KR102379220B1 - Composition and method for producing hydroxy fatty acid or dihydroxy fatty acid using 5r-lipoxygenase variant - Google Patents

Abstract

The present invention is Sphingomonas macrogoltabidus ( Sphingomonas macrogoltabidus ) From the amino acid sequence of lipoxygenase, at least one amino acid selected from the group consisting of amino acids 381, 385 and 392 mutated 5 R -lipoxygenase variant It relates to a composition and method for preparing a hydroxylated fatty acid or dihydroxylated fatty acid comprising as an active ingredient.

Description

A composition for preparing a hydroxylated fatty acid or dihydroxylated fatty acid using a 5R-lipoxygenase variant, and a production method using the same

The present invention relates to a composition for preparing hydroxylated fatty acid using a 5R-lipoxygenase mutant in which Sphingomonas macrogoltabidus -derived lipoxygenase is modified by site-directed mutation and a preparation method using the same, and the 5R-lipoxygenase It relates to a composition for preparing a dihydroxylated fatty acid using a combination of an ase variant and another regio lipoxygenase, and a manufacturing method using the same.

Hydroxated fatty acids are substances that exist in the lipids of various living organisms in nature, such as animals, plants, insects, and microorganisms, and have hydroxyl groups in fatty acids. Hydroxated fatty acids are used as raw materials industrially because of their excellent reactivity by hydroxyl groups, and are used as raw materials for cosmetics because of their high surface tension reduction and antibacterial and antifungal activity due to the action of hydroxyl groups. 5-hydroxylated fatty acids found in animals, especially among various living things, can contribute to innate immune responses by being used as precursors of signal transduction substances in the human body, so that only a single substance is involved in various physiological activities. Among lipid mediators, which are a kind of human signal transduction material, maresin and resolvin are mainly produced from polyunsaturated fatty acids and are converted by the dioxygenation reaction of lipoxygenase. Maresin and resolvin are important substances involved in various physiological functions such as homeostasis regulation and immune response in mammals including humans.

Specifically, maresin (MaR) and resolving (Rv) are products of a combination reaction of lipoxygenases (LOX) and are mainly omega 3 polyunsaturated fatty acids docosapentaenoic acid (docosapentaenoic acid, DPA) or docosahexaenoic acid (DHA) is a form of dihydroxy fatty acid produced by the sequential reaction of LOX from acid. Depending on the substrate used, Maresin 1 n-3 (Maresin 1 n-3) and Resolvin D5 n-3 (Resolvin D5 n-3) when using docosapentaenoic acid, Maresin 1 when using docosahexaenoic acid (Maresin 1) and Resolvin D5 (Resolvin D5). These substances are endogenous lipid mediators derived from the resolution of acute inflammation, and have been confirmed to have strong anti-inflammatory and early anti-inflammatory actions in several animal models. In the case of Maresin 1, it has been reported that in the E. coli model, neutrophils flocked to the site of inflammation during inflammation are removed to contribute to the resolution of inflammation, and Maresin 1 n-3 (Maresin 1 n-3) is a human It is known to exhibit a biological action similar to that of Maresin 1 in macrophages. In addition, in the case of Resolvin D5, it is reported that it has an antibiotic effect to protect hypothermia and viability and to remove skin infections caused by Staphylococcus aureus, a Gram-negative bacteria, and Resolvin D5 n-3 (Resolvin D5 n-3) has been reported to increase the phagocytosis of neutrophils by macrophages. Accordingly, the synthesis of maresins revealed so far was produced using a chemical synthesis method rather than a biological production method, and this chemical synthesis method has about 30 reaction steps, and organic solvents, heavy metals such as tin and lead, and toxicity As a method of synthesizing using carcinogens that are strong and harmful to the human body, pollutants and by-products produced in this chemical synthesis process are not biodegradable in nature, causing environmental pollution. In addition to the resolvins studied so far, if a resolvin analog with a similar material structure is developed, the strong bioactivity such as the existing resolvin can suggest the possibility of replacing other drugs related to resolving inflammation. The developed materials, which are considered necessary, can be used as research materials in various fields such as medicine, biology, and biotechnology, as well as the potential for next-generation anti-inflammatory related medical materials like other lipid mediators.

Lipoxygenase (LOX) is a dioxygenase, and although it is an oxidase enzyme, it does not contain heme and contains iron. Peroxidized fatty acid converted by an enzyme that converts it is converted to hydroxylated fatty acid with one oxygen in its natural state. Characteristically, only polyunsaturated fatty acids having two or more cis,cis-1,4-pentadiene are used as substrates to catalyze stereospecificity and reaction specificity through dioxygenation. The site specificity is different depending on the type of polyunsaturated fatty acid used as a substrate, and it is named as a site-specific oxidase depending on the position where it oxidizes mainly to arichidonic acid, an unsaturated fatty acid having 20 carbon atoms. 5 S -, 8 S -, 8 R -, 11 S -, 11 R- -, 12 S -, 12 R -, 15 S -lipoxygenase are present. Among them, 5R- lipoxygenase prepared through site-directed mutagenesis of 9- lipoxygenase , which produces a hydroxyl group at position 9 of animal polyunsaturated fatty acids. ), a hydroxyl group is formed at the 5th carbon position in an unsaturated fatty acid having 20 or more carbon atoms, such as arachidonic acid. In addition, this enzyme forms a hydroxyl group at the 7th carbon position in unsaturated fatty acids having 22 or more carbon atoms. In the case of 5R - Lipoxygenase , 5S- Lipoxygenase has been found in animals including humans so far, and 5R-Lipoxygenase has not been found in humans so far. algae) has been reported to 5R -hydroxyarachidonic acid, but the identification and biochemical properties of 5R -lipoxygenase have not been reported at all.

The present invention is to prepare a hydroxylated fatty acid or dihydroxylated fatty acid by a bioconversion process using a 5 R -lipoxygenase variant in which a novel microorganism-derived lipoxygenase is modified by site-directed mutation, Sphingomonas macrogoltavidus ( Sphingomonas macrogoltabidus ) From the amino acid sequence of the derived lipoxygenase, at least one amino acid selected from the group consisting of the 381th, 385th and 392th amino acids is mutated 5 R -Hydroxygenated fatty acid or dioxic acid comprising a lipoxygenase variant as an active ingredient To provide a composition and the like for preparing a fatty acid.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.

The present invention is Sphingomonas macrogoltabidus ( Sphingomonas macrogoltabidus ) From the amino acid sequence of lipoxygenase, at least one amino acid selected from the group consisting of amino acids 381, 385 and 392 mutated 5 R -lipoxygenase variant A composition for preparing a hydroxylated fatty acid comprising as an active ingredient, the hydroxylated fatty acid is 5 R -hydroxyarachidonic acid, 5 R -hydroxyeicosapentaenoic acid, 5 R - Provided is a composition for preparing a hydroxylated fatty acid, wherein at least one selected from the group consisting of hydroxydocosapentaenoic acid (5 R -hydroxydocosapentaenoic acid) and 5 R -hydroxydocosahexaenoic acid (5 R -hydroxydocosahexaenoic acid).

In the 5 R -lipoxygenase variant, from the amino acid sequence of the lipoxygenase, alanine (A) at the 381th amino acid is substituted with glycine (G), and leucine (L) at the 385th amino acid is tryptophan (W) or phenylalanine (F), isoleucine (I) at the 392th amino acid may be substituted with phenylalanine (F), and valine (V) at the 569th amino acid may be substituted with phenylalanine (F).

The 5 R -lipoxygenase variant may be composed of the amino acid sequence of SEQ ID NO: 1.

The composition has at least one carbon number selected from the group consisting of arachidonic acid, eicosapentaenoic acid, eicosapentaenoic acid and docosahexaenoic acid, 20- 22 may be for processing on a substrate comprising unsaturated fatty acids.

In one embodiment of the present invention, from the amino acid sequence of lipoxygenase derived from Sphingomonas macrogoltabidus , at least one amino acid selected from the group consisting of amino acids 381, 385 and 392 is mutated 5 R -lipoxygenase variants; and 11 S -lipoxygenase from Myxococcus xanthus , 12 S -lipoxygenase from Myxococcus xanthus or 15 S -lipoxygenase from Burkholderia thailandensis A composition for preparing a dihydroxylated fatty acid comprising cygenase as an active ingredient, wherein the dihydroxylated fatty acid is 5 R , 11 S -dihydroxyarachidonic acid (5 R , 11 S -dihydroxyarachidonic acid), 5 R , 12 S - arachidonic acid dihydroxy. Acid (5 R , 12 S -dihydroxyarachidonic acid), 5 R , 15 S -arachidonic acid dihydroxyl (5 R , 15 S -hydroxyarachidonic acid), 5 R , 11 S -eicosapentaenoic acid dihydrate (5 R , 11 S -dihydroxyeicopentaenoic acid), 5 R , 12 S -eicosapentaenoic acid dihydrate (5 R , 12 S -dihydroxyeicopentaenoic acid), 5 R , 15 S -eicosapentaenoic acid dihydrate (5 R , 15 S -hydroxyeicopentaenoic acid), 7 R , 13 S -docosapentaenoic acid dihydrate (7 R , 13 S -dihydroxydocosapentaenoic acid), 7 R , 13 S -docosapentaenoic acid dihydrate (7 R , 13 S -dihydroxydocosapentaenoic acid) , 7 R , 13 S -Docosapentaenoic acid dihydrate (7 R , 13 S -hydroxydocosapentaenoic acid), 7 R , 13 S -Docosahexaenoic acid dihydrate (7 R , 13 S -dihydroxydocosahexaenoic acid), 7 R , 13 S -Docosahexaenoic acid dihydroxyl (7 R , 13 S -dihydroxydocosahexaenoic acid) and 7 R , 13 S -Docosahexaenoic acid dihydrate (7 R , 13 S -hydroxydocosahexaenoic acid) It provides at least one selected from the group consisting of, a composition for preparing a dihydroxylated fatty acid.

The 11 S -lipoxygenase is composed of the amino acid sequence of SEQ ID NO: 2, the 12 S -lipoxygenase is composed of the amino acid sequence of SEQ ID NO: 3, and the 15 S -lipoxygenase is the amino acid sequence of SEQ ID NO: 4 may be made of

In another embodiment of the present invention, there is provided a composition for preparing the hydroxylated fatty acid comprising the 5 R -lipoxygenase mutant gene consisting of the nucleotide sequence of SEQ ID NO: 5 as an active ingredient.

In another embodiment of the present invention, 5 R -lipoxygenase mutant gene consisting of the nucleotide sequence of SEQ ID NO: 5; and 11 S -lipoxygenase gene consisting of the nucleotide sequence of SEQ ID NO: 6, 12 S -lipoxygenase gene consisting of the nucleotide sequence of SEQ ID NO: 7, or 15 S -lipoxygenase gene consisting of the nucleotide sequence of SEQ ID NO: 8 It provides a composition for preparing the above dihydroxylated fatty acid comprising as a component.

In another embodiment of the present invention, there is provided a method for preparing the hydroxylated fatty acid comprising the step of treating the composition to a substrate.

The treatment may be carried out at pH 6.5 to pH 9.0 and at 20°C to 40°C.

In another embodiment of the present invention, there is provided a method for producing the dihydroxylated fatty acid comprising the step of treating the composition to a substrate.

In another embodiment of the present invention, there is provided a recombinant expression vector for preparing the hydroxylated fatty acid comprising the 5 R -lipoxygenase mutant gene consisting of the nucleotide sequence of SEQ ID NO: 5.

In another embodiment of the present invention, there is provided a transformant transformed with the recombinant expression vector in a host cell.

In another embodiment of the present invention, there is provided a novel dihydroxylated fatty acid represented by any one of the following Chemical Formulas 1 to 4:

[Formula 1]

,

,

[Formula 2]

,

,

[Formula 3]

,

,

[Formula 4]

.

.

According to the present invention, a novel microorganism-derived lipoxygenase is converted to a bioconversion process using a 5 R -lipoxygenase variant or a combination of the 5 R -lipoxygenase variant and other sited lipoxygenase modified by site-directed mutation. Since hydroxylated fatty acid or dihydroxylated fatty acid can be produced with high productivity and high yield, it is expected to be usefully used in various industrial fields such as medicine, food and cosmetics.

The hydroxylated fatty acid or dihydroxylated fatty acid prepared according to the present invention is a signal transmitter and its analog used for signal transduction in the human body, and is expected to be involved in various physiologically active functions in animals including humans.

1 is a synthetic pathway of 5 R -hydroxylated arachidonic acid produced using arachidonic acid as a substrate using the 5 R -lipoxygenase variant of the present invention, and 11 S using the 5 R -lipoxygenase variant of the present invention. -Lipoxygenase , 12 S -Lipoxygenase or 15 S -Lipoxygenase 5R,11S -Dihydroxydonic acid, 5R , 12S -Dihydroxylated , produced using fatty acid already reacted with hydroxylated fatty acid as a substrate It shows the synthesis route of arachidonic acid or 5 R ,15 S -dihydroxydonic acid.
2(a) and (b) are reversed-phase and normal-phase HPLC chromatograms confirming the production of 5R -hydroxylated arachidonic acid, and FIG. 2(c) is 5R , 11S -reversed-phase HPLC confirming the production of arachidonic acid. It is a chromatogram, and FIG. 2(d) is a reversed-phase HPLC chromatogram confirming the production of 5R , 12S -dihydroxydonic acid, and FIG. 2(e) is a reversed phase confirming the production of 5R ,15S-dihydroxydonic acid. HPLC chromatogram.
3 (a) to (d) are 5 R -hydroxydonic acid, 5 S , 11 S - arachidonic acid dihydroxy, 5 R , 12 S - arachidonic acid dihydrate and 5 R , 15S - material of arachidonic acid dihydroxy The results of LC-MS/MS for identification are shown.
Figure 4 (a) is a HPLC chromatogram confirmed for the identification of the chiral of 5 R -hydroxylated arachidonic acid, Figure 4 (b) is 5 R ,12 S - Identification of the chiral of arachidonic acid dihydroxyl It is an HPLC chromatogram confirmed for , and FIG. 4(c) is an HPLC chromatogram confirmed for identification of a chiral of 5 R ,15 S - arachidonic acid dihydroxy.
Figure 5 (a) shows the effect of the pH of the 5 R - lipoxygenase mutant of the present invention on the 5 R - hydroxylated arachidonic acid production activity (●: HEPES buffer, ▼: HEPPS buffer, ■: CHES buffer), Figure 5 (b) shows the effect of the temperature of the 5 R -lipoxygenase variant of the present invention on the 5 R -hydroxylated arachidonic acid production activity.
Figure 6 shows the hourly production of 5R -hydroxydonic acid and 9S -hydroxylated arachidonic acid produced using arachidonic acid as a substrate using the 5R -lipoxygenase variant of the present invention (■: arachidonic acid, ▼ : 5 R -hydroxydonic acid, ○: 9 S -hydroxylated arachidonic acid).
7 is a synthetic route of 5 R -hydroxylated eicosapentaenoic acid produced using eicosapentaenoic acid as a substrate using the 5R -lipoxygenase variant of the present invention, and 5R -lipoxygenase of the present invention. 5R, 11S -dihydroxylated eicosapentaenoic acid produced using a hydroxyfatty acid that has already been reacted with 11 S -lipoxygenase, 12 S -lipoxygenase or 15 S -lipoxygenase using a mutant as a substrate , 5 R ,12 S -Eicosapentaenoic acid dihydrate or 5 R ,15 S -Eicosapentaenoic acid dihydrate shows the synthesis route.
8(a) and (b) are reversed-phase and normal-phase HPLC chromatograms confirming the production of 5R-hydroxylated eicosapentaenoic acid, and FIG. 8(c) is 5R ,11 S - dihydroxylated eicosapentaenoic acid. is a reversed-phase HPLC chromatogram confirming the production of, Figure 8(d) is a reverse-phase HPLC chromatogram confirming the production of 5R,12S-dihydrate eicosapentaenoic acid, Figure 8(e ) is 5R , 15S- This is a reversed-phase HPLC chromatogram confirming the production of eicosapentaenoic acid dihydrate.
9 (a) to (d) are 5 R -eicosapentaenoic acid hydroxide, 5S,11 S - eicosapentaenoic acid dihydrate, 5R,12S-eicosapentaenoic acid dihydrate and 5R , shows the results of LC-MS/MS for material identification of 15S-eicosapentaenoic acid dihydrate.
10 shows the hourly production of 5 R-hydroxylated eicosapentaenoic acid and 9 S - hydroxylated eicosapentaenoic acid produced using eicosapentaenoic acid as a substrate using the 5R-lipoxygenase variant of the present invention. (■: eicosapentaenoic acid, ▼: 5 R -hydroxyl eicosapentaenoic acid, ○: 9 S -hydroxyl eicosapentaenoic acid).
11 is a synthetic route of 7R-hydroxylated docosapentaenoic acid produced using docosapentaenoic acid as a substrate using the 5R-lipoxygenase variant of the present invention, and 5R -lipoxygenase of the present invention 7R, 13S -dihydroxylated docosapentaenoic acid produced using a hydroxyfatty acid already reacted with 11S-lipoxygenase, 12S -lipoxygenase or 15S -lipoxygenase as a substrate using the variant; 7 R ,14 S -docosapentaenoic acid dihydrate (Maresin 1 n-3) or 7 R ,17 S -docosapentaenoic acid dihydrate (stereospecific isomer of Resolvin D5 n-3) it has been shown
12(a) and (b) are reversed-phase and normal phase HPLC chromatograms confirming the production of 7R-hydroxylated docosapentaenoic acid, and FIG. 12(c) is 7R, 13S -dihydroxylated docosapentaenoic acid. It is a reversed-phase HPLC chromatogram confirming the production, and FIG. 12(d) is a reverse-phase HPLC chromatogram confirming the production of 7R,14S- docosapentaenoic acid dihydrate ( malecin 1 n-3), FIG. 12(e) is a reversed-phase HPLC chromatogram confirming the production of 7R, 17S - docosapentaenoic acid dihydrate (a stereospecific isomer of resolvin D5 n-3).
13 (a) to (d) are 7 R - hydroxy docosapentaenoic acid, 7 S , 13 S - dihydrate docosapentaenoic acid, 7 R , 14 S - docosapentaenoic acid dihydrate (Maresin 1 n -3) and 7R, 17S -Dihydroxydocosapentaenoic acid (a stereospecific isomer of Resolvin D5 n -3) was performed by LC-MS/MS for material identification.
Figure 14 shows the hourly production of 7R-hydroxylated docosapentaenoic acid and 11S-hydroxylated docosapentaenoic acid produced using docosapentaenoic acid as a substrate using the 5R-lipoxygenase variant of the present invention. (■: docosapentaenoic acid, ▼: 7 R -hydroxy docosapentaenoic acid, ○: 11 S -hydroxy docosapentaenoic acid).
15 is a synthetic route of 7R-hydroxylated docosahexaenoic acid produced using docosahexaenoic acid as a substrate using the 5R -lipoxygenase variant of the present invention, and 5R -lipoxygenase of the present invention 11 S -Lipoxygenase, 12 S -Lipoxygenase or 15 S -Lipoxygenase using the variant, 7 R ,13 S -Dihydroxydocosahexaenoic acid produced by using as a substrate a hydroxylated fatty acid that has already been reacted, The synthetic route of 7R, 14S -dihydroxylated docosahexaenoic acid ( Maresin 1) or 7R , 17S -dihydroxylated docosahexaenoic acid (a stereospecific isomer of Resolvin D5) is shown.
16 (a) and (b) are reversed-phase and normal phase HPLC chromatograms confirming the production of 7 R -hydroxylated docosahexaenoic acid, and FIG. 16 (c) is 7 R ,13 S -hydroxylated docosahexaenoic acid It is a reversed-phase HPLC chromatogram confirming the production, and FIG. 16(d) is a reverse-phase HPLC chromatogram confirming the production of 7R, 14S -docosahexaenoic acid dihydrate ( Maresin 1), and FIG. 16(e) is 7R ,17 S - This is a reversed-phase HPLC chromatogram confirming the production of docosahexaenoic acid dihydroxylated (a stereospecific isomer of Resolvin D5 n-3).
17 (a) to (d) are 7 R -hydroxylated docosahexaenoic acid, 7S, 13S -dihydroxylated docosahexaenoic acid, 7R , 14S -dihydroxylated docosahexaenoic acid ( Maresin 1) and 7 R ,17 S - LC-MS/MS for material identification of dihydroxydocosahexaenoic acid (a stereospecific isomer of Resolvin D5) is shown.
Figure 18 shows the hourly production of 7R -hydroxylated docosahexaenoic acid and 11S -hydroxylated docosahexaenoic acid produced using docosahexaenoic acid as a substrate using the 5R -lipoxygenase variant of the present invention. (■: docosahexaenoic acid, ▼: 7 R -hydroxylated docosahexaenoic acid, ○: 11 S -hydroxylated docosahexaenoic acid).
19 shows a recombinant vector synthesizing the 5R -lipoxygenase variant, 11S -lipoxygenase, 12S -lipoxygenase and 15S -lipoxygenase, respectively.

The present inventors first identified the gene and enzyme of 9 S - lipoxygenase from Sphingomonas macrogoltabidus corresponding to Gram-negative bacteria, and then 5 R - lipoxygenase variant through its site-directed mutation was finally manufactured, and continuous research was conducted to produce hydroxy fatty acid or dihydroxy fatty acid more effectively through the bioconversion process using this.

Specifically, the present inventors described the 5R- lipoxygenase variant, Myxococcus xanthus derived 11 S -Lipoxygenase, Myxococcus xanthus derived 12 S -Lipoxygenase and Berkolde By cloning 15 S -lipoxygenase derived from Burkholderia thailandensis , a recombinant expression vector and a transformed microorganism are prepared therefrom, and whole cells are produced using the cloning, and then treated with this environmentally friendly substrate. Through the process, it was confirmed that hydroxylated fatty acid or dihydroxylated fatty acid could be produced with high productivity and high yield, and the present invention was completed.

At this time, among the produced dihydroxy fatty acids, the following Chemical Formulas 1 to 4 are novel compounds and are involved in various physiologically active functions in animals including humans:

[Formula 1]

,

,

[Formula 2]

,

,

[Formula 3]

,

,

[Formula 4]

.

.

Hereinafter, the present invention will be described in detail.

As used herein, the term "hydroxylated fatty acid" refers to a fatty acid, preferably an unsaturated fatty acid having 20 to 22 carbon atoms, in which one hydroxyl group or a peroxide group is substituted, using the 5 R -lipoxygenase variant of the present invention. Can be produced, specifically, 5 R -hydroxyarachidonic acid (5 R -hydroxyarachidonic acid; 5 R -HETE), 5 R -hydroxyeicosapentaenoic acid (5 R -hydroxyeicosapentaenoic acid; 5 R -HEPE), 7 R -hydroxydocosapentaenoic acid (7 R -hydroxydocosapentaenoic acid; 7 R -HDOPE), 7 R -hydroxydocosahexaenoic acid (7 R -hydroxydocosahexaenoic acid; 7 R -HDOHE) may be at least one selected from the group consisting of , respectively, are represented by the following formulas 5 to 8 in order:

[Formula 5]

,

,

[Formula 6]

,

,

[Formula 7]

,

,

[Formula 8]

.

.

As used herein, the term "dihydroxylated fatty acid" refers to a fatty acid, preferably, an unsaturated fatty acid having 20 to 22 carbon atoms, in which two hydroxyl groups or peroxide groups are substituted, specifically, 5 R -lipoxygenase of the present invention variant; and 11 S -lipoxygenase from Myxococcus xanthus , 12 S -lipoxygenase from Myxococcus xanthus or 15 S -lipoxygenase from Burkholderia thailandensis . It can be produced by combining sygenase, and more specifically, the 5 R -lipoxygenase variant of the present invention; And when 11 S -lipoxygenase derived from Myxococcus xanthus is combined, 5R, 11S -dihydroxyarachidonic acid ( 5R,11S-dihydroxyarachidonic acid; 5R, 11S - diHETE ) , 5 R ,11 S -eicosapentaenoic acid dihydrate ( 5R,11 S -dihydroxyeicosapentaenoic acid; 5R,11S- diHEPE ) , 7R,13S- docosapentaenoic acid dihydroxyoxide ( 7R,13 selected from the group consisting of S -dihydroxydocosapentaenoic acid; 7R , 13S - diHDOPE ), and 7R, 13S -dihydroxydocosahexaenoic acid (7R, 13S -dihydroxydocosahexaenoic acid; 7R, 13S - diHDOHE ) . It may be one or more, and are respectively represented by the following formulas 9 and 10 in order, and the rest are novel compounds, and are represented by formulas 1 and 3 as above:

[Formula 9]

,

,

[Formula 10]

.

.

In addition, the 5 R -lipoxygenase variant of the present invention; And when 12 S -lipoxygenase derived from Myxococcus xanthus is combined, 5R, 12S -dihydroxyarachidonic acid ( 5R,12S-dihydroxyarachidonic acid; 5R, 12S - diHETE ) , 5 R ,12 S -eicosapentaenoic acid dihydrate (5 R ,12 S -dihydroxyeicosapentaenoic acid; 5 R ,12 S -diHEPE), 7 R ,14 S -docosapentaenoic acid dihydrate or maresin 1 n -3(7R,14S-dihydroxydocosapentaenoic acid; 7R, 14S - diHDOPE or Maresin 1 n -3) and 7R,14S-dihydroxydocosahexaenoic acid or maresin 1 ( 7R , 14S- It may be one or more selected from the group consisting of dihydroxydocosahexaenoic acid;

[Formula 11]

,

,

[Formula 12]

,

,

[Formula 13]

,

,

[Formula 14]

.

.

In addition, the 5 R -lipoxygenase variant of the present invention; And when 15 S -lipoxygenase derived from Burkholderia thailandensis is combined, 5R,15S-dihydroxyarachidonic acid ( 5R,15S-dihydroxyarachidonic acid; 5R , 15S - diHETE ) ), 5R,15S-dihydroxyeicosapentaenoic acid ( 5R, 15S -dihydroxyeicosapentaenoic acid; 5R, 15S - diHEPE ) , 7R , 17S -dihydroxyeicosapentaenoic acid ( 7R , selected from the group consisting of 17 S -dihydroxydocosapentaenoic acid; 7 R ,17 S -diHDOPE) and 7 R ,17 S -dihydroxydocosahexaenoic acid (7 R ,17 S -dihydroxydocosahexaenoic acid; 7 R ,17 S -diHDOHE). It may be one or more, and are respectively represented by the following formulas 15 and 16 in order, and the rest are novel compounds and are represented by formulas 2 and 4 as above:

[Formula 15]

,

,

[Formula 16]

.

.

Composition for preparing hydroxylated fatty acid or dihydroxylated fatty acid

The present invention is Sphingomonas macrogoltabidus ( Sphingomonas macrogoltabidus ) From the amino acid sequence of lipoxygenase, at least one amino acid selected from the group consisting of amino acids 381, 385 and 392 mutated 5 R -lipoxygenase variant It provides a composition for preparing the hydroxylated fatty acid comprising as an active ingredient.

In addition, the present invention is the 5 R -lipoxygenase variant; and 11 S -lipoxygenase from Myxococcus xanthus , 12 S -lipoxygenase from Myxococcus xanthus or 15 S -lipoxygenase from Burkholderia thailandensis It provides a composition for preparing the above dihydroxylated fatty acid comprising cygenase as an active ingredient.

First, the composition for preparing hydroxylated fatty acid or dihydroxylated fatty acid according to the present invention is one selected from the group consisting of 381th, 385th and 392th amino acids from the amino acid sequence of Sphingomonas macrogoltabidus -derived lipoxygenase. The above amino acids are mutated to include the 5 R -lipoxygenase variant as an active ingredient, and may include whole cells including the 5R -lipoxygenase variant.

First, the lipoxygenase is a wild-type isolated from a novel microorganism, Sphingomonas macrogoltabidus , and can be used to produce hydroxylated fatty acids or dihydroxylated fatty acids from fatty acids, specifically , a two-step oxidation reaction of producing hydroxy fatty acid from fatty acid through oxidation reaction and then producing dihydroxy fatty acid through additional oxidation reaction can be performed well. Therefore, dihydroxy fatty acid may be the main product, and hydroxylated fatty acid may be a by-product. In this case, the dihydroxylated fatty acid may be one in which a hydroxyl group is formed at the 9th carbon position of an unsaturated fatty acid having 20 carbon atoms, and then a hydroxyl group is formed at the 15th carbon position, or a hydroxyl group is formed at the 11th carbon position of an unsaturated fatty acid having 22 or more carbon atoms. After that, a hydroxyl group may be formed at the 17th carbon position.

Accordingly, the 5 R -lipoxygenase variant of the present invention is modified by the lipoxygenase site-directed mutation, and can be used to produce hydroxylated fatty acids from fatty acids. Specifically, hydroxylated fatty acids from fatty acids through oxidation reaction One-step oxidation reaction to produce In this case, the hydroxylated fatty acid may be one in which a hydroxyl group is formed at the 5th carbon position of an unsaturated fatty acid having 20 carbon atoms, and a hydroxyl group formed at the 7th carbon position in an unsaturated fatty acid having 22 or more carbon atoms.

Specifically, referring to the results of Table 1 below, the 5R-lipoxygenase variant is one or more amino acids selected from the group consisting of the 381th , 385th and 392th amino acids from the amino acid sequence of the lipoxygenase mutated In the 5R-lipoxygenase variant, from the amino acid sequence of the lipoxygenase, alanine (A) at position 381 is substituted with glycine (G), and leucine (L) at position 385 is tryptophan (W) ) or phenylalanine (F), isoleucine (I) at position 392 is substituted with phenylalanine (F), and valine (V) at position 569 is more preferably substituted with phenylalanine (F), in 5 The R -lipoxygenase variant is most preferably an A381G/L385W/I392F/V569F variant, but is not limited thereto.

amino acid residues specific activity
(U g ¹ ) HETE position (%) 5- 9- 11- 12- 15- Wild type 158 0 94.1 0 0 5.9 A381G 109 12.4 80.9 0 6.7 0 L385W 43.4 13.2 68.7 4.2 4.9 8.9 I392F 68.1 20.1 74.6 0 0 5.3 A381G/L385W 41.5 37.7 49.9 0 3.7 8.7 A381G/I392F 55.2 37.6 47.4 3.9 4.4 6.7 A381G/L385F/I392F 33.0 45.4 42.4 3.8 4.5 3.9 A381G/L385W/I392F 37.8 62.7 33.5 0 0 3.8 A381G/L385W/I392F/V569F 25.1 81.9 18.1 0 0 0

Accordingly, the 5 R -lipoxygenase variant not only consists of the amino acid sequence of SEQ ID NO: 1, but also its functional equivalent, that is, one or more substitutions, deletions, etc. in the sequence to induce mutations to achieve the object of the present invention It is meant to include all mutants to be achieved, and the 5 R -lipoxygenase variant may be a product expressed from a gene consisting of the nucleotide sequence of SEQ ID NO: 5.

On the other hand, the optimal active pH of the 5 R -lipoxygenase variant is 6.5 to 9.0, preferably 6.5 to 8.5, more preferably 6.5 to 7.5, and the optimal activity temperature is 20 °C to 40 °C, preferably 20 °C to 35°C, more preferably 20°C to 30°C.

Next, the composition for preparing a dihydroxylated fatty acid according to the present invention is the 5 R -lipoxygenase variant, in addition, myxococcus xanthus ( Myxococcus xanthus ) derived 11 S -lipoxygenase, myxococcus xanthus ( Myxococcus xanthus ) ) derived from 12 S - lipoxygenase or Burkholderia thailandensis ( Burkholderia thailandensis ) Derived to include 15 S - lipoxygenase as an active ingredient, the 11 S - lipoxygenase, 12 S - lipoxygenase or 15 It may include whole cells comprising S -lipoxygenase.

The 11 S - lipoxygenase, 12 S - lipoxygenase or 15 S - lipoxygenase is a wild-type (wild-type), the 11 S - lipoxygenase, 12 S - lipoxygenase or 15 S - lipoxygenase Aze not only consists of the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, but also its functional equivalent, that is, one or more substitutions, deletions, etc. in the sequence to achieve the object of the present invention by inducing mutations It is meant to include all mutants, and the 11 S -lipoxygenase, 12 S -lipoxygenase or 15 S -lipoxygenase is from a gene consisting of the nucleotide sequence of SEQ ID NO: 6, SEQ ID NO: 7 or SEQ ID NO: 8 Each may be an expressed product.

Specifically, the whole cell comprising the 5 R -lipoxygenase variant, 11 S -lipoxygenase, 12 S -lipoxygenase or 15 S -lipoxygenase is SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or Culturing a transformed microorganism transformed with a recombinant expression vector comprising a gene encoding the amino acid sequence of SEQ ID NO: 4 or a gene consisting of the nucleotide sequence of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8, and obtain this It is preferable to use

As the recombinant expression vector, any vector may be used as long as it is a plasmid vector used in the art for gene recombination. Specifically, it is more preferable to use a pET-28a-c(+) vector, but is not limited thereto.

As the transformation microorganism, any microorganism may be used as long as it is a microorganism used in the art as a system for overexpressing a desired protein by transformation with a recombinant vector, and specifically, it is more preferable to use Escherichia coli ER 2566 strain, not limited

The whole cells are obtained by: i) centrifuging the culture solution of the microorganism to recover primary whole cells; ii) washing the recovered whole cells with saline solution; iii) second centrifuging the washed whole cells to remove the supernatant to obtain whole cells; and iv) washing the secondarily recovered whole cells with physiological saline once again. Specifically, the recovery of whole cells in step i) can be performed in a range of around 6,000xg using a device known in the art such as a centrifuge, and washing of whole cells in step ii) is performed with 0.85% or less sodium chloride solution. It is appropriate to perform

At this time, the concentration of whole cells containing the 5 R -lipoxygenase variant, 11 S -lipoxygenase, 12 S -lipoxygenase or 15 S -lipoxygenase in the composition is 0.01 g/L to 1 g/ It is preferably L, and more preferably 0.1 g/L to 1 g/L, but is not limited thereto.

The composition has at least one carbon number selected from the group consisting of arachidonic acid, eicosapentaenoic acid, eicosapentaenoic acid and docosahexaenoic acid, 20- for treatment on a substrate comprising 22 unsaturated fatty acids (preferably with one or more cis, cis-1,4 pentadiene).

The concentration of the unsaturated fatty acid having 20 to 22 carbon atoms in the substrate is preferably 0.1 mM to 10 mM, but is not limited thereto. The unsaturated fatty acid having 20 to 22 carbon atoms may improve the production concentration of hydroxylated fatty acid or dihydroxylated fatty acid by maintaining this concentration.

On the other hand, the present invention provides a composition for preparing the hydroxylated fatty acid comprising the 5 R -lipoxygenase mutant gene consisting of the nucleotide sequence of SEQ ID NO: 5 as an active ingredient.

In addition, the present invention 5 R -lipoxygenase mutant gene consisting of the nucleotide sequence of SEQ ID NO: 5; and 11 S -lipoxygenase gene consisting of the nucleotide sequence of SEQ ID NO: 6, 12 S -lipoxygenase gene consisting of the nucleotide sequence of SEQ ID NO: 7, or 15 S -lipoxygenase gene consisting of the nucleotide sequence of SEQ ID NO: 8 It provides a composition for preparing the above dihydroxylated fatty acid comprising as a component.

In addition, the present invention provides a recombinant expression vector for preparing hydroxylated fatty acid comprising a 5 R -lipoxygenase mutant gene consisting of the nucleotide sequence of SEQ ID NO: 5, and a transformant in which the recombinant expression vector is transformed into a host cell do.

The 5 R -lipoxygenase variant gene, 11 S -lipoxygenase gene, 12 S -lipoxygenase gene or 15 S -lipoxygenase gene is SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 or SEQ ID NO: 8 It is meant to include not only the base sequence, but also functional equivalents thereof, that is, all mutants that achieve the object of the present invention by inducing one or more substitutions, deletions, etc., mutations in the sequence.

Method for producing hydroxylated fatty acid or dihydroxylated fatty acid

The present invention provides a method for producing the hydroxylated fatty acid or dihydroxylated fatty acid comprising the step of treating the composition on a substrate.

The method for producing a hydroxylated fatty acid or a dihydroxylated fatty acid according to the present invention includes treating the composition to a substrate.

Since the specific content of the composition is the same as described above, a redundant description thereof will be omitted.

The substrate has at least one carbon number selected from the group consisting of arachidonic acid, eicosapentaenoic acid, eicosapentaenoic acid, and docosahexaenoic acid 20- 22 unsaturated fatty acids.

The concentration of the unsaturated fatty acid having 20 to 22 carbon atoms in the substrate is preferably 0.1 mM to 10 mM, but is not limited thereto. The unsaturated fatty acid having 20 to 22 carbon atoms may improve the production concentration of hydroxylated fatty acid or dihydroxylated fatty acid by maintaining this concentration.

The treatment is preferably carried out at pH 6.5 to pH 9.0 and 20 °C to 40 °C, more preferably at pH 6.5 to pH 7.5 and 20 °C to 35 °C, but is not limited thereto. In order to maintain these pH conditions, HEPES, EPPS, or CHES buffer may be used as a reaction solvent. By maintaining such a pH condition, the enzyme used can be optimally activated, and finally, hydroxylated fatty acid or dihydroxylated fatty acid can be prepared with high productivity and high yield. In addition, the treatment is preferably performed for 10 minutes or more, but is not limited thereto.

Optionally, the treatment may be performed through reaction with cysteine at a concentration of 100 mM to 400 mM, and preferably through reaction with cysteine at a concentration of 100 mM to 300 mM, but is not limited thereto. Accordingly, the enzyme used can be optimally activated, and finally, hydroxylated fatty acid or dihydroxylated fatty acid can be produced with high productivity and high yield.

As described above, the novel microorganism-derived lipoxygenase is modified by site-directed mutation or a combination of the 5 R -lipoxygenase variant and other site- directed lipoxygenase to a bioconversion process. Since hydroxylated fatty acid or dihydroxylated fatty acid can be produced with high productivity and high yield, it is expected to be usefully used in various industrial fields such as medicine, food and cosmetics.

The hydroxylated fatty acid or dihydroxylated fatty acid prepared according to the present invention is a signal transmitter and its analog used for signal transduction in the human body, and is expected to be involved in various physiologically active functions in animals including humans.

Hereinafter, preferred examples are presented to help the understanding of the present invention. However, the following examples are provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.

Example 1. 9 S -Lipoxygenase, 11 S -Lipoxygenase, 12 S -Lipoxygenase and 15 S - Construction of recombinant expression vector and microorganism containing gene for expression of lipoxygenase

9 S - lipoxygenase, 11 S - lipoxygenase, 12 S - lipoxygenase and 15 S - To prepare the lipoxygenase gene of the present invention, Sphingomonas macrogoltabidus ( Spingomonas macrogoltabidus ) derived 9 S -Lipoxygenase gene, Myxococcus xanthus derived from 11S -Lipoxygenase gene and 12S-Lipoxygenase gene, Burkholderia thailandensis 15S-Lipoxygenase gene was first isolated.

Specifically, the gene base sequence and amino acid sequence are already specified Sphingomonas macrogoltabidus ( Spingomonas macrogoltabidus ), Myxococcus xanthus ( Myxococcus xanthus ) and Burkholderia thailandensis ) DNA bases of each Sphingomonas macrogoltabidus ), Myxococcus xanthus ) and Burkholderia thailandensis genomics to perform a polymerase chain reaction (PCR) based on the sequence DNA was extracted (Intron) and used as a template for PCR. Based on the DNA sequence of 9 S -Lipoxygenase, 11 S -Lipoxygenase, 12 S -Lipoxygenase and 15 S -Lipoxygenase Each primer was designed and polymerase chain reaction (PCR) was performed. Restriction enzymes Nde I and Hind III were used as primers for the sequence of 9 S -lipoxygenase, and the primer sequence was F: GCT CGA CCA TAT GTC CTT TGT GTC GCC TTC GCT G and R: GCG CCC AAG CTT TCA GAT ATT It consisted of GAT GCT CGT CGG G, 11 S -Lipoxygenase sequence primers were restriction enzymes Nde I and Hind III, and the primer sequence was F; GCC GCA TAT GAC TGT CGA GTA CAA AC and R; It was composed of TAC AAG CTT TCA GAC GGT GAT GCC G, restriction enzymes Nde I and Hind III were used as primers for the 12 S -lipoxygenase sequence, and the primer sequence was F: AGC GGC CTG GTG CCG CGC GGC AGC CAT ATG GCT GAC ATC ACG CAT CGA ACC GTA AAG and R : ATC TCA GTG GTG GTG GTG GTG GTG CTC GAG TCA GGC CGG CAG CTT CTT CAG GAA GGC CAG. Nde I and Hind III were used, and the primer sequence was F: AGC GGC CTG GTG CCG CGC GGC AGC CAT ATG GTC AAT CAC AAA ACC GGG TCA AAT ATG and R: ATC TCA GTG GTG GTG GTG GTG GTG CTC GAG TCA AAT GTT It consisted of CGT GCT TGC CGG AAT CCG GCT. In addition, the plasmid vector pET 28a(+) (manufactured by Novagen) was prepared by treatment with a restriction enzyme, followed by ligation to pET 28a(+)/9 S -lipoxygenase, pET 28a(+)/11 S -lipoxygenase, respectively. ase, pET 28a(+)/12 S -lipoxygenase and pET 28a(+)/15 S -lipoxygenase were prepared.

The recombinant expression vector obtained as described above was transformed into E. coli ER 2566 strain purchased from New England Biolabs (Hertfordshire, UK) by a conventional transformation method, and the transformed microorganism was added with 20% glycerine solution. and stored frozen at -70 °C.

Example 2.5 R - Construction of recombinant expression vector and microorganism containing gene for expression of lipoxygenase mutant

5 R - To prepare a lipoxygenase mutant gene of the present invention, Sphingomonas macrogoltabidus ( Spingomonas macrogoltabidus ) It was prepared using a site-directed mutation of the 9 S - lipoxygenase gene (Site-directed mutagenesis). .

Specifically, using the plasmid of Spingomonas macrogoltabidus prepared in Example 1 as a template for PCR, primers modified with A381G, L385W, I392F, V569F based on the amino acid sequence (Primer) was devised, respectively, and polymerase chain reaction (PCR) was performed. The primer sequence of A381G consisted of F: atc aac gaa cag ggg gcg acc tcg ctg and R: cag cga ggt cgc ccc ctg ttc gtt gat, and the primer sequence of L385W consisted of F: g ggg gcg acc tcg tgg atc gcg gcg R: g ttc gcc gcg atc cac gag gtc gcc ccc, and the primer sequence of I392F consisted of F: cg gcg aac ggc ccg ttc gac cat att ttc g and R: cg aaa ata tgg tcg aac ggg ccg ttc gcc g The primer sequence of V569F was F: cg ctc gaa caa ttg aac ttc ctc gaa ctg ctg ggg tc and R: ga ccc cag cag ttc gag gaa gtt caa ttg ttc gag cg. produced.

The recombinant expression vector obtained as described above was transformed into E. coli ER 2566 strain purchased from New England Biolabs (Hertfordshire, UK) by a conventional transformation method, and the transformed microorganism was added with 20% glycerine solution. Thus, it was stored frozen at -70 °C before culturing for production of hydroxylated fatty acid or dihydroxylated fatty acid.

Example 3.5 R -lipoxygenase variants, 11 S -Lipoxygenase, 12 S -Lipoxygenase and 15 S -Preparation of lipoxygenase

For protein expression of the enzyme, the transformed microorganisms stored frozen in Example 1 were aerated at 200 rev/min in a flask with 500 ml of LB (Difco, Sparks, MD, USA) medium and 20 μg/ml of kanamycin. Incubated at 37 °C under the conditions. When the absorbance of the bacteria reached 0.6 to 0.8 at 600 nm, after adding the final concentration of 0.1 mM IPTG to induce protein expression of the enzymes, the culture was stirred at 150 rev/min at 16 °C for 16-18 hours while stirring cultured.

E. coli cells containing the cultured 5 R -lipoxygenase variant, 11 S -lipoxygenase, 12 S -lipoxygenase and 15 S -lipoxygenase were collected and used. In addition, the 5 R -lipoxygenase mutant, 11 S -lipoxygenase, 12 S -lipoxygenase and 15 S -lipoxygenase produced by overexpression as described above, the culture medium of the transformed strain was 6,000xg 4 After centrifugation at ℃ for 30 minutes, washed twice with 0.85% sodium chloride (NaCl), and then used as recombinant cells for the production of hydroxylated fatty acids or dihydroxylated fatty acids.

Example 4.5 R - from arachidonic acid using a lipoxygenase variant 5 R -Hydroxy arachidonic acid, 5 R ,11 S -Arachidonic acid dihydrate, 5 R ,12 S -Arachidonic acid dihydrate and 5 R ,15 S -Construction of the synthesis route of arachidonic acid dihydrate

Using the 5R - lipoxygenase variant, 5R-hydroxylated arachidonic acid and 5R , 11S -dihydroxylated arachidonic acid, 5R , 12S -dihydroxylated arachidonic acid and 5R , 15S -dihydroxylated arachidonic acid Arachidonic acid (ARA) was used as a substrate to construct a synthetic pathway.

First, for the production of 5 R -hydroxydonic acid, 0.1 g/L of 5 R -lipoxygenase mutant was used with respect to 1 mM arachidonic acid, 200 Mm cysteine was added, and pH 7.0 and 30 ° C. for 40 minutes carried out.

Next, for the production of 5R, 11S -dihydroxylated arachidonic acid, 0.4 g/ L of 5R -lipoxygenase mutant was used for 1 mM 11S -hydroxylated arachidonic acid, pH 7.0 and 30 at 30 °C. minutes were carried out. In addition, for the production of 5R, 12S -dihydroxydonic acid, 0.4 g/ L of 5R -lipoxygenase mutant was used with respect to 1 mM 12S -hydroxylated arachidonic acid, pH 7.0 and 30°C for 30 minutes. was carried out during In addition, for the production of 5R, 15S -dihydroxydonic acid, 0.4 g/ L of 5R -lipoxygenase mutant was used with respect to 1 mM 15S -hydroxylated arachidonic acid, pH 7.0 and 30°C for 30 minutes. was carried out during

As a result, a synthetic route as shown in FIG. 1 was constructed. In addition, 5 R -arachidonic acid hydroxide (reverse phase and normal), 5 R ,11 S -arachidonic acid dihydroxy acid (reverse phase), 5 R ,12 S -arachidonic acid dihydrate (reverse phase) and 5 R ,15 S through HPLC. - The production of arachidonic acid dihydroxylated (reversed phase) was confirmed (Fig. 2(a)~(e)), and through material identification, 5 R -hydroxydonic acid, 5 R , 11 S - arachidonic acid dihydroxylated, 5 R , 12 S - arachidonic acid dihydrate and 5 R ,15 S - arachidonic acid dihydrate were confirmed (FIGS. 3(a) to (d)).

Example 5.5 R - using lipoxygenase variants, 5 R -Hydroxy arachidonic acid, 5 R ,12 S -Arachidonic acid dihydrate and 5 R ,15 S - Confirmation of chiral properties of arachidonic acid dihydrate

In order to confirm the chirality of 5R -hydroxylated arachidonic acid using the 5R -lipoxygenase variant, arachidonic acid was used as a substrate. For the production of 5R-hydroxylated arachidonic acid, 0.1 g/ L of 5R -lipoxygenase mutant was used with respect to 1 mM arachidonic acid, 200 Mm cysteine was added, and the reaction was carried out at pH 7.0 and 30° C. for 40 minutes. . As a result, the chirality of 5 R -hydroxydonic acid was confirmed through HPLC (FIG. 4(a)).

In addition, in order to confirm the chirality of 5R, 12S -dihydroxylated arachidonic acid using the 5R - lipoxygenase variant, 12S -hydroxylated arachidonic acid was used as a substrate. For the production of 5R, 12S -dihydroxydonic acid, 0.4 g/ L of 5R -lipoxygenase mutant was used for 1 mM 12S -hydroxylated arachidonic acid and 200 Mm cysteine was added, pH 7.0 and It was carried out at 30 °C for 30 minutes. As a result, the chirality of 5 R ,12 S -dihydroxydonic acid was confirmed through HPLC (FIG. 4(b)).

In addition, in order to confirm the chirality of 5R, 15S -dihydroxydonic acid using the 5R - lipoxygenase variant, 15S -hydroxylated arachidonic acid was used as a substrate. For the production of 5R, 15S -dihydroxydonic acid, 0.4 g/ L of 5R -lipoxygenase mutant was used for 1 mM 15S -hydroxylated arachidonic acid and 200 Mm cysteine was added, pH 7.0 and It was carried out at 30 °C for 30 minutes. As a result, the chirality of 5R , 15S -dihydroxydonic acid was confirmed through HPLC (FIG. 4(c)).

Example 6. 5 R -The pH and temperature of the lipoxygenase variant is 5 R -Effect on production activity of hydroxyarachidonic acid

In order to investigate the effect of pH on the production of 5 R -hydroxylated arachidonic acid using the 5 R -lipoxygenase variant, 1 mM arachidonic acid, HEPES buffer, pH 6.5-7.5), EPPS (EPPS) Buffer, pH 7.5-8.5) buffer and chess (CHES buffer, pH 8.5-9.0) buffer were used for enzymatic reaction for 30 minutes. As a result, it is confirmed that the optimum pH is 6.5 to 9.0, preferably 6.5 to 8.5, more preferably 6.5 to 7.5 (FIG. 5(a)).

In addition, in order to investigate the effect of temperature on the production of 5R -hydroxylated arachidonic acid using the 5R -lipoxygenase variant, the temperature was adjusted to 20° C. in 50 mM EPPS buffer pH 7.0 for 1 mM arachidonic acid. The range was set at 5 °C intervals from to 40 °C, and then the enzymatic reaction was carried out for 30 minutes. As a result, it is confirmed that the optimum temperature is 20 °C to 40 °C, preferably 20 °C to 35 °C, more preferably 20 °C to 30 °C (Fig. 5(b)).

Example 7.5 R -5 using lipoxygenase variants R -Conversion rate of hydroxylated arachidonic acid

In order to confirm the production of 5R -hydroxylated arachidonic acid using the 5R-lipoxygenase variant, a 50 mM HEPES buffer solution containing 0.1 g/ L of the 5R -lipoxygenase variant for 1 mM arachidonic acid was prepared. It was carried out at a pH of 7.0 and a temperature of 30 °C to measure the conversion rate over time of 5 R -hydroxydonic acid.

As a result, the 5R -lipoxygenase variant produced 0.82 mM 5R -hydroxylated arachidonic acid, and it was confirmed that the final conversion yield of 5R-hydroxylated-arachidonic acid was 82% (FIG. 6).

Example 8.5 R - 5 from eicosapentaenoic acid, using a lipoxygenase variant R -Hydroxylated eicosapentaenoic acid, 5 R ,11 S -Eicosapentaenoic acid dihydrate, 5 R ,12 S -Eicosapentaenoic acid dihydrate and 5 R ,15 S -Construction of the synthesis route of eicosapentaenoic acid dihydrate

Using the 5R - lipoxygenase variant, 5R-hydroxylated eicosapentaenoic acid and 5R , 11S -dihydroxylatedeicosapentaenoic acid, 5R, 12S -dihydroxylatedeicosapentaenoic acid and 5R ,15 S -eicosapentaenoic acid (EPA) was used as a substrate to construct a synthetic route of eicosapentaenoic acid dihydroxy.

First, for the production of 5 R -hydroxylated eicosapentaenoic acid, with respect to 1 mM eicosapentaenoic acid, 0.2 g / L of 5 R -lipoxygenase variant was used and 200 Mm cysteine was added, pH 7.0 and It was carried out at 30 °C for 40 minutes.

Next, for the production of 5R, 11S -dihydroxylated eicosapentaenoic acid, 1 mM 11S -hydroxylatedeicosapentaenoic acid, 5R -lipoxygenase mutant 0.8 g/ L was used and pH It was carried out at 7.0 and 30 °C for 30 minutes. In addition, for the production of 5 R ,12 S -eicosapentaenoic acid dihydroxy, 1 mM 12S -hydroxyl eicosapentaenoic acid, 0.8 g/L of 5R -lipoxygenase mutant was used and pH 7.0 and 30 °C for 30 minutes. In addition, for the production of 5R, 15S -dihydroxylated eicosapentaenoic acid, 1 mM 15S -hydroxylatedeicosapentaenoic acid, 5R -lipoxygenase mutant 0.8 g/ L was used and pH 7.0 and 30 °C for 30 minutes.

As a result, a synthetic route as shown in FIG. 7 was constructed. In addition, 5 R -eicosapentaenoic acid hydroxide (reverse phase and normal), 5R ,11 S -eicosapentaenoic acid dihydrate (reverse phase), 5R , 12S -eicosapentaenoic acid dihydrate through HPLC (Reversed phase) and 5 R ,15 S -Eicosapentaenoic acid dihydrate (reverse phase) production was confirmed (Figs. 8(a) to (e)), 5 R -Hydroxide eicosapentaenoic acid through material identification , 5R , 11S -eicosapentaenoic acid dihydrate, 5R, 12S -eicosapentaenoic acid dihydrate and 5R , 15S -eicosapentaenoic acid dihydrate were confirmed (FIG. 9(a) ) to (d)).

Example 9.5 R -5 using lipoxygenase variants R -Conversion rate of hydroxylated eicosapentaenoic acid

In order to confirm the production of 5R -hydroxylated eicosapentaenoic acid using the 5R -lipoxygenase variant, 0.2 g/ L of the 5R-lipoxygenase variant was contained with respect to 1 mM eicosapentaenoic acid. A 50 mM HEPES buffer solution was applied at a pH of 7.0 and a temperature of 30 °C to measure the conversion rate of 5 R -hydroxylated eicosapentaenoic acid over time.

As a result, the 5R -lipoxygenase variant produced 0.83 mM 5R -hydroxylated eicosapentaenoic acid, and the final conversion yield of 5R-hydroxylatedeicosapentaenoic acid was confirmed to be 83% (FIG. 10). ).

Example 10. 5 R - from docosapentaenoic acid using lipoxygenase variants 7 R -hydroxylated docosapentaenoic acid, 7 R ,13 S -Docosapentaenoic acid dihydrate, 7 R ,14 S -Docosapentaenoic acid dihydrate and 7 R ,17 S -Construction of the synthesis route of docosapentaenoic acid dihydrate

Using the 5R-lipoxygenase variant, 7R-hydroxylated docosapentaenoic acid and 7R,13S-dihydroxylated docosapentaenoic acid, 7R, 14S -dihydroxylated docosapentaenoic acid ( Maresin 1 n -3) and 7R,17S- Docosapentaenoic acid (DPA) was used as a substrate to construct a synthetic route of dihydroxylated docosapentaenoic acid (a stereospecific isomer of resolvin D5 n-3).

First, for the production of 7 R -hydroxylated docosapentaenoic acid, with respect to 1 mM docosapentaenoic acid, 0.2 g/L of 5 R -lipoxygenase mutant was used and 200 Mm cysteine was added, pH 7.0 and It was carried out at 30 °C for 40 minutes.

Next, for the production of 7R,13S-dihydroxylated docosapentaenoic acid, 1 mM 13S -hydroxylated docosapentaenoic acid, 5R-lipoxygenase mutant 0.8 g/ L was used and pH 7.0 and 30 °C for 30 minutes. In addition, for the production of 7R,14S-dihydroxylated docosapentaenoic acid ( malecin 1 n -3), 0.8 g of 5R-lipoxygenase variant with respect to 1 mM 14S-hydroxylated docosapentaenoic acid. /L was used and carried out at pH 7.0 and 30 °C for 30 minutes. In addition, for the production of 7R,17S- docosapentaenoic acid dihydroxylated (a stereospecific isomer of resolvin D5 n -3), 5R- lipoxy to 1 mM 17S -hydroxydocosapentaenoic acid. 0.8 g/L of the sygenase mutant was used and carried out at pH 7.0 and 30° C. for 30 minutes.

As a result, a synthetic route as shown in FIG. 11 was constructed. In addition, 7 R -docosapentaenoic acid hydroxide (reverse phase and normal), 7 R ,13 S -docosapentaenoic acid dihydrate (reverse phase), 7 R ,14 S -docosapentaenoic acid dihydrate (reverse phase) via HPLC The production of syn 1 n-3) (reverse phase) and 7 R ,17 S -docosapentaenoic acid dihydroxylated (a stereospecific isomer of resolvin D5 n-3) (reverse phase) was confirmed (FIG. 12(a)~ (e)), through material identification, 7 R -docosapentaenoic acid hydroxide, 7 R ,13 S -docosapentaenoic acid dihydrate, 7 R ,14 S -docosapentaenoic acid dihydrate (malecin 1 n- 3) and 7 R ,17 S -docosapentaenoic acid dihydroxylated (a stereospecific isomer of resorbin D5 n-3) were identified (FIGS. 13(a) to (d)).

Example 11.5 R -7 using lipoxygenase variants R -Conversion rate of hydroxylated docosapentaenoic acid

In order to confirm the production of 7R-hydroxylated docosapentaenoic acid using the 5R-lipoxygenase variant, with respect to 1 mM docosapentaenoic acid, 5R-lipoxygenase variant containing 0.2 g/ L A 50 mM HEPES buffer solution was applied at a pH of 7.0 and a temperature of 30° C. to measure the conversion rate of 7 R -hydroxydocosapentaenoic acid over time.

As a result, the 5R-lipoxygenase variant produced 0.73 mM 7R -hydroxylated docosapentaenoic acid, and it was confirmed that the final conversion yield of 7R-hydroxylated docosapentaenoic acid was 73% (FIG. 14). ).

Example 12.5 R - From docosahexaenoic acid using a lipoxygenase variant 7 R -hydroxylated docosahexaenoic acid, 7 R ,13 S -Docosahexaenoic acid dihydrate, 7 R ,14 S -Docosahexaenoic acid dihydrate and 7 R ,17 S -Construction of the synthesis route of docosahexaenoic acid dihydrate

Using the 5R -lipoxygenase variant, 7R-hydroxylated docosahexaenoic acid and 7R , 13S -dihydroxylated docosahexaenoic acid, 7R , 14S -dihydroxylated docosahexaenoic acid ( Maresin 1) And 7R , 17S -Docosahexaenoic acid (DHA) was used as a substrate to construct a synthetic route of dihydroxylated docosahexaenoic acid (a stereospecific isomer of resorbin D5).

First, for the production of 7 R -hydroxylated docosahexaenoic acid, with respect to 1 mM docosahexaenoic acid, 0.2 g / L of 5 R -lipoxygenase variant was used and 200 Mm cysteine was added, pH 7.0 and It was carried out at 30 °C for 40 minutes.

Next, for the production of 7R, 13S -dihydroxylated docosahexaenoic acid, 1 mM 13S -hydroxylated docosahexaenoic acid, 5R -lipoxygenase mutant 0.8 g/ L was used and pH 7.0 and 30 °C for 30 minutes. In addition, for the production of 7R,14S-dihydroxylated docosahexaenoic acid ( Maresin 1), 0.8 g/ L of 5R -lipoxygenase mutant to 1 mM 14S -hydroxylated docosahexaenoic acid was used and carried out at pH 7.0 and 30 °C for 30 minutes. In addition, for the production of 7R, 17S -dihydroxylated docosahexaenoic acid (a stereospecific isomer of resorbin D5), with respect to 1 mM 17S -hydroxylated docosahexaenoic acid, 5R -lipoxygenase variant 0.8 g/L was used and it was carried out at pH 7.0 and 30° C. for 30 minutes.

As a result, a synthetic route as shown in FIG. 15 was constructed. In addition, 7 R -docosahexaenoic acid hydroxide (reverse phase and normal), 7 R ,13 S -docosahexaenoic acid dihydrate (reverse phase), 7 R ,14 S -docosahexaenoic acid dihydrate (reversed phase) via HPLC Synthesis 1) (reverse phase) and 7 R ,17 S -docosahexaenoic acid dihydroxylated (stereospecific isomer of Resolvin D5) (reverse phase) production was confirmed ( FIGS. 16 (a) to (e)), substances Through identification, 7R -hydroxyhexaenoic acid, 7R,13S-dihydroxydocosahexaenoic acid, 7R , 14S -docosahexaenoic acid dihydrate ( Maresin 1) and 7R , 17S- Docosahexaenoic acid dihydrate (a stereospecific isomer of Resolvin D5) was confirmed (FIGS. 17(a)-(d)).

Example 13.5 R -7 using lipoxygenase variants R -Conversion rate of hydroxylated docosahexaenoic acid

In order to confirm the production of 7R-hydroxylated docosahexaenoic acid using the 5R-lipoxygenase variant, with respect to 1 mM docosahexaenoic acid, 5R -lipoxygenase variant containing 0.2 g/ L A 50 mM HEPES buffer solution was applied at a pH of 7.0 and a temperature of 30 °C to measure the conversion rate of 7R-hydroxydocosahexaenoic acid over time.

As a result, the 5R -lipoxygenase variant produced 0.69 mM 7R -hydroxylated docosahexaenoic acid, and it was confirmed that the final conversion yield of 7R-hydroxylated docosahexaenoic acid was 69% (FIG. 18). ).

Above, a specific part of the content of the present invention has been described in detail, for those of ordinary skill in the fatty acid industry and the medical community, these specific descriptions are only preferred embodiments, and the scope of the present invention is not limited thereby The point will be clear. Accordingly, it is intended that the substantial scope of the present invention be defined by the appended claims and their equivalents.

<110> Konkuk University Industrial Cooperation Corp <120> COMPOSITION AND METHOD FOR PRODUCING HYDROXY FATTY ACID OR DIHYDROXY FATTY ACID USING 5R-LIPOXYGENASE VARIANT <130> 2020-I174 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 646 <212> PRT <213> Artificial Sequence <220> <223> A381G/L385W/I392F/V569F mutant of lipoxygenase <400> 1 Met Pro Ser Ala Asn Pro Ser Leu Pro Gln Asn Asp Thr Pro Ala Glu 1 5 10 15 Gln Ala Ala Arg Ala Ala Gln Leu Ala Ala Ser Gln Ala Val Tyr Val 20 25 30 Trp Thr Thr Asp Val Pro Thr Leu Pro Gly Val Pro Leu Ala Thr Asp 35 40 45 Val Pro Lys Asn Asp Glu Pro Thr Ile Ala Trp Phe Gly Ile Leu Ile 50 55 60 Gly Val Gly Leu Ala Ile Val Arg Asn Ala Leu Thr Val Lys Leu Gly 65 70 75 80 Gly Val Asp Arg Gly Glu Leu Asp Thr Pro Arg Ala Glu Tyr Glu Thr 85 90 95 Ala Leu Ala Glu Cys Asp Ala Ile Glu Leu Ser Thr Ala Lys Ile Val 100 105 110 Ala Glu His Gly Val His Ser Gly Gly Asn Ile Phe Glu Arg Ile Val 115 120 125 Gly Asp Val Glu Asn Ala Val Ala Ala Ala Glu Arg Asp Val His Leu 130 135 140 Ala Leu Leu Gln Gly Tyr Lys Glu Arg Leu Glu Asp Leu Met Lys Val 145 150 155 160 Asp Glu Ala Glu Val Ala Gly Leu Gly Ser Lys Thr Pro Arg Ser Leu 165 170 175 Asp Ala Tyr Arg Ala Leu Phe Ala Thr Leu Pro Val Pro Gly Ile Ser 180 185 190 Tyr Met Phe Gln Asp Asp Lys Glu Phe Ala Arg Leu Arg Val Gln Gly 195 200 205 Pro Asn Cys Met Leu Ile Ala Ala Val Glu Gly Ala Leu Pro Ala Asn 210 215 220 Phe Pro Leu Ser Glu Lys Ala Tyr Ala Ala Val Val Asn Gly Asp Thr 225 230 235 240 Leu Ala Ala Ala Leu Ala Asp Gly Arg Leu Phe Met Leu Asp Tyr Lys 245 250 255 Pro Leu Ala Ile Leu Asp Pro Gly Thr Tyr Gly Gly Glu Ala Lys Tyr 260 265 270 Val Ser Gln Pro Met Ala Leu Phe Ala Val Pro Pro Gly Gly Ala Ser 275 280 285 Leu Ile Pro Val Ala Ile Gln Cys Gly Gln Asp Pro Ala Asp Cys Pro 290 295 300 Ile Phe Thr Pro Ser Pro Ala Ala Asp Arg Gln Trp Gly Trp Glu Met 305 310 315 320 Ala Lys Phe Val Val Gln Val Ala Asp Gly Asn Tyr His Glu Leu Phe 325 330 335 Ala His Leu Ala Arg Thr His Leu Val Ile Glu Ala Phe Ala Val Ala 340 345 350 Thr His Arg His Leu Ala Glu Ala His Pro Val Trp Ala Leu Leu Val 355 360 365 Pro His Phe Glu Gly Thr Leu Phe Ile Asn Glu Gln Gly Ala Thr Ser 370 375 380 Trp Ile Ala Ala Asn Gly Pro Phe Asp His Ile Phe Ala Gly Thr Ile 385 390 395 400 Ala Ser Ser Gln Leu Ala Ala Val Asp Ala Arg Leu Ala Phe Asp Phe 405 410 415 Arg Gly Lys Met Pro His Ala Asp Phe Ala Ala Arg Gly Val Gly Val 420 425 430 Asp Ser Ala Leu Ala Asp Tyr Pro Tyr Arg Asp Asp Ala Leu Leu Val 435 440 445 Trp Asp Ala Ile His Glu Trp Ala Arg Gln Tyr Val Asp Leu Tyr Tyr 450 455 460 Thr Gly Asp Thr Asp Ile Val Ala Asp Thr Glu Leu Ala Ala Trp Ala 465 470 475 480 Ala Cys Leu Ala Gly Glu Ala Lys Val Gly Gly Leu Gly Pro Val Thr 485 490 495 Thr Arg Asn Gln Leu Ala Glu Ile Cys Ala Met Val Met Phe Thr Ala 500 505 510 Ser Ala Gln His Ala Ala Val Asn Leu Pro Gln Lys Asp Ile Met Ala 515 520 525 Phe Ala Pro Ala Val Thr Gly Ala Ala Trp Gln Pro Ala Pro Asn Gly 530 535 540 Gln Arg Gly His Asp Lys Thr Gly Trp Leu Ala Met Met Pro Pro Met 545 55 0 555 560 Ala Leu Ala Leu Glu Gln Leu Asn Phe Leu Glu Leu Leu Gly Ser Val 565 570 575 His Tyr Arg Pro Leu Gly Asp Tyr Arg Ser Asn Ala Phe Pro Tyr Pro 580 585 590 Gln Trp Phe Gln Asp Pro Arg Val Thr Ala Ala Glu Gly Pro Leu Ala 595 600 605 Trp Phe Gln Ala Ala Leu Ala Asp Val Glu Ala Glu Ile Val Thr Arg 610 615 620 Asn Ala Glu Arg Met Gln Pro Tyr Pro Tyr Leu Gln Pro Ser Leu Ile 625 630 635 640 Pro Thr Ser Ile Asn Ile 645 <210> 2 <211> 675 <212> PRT <213> Myxococcus xanthus <400> 2 Met Thr Val Glu Tyr Lys Leu Thr Ile Arg Thr Gly Thr Lys Leu Gly 1 5 10 15 Ala Gly Thr Asp Ala Asp Ile Ser Ile Val Leu Val Gly Thr Arg Gly 20 25 30 Glu Ser Ala Pro Arg Val Leu Asp Lys His Phe His Asn Asp Phe Glu 35 40 45 Ala Gly Ala Glu Asp Val Tyr Ala Leu Ser Ser Glu Asp Leu Gly Asp 50 55 60 Le u Val Leu Leu Arg Phe Ser Asn Ala Gly Gly Val Ala Ala Asp Trp 65 70 75 80 Leu Leu Asp Trp Ala Ile Val Thr Ala Gly Glu Lys Gln Trp His Phe 85 90 95 Pro Phe Tyr Arg Trp Val Leu Ser Gly Ala Thr Val Asp Val Leu Glu 100 105 110 Gly Thr Ala Lys Leu Ala Arg Gln Ala Ser Ser Glu Arg Glu Ser Thr 115 120 125 Ala Arg Arg Glu Leu Leu Glu Ala Arg Gln Arg Met Tyr Pro Trp Arg 130 135 140 Ala Pro Glu Met Thr Glu Gly Leu Pro Gly Ala Leu Asp Leu Arg Glu 145 150 155 160 Gly Arg Pro Leu Pro Lys Asp Glu Leu Tyr Arg Gly Leu Thr Glu Gly 165 170 175 Ser Tyr Glu Val Val Ile Ala Lys Thr Leu Ala Ala Ile Lys Leu Asn 180 185 190 Leu Pro Met Leu Thr Arg Ala Trp Asn Gly Leu Val Asp Ile Phe Asp 195 200 205 Phe Phe Lys His Leu Glu Val Pro Gln Leu Ala Gln Arg Trp Lys Asp 210 215 220 Asp Leu Glu Phe Ala Arg Gln Ala Val Gln Gly Ile Ala Pro Leu His 225 230 235 240 Ile Thr Leu Val Pro Ser Leu Pro Gln Gly Met Pro Leu Thr Asp Asp 245 250 255 Asp Val Arg Gly Leu Leu Ser Pro Gly Thr Thr Leu Ala Arg Ala Leu 260 265 270 Asp Ala Lys Arg Ile Phe Leu Ile Asp Phe Glu Ile Leu Asp Asp Ile 275 280 285 Arg Met Tyr Arg Lys Val Gly Glu Asp Gly Val Glu Glu Arg Arg Trp 290 295 300 Ala Pro Ala Ala Arg Cys Leu Leu Tyr Leu Asp Asp Gln Arg Gln Leu 305 310 315 320 Arg Pro Leu Ala Ile Gln Leu Gly Arg Asp Ala Gln Lys Asp Pro Val 325 330 335 Phe Thr Pro Asn Asp Asp Ala Tyr Asp Trp Leu Ala Ala Lys Ile Tyr 340 345 350 Leu Arg Cys Ser Glu Gly Asn Ser His Gln Met Val Ser His Ala Leu 3 55 360 365 Arg Thr His Phe Val Ala Glu Pro Phe Val Met Ala Thr Met Arg Asn 370 375 380 Leu Pro Asp Pro His Pro Val Tyr Lys Leu Leu Arg Arg His Phe Arg 385 390 395 400 Tyr Thr Leu Ala Ile Asn Glu Gly Ala Arg Lys Gly Leu Leu Asp Ala 405 410 415 Gly Gly Val Phe Asp Asp Phe Ile Ala Thr Gly Gly Pro Asp Lys Gly 420 425 430 His Leu Gln Leu Gly Lys Lys Gly Phe Gln Arg Trp Thr Leu Ala Asp 435 440 445 Asn Lys Pro Arg Ala Asp Leu Glu Arg Arg Gly Val Leu Asp Pro Ala 450 455 460 Val Leu Pro Asn Tyr Pro Tyr Arg Asp Asp Ala Leu Pro Leu Trp Asp 465 470 475 480 Ala Phe Glu Glu Tyr Val Gly Gly Val Leu Arg His Phe Tyr Arg Thr 485 490 495 Asp Ala Asp Leu Glu Ala Asp Thr Glu Met Gln Gln Trp T rp Lys Asp 500 505 510 Leu Thr Glu His Gly Leu Pro Val Asp Lys Leu Pro Cys Arg Glu Leu 515 520 525 Arg Arg Val Asp Asp Leu Val Asp Ile Leu Thr Thr Val Leu Phe Thr 530 535 540 Val Ser Val Gln His Ala Ala Val Asn Tyr Leu Gln Tyr Glu His Tyr 545 550 555 560 Ala Phe Val Pro Asn Ala Pro Leu Ser Met Arg Arg Glu Pro Pro Arg 565 570 575 Gln Lys Gly Thr Leu Arg Ala Glu Asp Ile Pro Glu Met Ile Pro Thr 580 585 590 Lys Ser Gln Met Leu Trp Gln Val Ala Ile Gly Arg Ala Leu Ser Ser 595 600 605 Phe Gly Asp Asp Glu Glu Tyr Leu Leu His Glu Gly Gly Trp Arg Glu 610 615 620 Glu Tyr Phe His Glu Pro Glu Leu Val Ala Ile Arg Gln Arg Phe Gln 625 630 635 640 Glu Arg Leu Arg Ala Gln Arg Glu Ala Val G lu Ala Arg Asn Ala Gly 645 650 655 Ala Glu Val Pro Tyr Thr Ile Leu Arg Pro Asp Arg Ile Pro Cys Gly 660 665 670 Ile Thr Val 675 <210> 3 <211> 715 <212> PRT <213> Myxococcus xanthus < 400> 3 Met Ser Ala Ser Val Thr Arg Arg Gly Gly Ala Asp Asp Arg Arg Trp 1 5 10 15 Asp Gly Arg Ala Arg Gly Met Gly Thr Gly Met Met Phe Ala Gly Leu 20 25 30 Arg Arg Trp Met Gly Ala Leu Gly Gly Lys Gly Arg Glu Ser Gly Ser 35 40 45 Asn Glu Val Leu Asp Ala Glu Glu Leu Ser Arg Trp Tyr Ser Gly Leu 50 55 60 Ala Leu Glu Glu Arg Leu Ala Ile Ser Arg Glu Leu Ala Pro Arg Val 65 70 75 80 Arg Ala Val Arg Pro Ala Arg Glu Pro Ser Thr Leu Pro Ala Val Ala 85 90 95 Val Gly Arg Leu Val Phe Glu Gln Asp Gly Pro Gln Gly Pro Ile Pro 100 105 110 Met His His Ile Lys Val Glu Leu Trp Asp Arg Asp Phe Gly Thr Pro 115 120 125 Asp Asp Phe Leu Gly Glu Gly Phe Thr Asp Ser Asp Gly Cys Phe Ser 130 135 140 Ile Arg Tyr Asp Pro Ala Asp Ala Gly Val Asn Asp Leu Pro Asp Leu 145 150 155 160 Glu Val Arg Phe Phe Glu Pro Gln His Ser Phe Arg Pro Asp Gly Arg 165 170 175 Val Val Glu Ala Trp Cys Arg Ile Gly Ser Glu Lys Gly Pro Asp Asp 180 185 190 His Gly Gly Leu His Tyr Asp Phe Gly Thr Leu Arg Leu Pro Tyr Trp 195 200 205 Glu Tyr Asp Pro Thr Thr Pro Leu Ala Arg Leu Leu Val Thr Glu Glu 210 215 220 Gly Thr Pro Pro Thr Ala Tyr Ala Pro Gly Arg Ala Leu Ala Met Leu 225 230 235 240 Lys Ala Val Ala Pro Ile Glu Leu Val Lys Arg Arg His Leu Leu Gln 245 250 255 Gly Arg Leu Gly Gln Ala Pro Ser Leu Asp Arg Ile Gln Ala Asp Tyr 260 265 270 Pro Glu Ala Met Thr Val Arg Met Glu Arg Glu Ser Pro Gly Ser Thr 275 280 285 Arg Thr Asp Ala Phe Phe Gly Glu Arg Leu Leu Asn Gly Met Phe Ser 290 295 300 Thr Leu Met Asp Gly Asp Pro Glu Ala Pro Gly Asp Pro Glu Ala Phe 305 310 315 320 Arg Leu Tyr Phe Pro Trp Asn Ala Tyr Glu Gln Asp Gly Val His Cys 325 330 335 Leu Pro Asp Val Asp Val Arg Leu Arg Leu Val Glu Gly Arg Leu Leu 340 345 350 Pro Val Arg Ile Ile Leu Gly Met Arg Glu Pro Gly Ala Thr Ala Pro 355 360 365 Gly Ser Pro Val Thr Arg Arg Ser Tyr Thr Pro Ala Asp Gly Glu Ala 370 375 380 Trp Glu Ala Ala Lys Arg Met Ala Arg Val Ser Ala Thr Leu Glu Thr 385 390 395 400 Glu Leu Gly Asn His Leu Gly Gln Cys His Phe Asn Val Glu Gln Tyr 405 410 415 Ala Ile Ala Ala His Arg Asn Leu Arg Arg Ser Pro Leu Arg Trp Leu 420 425 430 Leu Met Pro His Leu Arg Glu Val Val Leu Ile Asn His Ser Ala Asn 435 440 445 Gly Phe Leu Val Gly Pro Thr Gly Tyr Ile Thr Arg Ala Ser Ala Leu 450 455 460 Thr Glu Arg Ser Val Glu Thr Arg Leu Leu His Leu Met Gly Ser Tyr 465 470 475 480 Asp Trp Lys Gly Phe Ala Pro Ala Pro Pro Ile Cys Glu Ser His Arg 485 490 495 Tyr Ala Arg Ala Ala Gly Leu Phe Trp Arg Leu Val Gly Glu His Val 500 505 510 Asp Ala Phe Phe Ala Glu His Gly Ala Ala Leu Glu Ala Gln Trp Ser 515 520 525 Glu Val Arg Arg Phe Ser Asp Asp Leu Val Gly His Ser Ala Pro Ala 530 535 540 Phe Val Cys Arg Tyr Leu Arg Ala Thr Val Pro Gly Arg Ala Ala Pro 545 550 555 560 Trp Phe Val Arg Ser Glu Arg Met Asp Leu Asp Ala Lys Val Ala Ala 565 570 575 Thr His Ala Lys Ala Val Ser Ala Val Thr Arg Thr Asp Ala Pro Gln 580 585 590 Pro Gly Glu Met Glu Ala Leu Lys Gln Leu Cys Arg Tyr Val Ile Tyr 595 600 605 Phe Ala Thr Phe Arg His Ala Trp Ala Asn Asn Leu Gln Trp Asp Asp 610 615 620 Ala Gly Glu Val Leu Tyr Ala Cys Leu Gly Leu Arg Trp Gly Lys Ala 625 630 635 640 Gly Ala Leu Ser Thr Glu Ala Asp His Asp Val Ala Pro Pro Pro Glu 645 650 655 Glu Ala Thr Glu Met Leu Trp Ile Ser Trp Met Leu Ser Lys Thr Ser 660 665 670 Tyr Gly Phe Leu Leu Ala Asn Glu Glu Ala Asp Val His Pro Arg Phe 675 680 685 Val Glu Cys Leu Arg Ala His Ala Ala Glu Phe Ser Ala Leu Gly Met 690 695 700 Asp Ile Arg Thr Val Ser Ser Arg Ile Asn Ile 705 710 715 <210> 4 <211> 695 <212> PRT <213> Burkholderia sp. <400> 4 Met Val Asn His Lys Thr Gly Ser Asn Met Asn Arg Arg Asp Leu Ile 1 5 10 15 Lys Phe Leu Ser Phe Ala Ala Ser Gly Thr Ala Phe Ala Gly Leu Val 20 25 30 Arg Ser Thr Leu Ser Ser Pro Ala Ala Ser Ser Ile Thr Ala Ser Pro 35 40 45 Arg Thr Leu Asp Ala Gly Ile Gly Ile Ser Ser Pro Gln Ala Val Arg 50 55 60 Ala Ala Ala Pro Val Leu Pro Gln Lys Asp Thr Ala Ala Gly Arg Ile 65 70 75 80 Ala Arg Ala Gly Phe Leu Ala Thr Gln Arg Leu Ser Tyr Ile Trp Thr 85 90 95 Glu His Val Pro Thr Ala Ser Gly Ile Pro Leu Ala Leu Val Thr Pro 100 105 110 Gln Asp Leu Pro Thr Ile Glu Trp Leu Ile Lys Phe Ile Ala Ile Val 115 120 125 Val Gly Val Ile Glu Asn Phe Leu Gly Ser Ala Pro Ala Thr Ala Val 130 135 140 Ala Leu Trp Arg Asp Gln Phe Ala Lys Ile Arg Val Asp Leu Leu Ser 145 150 155 160 Leu Glu Asn Leu Tyr Ser Asp Leu Thr His Asp Pro Asn Leu Gln Asp 165 170 175 Pro Val Ala Ile Ala Gln Ala Ala Ser Ile Gln Ala Ala Leu Ile Ala 180 185 190 Leu Leu Ala Asn Val Gly Val Leu Ser Lys Asp Ile Ile Ser Arg Leu 195 200 205 Gly Glu Ile Val Ser Asn His Asp Thr Arg Ser Glu Glu Asn Phe Lys 210 215 220 Ala Leu Phe Ser Thr Phe Pro Leu Pro Asp Ile Ser Ala Ala Tyr Gln 225 230 235 240 Arg Asp Asp His Phe Ala Ser Leu Arg Val Ala Gly Gln Asn Pro Val 245 250 255 Leu Ile Lys Arg Ile Ser Gly Leu Pro Ser Lys Phe Pro Leu Thr Asn 260 265 270 Ala Gln Phe Gln Gln Val Met Gly Pro Ala Asp Asn Leu Val Ser Ala 275 280 285 Ala Ala Glu Asn Arg Leu Tyr Leu Leu Asp Tyr Val Asp Asn Gly Leu 290 295 300 Leu Ala Thr Ser Arg Ala Val Ala Lys Pro Leu Thr Gly Ile Gly Tyr 305 310 315 320 Ser Tyr Ala Pro Ile Ala Leu Phe Ala Leu Pro Arg Gly Gly Ala Ser 325 330 335 Leu Val Pro Val Ala Ile Gln Cys Asp Gln Asp Pro Ala Thr Asn Pro 340 345 350 Leu Phe Leu Pro Ala Asp Pro Ser Gln Glu Ser Ala Tyr Trp Ala Trp 355 360 365 Gln Met Ala Lys Thr Val Val Gln Cys Ala Glu Glu Asn Tyr His Glu 370 375 380 Met Phe Val His Leu Ala Arg Thr His Leu Val Thr Gly Ala Ile Cys 385 390 395 400 Val Ala Thr His Arg Asn Leu Ala Ser Thr His Pro Leu Tyr Ala Leu 405 410 415 Leu Met Pro His Phe Glu Gly Thr Leu Tyr Ile Asn Glu Leu Ala Ala 420 425 430 Leu Thr Leu Leu Pro Pro Leu Met Phe Ile Asp Thr Leu Phe Ala Ala 435 440 445 Pro Ile Gln Gln Thr Gln Gln Met Val Ala Ser Asp Arg Leu Ala Phe 450 455 460 Asp Phe Tyr Asp His Met Leu Pro Asn Asp Ile Glu Met Arg Gly Val 465 470 475 480 Gly Ala Ala Asn Leu Pro Asp Tyr Pro Tyr Arg Asp Asp Gly Leu Leu 485 490 495 Ile Trp Asn Ala Ile Ala Glu Trp Ala Lys Ala Tyr Val Asp Val Tyr 500 505 510 Tyr Lys Ser Asp Gln Asp Val Val Asp Asp Tyr Glu Leu Arg Ser Trp 515 520 525 Ala Ala Asp Ile Ile Ala Asn Gly Lys Val Lys Gly Phe Arg Pro Val 530 535 540 Arg Ser Lys Ala Gln Leu Ile Asp Val Leu Thr Met Ile Ile Phe Thr 545 550 555 560 Ala Ser Ala Gln His Ala Ala Val Asn Phe Ser Gln Ser Asp Phe Ser 565 570 575 Thr Tyr Ala Pro Ala Leu Ser Ala Leu Leu Ser Ala Pro Ala Pro Thr 580 585 590 Ser Ala Val Gly Lys Ser Lys Ala Asp Trp Leu Lys Met Leu Pro Pro 595 600 605 Leu Val Ser Gly Ile Glu Arg Val Ala Ile Tyr Glu Ile Leu Ala Gly 610 615 620 Val Gln His Ser Ala Leu Gly Gln Tyr Arg Ser Asn Val Phe Pro Tyr 625 630 635 640 Arg Pro Leu Ile Thr Asp Pro Ala Ile Thr Gly Ser Asn Gly Pro Leu 645 650 655 Glu His Phe Arg Gln Ala Leu Gly Asp Val Glu Ser Gln Ile Asn Ala 660 665 670 Arg Asn Ser Ile Arg Lys Thr Pro Tyr Glu Tyr Leu Leu Pro Ser Arg 675 680 685 Ile Pro Ala Ser Thr Asn Ile 690 695 <210> 5 <211> 1941 <212> DNA < 213> Artificial Sequence <220> <223> A381G / L385W / I392F / V569F mutant of lipoxygenase <400> 5 ttgccatcgg ccaatcccag cctgccgcaa aacgatacgc ccgccgagca agcggcgcgc 60 gcggcacagc tcgccgcttc gcaggccgtc tatgtctgga ccaccgacgt cccgacgctg 120 cccggcgtgc cgctcgccac cgacgtgccg aagaacgacg aaccgacgat cgcctggttc 180 ggcatcttga tcggcgtcgg cctcgcgatc gtgcgcaatg cgctgacggt gaagctcggc 240 ggcgtcgacc ggggcgagct cgacacgccg cgcgccgaat atgaaaccgc gctcgccgag 300 tgcgacgcga tcgagctatc gaccgcgaag atcgtcgccg aacatggcgt tcacagcggc 360 ggcaatatct tcgaacgcat cgtcggcgac gtggaaaatg ccgtcgccgc ggctgagcgc 420 gacgtgcatc tcgctttgct tcagggatat aaggagcggc tcgaggatct catgaaggtc 480 gacgaggccg aggtggcggg gctgggcagc aagacgccgc gcagcctcga cgcatatcgc 540 gcgctgttcg ctaccctgcc ggtgccgggc atcagctata tgttccagga cgacaaggag 600 ttcgcccgcc tgcgcgtgca ggggccgaac tgcatgctga tcgcggcggt cgagggagcg 660 ctgcccgcca atttcccgct gagcgaaaag gcttacgccg cggtggtgaa tggcgacacg 720 ctggccgccg cgctcgccga cggccgcctc ttcatgctcg attacaagcc gctcgcgatc 780 ctcgaccccg gcacctatgg cggcgaagcc aaatatgtct cgcagccgat ggcgctgttc 840 gcggtaccgc cgggcggcgc atcgctcatc cccgtcgcga tccagtgcgg ccaggacccc 900 gccgactgtc cgattttcac gccctcaccg gcggccgaca ggcaatgggg ctgggaaatg 960 gcgaaattcg tcgtgcaggt cgccgacggt aattatcatg agctcttcgc ccatctggca 1020 cgcacccatc tggtgatcga ggcgttcgcg gtcgcgacgc accgccatct tgccgaggcg 1080 catccggtgt gggcgctgct cgtcccgcat ttcgagggga cattgttcat caacgaacag 1140 ggggcgacct cgtggatcgc ggcgaacggc ccgtt cgacc atattttcgc ggggacgatc 1200 gcgtcgagcc agcttgccgc agtcgatgcg cggctggcgt tcgatttccg gggcaagatg 1260 ccgcacgccg attttgccgc gcggggcgtc ggggtcgatt cggcgctcgc cgactatccg 1320 tatcgcgacg acgcgctgct ggtgtgggac gcgatccacg aatgggcgcg gcaatatgtc 1380 gatctttatt atacgggcga caccgatatc gtcgccgata ccgagctggc ggcatgggcc 1440 gcgtgcctcg cgggcgaagc caaggtcggc gggctcggcc cggtgacgac gcgcaaccag 1500 ctcgccgaaa tctgcgcgat ggtgatgttc accgccagcg cgcagcatgc ggcggtcaat 1560 ttaccgcaaa aggacatcat ggccttcgcc cccgcggtga ccggcgcagc gtggcaaccg 1620 gcgccgaacg gccagcgcgg acacgacaag acgggctggc tcgcgatgat gccgccgatg 1680 gccctcgcgc tcgaacaatt gaacttcctc gaactgctgg ggtcggtgca ttatcgcccg 1740 ctcggcgact atcgcagcaa cgcctttccc tatccgcagt ggttccagga tccgcgcgtc 1800 accgcggcgg agggcccgct cgcctggttt caggcggcgc ttgccgacgt cgaggcggaa 1860 atcgtcacgc gcaatgccga gcggatgcag ccctatccct atctgcagcc gagcctgatc 1920 ccgacgagca tcaatatctg a 1941 <210> 6 <211> 2028 <212> DNA <213> Myxococcus xanthus <400> 6 atgactgtcg agtacaaact ca cgattcgg acgggcacga agctcggcgc ggggacggat 60 gccgacattt ccatcgtcct cgtgggcacg cgaggagaga gcgccccccg cgtgctggac 120 aagcacttcc acaacgactt cgaggcgggc gcggaggacg tctacgccct ctcctccgag 180 gacctcggtg acctggtcct gttgcgcttc agcaacgcgg gcggcgtggc ggccgactgg 240 ctgctcgact gggcaatcgt cacggccgga gagaagcagt ggcacttccc tttctaccgg 300 tgggtgctga gtggcgccac ggtcgacgtg ctcgagggga ccgcgaagct cgctcgccag 360 gcaagcagcg agcgcgagtc cacggcgcgg cgcgagctgc tcgaggcccg ccagcggatg 420 tacccgtggc gcgcgcctga gatgaccgag gggcttcccg gcgcgctcga cctccgtgag 480 gggaggccgc tgccgaagga cgagctctac cggggcctga cggagggcag ctacgaagtg 540 gtcatcgcga agacgctggc ggccatcaag ctgaacctgc ccatgctgac ccgcgcctgg 600 aacgggctgg tggacatctt cgacttcttc aaacacctgg aggtgcccca gctcgcccag 660 cgctggaagg acgacctcga gttcgcgcgg caggccgtcc agggcatcgc ccccctccac 720 atcacgctcg tccccagtct gccgcagggc atgccgctca ccgacgacga cgtccggggc 780 ctcttgtcgc ccggcaccac gctggccagg gcgctcgacg ccaagcgcat cttcctgatc 840 gacttcgaaa tcctcgacga catcaggatg taccggaagg t cggcgagga cggagtcgag 900 gagcggcgct gggctcccgc ggcgcgctgc ctgctgtacc tggatgacca gcgtcaactg 960 cgacccctgg ccatccagct cgggcgggac gcccagaagg accctgtctt cacgccgaac 1020 gacgacgcgt acgactggct cgccgcgaaa atctacctcc ggtgcagcga gggcaactcg 1080 caccagatgg tgtcgcacgc gctgcgcaca cacttcgtgg cggagccgtt cgtcatggcg 1140 acgatgcgca acctgccgga cccgcacccc gtctacaaac tgctgcggcg gcacttccgc 1200 tacacgctcg ccatcaacga gggcgcacgc aagggcctgc tcgacgcagg cggggtgttc 1260 gacgacttca tcgcgacagg cggccccgac aagggccacc tccagttggg caagaagggc 1320 ttccagcgct ggacgctggc ggacaacaag ccccgtgctg acctggagcg gcggggcgtg 1380 ctggaccctg ccgtgctccc caactacccg taccgggacg acgccctgcc cttgtgggac 1440 gcgttcgagg agtacgtcgg cggcgtcctc aggcacttct accggaccga tgccgacctc 1500 gaggccgaca ccgagatgca gcaatggtgg aaggacctca ccgagcacgg gctgcccgtg 1560 gacaagctgc cctgccggga gctgcgccgc gtcgacgacc tggtcgacat cctcaccacc 1620 gtcctcttca cggtcagcgt gcagcacgcg gcggtgaact acctgcaata cgagcactac 1680 gccttcgtac cgaatgcgcc cctgagcatg cgccgggagc caccccgcc a gaaggggacg 1740 ctgcgtgcag aggacatccc cgagatgatt cccaccaagt cccagatgct ctggcaggtc 1800 gccatcggcc gggcgctctc cagcttcgga gacgacgagg agtacctgct gcacgagggc 1860 ggctggcgcg aggagtactt ccacgaaccg gagctggtgg ccatccgcca gcggttccag 1920 gagcgcctgc gcgcccagcg cgaggcggtg gaggcgcgca acgcgggcgc cgaggtgccc 1980 tacaccatcc tgcgtcccga ccggattccc tgcggcatca ccgtctga 2028 <210> 7 <211> 2148 <212> DNA < 213> Myxococcus xanthus <400> 7 atgagcgcga gtgtgacccg gagaggtgga gctgatgaca gacgttggga cgggcgcgcc 60 cgcggcatgg ggacggggat gatgttcgca gggctgcgcc gatggatggg cgctctcggg 120 ggcaaaggac gcgagagcgg aagcaacgag gtgctcgacg cggaggagct gtcccggtgg 180 tactcggggc tcgcgctcga ggagcgtctg gccatcagcc gcgagctcgc accgcgcgtc 240 cgggctgtcc gtcccgcgag ggagcccagc acgctgccag ccgtcgcggt cgggcggttg 300 gtcttcgagc aggacgggcc ccagggcccc attcccatgc atcacatcaa ggtggagctg 360 tgggaccggg acttcggcac gccggatgac ttcctggggg aggggttcac ggactcggat 420 ggatgttttt ccattcgcta tgacccggcc gacgcgggcg tgaatgacct gcccgacctg 480 gaggtgcgct tgggaccggg cc ccagcacagc ttccgcccgg atgggcgggt ggtggaggca 540 tggtgccgca tcggctctga gaaggggccg gatgaccatg gtgggctcca ctacgacttc 600 ggcacgctgc ggctgcctta ctgggagtac gaccccacga cgccgttggc ccggttgctt 660 gtcacggagg aggggactcc gcccacggcc tacgcgccgg ggcgcgcgct ggcgatgctg 720 aaggcggtgg cgcccatcga gctcgtcaag cgccgccacc tgctccaggg acggctggga 780 caggcgccga gcctggacag gattcaggcg gactatccgg aggcgatgac ggtgcggatg 840 gagcgcgagt cgccgggctc cacgcgcacc gacgccttct tcggagagcg gctgctcaac 900 ggcatgttct ccaccctcat ggatggcgac ccggaggctc ccggggaccc ggaggcgttc 960 cggctctact tcccgtggaa cgcttacgag caggacggcg tccactgcct gccggacgtg 1020 gacgtgcggc tgcggctggt ggaggggcgg ctgttgccgg tgcgcatcat cctgggcatg 1080 cgcgagccgg gcgcgacggc gccgggctct cccgtgacgc ggcggagcta cacgcccgcg 1140 gacggcgagg cctgggaggc cgccaagcgg atggcgcggg tgagcgcgac gctggagacg 1200 gagctgggca accacctggg gcagtgccac ttcaacgtgg agcagtacgc catcgccgcg 1260 caccgcaatc tgcgccgcag tccgctgcgc tggctgctca tgccgcacct gcgggaggtg 1320 gtcctcatca accactccgc caacggcttcctcgtgggac ccaccggcta catcacccgc 1380 gccagcgcgc tcaccgagcg cagcgtggag acgcggctgt tgcacctgat gggcagctac 1440 gactggaagg gcttcgcgcc cgcgccgccc atctgcgagt cgcaccgcta cgcacgcgcg 1500 gcgggcctgt tctggcggct ggtaggggag cacgtggatg ccttcttcgc cgagcacggc 1560 gcggcgttgg aggcgcagtg gagcgaggtg cggcgcttct cggacgacct ggtggggcac 1620 tcggcgcccg ccttcgtgtg ccgctacctg cgcgcgacgg tgccgggaag ggcggcgccg 1680 tggttcgtgc gctccgagcg catggacctg gacgcgaagg tcgccgcgac ccacgccaag 1740 gccgtcagcg cggtgacccg gacggacgcg ccccagcccg gagagatgga ggcgctcaag 1800 cagttgtgcc ggtacgtcat ctacttcgcg acgttccgcc atgcctgggc caacaacctc 1860 caatgggacg acgcgggcga ggtgctctat gcgtgcctgg gcctgcgctg gggcaaggcg 1920 ggcgcgctgt cgacggaggc ggaccatgac gtcgcgccgc ctccggagga ggccacggag 1980 atgctgtgga tttcgtggat gctctcgaag acgagctacg gcttcctgct ggccaacgag 2040 gaggcggacg tgcatccccg cttcgtggag tgcctgcgcg cccacgccgc cgagttctcc 2100 gcgctgggga tggacatccg caccgtcagt tcccgcatca atatctaa 2148 <210> 8 <211 > 2088 <212> DNA <213> Burkholderia sp. <400> 8 atggtcaatc acaaaaccgg gtcaaatatg aaccgaaggg atttaattaa attcttgagc 60 ttcgccgcca gcggaaccgc gtttgcgggg ctcgtcaggt cgactctgtc gtcaccggcc 120 gcgtcgtcga tcaccgcaag ccctcgcacg ctcgacgccg gcatcggcat ttcgtcgccg 180 caggcggttc gcgcagccgc gccggtgctg ccgcaaaaag acacggccgc aggcaggatc 240 gcacgggcgg gttttctcgc cacgcaaaga ctgagttaca tctggacgga acatgtgccg 300 accgcgagcg gcattccact tgcgctggtc acgccgcaag atcttccaac cattgaatgg 360 ctgatcaaat tcatcgcgat cgttgtgggc gtcatcgaga attttctcgg ctccgcaccc 420 gcgacggcgg ttgccctctg gcgcgatcag ttcgccaaga tcagggtgga tctgctttcc 480 ctcgaaaacc tgtattcgga tctcacccac gatccgaact tgcaagaccc ggttgccatt 540 gctcaggcag cgagcattca ggcggccttg atcgcgctgt tggcgaacgt cggcgtcttg 600 tcgaaggaca tcatttcaag attgggcgaa atcgtctcca accacgacac tcgaagcgaa 660 gagaacttca aggcgctgtt ttccaccttc ccgcttcccg acatctccgc cgcgtaccag 720 cgggacgatc atttcgcgtc tctccgggtt gccggccaga atccggtgtt gatcaagcgc 780 atctccggct tgccgtcgaa gttcccactg acgaacgctc aattccagca agtcatgggg 840 cccgccgaca at ctcgtcag cgccgccgcg gagaatcggc tgtatctcct cgattacgtc 900 gacaacggtc tgttggcgac gtcgcgggcc gtggccaaac cactcacggg catcggctac 960 tcctatgcgc ccatcgcact tttcgcgctg ccgaggggcg gcgcgtccct cgttcccgtg 1020 gcgattcaat gcgatcagga tcccgcgacg aatcccctgt tcctccctgc cgatcccagt 1080 caggaatccg cctattgggc gtggcaaatg gccaagacgg tcgttcaatg cgcggaggaa 1140 aactatcacg agatgtttgt tcatctcgcg cgaacgcacc tggtgaccgg cgcgatttgc 1200 gtcgccactc accggaatct cgcgtcgacg catccgctct acgcgcttct gatgccgcac 1260 ttcgagggca ctttgtacat caacgaactc gccgcgctca cgctgcttcc accgttgatg 1320 ttcatcgata cgctgtttgc cgcgcccatc cagcagacgc aacagatggt cgcaagcgat 1380 cggctcgcgt tcgatttcta cgatcacatg ttgcccaacg acatcgaaat gcgcggagtc 1440 ggcgcggcca acctgccgga ctatccgtat cgcgacgacg gcctcctgat ttggaacgcc 1500 atcgccgaat gggcgaaggc gtatgtcgat gtctattaca agtccgatca ggatgtcgtc 1560 gatgactacg agctcaggtc ctgggccgcc gacatcatcg ccaacggcaa ggtcaaggga 1620 ttccggccgg tgcgttcgaa ggcgcaattg atcgacgtgc tgaccatgat catctttacc 1680 gcaagcgccc agcacgccgc cgtcaacttc tcgcagtcgg atttttcgac ctacgcgccc 1740 gcgctttccg cactgctgtc cgcgccggcc ccgacaagcg ccgtgggaaa aagcaaggcc 1800 gattggctga agatgctccc tcccctcgtt tcagggatcg agcgggttgc gatctacgag 1860 atcttggcgg gcgtccagca cagcgcgttg ggccagtatc gcagcaacgt atttccatat 1920 cggccgctca tcacggaccc cgcgatcacc ggaagcaacg ggccgctcga gcatttccga 1980 caggcgctcg gcgacgtcga atcgcagatc aacgctcgca acagcatacg caagacgcct 2040tatgaatatc tgctgccgag ccggattccg gcaagcacga acatttga 2088

Claims (14)

A composition for preparing a hydroxylated fatty acid comprising the 5 R -lipoxygenase variant consisting of the amino acid sequence of SEQ ID NO: 1 as an active ingredient,
The hydroxylated fatty acid is 5 R -hydroxyarachidonic acid (5 R -hydroxyarachidonic acid), 5 R -hydroxyeicosapentaenoic acid (5 R -hydroxyeicopentaenoic acid), 5 R -hydroxydocosapentaenoic acid (5 R -hydroxydocosapentaenoic acid ) and 5 R -hydroxydocosahexaenoic acid (5 R -hydroxydocosahexaenoic acid) at least one selected from the group consisting of, a composition for preparing a hydroxylated fatty acid.
According to claim 1,
In the 5 R -lipoxygenase variant, from the amino acid sequence of the lipoxygenase, alanine (A) at the 381th amino acid is substituted with glycine (G), and leucine (L) at the 385th amino acid is tryptophan (W) or phenylalanine (F) is substituted, isoleucine (I) at the 392th amino acid is substituted with phenylalanine (F), and valine (V) at the 569th amino acid is substituted with phenylalanine (F).
delete According to claim 1,
The composition has at least one carbon number selected from the group consisting of arachidonic acid, eicosapentaenoic acid, eicosapentaenoic acid and docosahexaenoic acid, 20- A composition for preparing a hydroxylated fatty acid for treating a substrate containing 22 unsaturated fatty acids.
5 R -lipoxygenase variant consisting of the amino acid sequence of SEQ ID NO: 1; and
Myxococcus xanthus ( Myxococcus xanthus ) derived from 11 S - lipoxygenase, Myxococcus xanthus derived from 12 S - lipoxygenase or Burkholderia thailandensis 15 S - lipoxygenase from A composition for preparing a dihydroxylated fatty acid comprising an agent as an active ingredient, the composition comprising:
The dihydroxy fatty acid is 5 R , 11 S -Dihydroxyarachidonic acid (5 R , 11 S -dihydroxyarachidonic acid), 5 R , 12 S -Dihydroxyarachidonic acid (5 R , 12 S -dihydroxyarachidonic acid), 5 R , 15 S -Arachidonic acid dihydroxyl (5 R , 15 S -hydroxyarachidonic acid), 5 R , 11 S -Dihydroxyeicosapentaenoic acid (5 R , 11 S -dihydroxyeicopentaenoic acid), 5 R , 12 S -Dihydroxylation Eicosapentaenoic acid (5 R , 12 S -dihydroxyeicopentaenoic acid), 5 R , 15 S -Eicosapentaenoic acid dihydrate (5 R , 15 S -hydroxyeicopentaenoic acid), 7 R , 13 S -Docosapentadihydroxy acid enoic acid (7 R , 13 S -dihydroxydocosapentaenoic acid), 7 R , 13 S -docosapentaenoic acid dihydroxyl (7 R , 13 S -dihydroxydocosapentaenoic acid), 7 R , 13 S -docosapentaenoic acid dihydrate (7 R , 13 S -hydroxydocosapentaenoic acid), 7 R , 13 S - docosahexaenoic acid dihydroxyl (7 R , 13 S -dihydroxydocosahexaenoic acid), 7 R , 13 S -docosahexaenoic acid dihydrate (7 R , 13 S ) -dihydroxydocosahexaenoic acid) and 7 R , 13 S -Dihydroxydocosahexaenoic acid (7 R , 13 S -hydroxydocosahexaenoic acid) at least one selected from the group consisting of, a composition for preparing dihydroxylated fatty acid.
6. The method of claim 5,
The 11 S -lipoxygenase is composed of the amino acid sequence of SEQ ID NO: 2, the 12 S -lipoxygenase is composed of the amino acid sequence of SEQ ID NO: 3, and the 15 S -lipoxygenase is the amino acid sequence of SEQ ID NO: 4 A composition for preparing a dihydroxylated fatty acid comprising:
A composition for preparing a hydroxylated fatty acid comprising the 5 R -lipoxygenase mutant gene consisting of the nucleotide sequence of SEQ ID NO: 5 as an active ingredient,
The hydroxylated fatty acid is 5 R -hydroxyarachidonic acid (5 R -hydroxyarachidonic acid), 5 R -hydroxyeicosapentaenoic acid (5 R -hydroxyeicopentaenoic acid), 5 R -hydroxydocosapentaenoic acid (5 R -hydroxydocosapentaenoic acid ) and 5 R -hydroxydocosahexaenoic acid (5 R -hydroxydocosahexaenoic acid) at least one selected from the group consisting of, a composition for preparing a hydroxylated fatty acid.
5 R -lipoxygenase mutant gene consisting of the nucleotide sequence of SEQ ID NO: 5; and
11 S -lipoxygenase gene consisting of the nucleotide sequence of SEQ ID NO: 6, 12 S -lipoxygenase gene consisting of the nucleotide sequence of SEQ ID NO: 7, or 15 S -lipoxygenase gene consisting of the nucleotide sequence of SEQ ID NO: 8 as an active ingredient As a composition for preparing dihydroxy fatty acid comprising:
The dihydroxy fatty acid is 5 R , 11 S -Dihydroxyarachidonic acid (5 R , 11 S -dihydroxyarachidonic acid), 5 R , 12 S -Dihydroxyarachidonic acid (5 R , 12 S -dihydroxyarachidonic acid), 5 R , 15 S -Arachidonic acid dihydroxyl (5 R , 15 S -hydroxyarachidonic acid), 5 R , 11 S -Dihydroxyeicosapentaenoic acid (5 R , 11 S -dihydroxyeicopentaenoic acid), 5 R , 12 S -Dihydroxylation Eicosapentaenoic acid (5 R , 12 S -dihydroxyeicopentaenoic acid), 5 R , 15 S -Eicosapentaenoic acid dihydrate (5 R , 15 S -hydroxyeicopentaenoic acid), 7 R , 13 S -Docosapentadihydroxy acid enoic acid (7 R , 13 S -dihydroxydocosapentaenoic acid), 7 R , 13 S -docosapentaenoic acid dihydroxyl (7 R , 13 S -dihydroxydocosapentaenoic acid), 7 R , 13 S -docosapentaenoic acid dihydrate (7 R , 13 S -hydroxydocosapentaenoic acid), 7 R , 13 S - docosahexaenoic acid dihydroxyl (7 R , 13 S -dihydroxydocosahexaenoic acid), 7 R , 13 S -docosahexaenoic acid dihydrate (7 R , 13 S ) -dihydroxydocosahexaenoic acid) and 7 R , 13 S -Dihydroxydocosahexaenoic acid (7 R , 13 S -hydroxydocosahexaenoic acid) at least one selected from the group consisting of, a composition for preparing dihydroxylated fatty acid.
A method for producing a hydroxylated fatty acid comprising the step of treating a substrate with the composition according to any one of claims 1, 2, 4 and 7,
The hydroxylated fatty acid is 5 R -hydroxyarachidonic acid (5 R -hydroxyarachidonic acid), 5 R -hydroxyeicosapentaenoic acid (5 R -hydroxyeicopentaenoic acid), 5 R -hydroxydocosapentaenoic acid (5 R -hydroxydocosapentaenoic acid ) and 5 R -hydroxydocosahexaenoic acid (5 R -hydroxydocosahexaenoic acid) at least one selected from the group consisting of, a hydroxylated fatty acid production method.
10. The method of claim 9,
The treatment is carried out at pH 6.5 to pH 9.0 and 20 °C to 40 °C, a method for producing a hydroxylated fatty acid.
A method for producing a dihydroxylated fatty acid comprising the step of treating a substrate with the composition according to any one of claims 5, 6 and 8,
The dihydroxy fatty acid is 5 R , 11 S -Dihydroxyarachidonic acid (5 R , 11 S -dihydroxyarachidonic acid), 5 R , 12 S -Dihydroxyarachidonic acid (5 R , 12 S -dihydroxyarachidonic acid), 5 R , 15 S -Arachidonic acid dihydroxyl (5 R , 15 S -hydroxyarachidonic acid), 5 R , 11 S -Dihydroxyeicosapentaenoic acid (5 R , 11 S -dihydroxyeicopentaenoic acid), 5 R , 12 S -Dihydroxylation Eicosapentaenoic acid (5 R , 12 S -dihydroxyeicopentaenoic acid), 5 R , 15 S -Eicosapentaenoic acid dihydrate (5 R , 15 S -hydroxyeicopentaenoic acid), 7 R , 13 S -Docosapentadihydroxy acid enoic acid (7 R , 13 S -dihydroxydocosapentaenoic acid), 7 R , 13 S -docosapentaenoic acid dihydroxyl (7 R , 13 S -dihydroxydocosapentaenoic acid), 7 R , 13 S -docosapentaenoic acid dihydrate (7 R , 13 S -hydroxydocosapentaenoic acid), 7 R , 13 S - docosahexaenoic acid dihydroxyl (7 R , 13 S -dihydroxydocosahexaenoic acid), 7 R , 13 S -docosahexaenoic acid dihydrate (7 R , 13 S ) -dihydroxydocosahexaenoic acid) and 7 R , 13 S -Dihydroxydocosahexaenoic acid (7 R , 13 S -hydroxydocosahexaenoic acid) at least one selected from the group consisting of, a method for producing a fatty acid dihydroxy.
A recombinant expression vector for preparing hydroxylated fatty acids comprising a 5 R -lipoxygenase mutant gene consisting of the nucleotide sequence of SEQ ID NO: 5,
The hydroxylated fatty acid is 5 R -hydroxyarachidonic acid (5 R -hydroxyarachidonic acid), 5 R -hydroxyeicosapentaenoic acid (5 R -hydroxyeicopentaenoic acid), 5 R -hydroxydocosapentaenoic acid (5 R -hydroxydocosapentaenoic acid ) and 5 R -hydroxydocosahexaenoic acid (5 R -hydroxydocosahexaenoic acid) at least one selected from the group consisting of, a recombinant expression vector for preparing a hydroxylated fatty acid.
A transformant in which a host cell is transformed with the recombinant expression vector according to claim 12 .
A novel dihydroxylated fatty acid represented by any one of the following Chemical Formulas 1 to 4:
[Formula 1]

,
[Formula 2]

,
[Formula 3]

,
[Formula 4]

.

Images