KR102415530B1 - Composition for moisturizing skin - Google Patents

Abstract

The present invention relates to a composition for enhancing skin moisturizing, the composition comprising a compound represented by chemical formula 1 as an active ingredient. More specifically, the present invention relates to a composition for enhancing skin moisturizing that comprises an active ingredient capable of promoting the expression of HAS-3 and involucrin, both of which are factors associated with skin moisturizing.

Description

Composition for moisturizing skin

The present invention relates to a composition for enhancing skin moisture. More particularly, it relates to a composition having the effect of enhancing skin moisturizing by promoting the expression of skin moisturizing-related factors, strengthening the skin barrier, preventing or improving skin damage, and preventing or improving skin inflammation.

When the moisture content in the skin is lowered, the thickness of the skin is reduced, wrinkles are increased, elasticity is reduced, etc. skin aging progresses, as well as dry skin and various inflammatory skin diseases can be induced. Until now, many studies have been conducted on moisturizers for skin moisturizing enhancement, but as a form of supplying moisture from the outside, the efficacy is temporary and there is a limit to simple symptom relief, or there are problems with safety and formulation stability for the human body. the current situation. Accordingly, it is necessary to develop a new skin moisturizer that is harmless to the human body and exhibits an excellent effect in enhancing skin moisture.

On the other hand, the epidermis, located in the outermost part of the skin, performs a protective function to prevent excessive leakage of body moisture, and a high concentration of natural moisturizing factor, a water-soluble component, is contained in the cells constituting the stratum corneum of the epidermis. ; NMF) is present and plays a central role in maintaining moisture in the stratum corneum. In other words, in order to exert an excellent skin moisturizing effect, it is necessary to promote the production of natural moisturizing factors to increase the moisture content in the skin, and at the same time to improve and strengthen the skin barrier by improving the epidermal layer of the skin to effectively prevent the release of moisture in the body. It is important.

Hyaluronic acid (HA) is one of the representative natural moisturizing factors, and is known as a natural moisturizer that plays a very important role in maintaining skin moisture due to its strong hydrophilicity. Substances that induce or inhibit the synthesis of hyaluronic acid are effective in moisturizing the skin and preventing aging. In particular, among hyaluronic acid synthase (HAS), HAS-2 and HAS-3 play a decisive role in the synthesis of hyaluronic acid. is known to do Accordingly, recently, research to promote the production of hyaluronic acid through an increase in gene expression of HAS is being actively conducted.

In addition, involucrin is a skin barrier protein that plays an important role in the formation of the stratum corneum, and is cross-linked by a transglutaminase enzyme to form a keratinocyte membrane (Non-Patent Document 1). This not only provides the function of protecting the skin against the external environment, but can also effectively suppress the evaporation of moisture in the keratinocytes.

Nat. Rev. Mol. Cell Biol. 6(4):328-340, 2005

One aspect of the present invention provides a composition for enhancing skin moisturizing, comprising an active ingredient capable of promoting the expression of HAS-3 and Involucrin, which are factors related to skin moisturizing.

In addition, one aspect of the present invention provides a cosmetic composition and a pharmaceutical composition that do not cause skin side effects in the effective amount of use, and have excellent skin moisturizing and skin barrier improvement effects.

For the above purpose, one aspect of the present invention provides a composition for enhancing skin moisture, comprising a compound represented by the following formula (1) as an active ingredient.

[Formula 1]

The active ingredient may promote the expression of factors related to skin moisturizing.

The skin moisturizing factor may include HAS-3 (Hyaluronan synthase-3).

The skin moisturizing factor may include involucrin.

The compound represented by Formula 1 according to an embodiment may be included in an amount of 0.001 to 5% by weight based on the total weight of the composition.

The composition according to one embodiment may be a cosmetic composition for enhancing skin moisture.

The cosmetic composition may be formulated as a softening lotion, astringent lotion, nutritional lotion, eye cream, nourishing cream, massage cream, cleansing cream, cleansing foam, cleansing water, essence or pack.

The composition according to one embodiment may be a pharmaceutical composition for enhancing skin moisture.

The pharmaceutical composition may be formulated as a lotion, ointment, gel, cream, patch or spray.

The pharmaceutical composition for enhancing skin moisturizing is selected from the group consisting of skin wounds, dermatitis, atopic dermatitis, pruritus, eczematous skin disease, dry eczema, erythema, urticaria, psoriasis, weak rash, and acne treatment and It may be for prevention.

The composition according to an aspect of the present invention can effectively promote the expression of factors related to skin moisturizing, and exhibits an excellent skin moisturizing effect.

Specifically, the composition for enhancing skin moisture according to an embodiment has an excellent effect of promoting the expression of HAS-3 and Involucrin, and thus not only exhibits a skin moisturizing effect, but also improves the epidermal layer of the skin, and may exhibit an effect of improving and strengthening the skin barrier. That is, the composition for enhancing skin moisture according to an aspect can exhibit an excellent effect in enhancing skin moisture by simultaneously exhibiting a skin moisturizing effect and a skin barrier improvement effect, thereby maintaining an extremely high skin moisture level for a long period of time. Accordingly, the composition for enhancing skin moisture according to an embodiment is expected to be effective in preventing and treating dry skin and various skin diseases related thereto, as well as implementing effects such as wrinkle improvement and elasticity enhancement.

In addition, the composition for enhancing skin moisture containing the active ingredient according to an aspect of the present invention does not have cytotoxicity and skin side effects, so it can be safely applied as cosmetics and pharmaceutical compositions of various formulations.

1 is a graph quantifying the mRNA expression promoting effect of HAS-3 of Example 1 and Comparative Example 1.
2 is a graph quantifying the mRNA expression promoting effect of Involucrin of Example 1 and Comparative Example 1. FIG.
3 shows the results of confirming the HAS-3 protein expression promoting effect according to the treatment of Example 1 and Comparative Example 1 through cell immunofluorescence.

Hereinafter, the present invention will be described in more detail. If there is no other definition in the technical and scientific terms used at this time, it has the meaning commonly understood by those of ordinary skill in the art to which this invention belongs, and may unnecessarily obscure the subject matter of the present invention in the following description. Descriptions of possible known functions and configurations will be omitted.

In the present specification, the units used without special mention are based on weight, for example, the unit of % or ratio means weight % or weight ratio, and unless otherwise defined, weight % means that any one component of the composition is present in the composition. % by weight in

As used herein, the term "comprises" is an open-ended description having an equivalent meaning to expressions such as "comprises", "contains", "has" or "characterized by", and is an element not listed further; Materials or processes are not excluded.

Hereinafter, the present invention will be specifically described.

The present inventors confirmed that, while repeating research on a new material exhibiting excellent skin moisturizing effect, an amide-based compound having a specific structure can promote the expression of a skin moisturizing factor. Specifically, it was confirmed that the amide-based compound according to the present invention is excellent in promoting HAS-3 and Involucrin expression. Accordingly, the present inventors intend to propose the present invention by revealing a new use that was not previously known and a surprisingly remarkable effect based on such an effect.

One aspect of the present invention provides a composition for enhancing skin moisturizing, comprising a compound represented by the following formula (1) as an active ingredient.

[Formula 1]

The active ingredient according to one embodiment may promote the expression of factors related to skin moisturizing.

The skin moisturizing factor according to an embodiment may be a hyaluronic acid synthase including HAS-1 (Hyaluronan synthase 1), HAS-2 (Hyaluronan synthase 2) and HAS-3 (Hyaluronan synthase 3), specifically, HAS It can be -3.

The skin moisturizing factor according to an embodiment may be a skin barrier protein including involucrin, filaggrin, and loricrin, and specifically may be Involucrin.

The composition according to one embodiment may be a composition for promoting skin moisturizing to exhibit a skin moisturizing effect by promoting the expression of HAS-3. In addition, the composition for enhancing skin moisture according to an embodiment may promote the expression of Involucrin, improve the epidermal layer of the skin, and exhibit the effect of improving and strengthening the skin barrier. That is, the composition for enhancing skin moisture according to an aspect can exhibit an excellent effect in enhancing skin moisture by simultaneously exhibiting a skin moisturizing effect and a skin barrier improvement effect, thereby maintaining an extremely high skin moisture level for a long period of time. It has a desirable use.

That is, the composition for enhancing skin moisturizing according to an aspect has excellent skin moisturizing enhancement effect, so it can implement effects such as wrinkle improvement and elasticity enhancement, as well as prevention and treatment of dry skin and various skin diseases related thereto. It is expected that there will be The dry skin and skin diseases refer to all symptoms that occur due to dry skin due to insufficient moisture in the skin. As long as the dry skin is a symptom caused by dry skin due to insufficient moisture in the skin, the specific type or severity of the symptom is not particularly limited, but examples include atopic dermatitis, dry eczema, psoriasis, dry skin pigmentation. It may be any one or more selected from the group consisting of symptoms and the like.

The composition according to an embodiment does not cause irritation or safety problems in the range including an effective amount of the compound represented by Formula 1 above. Here, the effective amount is not limited as long as it is in the range of the amount of the compound used to exhibit skin moisturizing and skin barrier improvement effects.

For example, the compound represented by Formula 1 may be included in an amount of 0.001 to 5% by weight, specifically 0.001 to 3% by weight, and more specifically, 0.001 to 1% by weight based on the total weight of the composition. When the active ingredient of Formula 1 is included in the above-described range, the skin moisturizing enhancement effect and the skin barrier improvement effect can be further improved without compromising the stability of the formulation.

In addition, the composition for skin moisturizing enhancement comprising the compound represented by Formula 1 according to an aspect of the present invention as an active ingredient has excellent skin safety and is physically and chemically very stable, so it is easy to develop a formulation. It may be formulated as a cosmetic composition, a pharmaceutical composition, and the like.

The composition for enhancing skin moisture according to an embodiment may be a cosmetic composition.

Of course, the cosmetic composition according to an embodiment may include water in the above-mentioned active ingredient and the remaining amount, and may be formulated in various aspects.

The cosmetic composition according to an embodiment may be formulated into a general emulsified formulation and a solubilized formulation using a conventionally known manufacturing method. For example, the cosmetic composition may be formulated in a formulation selected from softening lotion, astringent lotion, nutrient lotion, eye cream, nourishing cream, massage cream, cleansing cream, cleansing foam, cleansing water, essence, pack, etc. It is not limited.

In addition, the cosmetic composition may further include additional additives appropriately according to the purpose, and is selected from the ingredients for wrinkle improvement, antioxidants, whitening ingredients, etc. known in the art together with the amide-based compound of Formula 1 It may further include an ingredient. For example, it may be selected from retinoic acid, TGF, animal placental-derived protein, betulinic acid, and chlorella extract, but is not limited thereto.

In addition, the cosmetic composition includes a stabilizer, an emulsifier, a thickener, a moisturizer, a liquid crystal film strengthening agent, a pH adjuster, an antibacterial agent, a water-soluble polymer, a film agent, a metal ion sequestrant, an amino acid, an organic amine, a polymer emulsion, a pH adjuster, a skin nutrient, an oxidation agent one or more aqueous additives selected from antioxidants, antioxidants, preservatives, fragrances, and the like; and one or more oil additives selected from oils and fats, waxes, hydrocarbon oil, higher fatty acid oil, higher alcohol, synthetic ester oil, and silicone oil; may further include one or more additives selected from the group consisting of.

In this case, each of the additives may be included in an amount of 0.001 to 20% by weight based on the total weight of the cosmetic composition, and specifically, it may be included in an amount of 0.01 to 10% by weight, or 0.05 to 5% by weight, but is not limited thereto.

In addition, the composition according to an embodiment of the present invention may be a pharmaceutical composition for enhancing skin moisture.

The pharmaceutical composition for enhancing skin moisture according to one embodiment is, for example, from the group consisting of skin wounds, dermatitis, atopic dermatitis, pruritus, eczema skin disease, dry eczema, erythema, urticaria, psoriasis, weak rash, and acne It may be for the treatment and prevention of any one or more selected skin diseases, but is not limited thereto.

The pharmaceutical composition according to one embodiment may be formulated as an anti-inflammatory pharmaceutical composition including a pharmaceutically acceptable carrier using a conventionally known manufacturing method. For example, the pharmaceutical composition may be formulated in a formulation selected from the group consisting of lotions, ointments, gels, creams, patches, sprays, and the like, but is not limited thereto.

In addition, the pharmaceutical composition may contain additional pharmaceutically acceptable carriers as appropriate. For example, lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose , methyl hydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil, but is not limited thereto. In addition to the carrier, it may further include a carrier such as a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent or a preservative.

In this case, each of the carriers may be included in an amount of 0.001 to 20% by weight based on the total weight of the composition, specifically 0.01 to 10% by weight, and 0.05 to 10% by weight, but is not limited thereto.

In addition, one aspect of the present invention provides a method for enhancing skin moisture. Specifically, it may be carried out by transdermally administering an effective amount of a composition comprising the compound represented by the following Chemical Formula 1 as an active ingredient to a subject in need of skin moisturizing.

[Formula 1]

Hereinafter, the present invention will be described in more detail based on Examples and Comparative Examples. However, the following examples and comparative examples are merely examples for explaining the present invention in more detail, and the present invention is not limited by the following examples and comparative examples.

[Production Example 1] Preparation of S8-099

Dissolve 2-(2-aminoethoxy)ethanol (35.55 g, 338.13 mmol, TCI) and sodium carbonate (Na ₂ CO ₃ , 16.29 g, 153.69 mmol, Samchunsoonyak) in 140mL of purified water and ethyl acetate (EA, 425mL, Samjeonsunyak) ) was added to prepare a reaction solution. After lowering the reaction temperature to 0 °C, Octanoyl Chloride (50.00 g, 307.39 mmol, TCI) was slowly added to the reaction solution for 10 minutes, and stirred at room temperature for 3 hours. After stirring, the reaction solution was allowed to stand to separate the layers, and the organic layers were collected, dehydrated with sodium sulfate (Na ₂ SO ₄ ), filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography to obtain a white solid compound (58.31 g, yield: 82%). The obtained solid was analyzed by MS (Agilent, USA) and NMR (Varian, USA). The analysis results are as follows.

¹ H NMR (600 MHz, CDCl ₃ ): 6.01 (brs, 1H), 3.77 - 3.74 (m, 2H), 3.59 - 3.56 (m, 4H), 3.49 - 3.46 (m, 2H), 2.37 (t, J) = 5.4 Hz, 1H), 2.18 (t, J = 7.2 Hz, 2H), 1.64 - 1.60 (m, 2H), 1.30 - 1.27 (m, 8H), 0.88 (t, J = 7.2 Hz, 3H).

MS (ESI pos, ion) m/z: 232 (MH+). Calc'd exact mass for C ₁₂ H ₂₅ NO ₃ : 231.34

[Example 1]

The compound prepared in Preparation Example 1 was dissolved in dimethyl sulfoxide (DMSO) at 1 wt% to prepare the composition for enhancing skin moisture in Example 1.

[Comparative Example 1]

A composition of Comparative Example 1 was prepared in the same manner as in Example 1, except that Comparative Compound 1 (ferulic acid) was used instead of the compound of Preparation Example 1.

Comparative compound 1:

<Experimental Example> Measurement of skin moisturizing enhancement effect

In order to confirm the skin moisturizing enhancement effect of Examples and Comparative Examples of the present invention, the activity of skin moisturizing factors (HAS-3 and Involucrin) according to the treatment of the compositions of Examples and Comparative Examples on Human Epidermal Keratinocytes (GIBCO) was confirmed.

Evaluation 1. qPCR method

Specifically, 1Х10 ⁵ cells/dish of human keratinocytes were prepared in a 6-well plate and cultured at 37° C. and 5% CO ₂ conditions for 24 hours. Then, each of the compositions of Example 1 and Comparative Example 1 at a concentration of 50 μM was treated and further cultured for 24 hours to prepare the experimental group models of Example 1 and Comparative Example 1. Each of the obtained cells was transferred to a 1.5 mL microfuge tube, 0.2 mL of chloroform was added, left at room temperature for 5 minutes, and centrifugation was performed at 14,000 rpm for 15 minutes. After centrifugation, the supernatant of the cell-destroyed mixture was transferred to a new 1.5 mL microfuge tube, and inverted by adding 0.4 mL of isopropyl alcohol. After standing at room temperature (25° C.) for 15 minutes, centrifugation was applied at 14,000 rpm for 15 minutes to precipitate RNA. After removing isopropyl alcohol from the tube, 1 mL of 75% ethanol was added to invert, and centrifugation was performed at 10,000 rpm for 5 minutes. Then, purified RNA was obtained by removing ethanol, and when RNA was completely dried, DEPC-DW was added to obtain RNA.

The mRNA expression levels of HAS-3 and Involucrin were measured by qPCR using each specific primer as shown in Table 1 below, and the results are shown in FIGS. 1 and 2 .

direction base sequence HAS-3 forward CTCTACTCCCTCCTCTATATGTC reverse AACTGCCACCCAGATGGA Involucrin forward GATGTCCCAGCAACACACAC reverse TGCTCTGGGTTTCTGCTTT

As shown in Figures 1 and 2, it was confirmed that when the composition of Example 1 according to the present invention was treated, the mRNA of HAS-3 and Involucrin, which are skin moisturizing factors, could be significantly increased. In addition, it was confirmed that the HAS-3 and Involucrin expression promotion effect was excellent compared to the composition of Comparative Example 1 containing ferulic acid, a phytochemical known to have a skin moisturizing effect.

Evaluation 2. Cell Immunofluorescence

Cells of each experimental group prepared in Evaluation 1 and Comparative Example 1 were fluorescence-stained by ICC (immunocytochemistry) staining method. Thereafter, a cover slide to which the stained cells were attached was covered with a slide with one drop of mounting solution, and then completely hardened and observed with a microscopic image. In addition, the micrographs were digitized with the image J program and quantitatively analyzed, and the results are shown in FIG. 3 .

As shown in FIG. 3 , when the composition of Example 1 according to the present invention was treated, it was confirmed that the expression level of HAS-3 protein, which is a skin moisturizing factor, was significantly increased when compared to the composition of Comparative Example 1.

As described above, the present invention has been described by specific matters and limited examples, but these are only provided to help a more general understanding of the present invention, and the present invention is not limited to the above examples, and the field to which the present invention belongs Various modifications and variations are possible from these descriptions by those of ordinary skill in the art.

Therefore, the spirit of the present invention should not be limited to the described embodiments, and not only the claims described below, but also all of the claims and all equivalents or equivalent modifications to the claims will be said to belong to the scope of the spirit of the present invention. .

Claims (10)

A cosmetic composition for promoting skin moisturizing, comprising the compound represented by the following formula (1) as an active ingredient for promoting the expression of skin moisturizing factors.
[Formula 1]

delete The method of claim 1,
The skin moisturizing-related factors include HAS-3 (Hyaluronan synthase-3), a cosmetic composition for enhancing skin moisture. The method of claim 1,
The skin moisturizing-related factors include involucrin (Involucrin), a cosmetic composition for promoting skin moisturizing. The method of claim 1,
The compound represented by Formula 1 is included in an amount of 0.001 to 5% by weight based on the total weight of the composition, a cosmetic composition for skin moisturizing enhancement. delete The method of claim 1,
The cosmetic composition is formulated as a softening lotion, astringent lotion, nutritional lotion, eye cream, nourishing cream, massage cream, cleansing cream, cleansing foam, cleansing water, essence or pack, a cosmetic composition for enhancing skin moisture. A pharmaceutical composition for the treatment and prevention of dry skin disease-related diseases, comprising the compound represented by the following formula (1) as an active ingredient that promotes the expression of skin moisturizing factors.
[Formula 1]

9. The method of claim 8,
The pharmaceutical composition is formulated in a lotion, ointment, gel, cream, patch or spray, a pharmaceutical composition for the treatment and prevention of dry skin disease-related diseases. 9. The method of claim 8,
The dry skin disease-related disease is at least one selected from the group consisting of skin wounds, dermatitis, atopic dermatitis, pruritus, eczematous skin disease, dry eczema, erythema, urticaria, psoriasis, weak rash, and acne, treatment of dry skin disease-related diseases and a pharmaceutical composition for prophylaxis.

Images