KR101472045B1 - Core-shell fibrous cell carrier and composition for regeneration of osseous tissue or cartilage tissue comprising the same - Google Patents

Abstract

The present invention relates to a core-shell fibrous cell carrier which includes: a core having a cell and collagen; and a shell including alginate. The present invention provides a method for producing the core-shell fibrous cell carrier and a composition including the core-shell fibrous cell carrier for regenerating bones or cartilage, wherein the method comprises a step of injecting a core material including a cell and collagen through an internal needle and a shell material including alginate through an external needle at a particular speed in a water tank including calcium chloride, where the internal needle and the external needle share the center and have different diameters. In the core-shell fibrous cell carrier, in which a core and a shell are clearly separated, of the present invention, the alginate content of the shell is optimized, so that oxygen and nutrition can be actively supplied to the cell disposed in the core and the cell can form a network in a boundary part with the shell, wherein oxygen and nutrition are actively supplied in the boundary part. The cell carrier can be easily molded into hydrogel form to be directly filled and transplanted even in a portion with tissue damage having a small or complicated shape.

Description

TECHNICAL FIELD The present invention relates to a core-shell fibrous cell carrier and a composition for regenerating bone tissue or cartilage tissue comprising the core-shell fibrous cell carrier.

The present invention relates to a core comprising cells and collagen; A core-shell fibrous cell carrier comprising a shell comprising alginate and an alginate, a core material comprising cells and collagen from an inner needle through needles of different diameters sharing a center, A method for producing the core-shell fibrous cell carrier, and a method for regenerating bone or cartilage comprising the core-shell fibrous cell carrier, which comprises injecting a substance into a water tank containing a crosslinking agent at a constant rate.

Bone tissue can be damaged by various diseases such as spinal injuries, fractures, infections, and tumors. In the case of simple fracture, natural treatment is possible, but a therapeutic agent for treating and / or regenerating bone loss in excess of the natural treatment limit is needed. In addition, when extracted due to periodontal disease or trauma, alveolar bone is absorbed, which causes problems in prosthetic treatment and implant treatment. In particular, for successful implants, the implant of a certain length and diameter should be placed. However, if the alveolar bone is insufficient, implant placement may be limited. In these areas, bone grafting is required to increase the height and width of the alveolar bone, and several regenerative treatments have been developed for this purpose. The most widely used bone defects are bone grafts, and autogenous bone, allogeneic bone, heterogeneous bone, or synthetic bone is used as a graft material for bone regeneration. Although autogenous bone contains bone cells capable of direct bone formation and is the best bone graft material with no rejection, it can guarantee a high success rate, but it requires additional operation on the harvesting site for bone harvesting, It is not easy to collect as much as necessary because the amount is limited. Therefore, in clinical practice, there is an increasing demand for the development of bone graft substitutes for replacing autogenous bone. Allografts are available as a substitute for autogenous bone because they can be harvested in large quantities compared to autogenous bone grafts, have the advantage of being transplanted with one operation, and have a high possibility of osteogenesis. However, it is not easy to manipulate, does not show consistent bone regeneration results, may cause failure in bone regeneration, side effects such as immune rejection may occur, and bone fragments obtained from disease holders may cause disease transmission This is controversial. Bone marrow is widely used to treat bone tissue from non-human animals and to use it as a graft material. The deproteinization process is used to remove the antigen and the possibility of infection of the heterogeneous bone, and the bones that have undergone this deproteinizing process are widely used for the bone grafting in the dental field. In addition, various synthetic materials that can be used as synthetic cores have been developed. To be used as a synthetic bone, it has no toxicity, is biocompatible, is porous, is able to penetrate regenerated bone cells, stably attaches and proliferates, and can be decomposed in the body over time.

Since cartilage tissue is free of blood vessels, nerves, and lymphatic vessels, the length of time to supplement the cells after injury is very limited. Cells that can be supplied as cartilage defect include cartilage cells migrating from nearby cartilage, stem cells present in bone marrow and synovial membrane and adipose tissue. Chondrocytes migrated from the periplasmic cartilage are not sufficient for cartilage regeneration because the rate and distance of movement are very limited. On the other hand, bone marrow stem cells can participate in cartilage regeneration in the case of whole cartilage defects, but not in regeneration of cartilage in the case of partial layer defects. On the other hand, the existence of stem cells in synovial membrane and adipose tissue has been reported, but sufficient evidence has not been given as to whether they participate in spontaneous regeneration of cartilage. Because of this feature, cartilage damaged by physical damage has many limitations in regenerating cartilage tissue with normal function and structure.

In addition, once the damaged cartilage boundary is vulnerable to mechanical pressure, it is easily broken and worn, resulting in a larger defect. In addition, debris of the cartilage can cause cartilage damage by providing a cause of inflammation, and as a result, osteoarthritis may progress rapidly. Therefore, it is very important to regenerate damaged cartilage prematurely. Currently, there are various methods for regeneration of cartilage defect, but it has not yet reached the regeneration of normal hyaline cartilage.

Since the introduction of autologous chondrocyte transplantation by M. Brittberg in 1994, the use of cell-based cartilage regeneration has been rapidly evolving. Methods for regenerating cartilage by cell transplantation include supplying cells to a defective site or implanting artificially cultured articular cartilage.

Meanwhile, as the technology for separating and culturing stem cells has developed, a method of transplanting stem cells capable of differentiating into various tissues into the affected part has been used as a cell therapy agent for regenerating the damaged bone tissue and cartilage tissue. At this time, there is a need for a cell delivery system capable of efficiently transferring cells to a damaged site and rapidly differentiating the cells into a desired tissue to promote regeneration.

Accordingly, the present inventors have found that when embryonic stem cells are encapsulated in a core-shell structure containing collagen and alginate, which are biocompatible materials, respectively, and formed into a fibrous form, microorganisms, which are favorable for the survival and differentiation of stem cells, And it is easy to mold and can be injected according to a complicated damage site. Thus, it is confirmed that the cell can be effectively transferred to promote regeneration of tissue, and the present invention has been completed.

One object of the present invention is a core comprising a cell and a collagen; And a shell comprising an alginate.

Another object of the present invention is to provide a method for manufacturing a core material containing cells and collagen from inner needles through needles of different diameters sharing a center and a shell material containing alginate from outer needles into a water tank containing a cross- Into a core-shell fibrous cell carrier.

It is still another object of the present invention to provide a composition for regenerating bone tissue or cartilage tissue comprising the core-shell fibrous cell carrier.

According to one aspect of the present invention, there is provided a method of manufacturing a cell, comprising: a core comprising a cell and a collagen; And a shell comprising an alginate.

Conventional cell carriers were prepared in the form of a hydrogel or solid sphere in which cells were enclosed and suspended in a liquid. The preferred dosage form thereof was therefore an injection. However, this is disadvantageous in that it is difficult to engage in a desired position because it is suspended in the liquid even if it is directly injected into the affected part. In order to provide a cell carrier that can be applied to the damaged tissue of the bony tissue while easily retaining its shape by improving its mechanical strength as compared with the conventional microsphere form without floating in a solution, A core comprising a cell; And a shell comprising alginate.

The term "cell carrier" in the present invention means a solid or semi-solid microstructure in which cells to be delivered are enclosed by a system for delivering cells as therapeutic agents to the affected part. The microstructure may be fabricated on a scale of several tens to several hundred micrometers so as to contain a certain amount of cells, but the shape is not limited. Preferably, the solid or semi-solid is an adduct that is introduced to support the cells, and a material that is not toxic to the cells is selected. The cell carrier according to the present invention is a core-shell structure cell carrier prepared so as to contain cells in a collagen core and further comprising a shell containing alginate so that the cell does not come into direct contact with the outside.

The collagen is a gel-like semi-solid as an adduct introduced to support cells as described above, and is a biodegradable substance that does not show cytotoxicity and is slowly degraded in the body.

The cells to be encapsulated in the cell carrier of the present invention may be undifferentiated stem cells capable of differentiating into various tissue cells depending on the culture environment, or tissue cells such as bone cells and cartilage cells. At this time, the bone cells and cartilage cells may be collected directly from the adult, or the stem cells may be differentiated from the cells. Alternatively, the undifferentiated stem cells may be encapsulated to prepare a cell transporter, and the cells may be used for differentiation in a differentiation medium before administration into the body.

Preferably, the core of the cell carrier according to the present invention has a diameter of 100 [mu] m to 1500 [mu] m. Cells mixed with the core material of the cell carrier of the present invention are located at the interface with the shell which is easy to receive oxygen and nutrients and form a network with each other. Therefore, considering that, when the core is formed to be smaller than the above range, it can not be provided with a sufficient core-shell boundary area that the cells can arrange and can be arranged in multiple layers. In this case, May not be fed with sufficient oxygen and nutrients, which may make normal growth difficult. If the core is formed larger than the above range, the surface area is excessively larger than the number of cells, and the cell density is low, so that normal cell network formation may be difficult or the density of the formed tissue may be too low.

The shell of the cell carrier according to the present invention preferably has a thickness of 100 [mu] m to 250 [mu] m. When the shell is formed to be thinner than the above range, the mechanical strength is low and can be quickly disintegrated. On the other hand, when it is formed to be thicker than the above range, diffusion of nutrients to the cells located in the core region and oxygen transmission are inhibited, and normal cell growth can be inhibited.

The core of the cell carrier according to the present invention is characterized by containing 0.5-5% of collagen in relation to the total weight of the core. If the collagen content is less than 0.5%, the mechanical strength may be too low and the physical properties may be weakened. On the other hand, when the collagen content exceeds 5%, the growth and migration of cells may be restricted.

The shell of the cell carrier according to the present invention is characterized in that it contains 2 to 5% by weight of fibrin alginate based on the total weight of the shell. When the alginate content of the shell portion is less than 2%, the durability is low and the decomposition rate is high and the mechanical properties are deteriorated. On the other hand, when alginate is contained in an amount of 5% by weight, a thick and dense shell layer may be formed to inhibit penetration of oxygen and nutrients for survival and proliferation of the cells encapsulated in the core portion.

According to another aspect of the present invention, there is provided a method of manufacturing a core material comprising cells and collagen from an inner needle through needles having different diameters with a center and a shell material comprising alginate from an outer needle, At a constant rate into the core-shell fibroblast cell line.

The core-shell fibrous cell carriers, cores, shells and cells are as described above.

The cell carrier according to the present invention is characterized in that it is constituted of clearly separated regions of the core portion containing collagen and cells and the shell containing alginate. In order to manufacture a cell carrier having such a structural characteristic, a shell material is discharged from the outer needle through the inner needle through the needles having different diameters, So that the alginate of the shell is in contact with the crosslinking agent solution, and the low valence ions of the alginate exchange with the ions of the higher valence to cross-bind, thereby growing a cured network outside the shell. Curing by fast cross-linking outside of the alginate can keep the cell-loaded collagen core free of loss of physical integrity.

In the method of manufacturing a cell carrier according to the present invention, the injection rate of the core and the shell material is 20 to 80 ml / h. If the infusion rate is less than 20 ml / h, the delay in the process due to the slow rate may increase the risk of cell death during in situ fibrous cell carcinogenesis. On the other hand, if the infusion rate exceeds 80 ml / h, it may induce inadequately thick shell formation and inhibit delivery of oxygen and nutrients required for cell survival.

Preferably, the crosslinking agent is not limited thereto, but may be calcium chloride. For example, when in contact with a calcium chloride solution, the monovalent sodium ion of the alginate can be exchanged with a divalent calcium ion to form a cross-link to cure the surface. The calcium chloride may be used at a concentration of 5 mM to 50 mM. When the concentration of the salt and calcium exceeds 50 mM, excess cross-linkage of alginate is induced to produce a highly cured carrier, which may adversely affect the activity of the encapsulated cells. When the concentration is less than 5 mM, It is difficult to maintain.

In another aspect, the present invention provides a composition for regenerating bone tissue or cartilage tissue comprising the core-shell fibrous cell carrier.

The present invention also provides a method for regenerating bone tissue or cartilage tissue comprising implanting bone or cartilage regeneration composition comprising the core-shell fibrous cell carrier.

 The term "osseous tissue" of the present invention is a term referring to a tissue that forms a bone. The bone is made up of fine-grained bone, and both ends of the central or iliac bone are associated with a spongy bone like a net. Most of the bones first develop as cartilage in the connective tissue and later turn into bone tissue, some of which are produced directly in the connective tissue. At the distal end, there is a joint surface in contact with the neighboring bone, and its surface is covered with articular cartilage, which is a supernatural bone. The sponge in the middle of the spongy is characterized by a constant arrangement. The osteocytes are arranged between the stratum corneum and are connected to other adjacent osteoclasts by protruding protrusions with irregular star shape. There is a rigid connective tissue periosteum on the surface of the bones, and nerve and blood vessels are distributed to protect and nourish the bones. If the periosteum is deficient, it becomes difficult to survive, start, regenerate, and the like of the bone. Bone content is 20% moisture, 35% organic and 35% inorganic, because the bone has a constant elasticity of organic matter. As age increases, minerals (mainly calcium phosphate) increase and bone hardness increases.

The term "cartilage tissue" of the present invention is a flexible connective tissue found in various parts of the human and animal body, including joints between bones, ribs, ears, nose, bronchi and intervertebral discs. Unlike bones, they are not rigid and rigid, but are stiffer and less flexible than muscles. Cartilage is a chondroblast that produces a large amount of extracellular matrix composed of collagen fibers, a ground substance rich in proteoglycan, and elastin fibers. Called discrete cells. The cartilage is divided into three types according to the relative content of the three main components: elastic cartilage, hyaline cartilage, and fibrocartilage. Chondroblasts trapped in the matrix are called chondrocytes, and they are located in a space called bovine. One space can accommodate up to 8 cartilage cells. Unlike other connective tissues, cartilage does not contain blood vessels, and cartilage cells are provided by diffusion by pumping action, which is produced by compression of articular cartilage or bending of elastic cartilage. Therefore, cartilage growth and recovery are very slow compared to other connective tissues.

The term "regeneration" of the present invention generally refers to an action in which, when an organism loses a part of its body or its function, the tissue or organ of the part is regenerated and restored or restored to its original state. This regeneration ability is stronger as the system is simple and systematic and the degree of evolution is low.

Preferably, the cell transporter comprises undifferentiated stem cells, or comprises bone or cartilage cells. The cell carrier according to the present invention comprises a core portion comprising collagen and cells, and a shell portion comprising alginate, which are clearly distinct. The alginate shell may contain pores to supply oxygen and nutrients necessary for survival present in the core, and may induce differentiation by transferring signal transduction materials, growth factors, and / or cytokines necessary for differentiation. Due to these structural features, the cells of the core part move to the boundary part between the alginate and the supply of oxygen and nutrients, forming a network along the axis of the fibrous structure.

The bone or cartilage cells encapsulated in the cell transporter may be prepared using bone or cartilage cells according to the cell transduction method described above, or a cell transporter prepared using undifferentiated stem cells in a bone or cartilage differentiation medium at 2 to 15 Lt; / RTI > for one day. The bone or cartilage cells may be somatic cells such as autologous bone cells or cartilage cells, or obtained by differentiation of stem cells. The undifferentiated stem cell may be an adult stem cell, an embryonic stem cell, an induced pluripotent stem cell, or the like, but it can be used without limitation regardless of the method of derivation or acquisition if it is a cell differentiable into various tissue cells.

As the bone differentiation medium, it is preferable to add ascorbic acid,? -Glycerophosphate and dexamethasone to a conventional cell culture medium, and as a cartilage differentiation medium, TGF-beta is added to a normal cell culture medium . The cell culture medium includes all of the media used in the art, and the medium and culture conditions can be selected depending on the type of the cells. The medium used for the culture is preferably a cell culture minimum medium (CCMM), generally comprising a carbon source, a nitrogen source and a trace element component. Non-limiting examples of such cell culture medium include DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), BME (Basal Medium Eagle), RPMI1640, F-10, F- , Glasgows Minimal Essential Medium (GMEM), and Iscove's Modified Dulbecco's Medium (IMDM). In addition, the medium may be supplemented with antibiotics such as penicillin, streptomycin or gentamicin, or serum additives such as fetal bovine serum (FBS) and human serum albumin As shown in FIG.

The composition for regenerating bone tissue or cartilage tissue according to the present invention may further comprise a pharmaceutically acceptable carrier. The term " pharmaceutically acceptable "as used herein refers to a substance which is not toxic to cells or humans exposed to the composition. The carrier can be used without limitation as long as it is known in the art such as a buffer, a preservative, an anhydrous agent, a solubilizer, an isotonic agent, a stabilizer, a base, an excipient, a lubricant and a preservative. The regenerating composition of the present invention can be administered through any route as long as it can induce migration to a disease site. Preferably, it is molded into a shape suitable for a tissue damage site and directly implanted, but is not limited thereto. The composition of the present invention is suitable for such a dosage form since it is a kind of hydrogel and easy to be molded. For example, it can be molded and implanted in a form suitable for the type of tissue damage, thereby effectively promoting tissue regeneration. In addition, as a stabilizer for preventing deterioration, microorganisms such as ascorbic acid, sodium hydrogen sulfite, BHA, tocopherol, EDTA and the like, emulsifiers, buffering agents for controlling pH, mercury nitrate, thimerosal, benzalkonium chloride, phenol, And a carrier such as a preservative for inhibiting growth.

The term "transplantation" generally refers to the process of transferring the donor's cells, tissues or organs to the recipient's damaged tissue or organ. Depending on the donor type, autografts transplanting their own cells or tissues elsewhere may be transplanted with allografts (eg, from human to human), cells, tissues, organs from the same donor as the recipient Organs (e.g., animal organs to humans) that are transplanted with xenografts. The subject of transplantation includes, without limitation, any cell, tissue or organ of the donor, as well as any material that can aid the regeneration of the injured tissue of the recipient. The transplantation can be performed by a method known in the art, and is not limited to the embodiment of the present invention. Generally, when a cell is transplanted, it can be implanted in a solid support, such as a scaffold, and implanted using an injection. However, the composition of the present invention is easy to mold without requiring a separate support as a form of a semi-solid hydrogel, and can be transplanted to a damaged tissue having a small or complex shape. On the other hand, when the preparation is injected into the cell itself or in the form of beads, it is diluted and floated in the injection solution and thus it is difficult to fix it at a desired position. However, since the composition of the present invention is made into a continuous semi-solid hydrogel fiber, It can be transplanted to a desired site without need, so that the introduced cells can be rapidly transplanted. Meanwhile, collagen and alginate, which are components of the core and the shell of the composition according to the present invention, are both biocompatible and biodegradable, so that they do not exhibit side effects or toxicity even when transplanted into the body, Helps the cells to engage.

The core-shell fibrous cell carrier, in which the core and shell of the present invention are clearly distinguished, can optimize the alginate content of the shell to smoothly supply oxygen and nutrients to the cells located in the core, It is possible to form a network at the boundary portion of the interface. The cell transporter is easy to be formed into a hydrogel form, and can be directly implanted in a small or complex tissue damage area.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a schematic view showing a device for manufacturing a collagen core and an alginate shell hydrogel carrier in which stem cells are captured and a device, a process for producing the same, and (c) a core-shell fibrous hydrogel carrier. Each of the MSC-collagen (2) and alginate (3) solutions was injected at a constant rate from the syringe using a core-shell needle (4, 5) designed for the present invention. (6) to allow the alginate to cure through cross-linking of calcium ions and sodium-alginate. The MSCs loaded into the collagen internal core were captured in the cured alginate. Direct-deposited cell-construction was incubated at 37 [deg.] C to allow the collagen to gel. Followed by incubation for cell culture for bone engineering. (b) shows a depot core-shell hydrogel carrier while preserving a continuous fibrous structure. (c) is a core-shell fibrous hydrogel carrier prepared in the form of the letter 'DKU'. As shown in Fig. 1C, the core-shell fibrous hydrogel carrier according to the present invention can be easily molded into any desired form suitable for the tissue-defect form.
Figure 2 shows the effect of alginate concentrations (a to e) and injection rates (f to j) on core and shell thickness. (a) and (b) show the thicknesses of shell and core measured for alginate concentration changes, respectively. shell fibrous morphology produced using different alginate concentrations (c; 2%, d; 3% and e; 5% (f) and (g) are graphs showing the thicknesses of the shell and the core measured for injection rate changes, respectively. shell fibrous morphology produced with different injection rates (h: 20 ml / h, i: 50 ml / h and j: 80 ml / h) Scale bar = 250 μm.
Figure 3 shows the mechanical properties of a core-shell structured fibrous hydrogel cell carrier made with various alginate concentrations (2%, 3% and 5%). (A) storage elastic modulus and (b) loss modulus were recorded by dynamic mechanical analysis at varying frequencies (from 0.1 Hz to 10 Hz). The storage modulus increased visibly with increasing alginate concentration, but no significant change in loss modulus was observed.
FIG. 4 is a graph showing (a) MSC proliferation, (b) cell viability and (c) core thickness change with time in the core-shell hydrogel carrier until day 21. The results were compared to those measured for MSCs cultured in pure collagen hydrogel, used as a positive control. Cell proliferation, which showed similar values on day 7, began to differ as the incubation period increased (14 days and 21 days) (core-shell <collagen, * p <0.05, statistically different). (b) showed a live / dead cell ratio determined for both of the above two groups by triplet blue screening and hematocyte counts, both of which were similar (approximately 70% survival at all time points). (c) shows the collagen core shrinkage measured by day 21. The core size was significantly reduced from about 1050 μm (initial) to 900 μm at 7 days, 500 μm at 14 days, and 350 μm at 21 days.
Figure 5 is an optical microscope image of a collagen gel comprising core-shell hydrogel carriers and (b, d, f and h) MSCs capturing MSCs at different incubation times (a, c, e and g) to be. The MSCs (a and b) with the initial round shape at the time of dispensing were highly elongated (e and f) after 14 days of spindle shaping (c and d) and 7 days. On day 21, cells proliferated to near confluence (g and h). In the core-shell carrier, the collagen core portion contracted considerably with increasing incubation time. Scale bar = 350 μm.
Figure 6 shows a confocal laser scanning microscope image showing the cytoskeletal process and kidney morphology in the core-shell fibrous carrier after a fixed period of incubation (7 days; a and b, 14 days; c and d, and 21 days; e and f) Fig. The cell nucleus was stained with blue color (DAPI) and the cytoskeleton was stained with red color (Alexa Fluor Phalloidin 548). Scale bars = 850 μm (a, c and e) and 350 μm (b, d and f).
Figure 7 shows osteogenic differentiation of MSCs cultured over 14 and 21 days in a core-shell fibrous hydrogel carrier. (a) BSP, (b) OPN and (c) OCN gene were quantitatively confirmed. * Indicates a significant difference (p <0.05, by ANOVA).
8 is a graph showing the in vivo bone performance of a core-shell hydrogel carrier capturing MSCs. The experimental group used includes a carrier ('w / o cell'), a non-osteogenic carrier containing undifferentiated MSCs, and a carrier ('osteogenic') containing MSCs differentiated for 7 days in osteogenic medium . After 6 weeks of transplantation, bone regeneration was analyzed by CT; (a) is a? CT structural image showing new bone formation (orange) around a 5 mm-diameter defect. (b) to (d) are quantitative analysis results showing the percentage of new bone volume, bone surface area and bone surface density, respectively. Significant differences were observed (* p <0.05, by ANOVA).
Figure 9 shows a histological image of a sample after 6 weeks of transplantation after hematoxylin and eosin (H &amp; E) and Masson's trichrome staining; A carrier comprising (a) a carrier, (b) a carrier comprising undifferentiated MSC, and (c) a differentiated MSC. (d) is an enlarged image of the newly formed bone in (c). Arrow: Defected edge, NB: New bone, HB: Host bone. Scale bars = 1 mm (a to c) and 200 μm (d).

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are for further illustrating the present invention, and the scope of the present invention is not limited to these examples.

Unless otherwise specified in the following examples, the experiment was carried out three times. Data were expressed as mean ± one standard deviation. Statistical analysis was performed by one way analysis of variance (ANOVA) with Fisher post-hoc test, and p <0.05 was judged as significant level.

Example  1: core-shell Fibrous  Preparation and Characterization of Cell Carrier

(1) Core-Shell Fibrous  Preparation of cell carriers

In the present invention, a dual concentric nozzle (inner 23G and outer 17G) was specifically designed and used in the fabrication of a fibrous network of core-shell structure of collagen-alginate. Here, sodium alginate (A2158, Sigma-Aldrich) used had an M / G ratio of 1.67 and a molecular weight of about 50 kDa. A sodium alginate solution was injected into the double concentric nozzle at a ratio of 2 wt% to 5 wt% to the outer syringe while the collagen solution was loaded to the inner syringe, and a schematic view thereof is shown in Fig.

Specifically, a 1 ml collagen containing 100 μl of 10 × DMEM (Dulbecco's modified eagle medium) was mixed with an appropriate amount of 1 N NaOH to prepare a solution of collagen (rat tail type 1 collagen: First Link (UK) 2.05 mg / ml) The solution conditions were adjusted to provide a neutral pH to provide a non-toxic environment for subsequent gelation and loaded cells. Each syringe was attached to an injection pump (KD Scientific) through a microtubule and the injection rate was varied between 20 and 80 ml / h. The core-shell structure collagen-alginate fibers were injected through a concentric nozzle into a water bath containing 50 mM calcium chloride (CaCl ₂ ) for 5 minutes. The entire injection procedure was carried out under sterile conditions. After injection, the outer alginate was cross-linked and gelled to contact the calcium ions to maintain the stability of the fibrous cell carrier.

Using the apparatus shown in FIG. 1A, a core-shell structured hydrogel cell carrier is prepared and optically visualized by core-shell fibrous injection through a concentric nozzle and collection of fibrous scaffolds, as shown in FIG. Successive fabrication of continuous fibers preserving the core-shell structure in which the alginate contained collagen-MSC was successfully prepared. In addition, the fibrous hydrogel of the present invention can be easily molded into any form; For example, the letter 'DKU' is formed using a prefabricated mold (FIG. 1c), indicating that the core-shell fibrous device can be made adjustable in tissue-defect 3D geometry.

(2) The prepared core-shell Fibrous  Characterization of Cell Carrier

(2) -1 Analysis of storage elastic modulus and loss elastic modulus

After the deposition of the core-shell fibrous cell carrier prepared in the above step (1), the thicknesses of the core and the shell were measured from ten arbitrarily selected images measured by an optical microscope. Fibrous hydrogel samples prepared by adjusting the injection rates (20, 50 and 80 ml / h) or alginate concentrations (2%, 3% and 5%) were used for the measurements. The mechanical properties of the fibrous hydrogel were measured using a parallel plate configuration with Dynamic Mechanical Analysis (DMA; MetraVib, DMA25N). For this purpose, the deposited fibers were laminated in a constant volume (0.5 ml fiber formulation) to a cylindrical teflon mold (12 mm diameter x 6 mm height). Mechanical tests were performed at 37 ° C using a dynamic frequency sweep at a frequency ranging from 0.1 to 10 Hz and a 5% strain amplitude in a viscoelasticity linear region. At this time, auto-compression and auto-strain adjustment were applied. The force was increased from 0.001 to 0.2 N and the maximum value allowing deformation was set at 10%. The storage modulus (E ') and the loss modulus (E' ') of the sample were measured. The phase angle delta (tan delta) was calculated as E '' / E '(n = 3).

Adjusting the thickness of the core and shell portions may have a significant effect on nutrient / oxygen permeability and survival of the captured cells, which could be achieved by varying the concentration of alginate and the rate of infusion. Figure 2 shows the effect of these variables on the shell and core thickness values. The thickness of the shell increased with increasing alginate concentration (from 200 [mu] m for 2% alginate to 450 [mu] m for 5% alginate; The core thickness decreased at the highest alginate concentration (Figure 2b). Core-shell morphology also reflected core and shell thickness changes to alginate concentration (Figures 2c-e). The effect of the injection rate was also clear. Shell thickness did not change (Fig. 2g), while shell thickness increased (from 100 [mu] m to 80 ml / h to 400 [mu] m; Optical images also showed core-shell thickness variations with varying injection rates.

The mechanical properties of the core-shell hydrogel cell vehicle were determined by dynamic mechanical analysis. Samples prepared by varying the alginate concentration were compared. The storage modulus (E ') and the loss modulus (E' ') values recorded at different frequencies are shown in FIG. As the alginate concentration increased, the storage modulus increased from 30 kPa for 2% alginate to 50 kPa for 5% alginate (Fig. 3a), which increased resistance to plastic deformation by increasing the alginate concentration ). &Lt; / RTI &gt; The loss modulus showed very similar values at different alginate concentrations (Fig. 3b), indicating that the viscous behavior of the scaffold was not affected by the alginate concentration.

That is, the storage modulus did not show a dependence on the frequency parameter, while the loss modulus showed almost a predominant increase with increasing frequency. The recorded storage modulus values were also higher than the loss modulus in all cases.

(2) -2 mass measurement

The water-uptake capacity of the fibrous hydrogel cell carrier was determined. After each sample was immersed in distilled water for 1 hour, the sample was taken out, dropped on a filter paper saturated with distilled water, and the mass (W _im ) was recorded. After washing and freeze drying the samples, the dry mass (W _dry ) was recorded. The water absorption capacity was expressed as a percentage (n = 3), determined by (W _im -W _dry ) / W _dry . Each sample was immersed in phosphate buffered saline (PBS) to test the degradation of the sample (0.3 ml volume of fiber formulation). After dipping for various times up to 21 days, samples were obtained, washed and dried to record the mass (W _deg ) after the decomposition experiments. The decomposition rate was calculated as (W _dry- W _deg ) / W _dry percentage.

The degradation of the core-shell hydrogel cell vehicle was measured in PBS over 21 days. Mass loss was measured using a cell carrier prepared using 3% alginate as a representative experimental group. Which was about 4% at 3 days, about 22% at 7 days and about 43% at 14 days. The cell carrier also showed uptake of up to 98% water. The water uptake was measured from the difference in mass between the hydrogel and the lyophilized sample, and the results showed typical hydrogel properties.

Example  2: core-shell Fibrous  The inclusion of cells in the cell carrier and Enclosed  Cell viability and Growth rate

(1) Cell culture

Mesenchymal stem cells derived from rat bone marrow were obtained from the femur and tibia of adult rats (180 to 200 g) according to the guidelines approved by the Dankook University Animal Experimental Ethics Committee. The obtained samples were centrifuged, and the supernatant was collected and cultured in a normal culture medium (? -MEM (? -Min essential medium;?) Containing 10% FBS (fetal bovine serum), 100 U / ml penicillin and 100 mg / ml streptomycin -minimal essential medium) and incubated in a humidified incubator containing 5% carbon dioxide at 37 ° C. After one day of culture, the medium was changed and the cells were cultured until confluence reached 80%. Cells were then subcultured with trypsin and maintained at normal culture conditions. Cells from 2 to 3 passages were used for further experiments.

(2) Core-shell Fibrous  Encapsulation of cells in the cell carrier

Sodium alginate powder was sterilized with ethylene oxide to contain the cells and stored under sterile conditions. The powder was mixed with distilled water to prepare a 3% sodium alginate solution. The collagen solution was used as-received under sterile conditions. A collagen hydrogel was prepared according to a known method to incorporate MSC into collagen hydrogel. The color change (change from yellow to orange-pink) of the collagen solution was observed, and 1 × 10 ⁵ cells were sealed after the pH reached a neutral value. The cell-loaded collagen solution was placed in an inner syringe, and the alginate solution was placed in an outer syringe, and the fibrous structure was performed under sterilization conditions according to the above-described method. The amount of collagen present in the core-shell fibrous structure was maintained at 0.3 ml for all cases (n = 3). As a result, a fibrous hydrogel (cell-collagen in the core and alginate in the shell) with the cells encapsulated was obtained. After forming the scaffold for 5 minutes, the cell-enclosed hydrogel was washed three times with the culture medium to remove excess calcium chloride, and cultured in? -EM containing 10% FBS and 1% penicillin / streptomycin for 37 days RTI ID = 0.0 &gt; 5 C &lt; / RTI &gt; carbon dioxide. As a positive control, 0.3 ml collagen hydrogel containing 1 x 10 &lt; ⁵ &gt; MSC was placed in the culture well without the core-shell fibrous structure.

(3) Core-shell Fibrous  Within the cell carrier Enclosed  Cell viability measurement

The number of viable cells in the core-shell fibrous cell carrier or collagen gel used as a positive control was determined. At each culture period, the hydrogel samples containing cells were washed twice with PBS and lysed with 1% collagenase for 5 minutes at 37 ° C. The supernatant was removed by centrifugation of the supernatant and the viable cell count was quantitated by trypan blue screening using a hemocytometer. Cell proliferative potential was measured using a double-stranded DNA detection kit (Quanti-iT Picogreen, Invitrogen). For this purpose, hydrogels containing cells were washed and lysed with 1% collagenase. The cell pellet was recovered and the sample was stored at -20 &lt; 0 &gt; C. The mixture was freeze-thawed in two repeated cycles. The fluorescence intensity was measured at 420 nm excitation and 530 nm emission wavelength and the cells were quantified according to the manufacturer's instructions. A standard curve was obtained according to the manufacturer's instructions and used to convert the fluorescence intensity to DNA content.

FIG. 4 shows the results of investigating the proliferation and viability of MSCs captured in the core-shell hydrogel carrier through the above process. At this time, the results were compared with MSCs cultured in a collagen hydrogel substrate which is a 3D substrate effective for cell growth and proliferation, and the collagen hydrogel substrate was used as a positive control.

As a result, the DNA analysis results showed that MSC proliferated actively in both groups with continuous increase over 21 days (Fig. 4A). However, cell proliferation levels were comparable to those of the two groups for 7 days, but after 14 and 21 days, proliferation in collagen was significantly higher than in the core-shell structure.

In addition, the live / dead cell assay showed that the collagen and core-shell groups were comparable to the cell survival rate of about 70% in the entire culture period (FIG. 4B).

As shown in Fig. 4, the core diameter was changed from the initial 1050 占 퐉 to 900 占 퐉 on the 7th day and 500 占 퐉 on the 14th day, to 21 占 퐉 Day, the result was remarkably reduced to 350 μm.

Example  3: core-shell Fibrous  Analysis of the morphology of cultured cells in a cell carrier

During the incubation, they were monitored under an optical microscope using an Olympus BX-50 microscope. Cells grown on each sample at each culture day (days 7, 14, and 21) were fixed with 4% paraformaldehyde and treated with 0.1% Triton X-100. After washing with PBS, alexafluoro-546-linked paloidine (Invitrogen A22283) diluted in PBS was added to each sample to stain F-Actin. Cells were stained with ProLong Gold antifade reagent containing 4 ', 6-diamidino-2-phenylindole (DAPI, Invitrogen) and bound to DNA in the nucleus, Fluorescence was formed and images were obtained with a confocal laser scanning microscope (CLSM) using a Zeiss LSM 510 microscope and the results are shown in FIGS. 5 and 6. FIG.

FIG. 5 is a representative optical microscope image of MSC obtained while being captured in a core-shell fibrous hydrogel carrier and cultured for up to 21 days. As a control group, cells captured in collagen were used. MSCs were rounded at the beginning immediately after capture (Fig. 5A) and some cytoskeletal extension was observed after 7 days of culture (Fig. 5C). Collagen gels were similarly observed in the control (Figs. 5B and 5D). Cells in the core-shell carrier were highly elongated at day 14 (Figure 5e). Interestingly, the cells exhibited directional elongation along the fiber axis. The cells in the collagen were also highly elongated but elongated in any direction (Fig. 5f). At day 21, cells in the core-shell carrier reached nearly confluence in the collagen core (Fig. 5G), and similar behavior was also observed in the collagen gel (Fig. 5F). In the core-shell system, the collagen core fraction was found to be significantly reduced during prolonged incubation.

As shown in Fig. 6, the cells were immunostained and observed with a confocal microscope to confirm the cytoskeletal process and kidney morphology of the cells. MSCs with limited cytoskeletal expansion on days 7 (Figs. 6A and 6B) showed significant elongation and formed a highly networked structure along the cells at day 14 (Figs. 6C and 6D). The cell network was mainly formed on the outer surface of the core portion, i.e., close to the core / shell boundary. When cell confluence was achieved at the surface area, the cells grew and proliferated to the inner portion of the collagen core portion and at 21 days the cells formed a more dense network oriented highly along the fiber axis through the collagen core (Figs. 6E and 6E) 6f).

Example  4: core-shell Fibrous  Differentiation of cultured cells in a cell carrier

MSCs encapsulated in hydrogel cell carriers induced osteogenic differentiation in osteogenic medium containing 50 [mu] g / ml ascorbic acid, 10 mM [beta] -glycerophosphate and 10 nM dexamethasone. Gene expression associated with osteogenesis, including osteocalcin (OCN), bone allosteric protein (BSP) and osteopontin (OPN), was confirmed based on quantitative PCR (qPCR).

Specifically, after 14 and 21 days of incubation, the cell-enclosed scaffolds were washed and lysed with collagenase. Cell pellets were harvested and frozen at-80 C until use. Total RNA was extracted from the differentiated cells using the RNeasy kit (Qiagen) according to the manufacturer's instructions. The concentration of RNA samples was quantified using a Nanodrop 2000 spectrophotometer (Thermo Scientific). RNA was ligated with any 6-mer and then denatured at 70 ° C for 5 minutes to transfer RNA samples to cDNA. For complete cDNA synthesis, the denatured samples were mixed with the RT pre-mix. Then, the cDNA was amplified by RT-PCR pre-mix (Bioneer) at 94 ° C for 5 minutes, followed by denaturation at 94 ° C for 1 minute, annealing at 57 ° C for 1 minute and extension at 72 ° C for 1 minute. The primers used for amplification were OCN: AGGACCCTCTCTCTGCTCAC (forward; SEQ ID NO: 1), AACGGTGGTGCCATAGATGC (reverse; SEQ ID NO: 2); BSP: CTGCTTTAATCTTGCTCTG (forward; SEQ ID NO: 3), CCATCTCCATTTTCTTCC (reverse; SEQ ID NO: 4); OPN: TCCAGCTGACTTGACTCATGG (forward, SEQ ID NO: 5), CCGATGAATCTGATGAGTCCTT (reverse; SEQ ID NO: 6); (GAPDH): CCATGTTTGTGATGGGTGTG (forward, SEQ ID NO: 7), GGATGCAGGGATGATGTTCT (reverse direction; SEQ ID NO: 8), and the results were normalized to GAPDH.

The osteogenic differentiation of MSCs cultured in the core-shell fibrous carrier was confirmed in terms of bone-related gene expression including BSP, OPN and OCN. Figure 7 shows mRNA expression levels of these genes by quantitative PCR analysis. (Expression levels were normalized to collagen gel on day 14). As a result, as shown in Fig. 7, after 14 days of culture, all the genes were expressed at a significantly higher level in the core-shell carrier than in the collagen gel. The drainage increases were 1.6, 3.0 and 5.5 for BSP, OPN and OCN, respectively. However, the difference decreased on the 21st.

Example  5: core-shell Fibrous  In vivo delivery and differentiation of cell carriers

The histocompatibility and bone morphology of MSCs delivered by hydrogel cell carriers were determined using two open - loop defect models in rats. The housing, management and experimental protocols were approved by the Dankook University Animal Experimental Ethics Committee. Nine 9-week-old, 350-400 g healthy male Sprague-Dawley rats were used. Zoletil 80 mg / kg and xylazine 10 mg / kg were anesthetized by intramuscular injection into the right quadriceps muscle for surgery. All instruments were sterilized before use and all surgical procedures for animals were performed under general anesthesia using the sterile technique. A # 10 blade with a Bard-Parker scalpel was used to expose the cranial bone after midline incision and periosteum excision through the skin . A maximum thickness cylindrical defect of 5 mm diameter was formed at the center of each parietal bone using a trephine burr. Two defects were formed in each animal and defects were randomly extracted into three groups. The defects were filled with 0.1 ml test sample. Group 1 consisted of cell carriers alone. Group 2 contains cell carriers that encapsulate undifferentiated MSCs. Group 3 contains a cell carrier that encapsulates the differentiated MSCs (n = 4). For group 3, MSCs in hydrogel structures were cultured in osteogenic medium for one week. After transplantation, the subcutaneous area was sutured with a 4-0 absorbable suture material, and the skin was then closed with a 4-0 non-absorbable short-fiber suture material. After surgery, the rats were individually housed in cages at 20-24 ° C and 30-70% relative humidity conditions and maintained a crossed 12-hour name / cancer cycle while feeding standard pelleted feed and water ad libitum. Observations were made with the naked eye for one week to monitor signs of infection, inflammation and adverse effects.

After 6 weeks of operation, animals were sacrificed to recover samples and surrounding tissues. Specimens were recovered from each animal by euthanasia and fixed with 10% neutral buffered formalin solution for a minimum of 24 to 48 hours. Samples were imaged using a high resolution micro-computed tomography (μCT) system (Skyscan 1072; Skyscan, Belgium) to confirm tissue recovery and bone regeneration. The recovered samples were scanned and a serial coronally oriented tomogram was reconstructed from a raw image using a NRecon CT reconstruction software. The cylindrical region of interest (ROI) was positioned precisely at the center of each defect to cover all new bone in the defect. The tubularly oriented &lt; RTI ID = 0.0 &gt; μCT &lt; / RTI &gt; image was reformatted in an axial orientation. CTAn (Skyscan) and 3D images were used to form a reconstructed image superimposed on the ROI. The total volume of newly formed bones in each ROI was determined by assigning thresholds for total bone content (including trabecular and cortical bone). The total volume of bone (mm ³ ) was reported by measuring 4 samples for each group.

After scanning the μCT, the specimens were decalcified with RapidCal ™ solution and dehydrated in a series of increasingly increasing concentrations of ethanol (70-100%) and embedded in trimmed paraffin. A histological section of about 5 μm thickness perpendicular to the skull was prepared and the sections were treated with hematoxylin-eosin (HE) and magenta tricolor (Masson &apos; s trichrome (MT)). Optical microscope digital images were acquired using Meta-Morph and analyzed with computerized image analysis system (Molecular Devices).

The histocompatibility and bone morphology of the MSCs captured in the core-shell hydrogel carrier was further confirmed using a rat globular model. Three different groups were tested: core-shell carrier alone, MSC-captured carrier, and MSC-captured carrier for 7 days after osteogenic differentiation.

As a result, animals showed excellent healing responses without adverse tissue reaction and material toxicity during 6 weeks of experiment and no visible signs of internal inflammation were found in recovered tissues. As shown in Fig. 8, bone regeneration was confirmed by μCT. The μCT-constructed image showed new bone formation (orange) in the defect site for the three groups (FIG. 8A). Bone regeneration from the marginal margin was observed at different levels. Percent bone volume, bone surface area, and bone surface density were quantified based on the μCT image. The percentage of bone volume was increased by about 13% in the vehicle treated group alone, while the bone volume was increased by 25% for the MSC-trapped vehicle and 45% for the MSC-captured vehicle (Fig. 8B ). Bone surface area and bone surface density also showed efficacy for osteogenic differentiation of the carrier containing MSC (Figures 8c and 8d).

New bone formation and defect closure were reaffirmed from histological point of view after H & E and MT staining and the results are shown in FIG. As shown in Fig. 9, all three groups showed excellent biocompatibility without noticeable symptoms of inflammatory cells. H & E staining showed cells and / or tissues growing in-growth at the defect site. MT staining clearly showed newly formed bones in the defect area. In the experimental group treated with the carrier alone, loose connective tissue formed in the defect including a limited amount of new bone formation at the edge was observed (Fig. 9A). Conversely, when undifferentiated MSCs were trapped in the vehicle, new bone formation (labeled NB) levels were observed at the center of the defect (Fig. 9b). A significant level of newly formed bone was observed in the central portion of the defect in the experimental group using the carrier containing differentiated MSCs (Fig. 9c). (c) demonstrate that at a higher magnification of the newly formed bone, the new bone has matured into a dense structure and arranged into many osteoblasts (Fig. 9d).

<110> Industry-Academic Cooperation Foundation, Dankook University <120> Core-shell fibrous cell carrier and composition for regeneration          of bone or cartilage comprising the same <130> PA130406 / KR <160> 8 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OCN forward primer <400> 1 aggaccctct ctctgctcac 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OCN reverse primer <400> 2 aacggtggtg ccatagatgc 20 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> BSP forward primer <400> 3 ctgctttaat cttgctctg 19 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> BSP reverse primer <400> 4 ccatctccat tttcttcc 18 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> OPN forward primer <400> 5 tccagctgac ttgactcatg g 21 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> OPN reverse primer <400> 6 ccgatgaatc tgatgagtcc tt 22 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH forward primer <400> 7 ccatgtttgt gatgggtgtg 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH reverse primer <400> 8 ggatgcaggg atgatgttct 20

Claims (12)

A core comprising cells and collagen; And
Shell containing alginate
Lt; RTI ID = 0.0 &gt; fibroblast &lt; / RTI &gt;
The method according to claim 1,
Wherein the core has a diameter of 100 [mu] m to 1500 [mu] m.
The method according to claim 1,
Wherein the shell has a thickness between 100 [mu] m and 250 [mu] m.
The method according to claim 1,
Wherein the core comprises from 0.5 to 5% by weight of collagen in relation to the total weight of the core.
The method according to claim 1,
Wherein the shell comprises 2 to 5% by weight of fused alginate relative to the total weight of the shell.
A step of injecting a core material containing cells and collagen from inner needles through needles of different diameters sharing a center and a shell material containing alginate from outer needles at a constant rate into a bath containing a crosslinking agent The method of producing a core-shell fibrous cell carrier according to any one of claims 1 to 5,
The method according to claim 6,
Wherein the rate is 20 to 80 ml / h.
The method according to claim 6,
The cross- Calcium chloride.
9. The method of claim 8,
Wherein the calcium chloride is at a concentration of 5 mM to 50 mM.
A composition for regenerating bone tissue or cartilage tissue comprising the core-shell fibrous cell carrier according to any one of claims 1 to 5.
11. The method of claim 10,
Wherein the cell transducer comprises undifferentiated stem cells or comprises bone or cartilage cells.
12. The method of claim 11,
The cell carrier comprising the bone or chondrocyte is produced by using bone or chondrocyte cells, or the cell carrier prepared by using undifferentiated stem cells is produced in bone or cartilage differentiation medium for 2 to 15 days. Composition.

Images