel™ matrix (BD Biosciences, US, 356234). The insert containing the scaffold was placed on top of the Matrigel, thus allowing ionic interactions of the cells. The 24-well plate surface was covered with Matrigel™ for 15 min at 37°C according to the manufacturer's instructions. After gelation, 1×10 ³ HUVEC cells were homogeneously aliquoted on Matrigel, and then 0.3ml scaffolds were loaded into transwell inserts and placed in each well. Tube morphology was observed at different time points (n = 5, 0, 7, 12 h) using a back-light microscope (IX71; Olympus, Japan). For each group, three samples were taken, and random fields were photographed for angiogenesis. ImageJ software was used to analyze total tubule length, number of nodes (branch points) and circles (mesh circles).

As a result, optical morphology (0, 7, 12 h) and live calcein-stained cells (12 h) were visualized to investigate the tube-forming ability and live state of the cells (Fig. 4a). Tubular networking such as total tube length, number of nodes, and number of tube circles was quantified (Fig. 4b). At 7 h, Si80% demonstrated a significant increase of -50% in the number of tube circles and nodes compared to the cells alone control or SiO%. The decrease in the number of circles and nodes at 12 hours compared to 7 hours is due to tube formation and subsequent increase in tube length.

Example 3. Angiogenesis of Scaffold Subcutaneous Implantation Rats (in vivo)

Biocompatibility and neovascularization capacity were evaluated (in vivo) by implanting fibrous scaffolds under the subcutaneous tissue of 6-week-old Sprague-Dawley male rats and analyzing them at different time points (2 and 4 weeks). Four replicates were used in the study for each experimental group (Si0%, Si50% and Si80%). Animals were housed in individual cages under controlled conditions with ad libitum food and water provided. Animal surgery was performed under anesthetic conditions by intramuscular injection of ketamine/xylazine. The back of the skin was shaved and sterilized with 70% ethanol and povidone solution. 0.5 mL of fibrous scaffolds from different experimental groups were implanted in separate pockets made under the skin on both sides of the spine. In addition, the incision was closed with non-absorbable suture material (4-0 Prolene, Ethicon, Germany) and the animals were sacrificed prior to histological analysis at each time point. The grafted scaffold regions were extracted and fixed with 10% neutral buffered formalin for 24 h at room temperature. Specimens were dehydrated with an ordered gradient of ethanol, halved and embedded in paraffin. Tissue sections of 5 μm were cut with a microtome (Leica RM2245, Leica™, Biosystems, Germany). Finally, samples were stained with hematoxylin and eosin (H&E) and analyzed by light microscopy (IX71, Olympus, Japan).

As a result, H&E staining images suggest no severe tissue toxicity and inflammation around the implanted material. New-vessels with erythrocytes were stained dark red (red arrow), and more vessels formed in Si80% than in Si0% (Fig. 5). The total number, area, and diameter distribution of blood vessels were quantitatively measured. As a result, the total number and area of blood vessels in the silica-shell group (Si50% or Si80%) significantly increased 3 to 10 times compared to the Si0% group. . The distribution of blood vessel diameter revealed a large-diameter blood vessel fraction in Si80% compared to Si0% and Si50%, and there was a significant difference in Si80% compared to other experimental groups. Collectively, the silicate ions (especially Si80%) secreted from silica-shell fiber hydrogels are believed to be highly involved in stimulating neovascularization in vivo, while maintaining excellent biocompatibility without severe inflammation.

Example 4. Scaffold Osteogenesis Assay

4-1. Analysis of apatite forming ability and osteogenic capacity (in vitro)

Along with angiogenic capacity, osteogenic properties are important factors for use as bone regeneration materials. First, acellular bone bioactivity was observed by the apatite-forming ability of the scaffolds in SBF. Next, based on angiogenesis assays, we tested cellular osteogenic stimulation of Si80% scaffolds vs. Si0% to reveal their potential to promote osteogenicity.

The apatite-forming ability of the fibrous scaffolds was estimated by incubating 0.5 ml of samples from each experimental group placed in 15 ml tubes with 10 ml of simulated body fluid (2xSBF) at 37° C. for 14 days. To confirm hydroxyapatite formation, the hydrogel was carefully washed with distilled water, lyophilized overnight, and examined by SEM and X-ray diffraction (Rigaku, Ultima IV, Japan).

To measure the osteogenic capacity of the scaffolds, rat mesenchymal cells were isolated, and the cells were cultured on TCP substrate at a rate of 6250 cells/cm 2 , and cultured for 24 hours before any experiments. Simultaneously, alginate and silicate-alginate fibers were immersed in α-modified MEM (Welgene, South Korea, LM 008-53) and incubated at 37° C. for 24 hours. The next day, both conditioned media were collected, filtered and mixed with 10% fetal bovine serum (FBS) (Corning, USA, 35-015-CV), 1% penicillin-streptomycin (Gibco, USA, 15140-122) and bone formation. supplemented with factors (10 mM β-glycerol phosphate, 10 nM dexamethasone and 50 μg/mL ascorbic acid). Cells were exposed to different osteogenic media and compared to controls for further characterization at different time points (days 7-28). The badge was changed every other day. Osteogenic differentiation of rat MSCs was analyzed by qPCR according to the aforementioned protocol, and the primers used are listed in Table 1 above.

As a result, acellular bone bioactivity was confirmed by the apatite-forming ability of the scaffold in SBF. SEM images of Si80% fiber scaffolds after immersion in SBF showed typical apatite crystal growth on the surface, whereas this mineralization process did not proceed under the same conditions in Si0% (Figs. 6a and b). This phenomenon can be explained by bioactive silicate-based materials. That is, it can be explained that in a series of processes of calcium ion secretion, calcium and phosphate ions precipitated on the hydrated silicate having a silanol group are precipitated, and calcium phosphate crystals are formed as a result with time. With the high apatite peak intensities shown in Si80%, the XRD spectra show apatite-related diffraction peaks at 2θ~27°, ~32° and ~46° after immersion in SBF, indicating that the silica-shelled scaffolds form bone-like minerals. improved ability

Next, based on the angiogenesis analysis, Si80% scaffold vs. Si0% cellular osteogenesis stimulation was tested. Among the groups, Si80% had the most prominent angiogenic potential and, consequently, the potential for osteogenesis promotion. After soaking the scaffolds in Si0% and Si80% for 24 h, the collected conditioned medium was treated with rMSCs. After culturing for 2 weeks, osteogenic gene expression was analyzed by qPCR compared to the control (OM) (Fig. 6c). Si0% had no effect on increased osteogenic gene expression, and Si80% maximally increased osteogenic gene expression, including early markers such as collagen type I and alkaline phosphatase, and late markers such as osteocalcin. It was possible to significantly increase 1.5 to 4 times. In particular, Si80% showed a significant increase in the expression of all osteogenic genes up to 1.8 to 4 times compared to Si0, proving the important role of secreted ions in stimulating the osteogenicity of stem cells. Although calcium ions are known to be involved in osteogenic differentiation through calcium signaling activation, the effect of calcium ions in this study was not well revealed because there was no significant increase by SiO% extract. Rather, the combined role of calcium ions and silicate ions through Si80% appeared to be more apparent in the stimulation of osteogenic formation of rMSCs.

4-2. Bone formation assay (in vivo)

The initial bone formation potential of the scaffolds was investigated in a rat calvarial circular defect model for 6 weeks. For this animal study, healthy male SD rats (9-10 weeks old) were used. Animals were housed in cages under constant temperature in a humidified environment, exposed to a 12-hour light-dark cycle, and had free access to water and food. Two study groups (Si0% and Si80%) were selected for in vivo studies. Under general anesthesia by intramuscular injection of the mixture (ketamine 80 mg/kg and xylazine 10 mg/kg), each calvaria defective rat was randomly selected for implantation of a 1.5 mL fibrous scaffold.

After shaving the cranial lesion, the surgical site was wiped with iodine and 70% ethanol, and a linear skin incision was performed with a surgical blade. The full-thickness flap was peeled off, exposing the cranial bones. In each rat, using a dental handpiece and a 5 mm diameter trephine drill (GHI, Pakistan), 5 mm diameter cranial bone defects on the right and left sides of the parietal bone under cooling conditions with sterile saline were removed. caused The subcutaneous tissue and periosteum were sutured with absorbable sutures (4-0 Vicryl®, Ethicon, Germany), and the skin was folded with a non-absorbable suture material (4-0 Prolene, Ethicon, Germany).

Following implantation of samples, animals were regularly supervised for possible clinical signs of infection, inflammation and any adverse reactions. At 6 weeks post-surgery, animals were euthanized by CO ₂ inhalation, tissue surrounding the grafted cranial duct defect site was harvested and fixed in 10% neutral buffered formalin for 24 h at room temperature.

After fixation, the harvested samples were subjected to micro-computed tomography (μ-CT) imaging (Skyscan 1176, Skyscan, Aartselaar, Belgium) with X-rays at 65 kV and 385 μA with an exposure time of 279 ms per section (μm). Images reconstructed from scan images were used to analyze hard tissue formation over the region of interest using CTAn Skyscan software; New hard tissue volume (mm ³ ), new bone volume (mm ³ ) and bone surface density (BS/BV) (1/mm) in the defect area. 3D images were visualized with CTvol Skyscan software (ver. 2.3.2.0).

For histological analysis, fixed tissues were demineralized in RapidCal™ solution (BBC Chemical Co., USA) for 5 days. After descaling, the samples were dehydrated in a series of increasing concentrations of ethanol solutions and then embedded in paraffin. Using a semi-automatic rotating microtome (Leica RM2245, Leica Biosystems, Germany), five-micrometer coronal sections of the central region of the sample were prepared and then transferred to coated glass slides. Slides with tissue sections were deparaffinized and hydrated through a series of xylene and grade ethanol solutions and finally stained with H&E to measure new bone area. Histological sections were visualized under a light microscope (IX71, Olympus, Japan).

As a result, hydrogel-based scaffolds made it possible to easily handle and mold the resulting bone defects. In the harvested tissue, no severe inflammation was observed near the graft area at the time of sacrifice. The μ-CT 3D image showed more new bone formation in Si80% than Si0% within the defective area, as indicated by the red-brown area (new bone) (Fig. 7a). According to quantitative data regarding bone mass and quality (Fig. 7c, bone volume (BV), surface area (BS), tissue volume (TV) and bone surface density (BSD)), the Si80% group had 3 times more than the Si0% group. showed bone formation.

After H&E and Masson's trichrome (MT) staining, the samples were further histologically analyzed. H&E and MT staining images showed that more new bone matrix was formed within the healing area at Si80% (Fig. 7b). Si80% showed more blood vessels ('*') than Si0%, highlighting facilitated angiogenesis in silicate-shell scaffolds. In addition, the collagen content was higher in Si80% than in Si0%, indicating that higher collagen deposition may help improve the bone healing and maturation process. The in vivo results demonstrated that silicate-shell scaffolds significantly enhanced early bone formation with simultaneous stimulation of angiogenesis.

Claims (8)

In the method for preparing a silicate-shelled hydrogel fibrous scaffold,
(a) preparing an alginate hydrogel by injecting an aqueous solution of alginate into an aqueous solution of calcium; and
(b) immersing the resultant of (a) in an aqueous silica solution having a strong acid of pH 0.5 to 2 added thereto, followed by washing;
The scaffold is a manufacturing method, characterized in that for hard tissue regeneration. The method of claim 1, wherein the alginate aqueous solution of step (a) is injected into the calcium aqueous solution at a rate of 30 to 90 ml/h. The method of claim 1, wherein the calcium aqueous solution of step (a) is 200-400mM CaCl ₂ aqueous solution. The method of claim 1, wherein in step (a), an alginate aqueous solution is injected into an aqueous calcium solution and maintained for 1 to 15 minutes to prepare an alginate hydrogel. The method of claim 1, wherein the concentration of the aqueous silica solution is 45 to 85% (w/v). A silicate-shelled hydrogel fibrous scaffold comprising an alginate hydrogel core and a silicate shell prepared by the method of any one of claims 1 to 5. [Claim 6] A method for tissue regeneration comprising the step of treating damaged hard tissues of animals other than humans with the silicate-shelled hydrogel fibrous scaffold prepared by the method of any one of claims 1 to 5.


delete

Images