KR102401557B1 - Development of methanotroph that assimilate glycerol and production of high value-added alcohol using itself - Google Patents

Development of methanotroph that assimilate glycerol and production of high value-added alcohol using itself Download PDF

Info

Publication number
KR102401557B1
KR102401557B1 KR1020200095935A KR20200095935A KR102401557B1 KR 102401557 B1 KR102401557 B1 KR 102401557B1 KR 1020200095935 A KR1020200095935 A KR 1020200095935A KR 20200095935 A KR20200095935 A KR 20200095935A KR 102401557 B1 KR102401557 B1 KR 102401557B1
Authority
KR
South Korea
Prior art keywords
glycerol
methanol
seq
methane
butanediol
Prior art date
Application number
KR1020200095935A
Other languages
Korean (ko)
Other versions
KR20220016391A (en
Inventor
이은열
타이 킨 호아 리
덕 안 뉴엔
이옥경
현승운
Original Assignee
경희대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 경희대학교 산학협력단 filed Critical 경희대학교 산학협력단
Priority to KR1020200095935A priority Critical patent/KR102401557B1/en
Publication of KR20220016391A publication Critical patent/KR20220016391A/en
Application granted granted Critical
Publication of KR102401557B1 publication Critical patent/KR102401557B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/245—Escherichia (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1022—Transferases (2.) transferring aldehyde or ketonic groups (2.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/18—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic polyhydric
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01006—Glycerol dehydrogenase (1.1.1.6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01008—Glycerol-3-phosphate dehydrogenase (NAD+) (1.1.1.8)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01304—Diacetyl reductase, (S)-acetoin forming (1.1.1.304)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y202/00—Transferases transferring aldehyde or ketonic groups (2.2)
    • C12Y202/01—Transketolases and transaldolases (2.2.1)
    • C12Y202/01006—Acetolactate synthase (2.2.1.6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/01029—Glycerone kinase (2.7.1.29), i.e. dihydroxyacetone kinase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/0103—Glycerol kinase (2.7.1.30)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Abstract

본 발명은 메탄자화균 내 글리세롤 대사 경로를 도입하여 탄소원으로 글리세롤을 활용함으로써 가스 알칸으로부터 고부가가치 알코올의 생산 방법에 대한 것으로, 보다 구체적으로 메탄 및 글리세롤 존재 하에서 형질전환된 메탄자화균을 배양하여 2,3-부탄디올을 생산하는 방법이며, 추가적으로 메탄올 탈수소 효소를 결손시켜 화학적 저해제 없이 메탄 (또는 에탄)으로부터 메탄올 (또는 에탄올)을 전환하는 방법으로 향후 산업용 촉매로 활용이 가능하다.The present invention relates to a method for producing high value-added alcohol from a gas alkane by introducing a glycerol metabolic pathway in methanogenic bacteria and utilizing glycerol as a carbon source. It is a method for producing ,3-butanediol, and it is a method of converting methanol (or ethanol) from methane (or ethane) without a chemical inhibitor by additionally lacking methanol dehydrogenase. It can be used as an industrial catalyst in the future.

Description

글리세롤을 동화하는 메탄자화균의 개발 및 이를 이용한 고부가가치 알코올 생산방법 {Development of methanotroph that assimilate glycerol and production of high value-added alcohol using itself}Development of methanotroph that assimilate glycerol and production of high value-added alcohol using itself}

본 발명은 메탄자화균 내 글리세롤 대사 경로를 도입하여 탄소원으로 글리세롤을 활용함으로써 가스 알칸으로부터 고부가가치 알코올의 생산 방법에 대한 것으로, 보다 구체적으로 메탄 및 글리세롤 존재 하에서 형질전환된 메탄자화균을 배양하여 2,3-부탄디올을 생산하는 방법이며, 추가적으로 메탄올 탈수소 효소를 결손시켜 화학적 저해제 없이 메탄 (또는 에탄)으로부터 메탄올 (또는 에탄올)을 전환하는 방법에 관한 것이다. The present invention relates to a method for producing high value-added alcohol from a gas alkane by introducing a glycerol metabolic pathway in methanogenic bacteria and utilizing glycerol as a carbon source. A method for producing ,3-butanediol, and additionally to a method for converting methanol (or ethanol) from methane (or ethane) without a chemical inhibitor by deficient methanol dehydrogenase.

화석 연료의 사용으로 인한 기후 변화는 기존 석유화학 기반의 연료 및 화학 물질 생산 분야를 바이오 생산 기반으로 전환하고 있으며, 지속가능하고 환경친화적인 대체 탄소원에 대한 필요성이 대두되고 있다. 메탄은 가장 강력한 온실 가스 중 하나이며, 천연 가스 및 바이오 가스의 주요 구성 요소로써 높은 가용성으로 잠재적 탄소원으로 주목받고 있다. 메탄자화균 (Methanotroph)은 유일한 탄소 및 에너지원으로 메탄을 이용할 수 있어 메탄 유래 다양한 바이오 연료 및 화학 중간체 생산을 위한 유망한 호스트 역할을 할 수 있는 잠재력을 제공한다. 메탄자화균을 메탄 생물 전환을 위한 바이오 촉매로 사용하려는 많은 시도가 있지만, 이 미생물 군에 대한 제한된 정보는 아직 많은 도전과 한계로 남아 있다. 메탄자화균을 혁신적인 메탄 생물전환 촉매로 활용하기 위해서는 혁신적인 엔지니어링 전략이 필요하다. 메탄자화균은 메탄 산화 및 산화적 인산화 사이의 NAD(P)H 형태의의 환원 등가물의 경쟁으로 인해 환원된 연료 및 화학 물질의 수율이 제한될 수 있다. 메탄자화균의 대사 모델 시뮬레이션는 메탄자화균의 목표 생성물의 낮은 수율에 대한 이유를 메탄 동화 경로의 낮은 효율이 아니라 메탄 모노옥시게나제에 의한 메탄 산화에 사용되는 불균형 환원 당량이라고 제안한다. 이는, 메탄이 가장 환원된 탄소임에도 불구하고, 메탄에서 메탄올로의 산화동안 산소 분할에 대한 전자 요구 사항으로 인해 환원된 물질 생산을 위한 전자의 공급이 제한된다는 것이다. 메탄과 다른 환원 된 기질의 공동 대사는 성장 정체를 극복하고 전자 공급 제한을 줄이는 유망한 접근법을 제공 할 수 있다. 메탄과 환원된 탄소 기질을 공동 대사하여 연료 및 화학 물질을 생산하기 위한 새로운 "플랫폼 변형"은 메탄자화균의 성장률을 증가시킬 뿐 아니라 연료 및 화학 물질의 수율을 향상시킬 수 있을 것으로 기대한다. 환원된 탄소 기질은 경제성을 확보하기 위하여, 저렴하고 풍부해야 한다. 바이오 디젤 생산의 부산물인 글리세롤은 메탄자화균의 공동 탄소 기질로 적합할 수 있다. 더욱이, 미정제 글리세롤은 상당한 수준의 메탄올을 함유하고 있어, 별도의 정제 없이도 메탄자화균에 의해 활용이 가능한 폐탄소 자원이다. 본 발명에서는 글리세롤을 대사할 수 있는 메탄자화균 개발을 위하여 메탄자화균 내 글리세롤 동화 경로를 구축하였으며, 이를 이용하여 메탄과 글리세롤 존재하에서 메탄으로부터 2,3-부탄디올을 생합성함으로써 기존 균주 대비 세포성장 및 2,3-부탄디올 생산성을 향상시키고자 하였다. 또한, 글리세롤 대사 균주를 이용하여 화학적 억제제를 첨가하지 않고 메탄-메탄올 생물 전환을 실시하고자 MDH를 암호화하는 유전자를 일부 결손하고자 하였다. 메탄과 글리세롤 존재하에서 글리세롤은 세포 성장을 유지하는데 사용하며, 메탄 또는 에탄은 메탄올 탈수소 효소 (MDH)를 완전히 제거되어 생상성이 향상될 것으로 기대한다. Climate change due to the use of fossil fuels is converting the existing petrochemical-based fuel and chemical production fields to bio-production-based, and the need for sustainable and environmentally friendly alternative carbon sources is emerging. Methane is one of the most potent greenhouse gases and is attracting attention as a potential carbon source due to its high availability as a major component of natural gas and biogas. Methanotrophs can utilize methane as the sole carbon and energy source, offering the potential to serve as a promising host for the production of a variety of methane-derived biofuels and chemical intermediates. Although many attempts have been made to use methanotrophs as biocatalysts for methane bioconversion, limited information on this microbial population still remains many challenges and limitations. An innovative engineering strategy is required to utilize methanogen as an innovative methane bioconversion catalyst. Methanotrophs may have limited yields of reduced fuels and chemicals due to the competition of reducing equivalents in the form of NAD(P)H between methane oxidation and oxidative phosphorylation. Metabolic model simulations of methanogens suggest that the reason for the low yield of the target product in methanogens is not the low efficiency of the methane assimilation pathway but the disproportionate reducing equivalents used for methane oxidation by methane monooxygenase. This is that although methane is the most reduced carbon, the supply of electrons for reduced material production is limited due to the electron requirement for oxygen splitting during methane to methanol oxidation. Co-metabolism of methane with other reduced substrates may provide a promising approach to overcome growth stagnation and reduce electron supply limitation. A new "platform modification" for producing fuels and chemicals by co-metabolizing methane and reduced carbon substrates is expected to increase the growth rate of methanogens as well as improve the yields of fuels and chemicals. The reduced carbon substrate must be inexpensive and abundant in order to secure economic feasibility. Glycerol, a by-product of biodiesel production, may be suitable as a co-carbon substrate for methanogens. Moreover, since crude glycerol contains a significant level of methanol, it is a waste carbon resource that can be utilized by methanogenic bacteria without separate purification. In the present invention, for the development of methanogenic bacteria capable of metabolizing glycerol, a glycerol assimilation pathway in methanogenic bacteria was constructed, and using this, 2,3-butanediol was biosynthesized from methane in the presence of methane and glycerol, thereby increasing cell growth and It was intended to improve the productivity of 2,3-butanediol. In addition, in order to perform methane-methanol bioconversion without adding a chemical inhibitor using a glycerol metabolizing strain, a part of the gene encoding MDH was deleted. In the presence of methane and glycerol, glycerol is used to maintain cell growth, and methane or ethane is expected to improve productivity by completely removing methanol dehydrogenase (MDH).

2,3-부탄디올은 4개의 탄소 및 2개의 히드록시기(-OH)를 가지는 유기화합물이며, 최근 화장품, 의약품, 보존제 등 다양한 용도로 사용되고 있다. 화학적 합성 이외에 다양한 미생물을 이용한 바이오 합성 과정이 연구중에 있으나, 아직까지 메탄자화균을 이용한 생산 방법은 공지된 바 없으며, 특히 메탄자화균을 통한 합성 시, 합성 효율을 고려한 다양한 연구가 필요한 실정이다. 2,3-butanediol is an organic compound having four carbons and two hydroxyl groups (-OH), and has recently been used for various purposes such as cosmetics, pharmaceuticals, and preservatives. In addition to chemical synthesis, biosynthetic processes using various microorganisms are being studied, but a production method using methanogenic bacteria is not yet known.

KRKR 10-2019-004957510-2019-0049575 AA

본 발명의 목적은, 글리세롤의 분해 또는 이용 경로에 관여하는 대장균 유래의 서열번호 1로 이루어진 글리세롤 트랜스포터(glycerol transporter, glpF), 서열번호 2로 이루어진 글리세롤 인산화효소(glycerol kinase, glpK), 서열번호 3으로 이루어진 FAD 의존적 글리세롤 3-인산 탈수소효소(FAD+-dependent glycerol 3-phosphate dehydrogenase, glpD), 서열번호 4로 이루어진 글리세롤 탈수소효소(Glycerol dehydrogenase, glpA) 및 서열번호 5로 이루어진 디하이드록시아세톤 키나아제(dihydroxyacetone kinase, dhaK)를 코딩하는 유전자가 도입 또는 증폭되어, 글리세롤의 존재 하에서 2,3-부탄디올(2,3-buthandiol) 생산능을 가지는 것을 특징으로 하는 형질 전환된 메탄자화균(Methanotrophic bacteria)을 제공하는 것이다.An object of the present invention, a glycerol transporter (glycerol transporter, glpF) consisting of SEQ ID NO: 1 derived from E. coli involved in the degradation or use pathway of glycerol, glycerol kinase consisting of SEQ ID NO: 2 (glycerol kinase, glpK), SEQ ID NO: FAD-dependent glycerol 3-phosphate dehydrogenase (FAD + -dependent glycerol 3-phosphate dehydrogenase, glpD) consisting of 3, glycerol dehydrogenase (Glycerol dehydrogenase, glpA) consisting of SEQ ID NO: 4 and dihydroxyacetone kinase consisting of SEQ ID NO: 5 (dihydroxyacetone kinase, dhaK) is introduced or amplified gene is introduced, transformed methanotrophic bacteria characterized in that it has the ability to produce 2,3-butanediol (2,3-buthandiol) in the presence of glycerol (Methanotrophic bacteria) is to provide

본 발명의 다른 목적은, 상기 메탄자화균 또는 이의 배양액 및 글리세롤을 포함하는 2,3-부탄디올 생산용 조성물을 제공하는 것이다.Another object of the present invention is to provide a composition for producing 2,3-butanediol comprising the methanogenic bacteria or a culture solution thereof and glycerol.

본 발명의 또 다른 목적은, 상기 메탄자화균을 글리세롤이 포함된 배지에서 배양하여, 전환 반응을 유도하는 2,3-부탄디올의 생산 방법을 제공하는 것이다.Another object of the present invention is to provide a method for producing 2,3-butanediol inducing a conversion reaction by culturing the methanogenic bacteria in a medium containing glycerol.

본 발명의 또 다른 목적은, 상기 메탄자화균에서, 메탄올 탈수소 효소를 불활성화 시킨 것을 특징으로 하는 메탄 또는 에탄을 메탄올 또는 에탄올로 전환하는 메탄자화균을 제공하는 것이다.Another object of the present invention is to provide a methanogenic bacterium that converts methane or ethane into methanol or ethanol, characterized in that the methanol dehydrogenase is inactivated in the methanogenic bacteria.

본 발명의 또 다른 목적은 상기 메탄자화균을 또는 이의 배양액 및 글리세롤을 포함하는 메탄 및 에탄을 메탄올 및 에탄올로 전환하는 메탄올 또는 에탄올 생산용 조성물을 제공하는 것이다.Another object of the present invention is to provide a composition for producing methanol or ethanol for converting methane and ethane containing the methanogenic bacteria or a culture solution thereof and glycerol into methanol and ethanol.

본 발명의 또 다른 목적은 상기 메탄자화균을 글리세롤이 포함된 배지에서 배양하는 단계; Another object of the present invention comprises the steps of culturing the methanogenic bacteria in a medium containing glycerol;

30 내지 70 부피%의 메탄 및 에탄을 더 첨가하여 배양하는 단계; 및Culturing by further adding 30 to 70% by volume of methane and ethane; and

배양된 배양물에서 메탄올 및 에탄올을 수득하는 단계를 포함하는 메탄올 또는 에탄올 생산 방법을 제공하는 것이다.It is to provide a method for producing methanol or ethanol comprising the step of obtaining methanol and ethanol from the cultured culture.

본 발명은, 글리세롤의 분해 또는 이용 경로에 관여하는 대장균 유래의 서열번호 1로 이루어진 글리세롤 트랜스포터(glycerol transporter, glpF), 서열번호 2로 이루어진 글리세롤 인산화효소(glycerol kinase, glpK), 서열번호 3으로 이루어진 FAD 의존적 글리세롤 3-인산 탈수소효소(FAD+-dependent glycerol 3-phosphate dehydrogenase, glpD), 서열번호 4로 이루어진 글리세롤 탈수소효소(Glycerol dehydrogenase, glpA) 및 서열번호 5로 이루어진 디하이드록시아세톤 키나아제(dihydroxyacetone kinase, dhaK)를 코딩하는 유전자가 도입 또는 증폭되어, 글리세롤의 존재 하에서 2,3-부탄디올(2,3-buthandiol) 생산능을 가지는 것을 특징으로 하는 형질 전환된 메탄자화균(Methanotrophic bacteria)을 제공한다.The present invention, a glycerol transporter (glycerol transporter, glpF) consisting of SEQ ID NO: 1 derived from Escherichia coli involved in the degradation or utilization pathway of glycerol, glycerol kinase consisting of SEQ ID NO: 2 (glycerol kinase, glpK), SEQ ID NO: 3 FAD-dependent glycerol 3-phosphate dehydrogenase (FAD + -dependent glycerol 3-phosphate dehydrogenase, glpD) consisting of, glycerol dehydrogenase (Glycerol dehydrogenase, glpA) consisting of SEQ ID NO: 4 and dihydroxyacetone kinase consisting of SEQ ID NO: 5 A gene encoding a kinase, dhaK) is introduced or amplified to provide transformed methanotrophic bacteria, characterized in that it has the ability to produce 2,3-butanediol (2,3-buthandiol) in the presence of glycerol do.

또한 본 발명은, 상기 메탄자화균 또는 이의 배양액 및 글리세롤을 포함하는 2,3-부탄디올 생산용 조성물을 제공한다.In addition, the present invention provides a composition for producing 2,3-butanediol comprising the methanogenic bacteria or a culture solution thereof and glycerol.

또한 본 발명은, 상기 메탄자화균을 글리세롤이 포함된 배지에서 배양하여, 전환 반응을 유도하는 2,3-부탄디올의 생산 방법을 제공한다.The present invention also provides a method for producing 2,3-butanediol inducing a conversion reaction by culturing the methanogen in a medium containing glycerol.

또한 본 발명은, 상기 메탄자화균에서, 메탄올 탈수소 효소를 불활성화 시킨 것을 특징으로 하는 메탄 또는 에탄을 메탄올 또는 에탄올로 전환하는 메탄자화균을 제공한다.The present invention also provides a methanogen converting methane or ethane into methanol or ethanol, characterized in that the methanol dehydrogenase is inactivated in the methanogenic bacteria.

또한 본 발명은 상기 메탄자화균을 또는 이의 배양액 및 글리세롤을 포함하는 메탄 및 에탄을 메탄올 및 에탄올로 전환하는 메탄올 또는 에탄올 생산용 조성물을 제공한다.The present invention also provides a composition for producing methanol or ethanol for converting methane and ethane containing the methanogenic bacteria or a culture solution thereof and glycerol into methanol and ethanol.

또한 본 발명은 상기 메탄자화균을 글리세롤이 포함된 배지에서 배양하는 단계; In addition, the present invention comprises the steps of culturing the methanogenic bacteria in a medium containing glycerol;

30 내지 70 부피%의 메탄 및 에탄을 더 첨가하여 배양하는 단계; 및Culturing by further adding 30 to 70% by volume of methane and ethane; and

배양된 배양물에서 메탄올 및 에탄올을 수득하는 단계를 포함하는 메탄올 또는 에탄올 생산 방법을 제공한다.It provides a method for producing methanol or ethanol comprising the step of obtaining methanol and ethanol from a cultured culture.

본 발명은 메탄자화균 내 글리세롤 대사 경로를 도입하여 탄소원으로 글리세롤을 활용하고, 가스 알칸으로부터 고부가가치 알코올의 생산 방법에 대한 것으로, 보다 구체적으로 메탄 및 글리세롤 존재 하에서 형질전환된 메탄자화균을 배양하여 2,3-부탄디올을 생산하는 방법이며, 추가적으로 메탄올 탈수소 효소를 결손시켜 화학적 저해제 없이 메탄 (또는 에탄)으로부터 메탄올 (또는 에탄올)을 전환하는 방법으로 향후 산업용 촉매로 활용이 가능하다. The present invention relates to a method for producing high value-added alcohol from gas alkane by introducing a glycerol metabolic pathway in methanogenic bacteria, utilizing glycerol as a carbon source, and more specifically, by culturing transformed methanogenic bacteria in the presence of methane and glycerol. This is a method for producing 2,3-butanediol, and additionally, it is a method of converting methanol (or ethanol) from methane (or ethane) without a chemical inhibitor by deficient methanol dehydrogenase. It can be used as an industrial catalyst in the future.

도 1은 메탄자화균 M. alcaliphilum 20Z에 글리세롤 대사경로를 구축하기 위하여 글리세롤 대사 경로를 도입한 것을 나타낸 도이다. Ru5P : 리보로스 5-포스페이트, H6P : 헥사로스 6-포스페이트, F6P : 과당 6-포스페이트, KDPG : 2-케토-3-데옥시 6-포스포글루코네이트, F1,6BP : 과당 1,6- 비스 포스페이트, DHAP : 디하이드록시 아세톤 포스페이트, G3P : 글리세르 알데히드 3- 포스페이트, PEP : 포스포에놀 피루베이트, OAA : 옥살로 아세트산, G3P (글리세롤로부터 전환) : 글리세롤 3-포스페이트, DHA : 디하이드록시 아세톤.
도 2A는 글리세롤-사용 형질전환 메탄자화균 20Z_FKD의 세포 성장 속도 및 글리세롤 소모량을 확인한 결과이다.
도 2B는 글리세롤 농도에 따른 형질전환 메탄자화균 20Z_FKD의 세포 성장 속도를 나타낸 도이다.
도 2C 및 D는 메탄자화균 20Z_FKD을 고농도의 글리세롤에서 배양하기 위하여 환경적응진화 및 글리세롤 농도에 따른 적응 진화 균주의 세포 성장 속도를 나타낸 도이다.
도 3은 형질전환 메탄자화균 20Z_FKD 내 2,3-부탄디올 생합성 경로의 도입을 나타낸 도이다.
도 4는 형질전환 메탄자화균 20Z_FKDG_budABC 균주의 성장 및 2,3-부탄디올 생성에 대한 균질화 및 공동-기질의 효과를 확인한 결과이다(A:　메탄 단독 혹은 글리세롤 병용 시, 형질 전환된 균주의 성장 정도, B: 2,3-부탄디올 생산량 측정 결과).
도 5A는 형질전환 메탄자화균 20Z_FKD 내 메탄올 탈수소 효소 결손을 도식화한 도이다
도 5B는 20Z_M2 균주의 성장 곡선 및 메탄올 축적을 나타낸 도이다.
도 5C는 20Z_M2 균주의 성장 곡선 및 에탄올 축적을 나타낸 도이다.1 is a diagram showing the introduction of a glycerol metabolic pathway in order to construct a glycerol metabolic pathway in M. alcaliphilum 20Z methanogen. Ru5P: Riborose 5-phosphate, H6P: Hexalose 6-phosphate, F6P: Fructose 6-phosphate, KDPG: 2-keto-3-deoxy 6-phosphogluconate, F1,6BP: Fructose 1,6-bis Phosphate, DHAP: dihydroxyacetone phosphate, G3P: glyceraldehyde 3-phosphate, PEP: phosphoenol pyruvate, OAA: oxaloacetic acid, G3P (converted from glycerol): glycerol 3-phosphate, DHA: dihydro Roxyacetone.
2A is a result of confirming the cell growth rate and glycerol consumption of glycerol-using transformed methanogen 20Z_FKD.
2B is a diagram showing the cell growth rate of the transformed methanogen 20Z_FKD according to the glycerol concentration.
2C and D are diagrams illustrating cell growth rates of adaptive evolutionary strains according to environmental adaptation and glycerol concentration in order to culture methanogen 20Z_FKD in a high concentration of glycerol.
3 is a diagram showing the introduction of the 2,3-butanediol biosynthetic pathway in the transformed methanogen 20Z_FKD.
4 is a result confirming the effect of homogenization and co-substrate on the growth and 2,3-butanediol production of the transformed methanogen 20Z_FKDG_budABC strain (A: when methane alone or glycerol is used, the growth degree of the transformed strain, B: 2,3-butanediol production measurement result).
5A is a schematic diagram of a methanol dehydrogenase defect in transformed methanogen 20Z_FKD
Figure 5B is a diagram showing the growth curve and methanol accumulation of the 20Z_M2 strain.
Figure 5C is a diagram showing the growth curve and ethanol accumulation of the 20Z_M2 strain.

본 발명은, 글리세롤의 분해 또는 이용 경로에 관여하는 대장균 유래의 서열번호 1로 이루어진 글리세롤 트랜스포터(glycerol transporter, glpF), 서열번호 2로 이루어진 글리세롤 인산화효소(glycerol kinase, glpK), 서열번호 3으로 이루어진 FAD 의존적 글리세롤 3-인산 탈수소효소(FAD+-dependent glycerol 3-phosphate dehydrogenase, glpD), 서열번호 4로 이루어진 글리세롤 탈수소효소(Glycerol dehydrogenase, glpA) 및 서열번호 5로 이루어진 디하이드록시아세톤 키나아제(dihydroxyacetone kinase, dhaK)를 코딩하는 유전자가 도입 또는 증폭되어, 글리세롤의 존재 하에서 2,3-부탄디올(2,3-buthandiol) 생산능을 가지는 것을 특징으로 하는 형질 전환된 메탄자화균(Methanotrophic bacteria)을 제공한다.The present invention, a glycerol transporter (glycerol transporter, glpF) consisting of SEQ ID NO: 1 derived from Escherichia coli involved in the degradation or utilization pathway of glycerol, glycerol kinase consisting of SEQ ID NO: 2 (glycerol kinase, glpK), SEQ ID NO: 3 FAD-dependent glycerol 3-phosphate dehydrogenase (FAD + -dependent glycerol 3-phosphate dehydrogenase, glpD) consisting of, glycerol dehydrogenase (Glycerol dehydrogenase, glpA) consisting of SEQ ID NO: 4 and dihydroxyacetone kinase consisting of SEQ ID NO: 5 A gene encoding a kinase, dhaK) is introduced or amplified to provide transformed methanotrophic bacteria, characterized in that it has the ability to produce 2,3-butanediol (2,3-buthandiol) in the presence of glycerol do.

상기 본 발명의 메탄자화균(Methanotroph)은 배양 시 메탄(혹은 메탄올)을 탄소원 혹은 영양원으로 사용하는 세균을 말하는 것으로서, 본 발명에 사용된 상기 메탄자화균은 이에 제한되는 것은 아니나, 메틸로모나스 속(Methylomonas), 메틸로마이크로비움 속(Methylomicrobium), 메틸로박터 속(Methylobacter), 메틸로코커스 속(Methylococcus), 메틸로스페라 속(Methylosphaera), 메틸로칼덤 속(Methylocaldum), 메틸로글로버스 속(Methyloglobus), 메틸로사르시나 속(Methylosarcina), 메틸로프로펀더스 속(Methyloprofundus), 메틸로썰머스 속(Methylothermus), 메틸로할로비우스 속(Methylohalobius), 메틸로게아 속(Methylogaea), 메틸로마리넘 속(Methylomarinum), 메틸로벌럼 속(Methylovulum), 메틸로마리노범 속(Methylomarinovum), 메틸로러브럼 속(Methylorubrum), 메틸로파라코커스 속(Methyloparacoccus), 메틸로시너스 속(Methylosinus), 메틸로시스티스 속(Methylocystis), 메틸로셀라 속(Methylocella), 메틸로캡사 속(Methylocapsa), 메틸로퍼룰라 속(Methylofurula), 메틸아시디필럼 속(Methylacidiphilum) 및 메틸아시디마이크로비움 속(Methylacidimicrobium)으로 이루어진 군으로부터 선택되는 1종 이상일 수 있으며, 보다 바람직하게는 메틸로마이크로비움 속(Methylomicrobium)일 수 있다. 본 발명의 실시예에서는 메틸로마아크로비움 알칼리필리움 20Z(Methylomicrobium alcaliphilum 20Z)를 이용하여 실험하였으나, 반드시 이에 제한되는 것은 아니다. Methanotroph of the present invention refers to bacteria that use methane (or methanol) as a carbon source or nutrient source during culture, and the methanotroph used in the present invention is not limited thereto, but the genus Methylomonas (Methylomonas), Methylomicrobium, Methylobacter, Methylococcus, Methylosphaera, Methylocaldum, Methyloglobus Methyloglobus, Methylosarcina, Methyloprofundus, Methylothermus, Methylohalobius, Methylogaea , genus Methylomarinum, genus Methylovulum, genus Methylomarinovum, genus Methylorubrum, genus Methyloparacoccus, genus Methylocinus ( Methylosinus), Methylocystis, Methylocella, Methylocapsa, Methylofurula, Methylacidiphilum and Methylacidiphilum It may be at least one selected from the group consisting of the genus (Methylacidimicrobium), and more preferably, may be the genus Methylomicrobium. In an embodiment of the present invention, an experiment was performed using Methylomicrobium alcaliphilum 20Z, but the present invention is not limited thereto.

본 발명의 상기 메탄자화균주는 대장균 유래의 서열번호 1로 이루어진 글리세롤 트랜스포터(glycerol transporter, glpF), 서열번호 2로 이루어진 글리세롤 인산화효소(glycerol kinase, glpK), 서열번호 3으로 이루어진 FAD 의존적 글리세롤 3-인산 탈수소효소(FAD+-dependent glycerol 3-phosphate dehydrogenase, glpD), 서열번호 4로 이루어진 글리세롤 탈수소효소(Glycerol dehydrogenase, glpA) 및 서열번호 5로 이루어진 디하이드록시아세톤 키나아제(dihydroxyacetone kinase, dhaK)를 코딩하는 유전자를 발현 또는 증폭하도록, 상기 유전자를 형질전환 벡터를 통해 도입시킨 것이다. 도 1에서 구체적으로 설명하고 있듯이, glpF는 외부의 글리세롤을 미생물 내부로 유입시키는 역할을 하며, glpK는 상기 유입된 글리세롤을 글리세롤 3 인산 (G3P) 으로 전환시킨다. 상기 G3P는 glpD에 의하여 dihydroxyacetone phosphate(DHAP)로 산화된다. The methanogenic strain of the present invention is E. coli-derived glycerol transporter (glycerol transporter, glpF) consisting of SEQ ID NO: 1, glycerol kinase (glycerol kinase, glpK) consisting of SEQ ID NO: 2, FAD-dependent glycerol 3 consisting of SEQ ID NO: 3 -Phosphate dehydrogenase (FAD + -dependent glycerol 3-phosphate dehydrogenase, glpD), glycerol dehydrogenase (Glycerol dehydrogenase, glpA) consisting of SEQ ID NO: 4 and dihydroxyacetone kinase (dihydroxyacetone kinase, dhaK) consisting of SEQ ID NO: 5 In order to express or amplify the encoding gene, the gene is introduced through a transformation vector. As described in detail in FIG. 1 , glpF serves to introduce external glycerol into the microorganism, and glpK converts the introduced glycerol into glycerol triphosphate (G3P). The G3P is oxidized to dihydroxyacetone phosphate (DHAP) by glpD.

본 발명의 메탄자화균은 2,3-부탄디올를 생산하는 유전자 및 오페론을 특이적으로 발현하는 발현 벡터로 형질전환된 메탄자화균으로서, 상기 발현 벡터는 서열번호 1 내지 서열번호 11을 포함하는 염기서열로 이루어진 핵산, 그와 기능적으로 동등한 절편을 포함한다.The methanogen of the present invention is a methanogen transformed with an expression vector specifically expressing a gene and operon for producing 2,3-butanediol, wherein the expression vector includes a nucleotide sequence comprising SEQ ID NOs: 1 to 11 It includes a nucleic acid consisting of, and a functionally equivalent fragment thereof.

본 발명의 발현 벡터와 "기능적으로 동등한 절편"은 본 발명의 발현 벡터와 실질적으로 동등한 효과를 나타내는, 서열번호 1로 내지 서열번호 11로 표시되는 염기서열로 이루어진 핵산의 조각 또는 일부분을 의미한다. 이러한 핵산 절편은 서열번호 1에 기재된 염기서열과 비교하여 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% 또는 그 이상의 서열 상동성을 가지며, 이러한 핵산 절편은 당업계에 널리 알려진 분자생물학적 방법에 의하여 용이하게 제작될 수 있다. 또한, 본 발명의 서열번호 1 내지 서열번호 11로 표시되는 유전자 영역은 공개된 시놀린 생합성 경로 유전자의 일부를 포함하는 서열로, 서열번호 1 내지 서열번호 11로 표시되는 염기 서열 중 일부가 치환, 삽입 또는 삭제되더라도 시놀린 생합성 경로의 일부 유전자 영역에 위치한 서열과 상동성이 유지되어 실질적으로 동등한 효과를 나타낸다면 본 발명의 범주에 포함될 수 있다. "Fragment functionally equivalent to the expression vector of the present invention" refers to a fragment or part of a nucleic acid consisting of the nucleotide sequence shown in SEQ ID NO: 1 to SEQ ID NO: 11, which exhibits substantially equivalent effects to the expression vector of the present invention. This nucleic acid fragment is 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, It has 96%, 97%, 98%, 99% or more sequence homology, and such nucleic acid fragments can be easily prepared by molecular biological methods well known in the art. In addition, the gene region represented by SEQ ID NO: 1 to SEQ ID NO: 11 of the present invention is a sequence including a part of the disclosed synoline biosynthetic pathway gene, and a part of the nucleotide sequence represented by SEQ ID NO: 1 to SEQ ID NO: 11 is substituted; Even if it is inserted or deleted, it may be included in the scope of the present invention if homology with a sequence located in some gene region of the synoline biosynthesis pathway is maintained and exhibits substantially equivalent effects.

또한 본 발명의 상기 메탄자화균주는 상기 glpD의 작용을 보완하여 균주의 생장률을 향상시키기 위하여 M. alcaliphilum 20Z 유래의 gpsA(서열번호 11) 유전자를 추가로 포함할 수 있다. gpsA는 보조인자로서 NAD+를 이용하여 G3P를 DHAP로 전환시킨다. 본 발명의 일 실시예에서는 상기 glpF, glpK 및 glpD를 코딩하는 유전자를 발현 또는 증폭하도록 형질전환된 M. alcalphilium 20Z 균주를 20Z_FKD로, gpsA를 추가로 형질전환한 것을 20Z_FKDG라고 각각 명명 하였으며, 상기 20Z_FKDG의 경우, 20Z_FKD에 비하여 균주의 성장률이 높은 것을 확인할 수 있었다. In addition, the methanogenic strain of the present invention may further include a gpsA (SEQ ID NO: 11) gene derived from M. alcaliphilum 20Z in order to improve the growth rate of the strain by supplementing the action of glpD. gpsA converts G3P to DHAP using NAD + as a cofactor. In an embodiment of the present invention, the M. alcalphilium 20Z strain transformed to express or amplify the glpF, glpK and glpD-encoding genes was named 20Z_FKD, and the one transformed with gpsA was named 20Z_FKDG, respectively, and the 20Z_FKDG In the case of , it was confirmed that the growth rate of the strain was higher than that of 20Z_FKD.

본 발명의 일실시예에 따르면, 상기 메탄자화균은 클렙시엘라 뉴모니애(Klebsiella pneumoniae) 유래의 서열번호 6으로 이루어진 아세토락테이트 디카르복실레이즈(acetolactate decarboxylase, budA), 서열번호 7로 이루어진 아세토락테이트 생합성효소 (acetolactate synthase, budB) 및 서열번호 8로 이루어진 아세토인 환원효소 (acetoin reductase, budC)를 코딩하는 유전자가 도입 또는 증폭되도록 추가로 형질전환된 메탄자화균일 수 있다.According to one embodiment of the present invention, the methanogenic bacteria is acetolactate decarboxylase (budA) consisting of SEQ ID NO: 6 derived from Klebsiella pneumoniae, and consisting of SEQ ID NO: 7 It may be a methanogenic bacterium further transformed such that genes encoding acetolactate synthase (budB) and acetoin reductase (budC) consisting of SEQ ID NO: 8 are introduced or amplified.

본 발명의 일 실시예에서 상기 균주는 20Z_FKDG_budABC라고 하였다. 상기 20Z_FKDG_budABC를 글리세롤 존재 하에서 배양하였을 때, 균주의 생장 및 2,3-부탄디올의 농도가 메탄 단독 포함 시에 비하여 매우 높게 증가되었음을 확인하였으며, 이는 상기 20Z_FKDG_budABC가 공동 기질로서 글리세롤과 메탄을 모두 이용하여 높은 수율로 2,3-부탄디올을 생산하는 것을 보여주는 것이다. In an embodiment of the present invention, the strain was called 20Z_FKDG_budABC. When the 20Z_FKDG_budABC was cultured in the presence of glycerol, it was confirmed that the growth of the strain and the concentration of 2,3-butanediol were significantly increased compared to the inclusion of methane alone. It shows the production of 2,3-butanediol in yield.

즉, 본 발명의 메탄자화균은 기본적으로 메탄 또는 메탄올을 영양원으로 활용하는 것이나, 글리세롤을 활용할 수 있는 대사 과정을 도입함으로써, 영양원으로서 글리세롤을 함께 이용하도록 형질전환된 것이다. 또한, 대사 물질 전환에 관여하는 유전자를 추가로 도입하여, 활용 가치가 높은 화합물인 2,3-부탄디올을 생성할 수 있도록 하였다. That is, the methanogenic bacteria of the present invention are basically transformed to use methane or methanol as a nutrient source, or to use glycerol as a nutrient source by introducing a metabolic process that can utilize glycerol. In addition, a gene involved in metabolite conversion was additionally introduced to produce 2,3-butanediol, a compound with high utility value.

본 발명의 일실시예에 따르면, 상기 메탄자화균은 메틸로마이크로비움 속 미생물인 것을 특징으로 하는 메탄자화균일 수 있으며, 바람직하게는 메틸로마이크로비움 알칼리필리움 20Z(Methylomicrobium alcaliphilum 20Z)인 것일 수 있다.According to an embodiment of the present invention, the methanogenic bacteria may be methanogenic bacteria, characterized in that they are microorganisms of the genus Methylomicrobium, and preferably Methylomicrobium alcaliphilum 20Z. have.

상기 메탄자화균의 배양은 통상적으로 알려진 배양 방법에 따라 배양될 수 있으며, 다만 메탄 가스를 주입할 수 있도록 공간을 포함하는 플라스크를 이용할 수 있다. 또한 상기 균주의 배양 결과 생산된 2,3-부탄디올은 통상적인 분리 및 정제 방법에 따라 수득할 수 있다. The culture of the methanogenic bacteria may be cultured according to a commonly known culture method, but a flask including a space for injecting methane gas may be used. In addition, 2,3-butanediol produced as a result of culturing the strain can be obtained according to a conventional separation and purification method.

또한 본 발명은 상기 메탄자화균 또는 이의 배양액 및 글리세롤을 포함하는 2,3-부탄디올 생산용 조성물을 제공한다.In addition, the present invention provides a composition for producing 2,3-butanediol comprising the methanogenic bacteria or a culture solution thereof and glycerol.

본 발명의 일실시예에 따르면, 상기 조성물은 30 내지 70 부피%의 메탄을 추가적으로 포함하는 것 일 수 있다.According to an embodiment of the present invention, the composition may additionally contain 30 to 70% by volume of methane.

또한 본 발명은 상기 메탄자화균을 글리세롤이 포함된 배지에서 배양하여, 전환 반응을 유도하는 2,3-부탄디올의 생산 방법을 제공한다.The present invention also provides a method for producing 2,3-butanediol inducing a conversion reaction by culturing the methanogenic bacteria in a medium containing glycerol.

본 발명의 상기 2,3-부탄디올 생산 방법에 있어, 20Z_FKDG_budABC 균주는 메탄 및 글리세롤이 함께 존재하는 조건에서 배양되었을 때, 가장 좋은 효율로 2,3-부탄디올을 생산하였다. 기질의 첨가량은 이에 제한되는 것은 아니나, 메탄의 경우, 상기 균주가 배양되는 동안 매 24시간마다 1 내지 50% v/v 으로 플라스크에 보충되며, 글리세롤은 배지 내 0.1 내지 1 g/L로 포함되었다. 상기 수치 범위는 본 발명의 균주가 기질을 효율적으로 이용하기 위한 최적의 농도인 것으로 확인되었다.In the method for producing 2,3-butanediol of the present invention, the 20Z_FKDG_budABC strain produced 2,3-butanediol with the best efficiency when cultured in the presence of methane and glycerol. The amount of substrate added is not limited thereto, but in the case of methane, the flask is replenished at 1 to 50% v/v every 24 hours while the strain is incubated, and glycerol is contained in the medium at 0.1 to 1 g/L . The above numerical range was confirmed to be the optimal concentration for the strain of the present invention to efficiently use the substrate.

또한 본 발명은 상기 메탄자화균에서, 메탄올 탈수소 효소를 불활성화 시킨 것을 특징으로 하는 메탄 또는 에탄을 메탄올 또는 에탄올로 전환하는 메탄자화균을 제공한다.The present invention also provides a methanogen converting methane or ethane into methanol or ethanol, characterized in that the methanol dehydrogenase is inactivated in the methanogenic bacteria.

본 발명의 일실시예에 따르면, 상기 메탄자화균은 칼슘 의존적 mxaFI 시스템 및 란타늄 의존성 xoxF 시스템이 녹아웃 된 것일 수 있다.According to an embodiment of the present invention, the methanogenic bacteria may be knockouts of a calcium-dependent mxaFI system and a lanthanum-dependent xoxF system.

또한 본 발명은, 상기의 메탄자화균 또는 이의 배양액 및 글리세롤을 포함하는 메탄 및 에탄을 메탄올 및 에탄올로 전환하는 메탄올 또는 에탄올 생산용 조성물을 제공한다.In addition, the present invention provides a composition for producing methanol or ethanol for converting methane and ethane containing the methanogenic bacteria or a culture solution thereof and glycerol into methanol and ethanol.

본 발명의 일실시예에 따르면, 상기 배양배지는 30 내지 50 부피%의 메탄 또는 에탄을 추가로 첨가하여 수행하는 것일 수 있다.According to an embodiment of the present invention, the culture medium may be performed by additionally adding 30 to 50% by volume of methane or ethane.

또한 본 발명은 상기 메탄자화균을 글리세롤이 포함된 배지에서 배양하는 단계; In addition, the present invention comprises the steps of culturing the methanogenic bacteria in a medium containing glycerol;

30 내지 70 부피%의 메탄 및 에탄을 더 첨가하여 배양하는 단계; 및Culturing by further adding 30 to 70% by volume of methane and ethane; and

배양된 배양물에서 메탄올 및 에탄올을 수득하는 단계를 포함하는 메탄올 또는 에탄올 생산 방법을 제공한다.It provides a method for producing methanol or ethanol comprising the step of obtaining methanol and ethanol from a cultured culture.

이하 본 발명을 실시예에 의하여 더욱 상세하게 설명한다. 이들 실시예는 단지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 범위가 이들 실시예에 국한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다. Hereinafter, the present invention will be described in more detail by way of Examples. These examples are merely for illustrating the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited to these examples.

<실험 방법><Experiment method>

(1) 균주의 준비 및 배양 조건 (1) strain preparation and culture conditions

본 발명에서 사용된 균주 및 플라스미드는 하기 표 1에 나타내었으며, 대장균 (DH5α, Invitrogen)을 플라스미드 구축에 사용 하였다. Luria-Bertani (Hallberg et al.) 배지는 탄소원으로서 포도당을 함유하는 성장 배지로서 상기 대장균 배양에 사용되었다. M. alcaliphilum 20Z의 야생형 및 그의 대사 경로를 변형시킨 형질전환 균주는 스크류 캡으로 밀봉된 500ml 플라스크에, 50ml의 NMS 배지를 이용하여 30℃, 230 rpm에서 진탕 배양 하였다. M. alcaliphilum 20Z의 배양을 위한 탄소 및 에너지원으로서, 메탄올(1 % v/v) 및 글리세롤(0.1, 0.5 및 1.0 v/v)을 사용 하였으며, 가스치환기를 이용하여, 배지 부피의 50%의 메탄을 최종 농도로 공급하였다. 세포 배양물의 광학 밀도는 1 cm 경로 길이를 갖는 1.5 ml 큐벳을 사용하는 베크만 분광 광도계로 측정 하였다. 재조합 플라스미드를 함유하는 M. alcaliphilum 20Z 및 E. coli 균주를 선택하기 위해 각각 최종 농도가 50 ㎍/ml 및 5 ㎍/ml 인 카나마이신 (Km) 및 젠타 마이신 (Gm)을 사용 하였다.The strains and plasmids used in the present invention are shown in Table 1 below, and E. coli (DH5α, Invitrogen) was used to construct the plasmid. Luria-Bertani (Hallberg et al.) medium was used for culturing the E. coli as a growth medium containing glucose as a carbon source. The wild-type M. alcaliphilum 20Z and the transgenic strain modified its metabolic pathway were cultured in a 500 ml flask sealed with a screw cap, using 50 ml of NMS medium, at 30° C. and 230 rpm with shaking. As carbon and energy sources for culturing M. alcaliphilum 20Z, methanol (1% v/v) and glycerol (0.1, 0.5, and 1.0 v/v) were used, and 50% of the medium volume was Methane was fed to the final concentration. The optical density of the cell cultures was measured with a Beckman spectrophotometer using a 1.5 ml cuvette with a 1 cm path length. Kanamycin (Km) and gentamicin (Gm) with final concentrations of 50 μg/ml and 5 μg/ml, respectively, were used to select M. alcaliphilum 20Z and E. coli strains containing recombinant plasmids.

Characteristic (s)Characteristic (s) Relevant featuresRelevant features Strainstrain E. coli DH5α E. coli DH5α Cloning hostCloning host M. alcaliphilum 20ZM. alcaliphilum 20Z Wild type, used as host strainWild type, used as host strain 20Z_FKD20Z_FKD M. alcaliphilum 20Z harboring pAWP89-FKD plasmid M. alcaliphilum 20Z harboring pAWP89-FKD plasmid 20Z_FKDG20Z_FKDG M. alcaliphilum 20Z harboring pAWP89-FKD-gpsA plasmid M. alcaliphilum 20Z harboring pAWP89-FKD- gpsA plasmid 20Z_glpA_dhaK 20Z_ glpA _ dhaK M. alcaliphilum 20Z harboring pAWP89-glpA-dhaK plasmid M. alcaliphilum 20Z harboring pAWP89- glpA - dhaK plasmid 20Z_FKDG_budABC 20Z_FKDG_budABC 20Z_FKDG with budABC integration20Z_FKDG with budABC integration 20Z_M220Z_M2 20Z_FKDG with mxaF and xoxF deletion20Z_FKDG with mxaF and xoxF deletion PlasmidPlasmid pAWP89pAWP89 Expression vector, P tac , Km R Expression vector, P tac , Km R pCM351pCM351 Deletion/integration vector, Gm R Deletion/integration vector, Gm R pAWP89_FKDpAWP89_FKD pAWP89 derivative carrying the glpF, glpK, and glpD genes from E. coli str. K-12 substr. W3110pAWP89 derivative carrying the glpF , glpK , and glpD genes from E. coli str. K-12 substr. W3110 pAWP89_FKDGpAWP89_FKDG pAWP89 derivative carrying the glpF, glpK, and glpD genes from E. coli str. K-12 substr. W3110 and gpsA from genome of M. alcaliphilum 20ZpAWP89 derivative carrying the glpF , glpK , and glpD genes from E. coli str. K-12 substr. W3110 and gpsA from genome of M. alcaliphilum 20Z pAWP89_glpA_dhaK pAWP89_ glpA _ dhaK pAWP89 derivative carrying the glpA and dhaK genes from E. coli W3110pAWP89 derivative carrying the glpA and dhaK genes from E. coli W3110 pBudK.ppBudK.p pAWP89-based backbone carrying Ptac promoter and 2,3 -BDO gene cluster originated from Klebsiella pneumoniae KCTC 224pAWP89-based backbone carrying P tac promoter and 2,3-BDO gene cluster originated from Klebsiella pneumoniae KCTC 224 pCM351_glgA1pCM351_glgA1 Variant of pCM351 GenR containing flanks of glycogen synthase (glgA1)Variant of pCM351 Gen R containing flanks of glycogen synthase ( glgA1 ) pCM351_budABCpCM351_budABC pCM351_glgA1 derivative carrying budABC for integrationpCM351_ glgA1 derivative carrying budABC for integration pCM351_F1F2_xoxF pCM351_F1F2_xoxF Variant of pCM351 GenR containing flanks to knock out xoxF Variant of pCM351 Gen R containing flanks to knock out xoxF pCM351_F1F2_mxaF pCM351_F1F2_mxaF Variant of pCM351 GenR containing flanks to knock out mxaF Variant of pCM351 Gen R containing flanks to knock out mxaF

(2) 박테리아의 형질 전환을 위한 플라스미드의 구축 (2) Construction of plasmids for bacterial transformation

본 발명에서 사용된 모든 플라스미드는 Gibson 어셈블리를 사용하여 제작하였으며 플라스미드 구축을 위해 사용한 프라이머는 하기 표 2에 나타내었다. 대장균 W3110의 게놈 DNA를 사용하여 서열번호 1로 이루어진 glpF, 서열번호 2로 이루어진 glpK, 서열번호 3으로 이루어진 glpD, 서열번호 4로 이루어진 glpA 및 서열번호 5로 이루어진 dhaK를 코딩하는 유전자를 각각 증폭시키고, 주형으로서 M. alcaliphilum 20Z의 게놈 DNA를 사용하여 gpsA(서열번호 11)를 증폭시키고 선형화 된 pAWP89 백본으로 조립 하였다. 게놈 통합에 사용 된 PCM351_F1F2_budABC 플라스미드는 이전의 연구(Nguyen et al. 2018)에 의해 공지된 것이다. PCR 증폭을 위하여 50μl PCR 솔루션을 사용하였으며, 이는 각각의 유전자에 대한 프라이머 0.5μM, DNA 폴리머라제(Fermentas) 1.25U Pfu, MgCl2를 포함하는 1xPfu 버퍼 및 0.2 mM의 데옥시뉴클레오시드 트리포스페이트(dNTP)를 사용하여 제조 하였다. DNA 주형을 95 ℃에서 3분 동안 변성시킨 후, 95℃에서 30초, 55℃ 내지 60℃에서 30초, 그리고 72℃에서 1 내지 3분간, 각각 30사이클에 걸쳐 thermal cycler(FTGene-5D; Techgene, Burlington, USA)를 사용하여 증폭시켰다. 최종 사이클 후, 상기 혼합물을 72 ℃에서 5 분 동안 추가로 인큐베이션 하였다. 모든 재조합 벡터는 클로닝을 위해 Competent DH5α E.coli 균주로 형질전환 시켰다.All plasmids used in the present invention were constructed using Gibson assembly, and the primers used for plasmid construction are shown in Table 2 below. Using the genomic DNA of E. coli W3110, amplify the genes encoding glpF consisting of SEQ ID NO: 1, glpK consisting of SEQ ID NO: 2, glpD consisting of SEQ ID NO: 3, glpA consisting of SEQ ID NO: 4 and dhaK consisting of SEQ ID NO: 5, respectively, and , amplified gpsA (SEQ ID NO: 11) using the genomic DNA of M. alcaliphilum 20Z as a template and assembled into a linearized pAWP89 backbone. The PCM351_F1F2_budABC plasmid used for genome integration was known by a previous study (Nguyen et al. 2018). A 50 μl PCR solution was used for PCR amplification, which contained 0.5 μM of primer for each gene, 1.25UP fu of DNA polymerase (Fermentas), 1xP fu buffer containing MgCl2 and 0.2 mM of deoxynucleoside triphosphate ( dNTP) was used. After denaturing the DNA template at 95°C for 3 minutes, a thermal cycler (FTGene-5D; Techgene) was performed for 30 cycles at 95°C for 30 seconds, 55°C to 60°C for 30 seconds, and at 72°C for 1 to 3 minutes, respectively. , Burlington, USA) was used for amplification. After the final cycle, the mixture was further incubated at 72 °C for 5 min. All recombinant vectors were transformed into Competent DH5α E. coli strains for cloning.

PrimerPrimer SequenceSequence DescriptionDescription pAWP89-glpF ForpAWP89- glpF For TTCACACAGGAAACAGCTATGAGTCAAACATCAACCTTTTCACACAGGAAACAGCTATGAGTCAAACATCAACCTT For amplifying of glpFK operon and ligated into pAWP89For amplifying of glpFK operon and ligated into pAWP89 pAWP89-glpK RevpAWP89- glpK Rev GTGAATACCTTTATTCGTCGTGTTCTTCCCGTGAATACCTTTATTCGTCGTGTTCTTCCC pAWP89-glpD ForpAWP89- glpD For AGGTATTCACACAGGAAACAGCTATGGAAACCAAAGATCTAGGTATTCACACAGGAAACAGCTATGGAAACCAAAGATCT For amplifying of glpD gene and ligated into pAWP89_glpFK For amplifying of glpD gene and ligated into pAWP89_ glpFK pAWP89-glpD RevpAWP89- glpD Rev TTACGACGCCAGCGATAACCTTACGACGCCAGCGATAACC pAWP89-gpsA ForpAWP89- gpsA For GGCGTCGTAAAGGTATTCACACAGGAAACAGCTATGACCTCAACTATCAGGGCGTCGTAAAGGTATTCACACAGGAAACAGCTATGACCTCAACTATCAG For amplifying of gpsA gene and ligated into pAWP89_glpFKD For amplifying of gpsA gene and ligated into pAWP89_ glpFKD pAWP89-gpsA RevpAWP89- gpsA Rev GCATCTTCCCGACAACTACTAGCTTTCGGCTTTTAATTCGCGGCATCTTCCCGACAACTACTAGCTTTCGGCTTTTAATTCGCG pAWP89-glpA ForpAWP89- glpA For TTCACACAGGAAACAGCTATGGACCGCATTATTCAATCACCTTCACACAGGAAACAGCTATGGACCGCATTATTCAATCACC For amplifying of glpA gene and ligated into pAWP89_glpF For amplifying of glpA gene and ligated into pAWP89_ glpF pAWP89-glpA RevpAWP89- glpA Rev TGTGAATACCTTTATTCCCACTCTTGCAGGAAACGTGTGAATACCTTTATTCCCACTCTTGCAGGAAACG pAWP89-dhaK ForpAWP89- dhaK For AGTGGGAATAAAGGTATTCACACAGGAAACAGCTATGAAAAAATTGATCAAAGTGGGAATAAAGGTATTCACACAGGAAACAGCTATGAAAAAATTGATCAA For amplifying of dhaK gene and ligated into pAWP89_glpFA For amplifying of dhaK gene and ligated into pAWP89_ glpFA pAWP89-dhaK RevpAWP89- dhaK Rev GCATCTTCCCGACAACTATTAACCCTGACGGTTGAAACGTTGGCATCTTCCCGACAACTATTAACCCTGACGGTTGAAACGTTG FWD_primer_F1FWD_primer_F1 CACCTGACGTCTAGATCTGGGTGCTGTAGTGAAAACCGACCACCTGACGTCTAGATCTGGGTGCTGTAGTGAAAACCGAC ForMxaF deletionForMxaF deletion REV_primer_F1REV_primer_F1 TGGTACCAATTGTACAGCTGTAGCCCGGCCTACATAAAGAGTGGTACCAATTGTACAGCTGTAGCCCGGCCTACATAAAGAG FWD_primer_F2FWD_primer_F2 CGTGTTAACCGGTGAGCTCCCTCTAATAATCGCGGTGTTTGCGTGTTAACCGGTGAGCTCCCTCTAATAATCGCGGTGTTTG REV_primer_F2REV_primer_F2 CTGGATCCTCTAGTGAGCTGTTTGTCCTTGATCGCCGTACCTGGATCCTCTAGTGAGCTGTTTGTCCTTGATCGCCGTAC FWD_primer_F1FWD_primer_F1 CACCTGACGTCTAGATCTGATACAGCAAGCCTTCGACTGACACCTGACGTCTAGATCTGATACAGCAAGCCTTCGACTGA ForxoxF deletionForxoxF deletion REV_primer_F1REV_primer_F1 TGGTACCAATTGTACAGCTGCCTCCTGGTATCCTGTTACGCTGGTACCAATTGTACAGCTGCCTCCTGGTATCCTGTTACGC FWD_primer_F2FWD_primer_F2 CGTGTTAACCGGTGAGCTGGGCGGCACATTAACTGTATT CGTGTTAACCGGTGAGCTGGGCGGCACATTAACTGTATT REV_primer_F2REV_primer_F2 CTGGATCCTCTAGTGAGCTCGCCTTGATCGATTAAGCCTAACTGGATCCTCTAGTGAGCTCGCCTTGATCGATTAAGCCTAA Flank F1 _FWFlank F1_FW CACCTGACGTCTAGATCTGGCCGCCAAAGTTCGGGCG
CACCTGACGTCTAGATCTGGCCGCCAAAGTTCGGGCG
 Integration of 2,3 BDO biosynthesis pathway in M. alcaliphilum 20ZIntegration of 2,3 BDO biosynthesis pathway in M. alcaliphilum 20Z Flank F1 _RVFlank F1_RV TGGTACCAATTGTACAGCTGAGAGGCCGATTCATGAGGATGTTGGTACCAATTGTACAGCTGAGAGGCCGATTCATGAGGATGT Flank F2 _FWFlank F2_FW CGTGTTAACCGGTGAGCTTTTGGAAGATTCGGCTTTAGGGTCGTGTTAACCGGTGAGCTTTTGGAAGATTCGGCTTTAGGGT Flank F2 _RVFlank F2_RV CTGGATCCTCTAGTGAGCTGGCTCGATTTAATTATCTGCAAGACTGGATCCTCTAGTGAGCTGGCTCGATTTAATTATCTGCAAGA BudABC cluster_FWBudABC cluster_FW AATTGGTACCATGGATGCAGAGAAAGGCGGACAGGTATAATTGGTACCATGGATGCAGAGAAAGGCGGACAGGTAT BudABC cluster_RVBudABC cluster_RV GTTATGCGGCCGCCATCAGAATTGGTTAATTGGTTGTGTTATGCGGCCGCCATCAGAATTGGTTAATTGGTTGT

(3)(3) M. alcaliphilum M. alcaliphilum 20Z의 전기천공법 기반 유전자 조작 방법 Electroporation-based genetic manipulation method of 20Z

50 ml 배양액을 1% 메탄올이 있는 조건에서 0.4-0.6의 광학 밀도로 배양하였다. 세포를 5000 ×g, 4℃에서 10 분 동안 원심분리 한 후, 50ml 냉수에서 재현탁시켜 세포를 수득하였다. 상기 수득된 세포를 냉수로 2회 세척 하였다. 생성 된 펠릿을 100μL 증류 멸균 수에 재현탁시켰다. 50㎕ 의 세포 현탁액을 500ng DNA 플라스미드와 부드럽게 혼합하고, 혼합물을 빙냉 1-mm-갭 cuvette (Bio-Rad)으로 옮겼다. Gene Pulser Xcell ™ 전기 천공 시스템 (Bio-Rad)을 사용하여 1.3kV, 25μF 및 200Ω에서 전기 천공을 수행 하였다. 전기 천공 후 즉시, 1ml의 NMS를 세포에 첨가 한 다음, 세포 회수를 위해 0.1 % 메탄올을 함유하는 180ml 혈청 bottle에서 10ml NMS 배지로 옮겼다. 진탕하면서 30℃에서 밤새 인큐베이션 한 후, 세포를 5000 xg에서 10 분 동안 실온에서 원심 분리하고, 선택배지가 있는 플레이트 상에 펼쳤다.50 ml of the culture medium was cultured at an optical density of 0.4-0.6 in the presence of 1% methanol. The cells were centrifuged at 5000 × g, 4°C for 10 minutes, and then resuspended in 50 ml of cold water to obtain cells. The obtained cells were washed twice with cold water. The resulting pellet was resuspended in 100 μL distilled sterile water. 50 μl of the cell suspension was gently mixed with 500 ng DNA plasmid, and the mixture was transferred to an ice-cold 1-mm-gap cuvette (Bio-Rad). Electroporation was performed at 1.3 kV, 25 μF and 200 Ω using a Gene Pulser Xcell™ electroporation system (Bio-Rad). Immediately after electroporation, 1 ml of NMS was added to the cells and then transferred from a 180 ml serum bottle containing 0.1% methanol to 10 ml NMS medium for cell recovery. After overnight incubation at 30°C with shaking, cells were centrifuged at 5000×g for 10 min at room temperature and spread on plates with selective media.

(4) 글리세롤 소비량의 측정(4) Determination of glycerol consumption

상기 배양된 균주의 600 nm에서의 광학 밀도 (OD600)를 Becman 분광 광도계 (Beckman Coulter, Mississauga, ON, Canada)로 측정 하였다. 원심 분리 후, 상층액을 0.22-μm-공극 크기 필터를 통해 여과하고 HPLC 분석을 위해 -20 ℃에서 저장 하였다. 글리세롤의 농도를 정량화하기 위해, 굴절률 검출기가 장착된 HPLC 시스템 (RID G1362A, 1100 시리즈; Agilent Technologies, 미국 캘리포니아 주 팔로 알토)을 사용하여 유기산 컬럼상에서 샘플을 분석하였다. 상기 여과된 배양 배지 (40㎕)를 컬럼 상에 로딩하고 55℃에서 30 분 동안 0.6ml/분의 유속으로 5mM 황산을 이용하여 용리시켰다.The optical density (OD600) at 600 nm of the cultured strain was measured with a Beckman spectrophotometer (Beckman Coulter, Mississauga, ON, Canada). After centrifugation, the supernatant was filtered through a 0.22-μm-pore size filter and stored at -20 °C for HPLC analysis. To quantify the concentration of glycerol, samples were analyzed on an organic acid column using an HPLC system equipped with a refractive index detector (RID G1362A, 1100 series; Agilent Technologies, Palo Alto, CA). The filtered culture medium (40 μl) was loaded onto the column and eluted with 5 mM sulfuric acid at 55° C. for 30 minutes at a flow rate of 0.6 ml/min.

(5)분석 방법(5) Analysis method

진탕 플라스크 배양물로부터 상층액을 원심 분리에 의해 세포로부터 분리 하였다. RI 검출기를 사용하는 Aminex HPX-87H 유기산 컬럼 (Bio-Rad, Hercules, USA) 및 HPLC (JascoCo., USA, USA)를 사용하여 2,3-부탄디올의 양을 측정 하였다. 0.7ml/min의 유량으로 60℃에서 이동상으로서 황산 (0.005M)을 사용 하였다.Supernatants from shake flask cultures were separated from cells by centrifugation. The amount of 2,3-butanediol was determined using an Aminex HPX-87H organic acid column (Bio-Rad, Hercules, USA) and HPLC (JascoCo., USA, USA) using an RI detector. Sulfuric acid (0.005 M) was used as the mobile phase at 60 °C at a flow rate of 0.7 ml/min.

실험예 1. Experimental Example 1. M. alcaliphilum M. alcaliphilum 20Z에서 글리세롤 이용 경로 구축Establishing a glycerol utilization pathway in 20Z

대장균에서 글리세롤을 이용하는 경로는, 호기 조건에서 glpK-glpD/glpABC 경로 (Booth, 2005) 및 발효 조건 하에서 glpD-dhaK 경로(Gonzalez et al. 2008)를 포함하는 두 가지 경로가 존재한다. M. alcaliphilum 20Z는 야생형인 경우 글리세롤을 활용하는 유전자를 프로세싱 하지 않는다(도 1). 첫 번째 호기 조건에서, 대장균의 글리세롤 트랜스포터(glpF, 서열번호 1), 글리세롤 키나아제(glpK, 서열번호 2) 및 FAD 의존적 글리세롤 3-인산 탈수소효소(glpD, 서열번호 3)를 pAWP89 벡터에 의해 발현(pAW89_FKD)시켰으며, 상기 플라스미드를 M. alcaliphilum 20Z에 도입하여 20Z_FKD 균주를 수득하였다. 야생형의 M. alcaliphilum 20Z은 탄소원 및 에너지원으로서 0.1% 글리세롤만을 함유하는 NMS 배지에서 성장하지 못했으나, 상기 20Z_FKD 균주는 상기 배지에서 느리게 성장하였다(도 2A). 상기 20Z_FKD 균주는 40시간 배양 후 세포 밀도(OD600)가 0.3으로 측정되었으며, 이와 같은 낮은 밀도를 나타내는 것은, 글리세롤의 활용 경로가 20Z_FKD 균주에서 독성을 나타낼 수 있기 때문임을 확인하였다(도 2A).There are two pathways for using glycerol in E. coli, including the glpK-glpD/glpABC pathway under aerobic conditions (Booth, 2005) and the glpD-dhaK pathway under fermentation conditions (Gonzalez et al. 2008). M. alcaliphilum 20Z does not process genes utilizing glycerol when wild-type ( FIG. 1 ). In the first aerobic condition, E. coli glycerol transporter (glpF, SEQ ID NO: 1), glycerol kinase (glpK, SEQ ID NO: 2) and FAD-dependent glycerol 3-phosphate dehydrogenase (glpD, SEQ ID NO: 3) were expressed by pAWP89 vector (pAW89_FKD), and the plasmid was introduced into M. alcaliphilum 20Z to obtain a 20Z_FKD strain. Wild-type M. alcaliphilum 20Z failed to grow in NMS medium containing only 0.1% glycerol as a carbon source and energy source, but the 20Z_FKD strain grew slowly in the medium ( FIG. 2A ). The 20Z_FKD strain had a cell density (OD600) of 0.3 after culturing for 40 hours, and it was confirmed that the low density was because the utilization route of glycerol could be toxic in the 20Z_FKD strain (FIG. 2A).

한편, 글리세롤 트랜스포터 (glpF), 글리세롤 탈수소 효소 (glpA, 서열번호 4) 및 디하이드록시 아세톤키나아제 (dhaK, 서열번호 5)로 구성된 제 2 글리세롤 이용 경로를 포함하는 20Z_glpF_glpA_dhaK 균주는 단독 탄소 공급원으로서 글리세롤을 함유하는 NMS 배지에서 성장하지 않았다. On the other hand, 20Z_glpF_glpA_dhaK strain comprising a second glycerol utilization pathway consisting of a glycerol transporter (glpF), glycerol dehydrogenase (glpA, SEQ ID NO: 4) and dihydroxyacetonkinase (dhaK, SEQ ID NO: 5) is a single carbon source of glycerol did not grow in NMS medium containing

실험예 2. gpsA의 내인성 과발현 및 적응적 진화에 의한 Experimental Example 2. Endogenous overexpression of gpsA and adaptive evolution M. alcaliphilum M. alcaliphilum 20Z에서 효과적인 글리세롤 활용Effective glycerol utilization at 20Z

글리세롤을 탄소원으로 포함하는 배지에서 G3P의 DHAP로의 전환이 속도 제한 단계인 것으로 추정되는데 Sec-translocon의 용량의 포화로 인한 메탄자화균의 멤브레인 시스템에서의 멤브레인 바인딩 효소, FAD+의존적 glpD의 약한 발현 때문이다. G3P의 축적은 글리세롤 키나아제의 높은 활성하에서 세포 성장을 억제하는 것으로 보고되었다. 또한, 이는 메탄자화균의 중심 대사에서 분기점이기 때문에 DHAP는 배제되었고, 세포는 DHAP를 전환시키는 기전을 갖는다. 따라서, 바이오 매스 합성을 위한 탄소 플럭스를 개선하고 환원 당량, 특히 NADH를 생성하고 G3P의 DHAP 로의 산화를 향상시키기 위해서는 다른 가용성 효소를 발현할 필요가 있다. M. alcaliphilum 20Z (MEALZ_0434)로부터 gpsA(서열번호 11)에 의해 암호화된 G3P 탈수소 효소를 발견하고 이를 glpFKD와 공동 발현하여 20Z_FKDG 균주를 구축하였다. 이는 20Z_FKD보다 글리세롤에서 더 높은 성장률을 보였으며 최종 OD600 1.4에 도달하였고 ~ 1g/L의 글리세롤을 소비했다(그림 2A). It is presumed that the conversion of G3P to DHAP in a medium containing glycerol as a carbon source is the rate-limiting step. This is because of the weak expression of the membrane-binding enzyme, FAD+-dependent glpD, in the membrane system of methanobacteria due to the saturation of the Sec-translocon capacity. . Accumulation of G3P has been reported to inhibit cell growth under high activity of glycerol kinase. In addition, DHAP was excluded because it is a branching point in the central metabolism of methanogenic bacteria, and the cell has a mechanism for converting DHAP. Therefore, it is necessary to express other soluble enzymes to improve the carbon flux for biomass synthesis and to generate reducing equivalents, especially NADH, and to enhance the oxidation of G3P to DHAP. A G3P dehydrogenase encoded by gpsA (SEQ ID NO: 11) was found from M. alcaliphilum 20Z (MEALZ_0434) and co-expressed with glpFKD to construct a 20Z_FKDG strain. It had a higher growth rate in glycerol than in 20Z_FKD, reaching a final OD 600 of 1.4 and consuming ~1 g/L of glycerol (Fig. 2A).

글리세롤은 가격이 저렴하고 쉽게 얻을 수 있는 기질이므로, 바이오매스의 전환 수율 향상을 위해 더 높은 글리세롤 농도하에서 상기 형질전환 메탄자화균을 배양하고자 하였다. 글리세롤 0.1% 포함 배지에서 20Z_FKDG 균주는 메탄 또는 메탄올을 탄소원으로 사용한 경우와 비교하여 성장률이 크게 향상되지 않았다(도 2B). 20Z_FKDG 균주의 글리세롤 기질 환경 적응력을 증가시키기 위하여 글리세롤의 농도를 1%까지 증가시켜 50회 이상 반복해서 배양한 결과, 20Z_FKDG 균주는 1% 글리세롤 첨가하였을 때 효율적으로 성장할 수 있었고, 60시간 후, 메탄 또는 메탄올을 탄소원으로 사용한 경우에 비하여 매우 높은 성장률을 보였다(도 2C, 2D).Since glycerol is an inexpensive and easily obtainable substrate, it was attempted to culture the transgenic methanogen under a higher glycerol concentration in order to improve the conversion yield of biomass. In the medium containing 0.1% glycerol, the 20Z_FKDG strain did not significantly improve the growth rate compared to the case where methane or methanol was used as a carbon source (Fig. 2B). In order to increase the adaptability to the glycerol substrate environment of the 20Z_FKDG strain, the concentration of glycerol was increased to 1% and cultured repeatedly more than 50 times. As a result, the 20Z_FKDG strain was able to grow efficiently when 1% glycerol was added, and after 60 hours, methane or It showed a very high growth rate compared to the case where methanol was used as a carbon source ( FIGS. 2C and 2D ).

실험예 3. Experimental Example 3. M. alcaliphilumM. alcaliphilum 20Z에서 혼합 영양 성장을 통한 2,3-부탄디올(2,3-Buthanediol) 생산 개선 Improved production of 2,3-Butanediol through mixed vegetative growth at 20Z

이전 연구(Nguyen et al., 2018)에서는, 2,3-부탄디올(2,3-Buthanediol)를 생산하기 위하여 K.pneumoniae 유래의 서열번호 6으로 이루어진 아세토락테이트 디카르복실레이즈(acetolactate decarboxylase, budA), 서열번호 7로 이루어진 아세토락테이트 생합성효소 (acetolactate synthase, budB) 및 서열번호 8로 이루어진 아세토인 환원효소 (acetoin reductase, budC)를 코딩하는 유전자를 발현벡터에 클로닝한 후 M. alcaliphilum 20Z에 도입하여 형질전환 메탄자화균을 제작하였다.In a previous study (Nguyen et al., 2018), acetolactate decarboxylase ( budA ) consisting of SEQ ID NO: 6 derived from K. pneumoniae to produce 2,3-butanediol (2,3-Butanediol) ), acetolactate synthase (budB) consisting of SEQ ID NO: 7 and acetoin reductase (budC) consisting of SEQ ID NO: 8 were cloned into an expression vector, and then in M. alcaliphilum 20Z Introduced to prepare a transformed methanogen.

플라스미드를 기반으로 하는 이종간의 발현은 플라스미드 대사의 부담 및 유전적 불안정성으로 인하여 산업적으로 적용되는데 한계가 있었다. 따라서, 이종간의 대사 경로의 염색체 통합은 산업적인 발효 공정에 최적화된 결과를 제공하는 것이다. The plasmid-based heterologous expression had limitations in industrial application due to the burden of plasmid metabolism and genetic instability. Thus, chromosomal integration of heterologous metabolic pathways provides optimized results for industrial fermentation processes.

20Z_FKDG는 glpFKD 및 gpsA의 발현을 위한 광범위한 범위의 숙주에 적용 가능한 상업적 플라스미드를 통해 제작할 수 있으며, 이전 연구에서 얻어진 2,3-부탄디올 생합성 경로(budABC)를 Ptac 프로모터의 제어 하에 M. alcaliphilum 20Z의 염색체로 통합하였다. 20Z_FKDG can be constructed through a commercial plasmid applicable to a wide range of hosts for the expression of glpFKD and gpsA, and the 2,3-butanediol biosynthetic pathway (budABC) obtained in the previous study was transferred to the chromosome of M. alcaliphilum 20Z under the control of the Ptac promoter. was integrated into

염색체의 형질 도입을 통하여, glgA1 유전자를 대체하였다. K. pneumoniae로부터 2,3-부탄디올 유전자 클러스터를 Ptat pBudK.p로부터 증폭시키고, 이어서 pCM351-glgA1 벡터에 라이게이션 하여 pCM351-budABC를 구축하고 형질전환 메탄자화균 20Z_FKDG에 도입하였다 (도 3). Through transduction of the chromosome, the glgA1 gene was replaced. The 2,3-butanediol gene cluster from K. pneumoniae was amplified from P tat pBudK.p and then ligated to the pCM351-glgA1 vector to construct pCM351-budABC and introduced into the transformed methanogen 20Z_FKDG (FIG. 3).

이론적으로, 메탄 및 글리세롤과 같이 다른 기질을 공동으로 이용하는 것은, 여분의 탄소를 제공하고 등가물을 감소시켜 표적 생성물의 생산량을 증가시킬 수 있다. 따라서, 메탄과 글리세롤을 공동으로 이용할 수 있는 균주의 개발로 결과적으로는 2,3-부탄디올의 생산을 향상시킬 수 있다고 가정하였다. 메탄 및 글리세롤을 공동 기질로 사용하기 위하여, 쉐이크 플라스크의 헤드스페이스를 24시간마다 50% v/v의 메탄으로 채워주고, 0.5% 글리세롤을 초기에 공급하였다. Theoretically, the joint use of other substrates, such as methane and glycerol, could increase the yield of the target product by providing extra carbon and reducing equivalents. Therefore, it was assumed that the production of 2,3-butanediol could be improved as a result of the development of a strain capable of using methane and glycerol jointly. To use methane and glycerol as co-substrates, the headspace of the shake flask was filled with 50% v/v methane every 24 hours, and 0.5% glycerol was initially fed.

예상한 바와 같이, 메탄 및 글리세롤을 혼합하여 배양한 20Z_FKDG_budABC 균주의 성장률이 메탄만을 탄소원으로 제공한 경우에 비하여, 유의미하게 증가하는 것을 확인할 수 있었다(도 4A). As expected, it was confirmed that the growth rate of the 20Z_FKDG_budABC strain cultured by mixing methane and glycerol was significantly increased compared to the case where only methane was provided as a carbon source (FIG. 4A).

메탄 및 글리세롤 존재하에서, 20Z_FKDG_budABC 균주의 2,3-부탄디올의 생성량을 모니터링하였으며, 144 시간 후 68 mg/L의 2,3-부탄디올을 생산하였고, 이는 탄소원으로 메탄만을 제공한 경우보다 약 4 배 높은 역가를 얻을 수 있었다(도 4B). 이는 메탄자화균의 추가 탄소원으로서 글리세롤의 잠재력을 시사하는 것이다. In the presence of methane and glycerol, the production amount of 2,3-butanediol of the 20Z_FKDG_budABC strain was monitored, and after 144 hours, 68 mg/L of 2,3-butanediol was produced, which was about 4 times higher than when only methane was provided as a carbon source. titers could be obtained (Fig. 4B). This suggests the potential of glycerol as an additional carbon source for methanogens.

실험예 4. 메탄 및 에탄에서 메탄올 및 에탄올로 직접 전환을 위한 생촉매 개발Experimental Example 4. Development of a biocatalyst for direct conversion of methane and ethane to methanol and ethanol

메탄 및 에탄에서 메탄올 및 에탄올로 변환하는 것은 가스-액체 변환 기술에서 지속적인 관심을 받고 있다. 유기물 중 메탄의 탄소-수소(C-H) 결합은 높은 결합 에너지를 가지고 있어, 메탄에서 메탄올로의 직접 전환을 위한 효율적인 촉매의 개발이 요구되고 있다. 본 발명에서는 형질전환 메탄자화균 20Z_FKDG에 메탄올 탈수소 효소를 결손시켜 메탄 및 에탄을 메탄올 및 에탄올로 직접 전환하는 생촉매로 이용하고자 하였다(도 5A). 구체적으로, M. alcaliphilum 20Z_FKDG에서 메탄올 산화는 칼슘 의존적 mxaFI 시스템 및 란타늄 의존성 xoxF를 포함하는 주변 세포질 피롤로 퀴놀린 퀴논-연결 메탄올 탈수소 효소에 의하여 촉매되기 때문에, 본 발명에서는 mxaFI 시스템 및 xoxF 결손시켜 형질전환 20Z_M2 균주를 얻었다.The conversion of methane and ethane to methanol and ethanol continues to receive interest in gas-liquid conversion technology. Since the carbon-hydrogen (CH) bond of methane in organic matter has a high binding energy, the development of an efficient catalyst for direct conversion of methane to methanol is required. In the present invention, it was attempted to use as a biocatalyst for direct conversion of methane and ethane into methanol and ethanol by deficient methanol dehydrogenase in 20Z_FKDG of transformed methanogen (FIG. 5A). Specifically, since methanol oxidation in M. alcaliphilum 20Z_FKDG is catalyzed by a calcium-dependent mxaFI system and a periplasmic pyrroloquinoline quinone-linked methanol dehydrogenase containing a lanthanum-dependent xoxF, the present invention transforms the mxaFI system and the xoxF deletion. 20Z_M2 strain was obtained.

메탄올 탈수소 효소가 결실된 20Z_M2는 메탄을 단일탄소원으로 사용하였을 때에는 성장하지 않았으나, 메탄과 글리세롤 존재하에서 3일 동안 배양하였을 때, 11.6 mM의 메탄올이 축적된 것을 확인하였다(도 5B). 또한, 동일한 조건에서 에탄을 주입하였을 때에도, 3일 후에 12.7 mM의 에탄올이 축적된 것을 확인하였다(도 5C). 따라서, 본 발명에서 형질전환된 20Z_M2는 메탄 및 에탄로부터 화학적 저해제 없이 메탄올 및 에탄올을 축적시킬 수 있는 것을 확인하였다. 20Z_M2 in which methanol dehydrogenase is deleted did not grow when methane was used as a single carbon source, but when cultured for 3 days in the presence of methane and glycerol, it was confirmed that 11.6 mM methanol was accumulated (FIG. 5B). In addition, even when ethane was injected under the same conditions, it was confirmed that 12.7 mM of ethanol was accumulated after 3 days ( FIG. 5C ). Therefore, it was confirmed that the 20Z_M2 transformed in the present invention could accumulate methanol and ethanol from methane and ethane without chemical inhibitors.

이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 특허청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.So far, with respect to the present invention, the preferred embodiments have been looked at. Those of ordinary skill in the art to which the present invention pertains will understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments are to be considered in an illustrative rather than a restrictive sense. The scope of the present invention is indicated in the claims rather than the foregoing description, and all differences within the scope equivalent thereto should be construed as being included in the present invention.

<110> University-Industry Cooperation Group of Kyung Hee University <120> Development of methanotroph that assimilate glycerol and production of high value-added alcohol using itself <130> PN1910-472 <160> 11 <170> KoPatentIn 3.0 <210> 1 <211> 846 <212> DNA <213> Unknown <220> <223> Glycerol transporter (glpF) <400> 1 atgagtcaaa catcaacctt gaaaggccag tgcattgctg aattcctcgg taccgggttg 60 ttgattttct tcggtgtggg ttgcgttgca gcactaaaag tcgctggtgc gtcttttggt 120 cagtgggaaa tcagtgtcat ttggggactg ggggtggcaa tggccatcta cctgaccgca 180 ggggtttccg gcgcgcatct taatcccgct gttaccattg cattgtggct gtttgcctgt 240 ttcgacaagc gcaaagttat tccttttatc gtttcacaag ttgccggcgc tttctgtgct 300 gcggctttag tttacgggct ttactacaat ttatttttcg acttcgagca gactcatcac 360 attgttcgcg gcagcgttga aagtgttgat ctggctggca ctttctctac ttaccctaat 420 cctcatatca attttgtgca ggctttcgca gttgagatgg tgattaccgc tattctgatg 480 gggctgatcc tggcgttaac ggacgatggc aacggtgtac cacgcggccc tttggctccc 540 ttgctgattg gtctactgat tgcggtcatt ggcgcatcta tgggcccatt gacaggtttt 600 gccatgaacc cagcgcgtga cttcggtccg aaagtctttg cctggctggc gggctggggc 660 aatgtcgcct ttaccggcgg cagagacatt ccttacttcc tggtgccgct tttcggccct 720 atcgttggcg cgattgtagg tgcatttgcc taccgcaaac tgattggtcg ccatttgcct 780 tgcgatatct gtgttgtgga agaaaaggaa accacaactc cttcagaaca aaaagcttcg 840 ctgtaa 846 <210> 2 <211> 1509 <212> DNA <213> Unknown <220> <223> Glycerol kinase (glpK) <400> 2 atgactgaaa aaaaatatat cgttgcgctc gaccagggca ccaccagctc ccgcgcggtc 60 gtaatggatc acgatgccaa tatcattagc gtgtcgcagc gcgaatttga gcaaatctac 120 ccaaaaccag gttgggtaga acacgaccca atggaaatct gggccaccca aagctccacg 180 ctggtagaag tgctggcgaa agccgatatc agttccgatc aaattgcagc tatcggtatt 240 acgaaccagc gtgaaaccac tattgtctgg gaaaaagaaa ccggcaagcc tatctataac 300 gccattgtct ggcagtgccg tcgtaccgca gaaatctgcg agcatttaaa acgtgacggt 360 ttagaagatt atatccgcag caataccggt ctggtgattg acccgtactt ttctggcacc 420 aaagtgaagt ggatcctcga ccatgtggaa ggctctcgcg agcgtgcacg tcgtggtgaa 480 ttgctgtttg gtacggttga tacgtggctt atctggaaaa tgactcaggg ccgtgtccat 540 gtgaccgatt acaccaacgc ctctcgtacc atgttgttca acatccatac cctggactgg 600 gacgacaaaa tgctggaagt gctggatatt ccgcgcgaga tgctgccaga agtgcgtcgt 660 tcttccgaag tatacggtca gactaacatt ggcggcaaag gcggcacgcg tattccaatc 720 tccgggatcg ccggtgacca gcaggccgcg ctgtttggtc agttgtgcgt gaaagaaggg 780 atggcgaaga acacctatgg cactggctgc tttatgctga tgaacactgg cgagaaagcg 840 gtgaaatcag aaaacggcct gctgaccacc atcgcctgcg gcccgactgg cgaagtgaac 900 tatgcgttgg aaggtgcggt gtttatggca ggcgcatcca ttcagtggct gcgcgatgaa 960 atgaagttga ttaacgacgc ctacgattcc gaatatttcg ccaccaaagt gcaaaacacc 1020 aatggtgtgt atgtggttcc ggcatttacc gggctgggtg cgccgtactg ggacccgtat 1080 gcgcgcgggg cgattttcgg tctgactcgt ggggtgaacg ctaaccacat tatacgcgcg 1140 acgctggagt ctattgctta tcagacgcgt gacgtgctgg aagcgatgca ggccgactct 1200 ggtatccgtc tgcacgccct gcgcgtggat ggtggcgcag tagcaaacaa tttcctgatg 1260 cagttccagt ccgatattct cggcacccgc gttgagcgcc cggaagtgcg cgaagtcacc 1320 gcattgggtg cggcctatct cgcaggcctg gcggttggct tctggcagaa cctcgacgag 1380 ctgcaagaga aagcggtgat tgagcgcgag ttccgtccag gcatcgaaac cactgagcgt 1440 aattaccgtt acgcaggctg gaaaaaagcg gttaaacgcg cgatggcgtg ggaagaacac 1500 gacgaataa 1509 <210> 3 <211> 1506 <212> DNA <213> Unknown <220> <223> FAD dependent glycerol 3-phosphate dehydrogenase (glpD) <400> 3 atggaaacca aagatctgat tgtgataggg ggcggcatca atggtgctgg tatcgcggca 60 gacgccgctg gacgcggttt atccgtgctg atgctggagg cgcaggatct cgcttgcgcg 120 acctcttccg ccagttcaaa actcattcac ggtggcctgc gctaccttga gcactatgaa 180 ttccgcctgg tcagcgaggc gctggctgaa cgtgaagtgc tgctgaaaat ggccccgcat 240 atcgccttcc cgatgcgttt tcgcctgcca catcgtccgc atctgcgccc ggcgtggatg 300 attcgcattg gtctgtttat gtacgatcat ctgggtaaac gcaccagctt gccgggatca 360 actggtttgc gttttggcgc aaattcagtg ttaaaaccgg aaattaagcg cggattcgaa 420 tattctgact gttgggtaga cgacgcccgt ctggtactcg ccaacgccca gatggtggtg 480 cgtaaaggcg gcgaagtgct tactcggact cgcgccacct ctgctcgccg cgaaaacggc 540 ctgtggattg tggaagcgga agatatcgat accggcaaaa aatatagctg gcaagcgcgc 600 ggcttggtta acgccaccgg cccgtgggtg aaacagttct tcgacgacgg gatgcatctg 660 ccttcgcctt atggcattcg cctgatcaaa ggcagccata ttgtggtgcc gcgcgtgcat 720 acccagaagc aagcctacat tctgcaaaac gaagataaac gtattgtgtt cgtgatcccg 780 tggatggacg agttttccat catcggcact accgatgtcg agtacaaagg cgatccgaaa 840 gcggtgaaga ttgaagagag tgaaatcaat tacctgctga atgtgtataa cacgcacttt 900 aaaaagcagt taagccgtga cgatatcgtc tggacctact ccggtgtgcg tccgctgtgt 960 gatgatgagt ccgactcgcc gcaggctatt acccgtgatt acacccttga tattcatgat 1020 gaaaatggca aagcaccgct gctgtcggta ttcggcggta agctgaccac ctaccgaaaa 1080 ctggcggaac atgcgctgga aaaactaacg ccgtattatc agggtattgg cccggcatgg 1140 acgaaagaga gtgtgctacc gggtggcgcc attgaaggcg accgcgacga ttatgccgct 1200 cgcctgcgcc gccgctatcc gttcctgact gaatcgctgg cgcgtcatta cgctcgcact 1260 tacggcagca acagcgagct gctgctcggc aatgcgggaa cggtaagcga tctcggggaa 1320 gatttcggtc atgagttcta cgaagcggag ctgaaatacc tggtggatca cgaatgggtc 1380 cgccgcgccg acgacgccct gtggcgtcgc acaaaacaag gcatgtggct aaatgcggat 1440 caacaatctc gtgtgagtca gtggctggtg gagtatacgc agcagaggtt atcgctggcg 1500 tcgtaa 1506 <210> 4 <211> 1629 <212> DNA <213> Unknown <220> <223> Glycerol dehydrogenase (glpA) <400> 4 atgaaaactc gcgactcgca atcaagtgac gtgattatca ttggcggcgg cgcaacggga 60 gccgggattg cccgcgactg tgccctgcgc gggctgcgcg tgattttggt tgagcgccac 120 gacatcgcaa ccggtgccac cgggcgtaac cacggcctgc tgcacagcgg tgcgcgctat 180 gcggtaaccg atgcggaatc ggcccgcgaa tgcattagtg aaaaccagat cctgaaacgc 240 attgcacgtc actgcgttga accaaccaac ggcctgttta tcaccctgcc ggaagatgac 300 ctctccttcc aggccacttt tattcgcgcc tgcgaagaag cagggatcag cgcagaagct 360 atagacccgc agcaagcgcg cattatcgaa cctgccgtta acccggcact gattggcgcg 420 gtgaaagttc cggatggcac cgttgatcca tttcgtctga ccgcagcaaa catgctggat 480 gccaaagaac acggtgccgt tatccttacc gctcatgaag tcacggggct gattcgtgaa 540 ggcgcgacgg tgtgcggtgt tcgtgtacgt aaccatctca ccggcgaaac tcaggccctt 600 catgcacctg tcgtggttaa tgccgctggg atctgggggc aacacattgc cgaatatgcc 660 gatctgcgca ttcgcatgtt cccggcgaaa ggatcgctgc tgatcatgga tcaccgcatt 720 aaccagcatg tgatcaaccg ctgccgtaaa ccttccgacg ccgatattct ggtgcctggc 780 gataccattt cgctgattgg taccacctct ttacgtattg attacaacga gattgacgat 840 aatcgagtga cggcagaaga ggttgatatt ctgctgcgtg aaggggaaaa actggccccc 900 gtgatggcga aaacgcgcat tttgcgggcc tattctggcg tgcgcccgct ggttgccagc 960 gatgacgacc cgagcggacg taacgtcagc cgtggcatcg tgctgctcga ccatgctgaa 1020 cgcgatggtc tggacggatt tatcaccatc accggtggca aactgatgac ctatcggctg 1080 atggctgaat gggctaccga cgcggtatgc cgcaaactgg gcaacacgcg cccctgtacg 1140 actgccgatc tggcactgcc tggttcacaa gaacccgctg aagttacctt gcgtaaagtc 1200 atctccctgc ctgccccgct gcgcggttct gcggtttatc gtcatggcga tcgcacgcct 1260 gcctggctga gcgaaggccg tctgcaccgt agcctggtat gtgagtgcga agcggtaact 1320 gcgggtgaag tgcagtacgc ggtagaaaat ttaaacgtta atagcctgct ggatttacgc 1380 cgtcgtaccc gtgtggggat gggcacctgc cagggcgaac tctgcgcctg ccgcgctgcc 1440 ggactgctgc aacgttttaa cgtcacgacg tccgcgcaat ctatcgagca actttccacc 1500 ttccttaacg aacgctggaa aggcgtgcaa cccatcgcct ggggagatgc actgcgcgaa 1560 agcgaattta cccgctgggt ttatcaggga ttgtgtggtc tggagaagga gcagaaagat 1620 gcgctttga 1629 <210> 5 <211> 1071 <212> DNA <213> Unknown <220> <223> Dihydroxyacetone kinase (dhaK) <400> 5 ttatttaccc cagttaaggg ccggggtgtg gaccggggcg tcccagagtg ccagcgtttc 60 gtcatcaact ttcagtaagg tgattgagaa accggtcata tccagtgagg tgcagtacgc 120 gccaattaaa ttacgttcga tagtcaatcc cgcttgctgg caacgtgtgg tcaggcggtt 180 atagacgccg tacagctcag aaagcggagt tgcgccaaga ttgttaacca gcgcaatcac 240 ccgatcgcca gactggagcg gttgtttggt ttgttgttct tcctgccaac tgccttgttg 300 ataatcccag aaacgcaaag tgcgatggta tgagccattt accagcaggg tgtcgaacat 360 ttcatcgacg gtttgatcaa gggaagagaa ggggcggcgg tcaatacccg gctcaccatg 420 aatgccgacg ccaaactcca tctcattatc cgccagggta aaagaaggtt tgcccgcggc 480 aggaacggta caggcaccga gagcgatacc tattgagtgg ccttgattat tcagcttacg 540 ccccagttcc gcacaggcgt ccagtgagtc gccacgctcc gccgctgcgc ctacgagttt 600 ttcaattaat acggtgttgg caacgccgcg tcgcccggca gtataaagac tgtcttttac 660 cgcaacgtcg tcatcaatga ccacagtggt cacttttacg ccgctatcgt gcagtaactc 720 ggtcgctgtt tcaaagttaa gaatatcgcc ggtgtaattt ttgataatca acagtacacc 780 ttcgccgcca tcaacttgca tggcgcattc aaagatttta tcgggcgtcg gtgaggtgaa 840 aatttcgccc ggacaggccc ccgaaagcat cccctgaccg atataaccac agtgcatcgg 900 ctcgtgtccg ctgccgccac ccgacagcag ggcgactttt cctgcaacag gggcatcagc 960 tcgggtgaca tacaccggat cctgatgcag tgtcagcgat ggatgcgctt tcgccagtcc 1020 tgccagttgt tcgtccagta cgtcttgcac atcattgatc aattttttca t 1071 <210> 6 <211> 780 <212> DNA <213> Unknown <220> <223> Alpha-acetolactase decarbonxylase (BudA) <400> 6 atgaatcatt ctgctgaatg cacctgcgaa gagagtctat gcgaaaccct gcgggcgttt 60 tccgcgcagc atcccgagag cgtgctctat cagacatcgc tcatgagcgc cctgctgagc 120 ggggtttacg aaggcagcac caccatcgcc gacctgctga aacacggcga tttcggcctc 180 ggcaccttta atgagctgga cggggagctg atcgccttca gcagtcaggt ctatcagctg 240 cgcgccgacg gcagcgcgcg caaagcccag ccggagcaga aaacgccgtt cgcggtgatg 300 acctggttcc agccgcagta ccggaaaacc tttgaccatc cggtgagccg ccagcagctg 360 cacgaggtga tcgaccagca aatcccctct gacaacctgt tctgcgccct gcgcatcgac 420 ggccatttcc gccatgccca tacccgcacc gtgccgcgcc agacgccgcc gtaccgggcg 480 atgaccgacg tactcgacga tcagccggtg ttccgcttta accagcgcga aggggtgctg 540 gtcggcttcc ggaccccgca gcatatgcag gggatcaacg tcgccgggta tcacgagcat 600 tttattaccg atgaccgcaa aggcggcggt cacctgctgg attaccagct cgaccacggg 660 gtgctgacct tcggcgaaat tcacaagctg atgatcgacc tgcccgccga cagcgcgttc 720 ctgcaggcta atctgcatcc cgataatctc gatgccgcca tccgttccgt agaaagttaa 780 780 <210> 7 <211> 1680 <212> DNA <213> Unknown <220> <223> Acetolactate synthase (BudB) <400> 7 atggacaaac agtatccggt acgccagtgg gcgcacggcg ccgatctcgt cgtcagtcag 60 ctggaagcac agggggtacg ccaggtgttc ggcatccccg gcgccaaaat cgacaaggtc 120 ttcgattcac tgctggattc ctccattcgc attattccgg tacgccacga agccaacgcc 180 gcatttatgg ccgccgccgt cggacgtatt accggcaaag cgggcgtggc gctggtcacc 240 tccggtccgg gttgttctaa cctgatcacc ggcatggcca ccgcgaacag cgaaggcgac 300 ccggtggtgg ccctgggcgg cgcggtaaaa cgcgccgata aagccaaaca ggtccaccag 360 agtatggata cggtggcgat gttcagcccg gtcaccaaat acgccgtcga ggtgacggcg 420 ccggatgcgc tggcggaagt ggtctccaac gccttccgcg ccgccgagca gggccggccg 480 ggcagcgcgt tcgttagcct gccgcaggat gtggtcgatg gcccggtcag cggcaaagta 540 ctgccggcca gcggggcccc gcagatgggc gccgcgccgg atgatgccat cgaccaggtg 600 gcgaagctta tcgcccaggc gaagaacccg atcttcctgc tcggcctgat ggccagccag 660 ccggaaaaca gcaaggcgct gcgccgtttg ctggagacca gccatattcc agtcaccagc 720 acctatcagg ccgccggagc ggtgaatcag gataacttct ctcgcttcgc cggccgggtt 780 gggctgttta acaaccaggc cggggaccgt ctgctgcagc ttgccgacct ggtgatctgc 840 atcggctaca gcccggtgga atacgaaccg gcgatgtgga acagcggcaa cgcgacgctg 900 gtgcacatcg acgtgctgcc cgcctatgaa gagcgcaact acaccccgga tgtcgagctg 960 gtaggcgata tcgccggcac tctcaacaag ctggcgcaaa atatcgatca tcggctggtg 1020 ctctccccgc aggcggcgga gatcctccgc gaccgccagc accagcgcga gctgctggac 1080 cgccgcggcg cgcagctcaa ccagtttgcc ctgcatccgc tgcgtatcgt tcgcgccatg 1140 caggacatcg tcaacagcga cgtcacgttg accgtggaca tgggcagctt ccatatctgg 1200 attgcccgct acctgtacag cttccgcgcc cgccaggtga tgatctccaa cggccagcag 1260 accatgggcg tcgccctgcc ctgggccatc ggcgcctggc tggtcaatcc tgagcgcaaa 1320 gtggtctccg tctccggcga cggcggcttc ctgcagtcga gcatggagct ggagaccgcc 1380 gtccgcctga aagccaacgt gctgcacctg atctgggtcg ataacggcta caacatggtg 1440 gccattcagg aagagaaaaa ataccagcgc ctgtccggcg tcgagtttgg gccgatggat 1500 tttaaagcct atgccgaatc cttcggcgcg aaagggtttg ccgtggaaag cgccgaggcg 1560 ctggagccga ccctgcgcgc ggcgatggac gtcgacggcc cggcggtagt ggccatcccg 1620 gtggattatc gcgataaccc gctgctgatg ggccagctgc atctgagtca gattctgtaa 1680 1680 <210> 8 <211> 771 <212> DNA <213> Unknown <220> <223> Acetoin reductase (BudC) <400> 8 atgaaaaaag tcgcacttgt taccggcgcc ggccagggga ttggtaaagc tatcgccctt 60 cgtctggtga aggatggatt tgccgtggcc attgccgatt ataacgacgc caccgccaaa 120 gcggtcgcct ccgaaatcaa ccaggccggc ggccgcgcca tggcggtgaa agtggatgtt 180 tctgaccgcg accaggtatt tgccgccgtc gaacaggcgc gcaaaacgct gggcggcttc 240 gacgtcatcg tcaacaacgc cggcgtggcg ccatccacgc cgatcgagtc cattaccccg 300 gagattgtcg acaaagtcta caacatcaac gtcaaagggg tgatctgggg catccaggca 360 gcggtcgagg cctttaagaa agagggtcac ggcgggaaaa tcatcaacgc ctgttcccag 420 gccggccacg tcggcaaccc ggagctggcg gtatatagct cgagtaaatt cgcggtacgc 480 ggcttaaccc agaccgccgc tcgcgacctc gcgccgctgg gcatcacggt caacggctac 540 tgcccgggga ttgtcaaaac gccgatgtgg gccgaaattg accgccaggt gtccgaagcc 600 gccggtaaac cgctgggcta cggtaccgcc gagttcgcca aacgcatcac cctcggccgc 660 ctgtccgagc cggaagatgt cgccgcctgc gtctcctatc ttgccagccc ggattctgat 720 tatatgaccg gtcagtcatt gctgatcgac ggcggcatgg tgtttaacta a 771 <210> 9 <211> 1809 <212> DNA <213> Unknown <220> <223> Calcium-dependent methanol dehydrogenase mxaFI <400> 9 atgcaacacc ataaaaaacg cgaactctgg ggcgcggcgg cattagtgtc gagtgtcttg 60 ctggccgcgt cacagccggc gcaggccaat caagcgttag ataagttgtc taaacaaaat 120 accaattggg tcatgcagac caaggattac agctcgactc actatagcga gttgtacgat 180 atcaacatta cgaatgtaca aaacctgaag ccggcctggt cattttcaac cggcgttctg 240 aacggtcatg aaggcggtcc tctggtcgtc gacggcatta tgtatgtaca ctcgccctat 300 ccgaataatg tctttgcgat cgatctgaat aaccccgata aaattctgtg gcaattcaaa 360 cctaagcaaa acccggccgc acgcgcggtg gcttgttgcg acgttgtcaa ccgcggcttg 420 gcttatgcgc cgcaaggcaa ggattatccg gcgactatct ttttgaatca gcttgacgga 480 catgtcgtcg cattgaatgc gaaaaccggc gaactgctat ggaaaatgga aaactccgac 540 atcgcgatgg gctcgacgct gactgtggcg ccgttcgtcg ctgaggataa agtcatcgtc 600 ggcacttccg gcgccgaatt aggggttcgc ggatacgcga ccgcctacaa catcaaagac 660 ggcaaacaag cctggcgcgt ctatgcgacc ggtcccgacg aagacatcaa gctgtcgaaa 720 gacttcaaca aggccaatcc gcattacggg cagttcggtc tggggctgaa aacctgggaa 780 ggcgatgcct ggaaaatcgg cggcggtacg aactggggtt ggtatgcata cgatcctgac 840 ttgagaatgc tgtactacgg atcgggtaac ccagcgccct ggaacgaaac gatgcgtccc 900 ggcgacaaca aatggaccat gacgatctgg ggccgcgata tcgagaccgg ggaagcgaaa 960 ttcggctatc aaaaaacgcc tcacgacgaa tgggattatg ccggcgtcaa ttacatgggg 1020 ctgtccgagc agaaggtcaa cggtaagatg accaagttgc tgacccatcc ggaccgtaac 1080 ggtatcgtct atacgctaaa ccgcgaaaac ggcgacctgg tcaacgcgtt caagatcgac 1140 aacacagtca actgggtcaa gcatgtcgat ttgaaaaccg gactgccggt acgcgatcct 1200 gaatattcga cacgcatgga tcacgaagcg aaaggcatct gtccttcggc aatgggttat 1260 cacaaccaag gcatcgagtc ctacgatccg aacaagcaat tgttcttcat gggcgtcaac 1320 cacatctgca tggattggga gccgtttatg ttgccttatc gggccggcca attcttcgtc 1380 ggagcgacgt tgaacatgta tccgggaccg aaaggcacgt taggtcaagt caaggcgatg 1440 aacggcgtga ccggcgagtt cgaatgggaa gttcaggaga aattcgcggt ttggggcggc 1500 acgaccgcaa cagccggcga cttggtcttc tacggcacgt tggacggcta catcaaggcc 1560 ttgaactcga aaaccggcga agaactatgg aaattcaagc tgccttccgg cgtgatcggt 1620 catccgatta cctataaaca cgaaggtaag caatatgtcg cgatttatta tggagtcggc 1680 ggttggccag gtgtcggctt ggtcttcgat ctgaaagacc cgtctgccgg tttaggcgcg 1740 gtcggtgcgt ttaaggagtt ggcgcatcac acccaaatgg gcggcggcgt gatggtattc 1800 tcgttgtaa 1809 <210> 10 <211> 1854 <212> DNA <213> Unknown <220> <223> lanthanum-dependent methanol dehydrogenase xoxF <400> 10 atgaagaagc ctgtcaaaag ctggctgatt gcttcaactg tcgcagccct gcttgcagta 60 cctgcagtat ctcaagcgaa tagcgaagtt gaaaaattga cccaaaaccc tgcgaactgg 120 gcgacttggg gcggtaacta tcagggtacc cgttacagcg aactcaaaca aatcaatact 180 tctaacgtca aaaacctgca accgtcatgg actttttcaa ccggcgttct gcgcggtcat 240 gaaggcggcc cactggttat caatgacgtc atgtatattc acacaccatt ccctaacacc 300 gtttatgcga tcgaccaaaa gtctcaagcg gtcatttggg aatatactcc gcaacaagac 360 gccgacgtca ctatccctgt aatgtgctgt gacaccgtca accgcggatt agcttacggt 420 gacggtaaaa tcttcctgca acaatccgat accgtattga ctgcgttgga cgctaaaacc 480 ggtaaacgcg tatggagcgt gcaaaacggc gatcctaaat tgggcatgac caacactcaa 540 gcacctttgg tcgttaaaga caaagtcatc accggcatct ccggcggtga attcggcgtg 600 cgcggcttct tggcggctta caacatccgt accggcgagc tggactggaa aggctacagc 660 atggggccgg atgccgacac actgattaat gcaacaaaaa ccacaacatg gaaagacggt 720 aaagttcaac ctgtcggcaa ggattccagc cttagcactt gggaaggcga ccaatggaaa 780 atcggcggcg gcaccacttg gggctggtat agctatgatc ctgaattgaa cctggtctat 840 tacggatcgg gcaacccttc gacttggaac ccggcgcaac gtcctggcga caacaagtgg 900 tcgatgtcat tgtgggctcg tgacgccgac accggcgaag tcaaatgggt ttaccaaatg 960 actccgcatg acgaatggga ttacgacggc atcaacgaag tcgcactcgt cgatcaagaa 1020 atcaatggca aaatgcgtaa aaccgccgtc cacttcgacc gtaacggttt cggctacacg 1080 ctggaccgcg tcaccggcga attgttggtt gccgaaaaat tcgacaaagc ggttaactgg 1140 gcgtctcatg tcgacatgaa atccgggcgt ccgcaagtcg tttctcagta cagcaccgaa 1200 tacaacggcg aagatgtcaa tactgaaggc gtctgccctg cggcattggg aagcaaaaac 1260 caacagcctg tttcttactc tccgcaaacc ggttatttct atatatccgg caaccacgtt 1320 tgcatggact acgaaccgtt cgaggttgaa tacactgccg gccaacctta tgttggtgcg 1380 accttgtcta tgttcccggc cggtaaagat gccatcacag gaaaagaaga cggctctaat 1440 aacctgggtc aattcactgc atgggatgct acaaccggta aaatcatctg gtctaacaaa 1500 gagcaattct cggtatggtc aggttcgctg gctactgccg gcggtgtcgt tttctacggc 1560 actctggaag gctacctgaa agcggtcgac gcaaaaacag gtaaagagct ttaccggttt 1620 aaaacacctt ccggcatcat tggtaacgtc aatacttggg aatacgaagg caaacaatat 1680 gtcggcgtac tgtcaggcgt cggcggctgg gctggtatcg gtattgctgc gggactcgac 1740 tccggcgaag aatcttctaa ctctgaaggt ttaggagcgg tcggcgcata cagaagctta 1800 agctcttaca ctaaattggg cggcacatta actgtattcg cattgcctaa ttaa 1854 <210> 11 <211> 999 <212> DNA <213> Unknown <220> <223> dependent glycerol 3-phosphate dehydrogenase (gpsA) <400> 11 atgacctcaa ctatcagcgt actcggtgcc gggtcatggg gcactgcttt agcgatacaa 60 gcagcccgaa acggctatcg tacgctgctg tggggacacg atccaatcca tattcgaaca 120 ctacaacaga atagaaccaa tcagcgatac ttgcccggtt ttgtttttcc caacaccctt 180 gaaaccagct ctgaacttgc cgaagccgca gcattcagcg acttaatcct gattgccgtt 240 cctagtcatg cattcaagga cacgctgatc aagctacgtc gatttaccgg ccaacaggtg 300 caaatcgcct gggctaccaa agggttcgca ccaaacgacg ggtatttgtt acattactcg 360 gtcgaacgca tattttccaa agagactccg actgcggttt tatccggtcc gacttttgcc 420 cgcgaagtcg cggccgattt accgacggca attacaattg catctaatca tgccggcttc 480 tctgaactat taacccgaat cttccacagc gcacgattcc gcacttacac cagcaccgac 540 atgatcggcg tacaaaccgg cggcgcggtt aaaaacgtat tggctatcgc ctcgggcatt 600 gcagacggtc tgaatttcgg cgccaacaca cgcgccgcac tcattacacg gggactccat 660 gaaataatca ggctcggctt agaactcggc ggccgacaag aaacgttcat gggccttgcc 720 ggactcggcg acttgatttt aacttgtacc gacaaccaat caagaaaccg gcgcttcgga 780 cttgcgctcg gacagaacaa aaatcgcgcc gcagcccgtg aagaaatcga ccaagaaatc 840 gaaggcgtgt cggctgcaaa agaaacttat ttacttgcgc agacccacgg catcgacatg 900 ccgattactg aacaaaccta caaagtactc tatgagagct tatcgccgct ggctgccgtg 960 caaaacctat tggaccgcga attaaaagcc gaaagctag 999 <110> University-Industry Cooperation Group of Kyung Hee University <120> Development of methanotroph that assimilate glycerol and production of high value-added alcohol using itself <130> PN1910-472 <160> 11 <170> KoPatentIn 3.0 <210> 1 <211> 846 <212> DNA <213> Unknown <220> <223> Glycerol transporter (glpF) <400> 1 atgagtcaaa catcaacctt gaaaggccag tgcattgctg aattcctcgg taccgggttg 60 ttgattttct tcggtgtggg ttgcgttgca gcactaaaag tcgctggtgc gtcttttggt 120 cagtgggaaa tcagtgtcat ttggggactg ggggtggcaa tggccatcta cctgaccgca 180 ggggtttccg gcgcgcatct taatcccgct gttaccattg cattgtggct gtttgcctgt 240 ttcgacaagc gcaaagttat tccttttatc gtttcacaag ttgccggcgc tttctgtgct 300 gcggctttag tttacgggct ttactacaat ttatttttcg acttcgagca gactcatcac 360 attgttcgcg gcagcgttga aagtgttgat ctggctggca ctttctctac ttaccctaat 420 cctcatatca attttgtgca ggctttcgca gttgagatgg tgattaccgc tattctgatg 480 gggctgatcc tggcgttaac ggacgatggc aacggtgtac cacgcggccc tttggctccc 540 ttgctgattg gtctactgat tgcggtcatt ggcgcatcta tgggccc att gacaggtttt 600 gccatgaacc cagcgcgtga cttcggtccg aaagtctttg cctggctggc gggctggggc 660 aatgtcgcct ttaccggcgg cagagacatt ccttacttcc tggtgccgct tttcggccct 720 atcgttggcg cgattgtagg tgcatttgcc taccgcaaac tgattggtcg ccatttgcct 780 tgcgatatct gtgttgtgga agaaaaggaa accacaactc cttcagaaca aaaagcttcg 840 ctgtaa 846 <210> 2 <211> 1509 <212> DNA <213> Unknown < 220> <223> Glycerol kinase (glpK) <400> 2 atgactgaaa aaaaatatat cgttgcgctc gaccagggca ccaccagctc ccgcgcggtc 60 gtaatggatc acgatgccaa tatcattagc gtgtcgcagc gcgaatttga gcaaatctac 120 ccaaaaccag gttgggtaga acacgaccca atggaaatct gggccaccca aagctccacg 180 ctggtagaag tgctggcgaa agccgatatc agttccgatc aaattgcagc tatcggtatt 240 acgaaccagc gtgaaaccac tattgtctgg gaaaaagaaa ccggcaagcc tatctataac 300 gccattgtct ggcagtgccg tcgtaccgca gaaatctgcg agcatttaaa acgtgacggt 360 ttagaagatt atatccgcag caataccggt ctggtgattg acccgtactt ttctggcacc 420 aaagtgaagt ggatcctcga ccatgtggaa ggctctcgcg agcgtgcacg tcgtggtgaa 480 ttgctgtttg gtacggttga tacgtggctt atctggaaaa t gactcaggg ccgtgtccat 540 gtgaccgatt acaccaacgc ctctcgtacc atgttgttca acatccatac cctggactgg 600 gacgacaaaa tgctggaagt gctggatatt ccgcgcgaga tgctgccaga agtgcgtcgt 660 tcttccgaag tatacggtca gactaacatt ggcggcaaag gcggcacgcg tattccaatc 720 tccgggatcg ccggtgacca gcaggccgcg ctgtttggtc agttgtgcgt gaaagaaggg 780 atggcgaaga acacctatgg cactggctgc tttatgctga tgaacactgg cgagaaagcg 840 gtgaaatcag aaaacggcct gctgaccacc atcgcctgcg gcccgactgg cgaagtgaac 900 tatgcgttgg aaggtgcggt gtttatggca ggcgcatcca ttcagtggct gcgcgatgaa 960 atgaagttga ttaacgacgc ctacgattcc gaatatttcg ccaccaaagt gcaaaacacc 1020 aatggtgtgt atgtggttcc ggcatttacc gggctgggtg cgccgtactg ggacccgtat 1080 gcgcgcgggg cgattttcgg tctgactcgt ggggtgaacg ctaaccacat tatacgcgcg 1140 acgctggagt ctattgctta tcagacgcgt gacgtgctgg aagcgatgca ggccgactct 1200 ggtatccgtc tgcacgccct gcgcgtggat ggtggcgcag tagcaaacaa tttcctgatg 1260 cagttccagt ccgatattct cggcacccgc gttgagcgcc cggaagtgcg cgaagtcacc 1320 gcattgggtg cggcctatct cgcaggcctg gcggttggct tctggcagaa cctc gacgag 1380 ctgcaagaga aagcggtgat tgagcgcgag ttccgtccag gcatcgaaac cactgagcgt 1440 aattaccgtt acgcaggctg gaaaaaagcg gttaaacgcg glycerinase 1506 dependent hydrogen 212 212 DNA deggaagaacac <gacgaa 211 <gacgaataa 1509 <400> 3 atggaaacca aagatctgat tgtgataggg ggcggcatca atggtgctgg tatcgcggca 60 gacgccgctg gacgcggttt atccgtgctg atgctggagg cgcaggatct cgcttgcgcg 120 acctcttccg ccagttcaaa actcattcac ggtggcctgc gctaccttga gcactatgaa 180 ttccgcctgg tcagcgaggc gctggctgaa cgtgaagtgc tgctgaaaat ggccccgcat 240 atcgccttcc cgatgcgttt tcgcctgcca catcgtccgc atctgcgccc ggcgtggatg 300 attcgcattg gtctgtttat gtacgatcat ctgggtaaac gcaccagctt gccgggatca 360 actggtttgc gttttggcgc aaattcagtg ttaaaaccgg aaattaagcg cggattcgaa 420 tattctgact gttgggtaga cgacgcccgt ctggtactcg ccaacgccca gatggtggtg 480 cgtaaaggcg gcgaagtgct tactcggact cgcgccacct ctgctcgccg cgaaaacggc 540 ctgtggattg tggaagcgga agatatcgat accggcaaaa aatatagctg gcaagcgcgc 600 ggcttggtta ac gccaccgg cccgtgggtg aaacagttct tcgacgacgg gatgcatctg 660 ccttcgcctt atggcattcg cctgatcaaa ggcagccata ttgtggtgcc gcgcgtgcat 720 acccagaagc aagcctacat tctgcaaaac gaagataaac gtattgtgtt cgtgatcccg 780 tggatggacg agttttccat catcggcact accgatgtcg agtacaaagg cgatccgaaa 840 gcggtgaaga ttgaagagag tgaaatcaat tacctgctga atgtgtataa cacgcacttt 900 aaaaagcagt taagccgtga cgatatcgtc tggacctact ccggtgtgcg tccgctgtgt 960 gatgatgagt ccgactcgcc gcaggctatt acccgtgatt acacccttga tattcatgat 1020 gaaaatggca aagcaccgct gctgtcggta ttcggcggta agctgaccac ctaccgaaaa 1080 ctggcggaac atgcgctgga aaaactaacg ccgtattatc agggtattgg cccggcatgg 1140 acgaaagaga gtgtgctacc gggtggcgcc attgaaggcg accgcgacga ttatgccgct 1200 cgcctgcgcc gccgctatcc gttcctgact gaatcgctgg cgcgtcatta cgctcgcact 1260 tacggcagca acagcgagct gctgctcggc aatgcgggaa cggtaagcga tctcggggaa 1320 gatttcggtc atgagttcta cgaagcggag ctgaaatacc tggtggatca cgaatgggtc 1380 cgccgcgccg acgacgccct gtggcgtcgc acaaaacaag gcatgtggct aaatgcggat 1440 caacaatctc gtgtgagtca gtg gctggtg gagtatacgc agcagaggtt atcgctggcg 1500 tcgtaa 1506 <210> 4 <211> 1629 <212> DNA <213> Unknown <220> <223> Glycerol dehydrogenase (glpA) <400> 4 atgaaaactc gcgactcgca atcaagtgac gtgattatca ttggcggcgg cgcaacggga 60 gccgggattg cccgcgactg tgccctgcgc gggctgcgcg tgattttggt tgagcgccac 120 gacatcgcaa ccggtgccac cgggcgtaac cacggcctgc tgcacagcgg tgcgcgctat 180 gcggtaaccg atgcggaatc ggcccgcgaa tgcattagtg aaaaccagat cctgaaacgc 240 attgcacgtc actgcgttga accaaccaac ggcctgttta tcaccctgcc ggaagatgac 300 ctctccttcc aggccacttt tattcgcgcc tgcgaagaag cagggatcag cgcagaagct 360 atagacccgc agcaagcgcg cattatcgaa cctgccgtta acccggcact gattggcgcg 420 gtgaaagttc cggatggcac cgttgatcca tttcgtctga ccgcagcaaa catgctggat 480 gccaaagaac acggtgccgt tatccttacc gctcatgaag tcacggggct gattcgtgaa 540 ggcgcgacgg tgtgcggtgt tcgtgtacgt aaccatctca ccggcgaaac tcaggccctt 600 catgcacctg tcgtggttaa tgccgctggg atctgggggc aacacattgc cgaatatgcc 660 gatctg ggcattc g accttgc ggcattc tc tgatcaaccg ctgccgtaaa ccttccgacg ccgatattct ggtgcctggc 780 gataccattt cgctgattgg taccacctct ttacgtattg attacaacga gattgacgat 840 aatcgagtga cggcagaaga ggttgatatt ctgctgcgtg aaggggaaaa actggccccc 900 gtgatggcga aaacgcgcat tttgcgggcc tattctggcg tgcgcccgct ggttgccagc 960 gatgacgacc cgagcggacg taacgtcagc cgtggcatcg tgctgctcga ccatgctgaa 1020 cgcgatggtc tggacggatt tatcaccatc accggtggca aactgatgac ctatcggctg 1080 atggctgaat gggctaccga cgcggtatgc cgcaaactgg gcaacacgcg cccctgtacg 1140 actgccgatc tggcactgcc tggttcacaa gaacccgctg aagttacctt gcgtaaagtc 1200 atctccctgc ctgccccgct gcgcggttct gcggtttatc gtcatggcga tcgcacgcct 1260 gcctggctga gcgaaggccg tctgcaccgt agcctggtat gtgagtgcga agcggtaact 1320 gcgggtgaag tgcagtacgc ggtagaaaat ttaaacgtta atagcctgct ggatttacgc 1380 cgtcgtaccc gtgtggggat gggcacctgc cagggcgaac tctgcgcctg ccgcgctgcc 1440 ggactgctgc aacgttttaa cgtcacgacg tccgcgcaat ctatcgagca actttccacc 1500 ttccttaacg aacgctggaa aggcgtgcaa cccatcgcct ggggagatgc actgcgcgaa 1560 agcgaattta cccgctggg t ttatcaggga ttgtgtggtc tggagaagga gcagaaagat 1620 gcgctttga 1629 <210> 5 <211> 1071 <212> DNA <213> Unknown <220> <223> Dihydroxyacetone kinase (dhaK) <400> 5 ttatttaccc cagttaaggt tgatta ggtg t gatta tg ccggagtgtg t gatt 60 tccagtgagg tgcagtacgc 120 gccaattaaa ttacgttcga tagtcaatcc cgcttgctgg caacgtgtgg tcaggcggtt 180 atagacgccg tacagctcag aaagcggagt tgcgccaaga ttgttaacca gcgcaatcac 240 ccgatcgcca gactggagcg gttgtttggt ttgttgttct tcctgccaac tgccttgttg 300 ataatcccag aaacgcaaag tgcgatggta tgagccattt accagcaggg tgtcgaacat 360 ttcatcgacg gtttgatcaa gggaagagaa ggggcggcgg tcaatacccg gctcaccatg 420 aatgccgacg ccaaactcca tctcattatc cgccagggta aaagaaggtt tgcccgcggc 480 aggaacggta caggcaccga gagcgatacc tattgagtgg ccttgattat tcagcttacg 540 ccccagttcc gcacaggcgt ccagtgagtc gccacgctcc gccgctgcgc ctacgagttt 600 ttcaattaat acggtgttgg caacgccgcg tcgcctcggca gtataaagac tagctcaggca gtataaagac tgctcat gagtataaagac 660 cgctttttc gcct gtcgctgtt tcaaagttaa gaatatcgcc ggtgtaattt ttgataatca acagtacacc 780 ttcgccgcca tcaacttgca tggcgcattc aaagatttta tcgggcgtcg gtgaggtgaa 840 aatttcgccc ggacaggccc ccgaaagcat cccctgaccg atataaccac agtgcatcgg 900 ctcgtgtccg ctgccgccac ccgacagcag ggcgactttt cctgcaacag gggcatcagc 960 tcgggtgaca tacaccggat cctgatgcag tgtcagcgat ggatgcgctt tcgccagtcc 1020 tgccagttgt tcgtccagta cgtcttgcac atcattgatc aattttttca t 1071 <210> 6 <211> 780 <212> DNA <213> Unknown <220> <223> Alpha-acetolactase decarbonxylase (BudA) <400> 6 atgaatcatt ctgctgaatg cacctgcgaa gagagtctat gcgaaaccct gcgggcgttt 60 tccgcgcagc atcccgagag cgtgctctat cagacatcgc tcatgagcgc cctgctgagc 120 ggggtttacg aaggcagcac caccatcgcc gacctgctga aacacggcga tttcggcctc 180 ggcaccttta atgagctgga cggggagctg atcgccttca gcagtcaggt ctatcagctg 240 cgcgccgacg gcagcgcgcg caaagcccag ccggagcaga aaacgccgtt cgcggtgatg 300 acctggttcc agccgcagta ccgctggaaaacc tttgctg accgcc gaccaacc tttgctg accgcc cc caggtga cctg accgt 420 ggccatttcc gccatgccca tacccgcacc gtgccgcgcc agacgccgcc gtaccgggcg 480 atgaccgacg tactcgacga tcagccggtg ttccgcttta accagcgcga aggggtgctg 540 gtcggcttcc ggaccccgca gcatatgcag gggatcaacg tcgccgggta tcacgagcat 600 tttattaccg atgaccgcaa aggcggcggt cacctgctgg attaccagct cgaccacggg 660 gtgctgacct tcggcgaaat tcacaagctg atgatcgacc tgcccgccga cagcgcgttc 720 ctgcaggcta atctgcatcc cgataatctc gatgccgcca tccgttccgt agaaagttaa 780 780 <210> 7 <211 > 1680 <212> DNA <213> Unknown <220> <223> Acetolactate synthase (BudB) <400> 7 atggacaaac agtatccggt acgccagtgg gcgcacggcg ccgatctcgt cgtcagtcag 60 ctggaagcac agggggtacg ccaggtgttc ggcatccccg gcgccaaaat cgacaaggtc 120 ttcgattcac tgctggattc ctccattcgc attattccgg tacgccacga agccaacgcc 180 gcatttatgg ccgccgccgt cggacgtatt accggcaaag cgggcgtggc gctggtcacc 240 tccggtccgg gttgttctaa cctgatcacc ggcatggcca ccgcgaacag cgaaggcgac 300 ccggtggtgg ccctgggcgg cgcggtaaaa cgcgcgccgata aagccaaaca g aggtcacca cggtccaaaca g aggtcacca ggcg 420 ccggatgcgc tggcggaagt ggtctccaac gccttccgcg ccgccgagca gggccggccg 480 ggcagcgcgt tcgttagcct gccgcaggat gtggtcgatg gcccggtcag cggcaaagta 540 ctgccggcca gcggggcccc gcagatgggc gccgcgccgg atgatgccat cgaccaggtg 600 gcgaagctta tcgcccaggc gaagaacccg atcttcctgc tcggcctgat ggccagccag 660 ccggaaaaca gcaaggcgct gcgccgtttg ctggagacca gccatattcc agtcaccagc 720 acctatcagg ccgccggagc ggtgaatcag gataacttct ctcgcttcgc cggccgggtt 780 gggctgttta acaaccaggc cggggaccgt ctgctgcagc ttgccgacct ggtgatctgc 840 atcggctaca gcccggtgga atacgaaccg gcgatgtgga acagcggcaa cgcgacgctg 900 gtgcacatcg acgtgctgcc cgcctatgaa gagcgcaact acaccccgga tgtcgagctg 960 gtaggcgata tcgccggcac tctcaacaag ctggcgcaaa atatcgatca tcggctggtg 1020 ctctccccgc aggcggcgga gatcctccgc gaccgccagc accagcgcga gctgctggac 1080 cgccgcggcg cgcagctcaa ccagtttgcc ctgcatccgc tgcgtatcgt tcgcgccatg 1140 caggacatcg tcaacagcga cgtcacgttg accgtggaca tgggcagctt ccatatctgg 1200 attgcccgct acctgtacag cttccgcgcc cgccaggtga tgatctccaa cggccagcag 1260 accat ggcg tcgccctgcc ctgggccatc ggcgcctggc tggtcaatcc tgagcgcaaa 1320 gtggtctccg tctccggcga cggcggcttc ctgcagtcga gcatggagct ggagaccgcc 1380 gtccgcctga aagccaacgt gctgcacctg atctgggtcg ataacggcta caacatggtg 1440 gccattcagg aagagaaaaa ataccagcgc ctgtccggcg tcgagtttgg gccgatggat 1500 tttaaagcct atgccgaatc cttcggcgcg aaagggtttg ccgtggaaag cgccgaggcg 1560 ctggagccga ccctgcgcgc ggcgatggac gtcgacggcc cggcggtagt ggccatcccg 1620 gtggattatc gcgataaccc gctgctgatg ggccagctgc atctgagtca gattctgtaa 1680 1680 <210> 8 <211> 771 <212> DNA <213> Unknown <220> <223> Acetoin reductase (BudC) <400> 8 atgaaaaaag tcgcacttgt taccggcgcc ggccagggga ttggtaaagc tatcgccctt 60 cgtctggtga aggatggatt tgccgtggcc attgccgatt ataacgacgc caccgccaaa 120 gcggtcgcct ccgaaatcaa ccaggccggc ggccgcgcca tggcggtgaa agtggatgtt 180 tctgaccgcg accaggtatt tgccgccgtc gaacaggcgc gcaaaacgct gggcggcttc 240 gacgtcatcg tcaacaacgc cggcgtggcg ccatccacgc cgatcgaacgtc cattaccaggg acaagcagtcgg gg acagcaacgtc cattaccagg acaagcagtagg 36 0 gcggtcgagg cctttaagaa agagggtcac ggcgggaaaa tcatcaacgc ctgttcccag 420 gccggccacg tcggcaaccc ggagctggcg gtatatagct cgagtaaatt cgcggtacgc 480 ggcttaaccc agaccgccgc tcgcgacctc gcgccgctgg gcatcacggt caacggctac 540 tgcccgggga ttgtcaaaac gccgatgtgg gccgaaattg accgccaggt gtccgaagcc 600 gccggtaaac cgctgggcta cggtaccgcc gagttcgcca aacgcatcac cctcggccgc 660 ctgtccgagc cggaagatgt cgccgcctgc gtctcctatc ttgccagccc ggattctgat 720 tatatgaccg gtcagtcatt gctgatcgac ggcggcatgg tgtttaacta a 771 <210> 9 <211> 1809 <212> DNA <213> Unknown <220> <223> Calcium-dependent methanol dehydrogenase mxaFI <400> 9 atgcaacacc ataaaaaacg cgaactctgg ggcgcggcgg cattagtgtc gagtctctttg 60 ctagtagtc acca gatta caggact tagtc accattag 60 ctggccgtc taggacca tagtc g actatagcga gttgtacgat 180 atcaacatta cgaatgtaca aaacctgaag ccggcctggt cattttcaac cggcgttctg 240 aacggtcatg aaggcggtcc tctggtcgtc gacggcatta tcgagtatgtaca ctcgccctat 300 tacttttgtc gtagta attcaaa 360 cctaagcaaa acccggccgc acgcgcggtg gcttgttgcg acgttgtcaa ccgcggcttg 420 gcttatgcgc cgcaaggcaa ggattatccg gcgactatct ttttgaatca gcttgacgga 480 catgtcgtcg cattgaatgc gaaaaccggc gaactgctat ggaaaatgga aaactccgac 540 atcgcgatgg gctcgacgct gactgtggcg ccgttcgtcg ctgaggataa agtcatcgtc 600 ggcacttccg gcgccgaatt aggggttcgc ggatacgcga ccgcctacaa catcaaagac 660 ggcaaacaag cctggcgcgt ctatgcgacc ggtcccgacg aagacatcaa gctgtcgaaa 720 gacttcaaca aggccaatcc gcattacggg cagttcggtc tggggctgaa aacctgggaa 780 ggcgatgcct ggaaaatcgg cggcggtacg aactggggtt ggtatgcata cgatcctgac 840 ttgagaatgc tgtactacgg atcgggtaac ccagcgccct ggaacgaaac gatgcgtccc 900 ggcgacaaca aatggaccat gacgatctgg ggccgcgata tcgagaccgg ggaagcgaaa 960 ttcggctatc aaaaaacgcc tcacgacgaa tgggattatg ccggcgtcaa ttacatgggg 1020 ctgtccgagc agaaggtcaa cggtaagatg accaagttgc tgacccatcc ggaccgtaac 1080 ggtatcgtct atacgctaaa ccgcgaaaac ggcgacctgg tcaacgcgtt caagatcgac 1140 aacacagtca actgggtcaa gcatgtcgat ttgaaaaccg gactgccggt acgcgatcct 1200 gaat attcga cacgcatgga tcacgaagcg aaaggcatct gtccttcggc aatgggttat 1260 cacaaccaag gcatcgagtc ctacgatccg aacaagcaat tgttcttcat gggcgtcaac 1320 cacatctgca tggattggga gccgtttatg ttgccttatc gggccggcca attcttcgtc 1380 ggagcgacgt tgaacatgta tccgggaccg aaaggcacgt taggtcaagt caaggcgatg 1440 aacggcgtga ccggcgagtt cgaatgggaa gttcaggaga aattcgcggt ttggggcggc 1500 acgaccgcaa cagccggcga cttggtcttc tacggcacgt tggacggcta catcaaggcc 1560 ttgaactcga aaaccggcga agaactatgg aaattcaagc tgccttccgg cgtgatcggt 1620 catccgatta cctataaaca cgaaggtaag caatatgtcg cgatttatta tggagtcggc 1680 ggttggccag gtgtcggctt ggtcttcgat ctgaaagacc cgtctgccgg tttaggcgcg 1740 gtcggtgcgt ttaaggagtt ggcgcatcac acccaaatgg gcggcggcgt gatggtattc 1800 tcgttgtaa 1809 <210> 10 <211> 1854 <212> DNA <213> Unknown <220> <223> lanthanum-dependent methanol dehydrogenase xoxF <400> 10 atgaagaagc ctgtcaaaag ctggctgatt gcttcaactg tcgcagccct gcttgcagta 60 cctgcagtat ctcaagcgaa tagcgaagtt gaaaaattga cccaaaaccc tgcgaactgg 120 gcgacttg tcaggtaacta gtacc cgttacagcg aactcaaaca aatcaatact 180 tctaacgtca aaaacctgca accgtcatgg actttttcaa ccggcgttct gcgcggtcat 240 gaaggcggcc cactggttat caatgacgtc atgtatattc acacaccatt ccctaacacc 300 gtttatgcga tcgaccaaaa gtctcaagcg gtcatttggg aatatactcc gcaacaagac 360 gccgacgtca ctatccctgt aatgtgctgt gacaccgtca accgcggatt agcttacggt 420 gacggtaaaa tcttcctgca acaatccgat accgtattga ctgcgttgga cgctaaaacc 480 ggtaaacgcg tatggagcgt gcaaaacggc gatcctaaat tgggcatgac caacactcaa 540 gcacctttgg tcgttaaaga caaagtcatc accggcatct ccggcggtga attcggcgtg 600 cgcggcttct tggcggctta caacatccgt accggcgagc tggactggaa aggctacagc 660 atggggccgg atgccgacac actgattaat gcaacaaaaa ccacaacatg gaaagacggt 720 aaagttcaac ctgtcggcaa ggattccagc cttagcactt gggaaggcga ccaatggaaa 780 atcggcggcg gcaccacttg gggctggtat agctatgatc ctgaattgaa cctggtctat 840 tacggatcgg gcaacccttc gacttggaac ccggcgcaac gtcctggcga caacaagtgg 900 tcgatgtcat tgtgggctcg tgacgccgac accggcgaag tcaaatgggt ttaccaaatg 960 actccgcatg acgaatggga ttacgacggc atcaacgaag tcg cactcgt cgatcaagaa 1020 atcaatggca aaatgcgtaa aaccgccgtc cacttcgacc gtaacggttt cggctacacg 1080 ctggaccgcg tcaccggcga attgttggtt gccgaaaaat tcgacaaagc cctgactgcatgtc tc tgacta gtaagtc tc cc ggctgcatgtc acct tacaacggcg aagatgtcaa tactgaaggc gtctgccctg cggcattggg aagcaaaaac 1260 caacagcctg tttcttactc tccgcaaacc ggttatttct atatatccgg caaccacgtt 1320 tgcatggact acgaaccgtt cgaggttgaa tacactgccg gccaacctta tgttggtgcg 1380 accttgtcta tgttcccggc cggtaaagat gccatcacag gaaaagaaga cggctctaat 1440 aacctgggtc aattcactgc atgggatgct acaaccggta aaatcatctg gtctaacaaa 1500 gagcaattct cggtatggtc aggttcgctg gctactgccg gcggtgtcgt tttctacggc 1560 actctggaag gctacctgaa agcggtcgac gcaaaaacag gtaaagagct ttaccggttt 1620 aaaacacctt ccggcatcat tggtaacgtc aatacttggg aatacgaagg caaacaatat 1680 gtcggcgtac tgtcaggcgt cggcggctgg gctggtatcg gtattgctgc gggactcgac 1740 tccggcgaag aatcttctaa ctctgaaggt ttaggagcgg tcggcgcata cagaagctta 1800 agctcttaca ctaaattggg cggcacatta actgtattcg cattgcctaa ttaa 1854 <210> 11 <211> 999 <212> DNA <213> Unknown <220> <223> dependent glycerol 3-phosphate dehydrogenase (gpsA) <400> 11 atgacctcaa ctatcagcgt actcggtgcc gggtcatggg gcactgcttt agcgatacaa 60 gcagcccgaa acggctatcg tacgctgctg tggggac acg atccaatcca tattcgaaca 120 ctacaacaga atagaaccaa tcagcgatac ttgcccggtt ttgtttttcc caacaccctt 180 gaaaccagct ctgaacttgc cgaagccgca gcattcagcg acttaatcct gattgccgtt 240 cctagtcatg cattcaagga cacgctgatc aagctacgtc gatttaccgg ccaacaggtg 300 caaatcgcct gggctaccaa agggttcgca ccaaacgacg ggtatttgtt acattactcg 360 gtcgaacgca tattttccaa agagactccg actgcggttt tatccggtcc gacttttgcc 420 cgcgaagtcg cggccgattt accgacggca attacaattg catctaatca tgccggcttc 480 tctgaactat taacccgaat cttccacagc gcacgattcc gcacttacac cagcaccgac 540 atgatcggcg tacaaaccgg cggcgcggtt aaaaacgtat tggctatcgc ctcgggcatt 600 gcagacggtc tgaatttcgg cgccaacaca cgcgccgcac tcattacacg gggactccat 660 gaaataatca ggctcggctt agaactcggc ggccgacaag aaacgttcat gggccttgcc 720 ggactcggcg acttgatttt aacttgtacc gacaaccaat caagaaaccg gcgcttcgga 780 cttgcgctcg gacagaacaa aaatcgcgcc gcagcccgtg aagaaatcga ccaagaaatc 840 gaaggcgtgt cggctgcaaa agaaacttat ttacttgcgc agacccacgg catcgacatg 900 ccgattactg aacaaaccta caaagtactc tatgagagct tatcgccgct ggctg ccgtg 960caaaacctat tggaccgcga attaaaagcc gaaagctag 999

Claims (18)

글리세롤의 분해 또는 이용 경로에 관여하는 대장균 유래의 서열번호 1을 포함하는 글리세롤 트랜스포터(glycerol transporter, glpF), 서열번호 2를 포함하는 글리세롤인산화효소(glycerol kinase, glpK), 서열번호 3을 포함하는 FAD 의존적 글리세롤 3-인산탈수소효소(FAD+-dependent glycerol 3-phosphate dehydrogenase, glpD), 메틸로마이크로비움 알칼리필리움 20Z(Methylomicrobium alcaliphilum 20Z) 유래의 서열번호 11의 글리세롤 3-인산 탈수소효소(glycerol 3-phosphate dehydrogenase, gpsA), 클렙시엘라 뉴모니애(Klebsiella pneumoniae) 유래의 서열번호 6을 포함하는 아세토락테이트 디카르복실레이즈(acetolactate decarboxylase, budA), 서열번호 7을 포함하는 아세토락테이트 생합성효소 (acetolactate synthase, budB) 및 서열번호 8을 포함하는 아세토인 환원효소 (acetoin reductase, budC)를 코딩하는 유전자가 도입 또는 증폭되어, 글리세롤 존재 하에서 2,3-부탄디올(2,3-buthandiol) 생산능을 가지는 것을 특징으로 하는 형질 전환된 메탄자화균(Methanotrophic bacteria).A glycerol transporter (glycerol transporter, glpF) containing SEQ ID NO: 1 derived from Escherichia coli involved in the degradation or use of glycerol, glycerol kinase containing SEQ ID NO: 2 (glycerol kinase, glpK), SEQ ID NO: 3 containing FAD-dependent glycerol 3-phosphate dehydrogenase (FAD+-dependent glycerol 3-phosphate dehydrogenase, glpD), glycerol 3-phosphate dehydrogenase of SEQ ID NO: 11 from Methylomicrobium alcaliphilum 20Z (glycerol 3-phosphate dehydrogenase) phosphate dehydrogenase, gpsA), acetolactate decarboxylase (budA) containing SEQ ID NO: 6 derived from Klebsiella pneumoniae, acetolactate biosynthetase containing SEQ ID NO: 7 ( A gene encoding acetolactate synthase, budB) and acetoin reductase (budC) comprising SEQ ID NO: 8 was introduced or amplified, and 2,3-butanediol (2,3-buthandiol) production ability was obtained in the presence of glycerol. Transformed methanotrophic bacteria, characterized in that it has. 제1항에 있어서,
상기 메탄자화균은 대장균 유래의 서열번호 4를 포함하는 글리세롤 탈수소효소(Glycerol dehydrogenase, glpA) 및 서열번호 5를 포함하는 디하이드록시아세톤 키나아제(dihydroxyacetone kinase, dhaK)를 코딩하는 유전자가 추가로 도입 또는 증폭되도록 형질전환된 메탄자화균.The method of claim 1,
The methanogen is a glycerol dehydrogenase containing SEQ ID NO: 4 derived from E. coli (Glycerol dehydrogenase, glpA) and SEQ ID NO: 5 dihydroxyacetone kinase (dihydroxyacetone kinase, dhaK) containing a gene encoding an additional introduced or Methanogen transformed to be amplified. 삭제delete 제1항에 있어서,
상기 메탄자화균은 메틸로마이크로비움 속 미생물인 것을 특징으로 하는 메탄자화균. The method of claim 1,
The methanogenic bacteria are methanogenic bacteria, characterized in that they are microorganisms of the genus Methylomicrobium. 제1항에 있어서,
상기 메탄자화균은 메틸로마이크로비움 알칼리필리움 20Z(Methylomicrobium alcaliphilum 20Z)인 것을 특징으로 하는 메탄자화균. The method of claim 1,
The methanogenic bacteria are methanogenic bacteria, characterized in that Methylomicrobium alcaliphilum 20Z. 제1항의 메탄자화균에 글리세롤을 포함하는 2,3-부탄디올 생산용 조성물.A composition for producing 2,3-butanediol comprising glycerol in the methanogenic bacteria of claim 1. 제6항에 있어서,
상기 글리세롤은 조성물 내에 0.1 내지 1.0 중량%로 포함하는 것을 특징으로 하는 2,3-부탄디올 생산용 조성물.7. The method of claim 6,
The composition for producing 2,3-butanediol, characterized in that the glycerol is included in an amount of 0.1 to 1.0% by weight in the composition. 제6항에 있어서,
상기 조성물은 30 내지 70 부피%의 메탄을 추가적으로 포함하는 것을 특징으로 하는 2,3-부탄디올 생산용 조성물.7. The method of claim 6,
The composition for the production of 2,3-butanediol, characterized in that it further comprises 30 to 70% by volume of methane. 제1항의 메탄자화균을 글리세롤이 포함된 배지에서 배양하여, 전환 반응을 유도하는 2,3-부탄디올의 생산 방법.A method for producing 2,3-butanediol inducing a conversion reaction by culturing the methanogen of claim 1 in a medium containing glycerol. 제9항에 있어서,
상기 전환 반응은 배양액에 0.1 내지 1.0 % 의 글리세롤을 첨가하여 수행하는 것인, 2,3-부탄디올의 생산 방법.10. The method of claim 9,
The conversion reaction is a method for producing 2,3-butanediol, which is carried out by adding 0.1 to 1.0% of glycerol to the culture medium. 제9항에 있어서,
상기 전환 반응은 24시간마다 30 내지 70% v/v의 메탄을 첨가하여 수행하는 것인, 2,3-부탄디올의 생산 방법.10. The method of claim 9,
The method for producing 2,3-butanediol, wherein the conversion reaction is performed by adding 30 to 70% v/v of methane every 24 hours. 제1항의 메탄자화균에서, 메탄올 탈수소 효소를 불활성화시킨 것을 특징으로 하는 메탄 또는 에탄을 메탄올 또는 에탄올로 전환하는 메탄자화균.In the methanogenic bacteria of claim 1, the methanogenic bacteria converting methane or ethane into methanol or ethanol, characterized in that the methanol dehydrogenase is inactivated. 제 12항에 있어서,
상기 메탄자화균은 서열번호 9를 포함하는 칼슘 의존적 mxaFI 시스템 및 서열번호 10을 포함하는 란타늄 의존성 xoxF 시스템이 녹아웃 된 것을 특징으로 하는 메탄자화균.13. The method of claim 12,
The methanator is a methanator, characterized in that the calcium-dependent mxaFI system containing SEQ ID NO: 9 and the lanthanum-dependent xoxF system containing SEQ ID NO: 10 are knocked out. 제 12항의 메탄자화균에 글리세롤을 포함하는 메탄 및 에탄을 메탄올 및 에탄올로 전환하는 메탄올 또는 에탄올 생산용 조성물.A composition for producing methanol or ethanol for converting methane and ethane containing glycerol to methanol and ethanol in the methanogenic bacteria of claim 12 . 제 14항에 있어서,
상기 글리세롤은 배양 배지의 0.1 내지 1.0 중량%로 첨가하여 수행하는 것인, 메탄올 또는 에탄올 생산용 조성물.15. The method of claim 14,
The glycerol is to be carried out by adding 0.1 to 1.0% by weight of the culture medium, methanol or ethanol production composition. 제 15항에 있어서,
상기 배양 배지는 30 내지 50 부피%의 메탄 또는 에탄을 추가로 첨가하여 수행하는 것인, 메탄올 또는 에탄올 생산용 조성물.16. The method of claim 15,
The culture medium is to be carried out by additionally adding 30 to 50% by volume of methane or ethane, methanol or ethanol production composition. 제 12 항의 메탄자화균을 글리세롤이 포함된 배지에서 배양하는 단계;
30 내지 70 부피%의 메탄 및 에탄을 더 첨가하여 배양하는 단계; 및
배양된 배양물에서 메탄올 및 에탄올을 수득하는 단계를 포함하는 메탄올 또는 에탄올 생산 방법.Culturing the methanogenic bacteria of claim 12 in a medium containing glycerol;
Culturing by further adding 30 to 70% by volume of methane and ethane; and
A method for producing methanol or ethanol comprising the step of obtaining methanol and ethanol from a cultured culture. 제 17항에 있어서,
상기 글리세롤은 배양 배지의 0.1 내지 1.0 중량%로 첨가하여 수행하는 것인, 메탄올 또는 에탄올 생산 방법.18. The method of claim 17,
The glycerol is to be carried out by adding 0.1 to 1.0% by weight of the culture medium, methanol or ethanol production method.
KR1020200095935A 2020-07-31 2020-07-31 Development of methanotroph that assimilate glycerol and production of high value-added alcohol using itself KR102401557B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020200095935A KR102401557B1 (en) 2020-07-31 2020-07-31 Development of methanotroph that assimilate glycerol and production of high value-added alcohol using itself

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020200095935A KR102401557B1 (en) 2020-07-31 2020-07-31 Development of methanotroph that assimilate glycerol and production of high value-added alcohol using itself

Publications (2)

Publication Number Publication Date
KR20220016391A KR20220016391A (en) 2022-02-09
KR102401557B1 true KR102401557B1 (en) 2022-05-26

Family

ID=80266155

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020200095935A KR102401557B1 (en) 2020-07-31 2020-07-31 Development of methanotroph that assimilate glycerol and production of high value-added alcohol using itself

Country Status (1)

Country Link
KR (1) KR102401557B1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150232888A1 (en) 2012-10-15 2015-08-20 Calysta Inc. Genetically engineered microorganisms for biological oxidation of hydrocarbons
US20180087059A1 (en) 2012-10-24 2018-03-29 Calysta, Inc. Engineering of multi-carbon substrate utilization pathways in methanotrophic bacteria

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130011343A (en) * 2011-07-21 2013-01-30 한국생명공학연구원 Method for producing diol compound with high yield using mutant of glycerol fermenting microorganism
KR102165641B1 (en) 2017-10-30 2020-10-15 서강대학교산학협력단 Composition for the production of propanol containing methanotroph and propanol production method

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150232888A1 (en) 2012-10-15 2015-08-20 Calysta Inc. Genetically engineered microorganisms for biological oxidation of hydrocarbons
US20180087059A1 (en) 2012-10-24 2018-03-29 Calysta, Inc. Engineering of multi-carbon substrate utilization pathways in methanotrophic bacteria

Also Published As

Publication number Publication date
KR20220016391A (en) 2022-02-09

Similar Documents

Publication Publication Date Title
Cheng et al. Metabolic engineering of Clostridium carboxidivorans for enhanced ethanol and butanol production from syngas and glucose
Yazdani et al. Engineering Escherichia coli for the efficient conversion of glycerol to ethanol and co-products
JP6445970B2 (en) Recombinant microorganisms and uses thereof
Wang et al. Glycerol dehydrogenase plays a dual role in glycerol metabolism and 2, 3-butanediol formation in Klebsiella pneumoniae
US9422565B2 (en) Recombinant microorganisms comprising NADPH dependent enzymes and methods of production therefor
US20140106424A1 (en) Reducing Carbon Dioxide Production and Increasing Ethanol Yield During Microbial Ethanol Fermentation
Cha et al. Deletion of a gene cluster for [Ni-Fe] hydrogenase maturation in the anaerobic hyperthermophilic bacterium Caldicellulosiruptor bescii identifies its role in hydrogen metabolism
AU2013363249B2 (en) Process for producing n-propanol and propionic acid using metabolically engineered propionibacteria
Le et al. Sustainable biosynthesis of chemicals from methane and glycerol via reconstruction of multi‐carbon utilizing pathway in obligate methanotrophic bacteria
Matsakas et al. New trends in microbial production of 3-hydroxypropionic acid
Li et al. Comparative transcriptome analysis of Clostridium tyrobutyricum expressing a heterologous uptake hydrogenase
TWI824995B (en) Arginine supplementation to improve efficiency in gas fermenting acetogens
Debabov Acetogens: Biochemistry, bioenergetics, genetics, and biotechnological potential
Crépin et al. Alka (e) ne synthesis in Cupriavidus necator boosted by the expression of endogenous and heterologous ferredoxin–ferredoxin reductase systems
Fu et al. Enhanced ethanol production from lignocellulosic hydrolysates by inhibiting the hydrogen synthesis in Thermoanaerobacterium aotearoense SCUT27 (Δldh)
Le et al. Biological production of 2-propanol from propane using a metabolically engineered type I methanotrophic bacterium
KR102401557B1 (en) Development of methanotroph that assimilate glycerol and production of high value-added alcohol using itself
WO2017094053A1 (en) Recombinant cell, method for producing recombinant cell, and method for producing organic compound
JP2005507255A (en) Fungal microorganisms with enhanced ability to carry out biotechnology processes
JP6470532B2 (en) Recombinant cells and methods for producing organic compounds
US20110152511A1 (en) Genetically transformed microorganisms with simultaneous enhancement of reduction potential and reductive enzyme activities for biomass fermentation
CN113840909A (en) Fermentative production of 2-phenylethyl alcohol from gaseous substrates
KR20210045752A (en) Transformed methanotrophs for producing 1,3-butanediol and uses thereof
Lee et al. A simple biosynthetic pathway for 2, 3-butanediol production in Thermococcus onnurineus NA1
Gan et al. Metabolic engineering strategies for microbial utilization of methanol

Legal Events

Date Code Title Description
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right