KR102358385B1 - Use of VLDLR for preventing, diagnosing or treating colorectal and rectal cancer - Google Patents

Abstract

The present invention relates to the use of VLDLR for the prevention, diagnosis or treatment of colorectal cancer and rectal cancer, wherein VLDLR expression is down-regulated in CRC, and this under-expression is regulated by miR-200c, so that over-expression of VLDLR , has an effect applicable to the treatment of colorectal and rectal cancer through inhibition of miR-200c.

Description

Use of VLDLR for preventing, diagnosing or treating colorectal and rectal cancer

The present invention relates to the use of VLDLR for the prevention, diagnosis or treatment of colorectal and rectal cancer.

Colorectal cancer (CRC) is the third most common cancer worldwide and one of the leading causes of cancer-related disease and mortality. CRC accounts for 9.7% of all cancer incidence worldwide. There are over one million CRC diagnosed cases each year, as well as 600,000 CRC-related deaths. Although surgery and chemotherapy are performed to improve clinical outcomes, many CRC patients appear to have tumor metastases to advanced stages with low survival rates. Therefore, it is necessary to develop new prognostic molecular markers in preparing an effective treatment strategy for CRC. Although many studies report molecules as risk factors for the development of CRC, the mechanisms causing tumor invasion and metastasis of CRC have not been fully elucidated.

The very low density lipoprotein receptor (VLDLR) is a member of the low-density lipoprotein receptor (LDLR) superfamily, an N-terminal ligand-binding domain with cysteine-rich repeats, EGF It consists of a homolog domain, an O-linked glycosylation sugar domain, a transmembrane domain, and a cytoplasmic domain comprising the NPxY sequence. VLDLR has a domain structure similar to that of LDLR, except that it has one more cysteine-rich ligand-binding domain repeat. VLDLR is expressed in a variety of tissues throughout the body, including heart, skeletal muscle, brain and adipose tissue, but not in the liver. Similar to LDLR, VLDLR is generally considered to play an important role in lipid metabolism. However, in previous studies, VLDLR binds to numerous ligands such as lipoprotein lipase (LPL), receptor-associated protein (RAP), thrombospondin-1, urokinase-plasminogen activator and other proteinase-serpin complexes. It has been shown that it can affect various cellular functions. Moreover, mutations in VLDLR are known to be associated with several serious disorders, including hypocerebellar hypoplasia and atherosclerosis, and aberrant expression of VLDLR has been associated with several cancers. Nevertheless, the physiopathological role of VLDLR is not fully understood.

MicroRNAs (miRNAs) are a class of endogenous small RNA molecules of 20-22 nucleotides produced by Dicer that cleaves larger pre-miRNA duplex complexes into mature miRNAs. miRNA affects gene expression by binding to the 3'-UTR of a specific target mRNA and inhibiting translation at the post-transcriptional level. In many studies, miRNAs have been demonstrated to play important roles in a variety of biological processes, including the regulation of development, proliferation, differentiation, apoptosis, cell cycle, stem cell division and many pathological processes. Aberrant expression of miRNAs has also been associated with tumor initiation and progression. Recently, deregulation of miRNAs and their target genes has been shown to correlate closely with the proliferation, invasion, and metastasis progression of many tumors, including CRC. Therefore, the identification of CRC-associated miRNAs and their target genes has been extensively studied for early tumor prognosis and development of potential target-based therapies for CRC patients. Although several studies have shown altered expression of VLDLR and its biological role in some cancers, in particular, the function and regulation of VLDLR by miRNA has not been investigated in CRC.

Aran V, Victorino AP, Thuler LC, Ferreira CG. Colorectal Cancer: Epidemiology, Disease Mechanisms and Interventions to Reduce Onset and Mortality. Clinical colorectal cancer 2016 Nimpf J, Schneider WJ. The VLDL receptor: an LDL receptor relative with eight ligand binding repeats, LR8. Atherosclerosis 1998;141(2):191-202 Wu L, Fan J, Belasco JG. MicroRNAs direct rapid deadenylation of mRNA. Proceedings of the National Academy of Sciences of the United States of America 2006;103(11):4034-4039.

It is an object of the present invention to provide a pharmaceutical use of VLDLR for diagnosis, prevention or treatment in colorectal and rectal cancer.

In order to achieve the above object, the present invention includes an agent for measuring the expression level of mRNA or a protein thereof of a very low density lipoprotein receptor (VLDLR) gene, and the agent for measuring the expression level of the mRNA is complementary to the mRNA An oligonucleotide having a sequence, wherein the agent for measuring the expression level of the protein includes an antibody, oligopeptide, ligand, PNA (peptide nucleic acid) or aptamer specific for the protein A diagnostic composition is provided.

The present invention also provides a kit for diagnosing colon cancer and rectal cancer comprising the composition.

The present invention also comprises the steps of measuring the expression level of mRNA or protein thereof of a very low density lipoprotein receptor (VLDLR) gene from a subject's blood, serum or plasma sample; and comparing the measured expression level of the mRNA or protein thereof of the VLDLR gene with the expression level in a normal control sample.

The present invention also provides a composition for preventing or treating colorectal and rectal cancer comprising a very low density lipoprotein receptor (VLDLR) gene, a vector including the gene, or a transformed cell line transformed with the vector.

The present invention also provides the use of a VLDLR for the manufacture of a pharmaceutical composition for the prevention or treatment of colorectal cancer and rectal cancer.

The present invention also provides a method for treating colorectal cancer and rectal cancer comprising administering to a subject a composition for preventing or treating colorectal cancer and rectal cancer comprising a pharmaceutically effective amount of VLDLR.

The present invention also relates to a case in which a very low density lipoprotein receptor (VLDLR) gene or a VLDLR protein is brought into contact with a candidate drug, and the candidate material promotes the mRNA expression level of the VLDLR gene or enhances the function or activity of the VLDLR protein, colorectal cancer and Provided is a screening method for a medicament for the treatment of colorectal cancer and rectal cancer, which includes determining as a therapeutic agent for rectal cancer.

The present invention confirms the down-expression of VLDLR in colorectal cancer and rectal cancer, and identifies the inverse correlation between VLDLR and miR-200c, in which VLDLR down-expression is regulated by miR-200c, thereby using VLDLR as a diagnostic marker for colorectal and rectal cancer. and the up-expression of VLDLR has an effect that can be used for the prevention or treatment of colorectal cancer and rectal cancer.

1 shows VLDLR expression in various cancers, in which dots indicate outliers, and boxes indicate the first quartile, the median value, and the third quartile (RSEM: RNA-Seq by Expectation-Maximization).
Figure 2 shows the reduced expression of VLDLR in CRC tumors and cell lines, Figures 2A-F are data analysis results from the GEO database (accession numbers, GSE32323, GSE21510, GSE37364, GSE41657, GSE41258 and GSE44076) (P values are Calculated by Mann-Whitney test; ** P <0.01, *** P <0.001), FIG. 2G is qRT-PCR showing the relative expression of VLDLR in CRC tissues relative to adjacent non-tumor tissues of 23 CRC patients Results (results normalized compared to GAPDH mRNA expression), Figure 2H shows seven CRC cell lines (DLD1, HT29, SNU-C4, HCT116, CoLo-320 DM, and LoVo) and normal colon cells (CCD-18Co). is a diagram showing the expression of VLDLR in , and FIG. 2I is a diagram showing the expression of VLDLR in normal colon tissues and colon cancer tissues.
3 is a diagram showing that VLDLR inhibits the proliferation and migration of CRC cells, and FIGS. 3A-C are results of analyzing VLDLR expression using data obtained from the GEO database (accession numbers, GSE8671, GSE37364 and GSE41657) ( P values calculated by Mann-Whitney test; *** P <0.001), Figure 3D Western blot analysis showing that transfection of VLDLR-cDNA constructs resulted in increased expression of VLDLR in four CRC cell lines results (-actin used as a loading control), Figure 3E is a diagram showing that over-expression of VLDLR inhibits the proliferation of DLD-1, SNU-C4, and HT29 cells, Figure 3F is a diagram showing DLD-1, SNU -C4, and SW620 CRC cell migration ability is a result of a wound closure analysis showing that VLDLR over-expression is reduced. Number of viable CRC cells (relative viability of cells was determined by normalizing to the number of viable cells after transfection with control vector). Figure 3H is a quantification of the results of Figure 3F, and after transfection with VLDLR-cDNA structure or a control vector, the area was determined by measuring the area using ImageJ at 24 hours and 48 hours, and CRC calculated as the ratio of the colored area A plot showing the wound healing rate of cells (results are the mean of three independent experiments for both proliferation and migration assays; *P <0.05; **P < 0.01).
4 is a diagram showing that VLDLR is a direct target of miR-200c in CRC cells, and FIG. 4A is a diagram showing that the expected binding sites of miR-200c and miR-182 in VLDLR 3'-UTR are conserved in various species. 4B-C qRT-PCR results showing that endogenous expression of VLDLR was significantly inhibited by miR-200c in both DLD1 and HT29 cells, but its expression was not changed by over-expression of miR-182. (results are normalized compared to GAPDH mRNA expression, and represent the average value of three independent experiments performed in 2 replicates), and FIG. 4D is a result showing that VLDLR expression increases when miR-200c inhibitor is added. VLDLR expression The results show that this is affected by miR-200c, and FIGS. 4E-F are diagrams showing that the luciferase activity of VLDLR 3'-UTR is significantly reduced in miR-200c over-expressed DLD1 and HT29 cells. , Figure 4G is a schematic showing the predicted binding sequence of miR-200c in the 3'UTR of VLDLR (deletion sites are indicated by red hyphens), and Figure 4H is a deletion mutant lacking the miR-200c binding site co-transfected into cells. is a diagram showing that luciferase activity in DLD1 and HT29 cells is not changed by miR-200c when NS = not significant).
FIG. 5 is a result showing the inverse correlation between VLDLR and miR-200c in CRC cells and tissues, and FIG. 5A is a diagram showing that VLDLR expression is inversely correlated with MIR-200c in 7 CRC cell lines in the NCI 60 database. 5B-C is a diagram showing that the GEO database (accession numbers, GSE10259 and GSE50194) shows that miR-200c expression is increased in CRC tissues compared to non-tumor controls (P values calculated by Mann-Whitney test) ; P <0.05), FIG. 5D is a diagram showing the relative expression of miR-200c in CRC tissues and their adjacent non-tumor tissues of 23 CRC patients (results normalized compared to U6 RNA expression), FIG. 5E is A diagram comparing the expression levels of VLDLR and miR-200c in 23 CRC patients.

We investigated the expression of VLDLR in CRC patients and found that it was significantly reduced in tumors compared to paired adjacent non-tumor tissues. In addition, it was found that over-expression of VLDLR inhibits proliferation and migration of CRC cell lines. Moreover, it was confirmed that VLDLR expression was negatively regulated by miR-200c, indicating an inverse correlation between VLDLR and miR-200c in CRC patients. These results suggest that down-regulation of VLDLR mediated by increased expression of miR-200c in CRC may play an important role in the development of CRC.

Accordingly, the present invention includes an agent for measuring the expression level of mRNA or a protein thereof of a very low density lipoprotein receptor (VLDLR) gene, and the agent for measuring the expression level of the mRNA is an oligonucleotide having a sequence complementary to the mRNA Including, wherein the agent for measuring the expression level of the protein provides a composition for diagnosing colon cancer and rectal cancer comprising an antibody, oligopeptide, ligand, PNA (peptide nucleic acid) or aptamer specific to the protein .

As used herein, the term “diagnosis” refers to determining a subject's susceptibility to a specific disease or disorder, determining whether the subject currently has a specific disease or disorder, or to a specific disease or disorder. Determining the prognosis of an affected subject (e.g., identifying a pre-metastatic or metastatic cancer state, staging the cancer, or determining the responsiveness of the cancer to treatment), or therametrics (e.g., determining the efficacy of a treatment); monitoring the state of an object to provide information about it). For the purpose of the present invention, diagnosis is to determine whether or not the occurrence of colorectal cancer and rectal cancer or the possibility (risk) of the occurrence.

As used herein, the term "marker", "biomarker" or "diagnostic marker" refers to a marker that can distinguish a normal or pathological condition or predict a treatment response and can be objectively measured. In particular, with respect to colorectal cancer and rectal cancer in the present invention, the protein expression level or Organic biomolecules such as polypeptides or nucleic acids (eg, mRNA), lipids, glycolipids, glycoproteins, sugars (monosaccharides, disaccharides, oligosaccharides, etc.) it means.

The present invention is characterized in that by utilizing VLDLR as a marker for diagnosing colorectal cancer and rectal cancer, it is characterized in that it is effectively diagnosed whether or not the onset or possibility of colorectal cancer and rectal cancer is occurring in a subject.

As used herein, the term "measurement of the expression level of a protein" refers to a process of confirming the presence and expression level of a marker (protein) for diagnosing colorectal cancer and rectal cancer or a gene encoding the same in a biological sample for diagnosing colorectal cancer and rectal cancer. it means. The protein expression level measurement or comparative analysis method includes protein chip analysis, immunoassay, ligand binding assay, MALDI-TOF (Matrix Assisted Laser Desorption/Ionization Time of Flight Mass Spectrometry) analysis, SELDI-TOF (Sulface Enhanced Laser Desorption). /Ionization Time of Flight Mass Spectrometry) analysis, radioimmunoassay, radioimmunodiffusion method, octeroni immunodiffusion method, rocket immunoelectrophoresis, tissue immunostaining, complement fixation assay, two-dimensional electrophoresis analysis, liquid chromatography-mass spectrometry (liquid chromatography-Mass Spectrometry, LC-MS), LC-MS/MS (liquid chromatography-Mass Spectrometry/ Mass Spectrometry), Western blotting, and ELISA (enzyme linked immunosorbent assay), but are not limited thereto.

In the composition for diagnosing colorectal cancer and rectal cancer according to the present invention, the agent for measuring the expression level of VLDLR protein is an antibody, oligopeptide, ligand, PNA (peptide nucleic acid) or aptamer that specifically binds to VLDLR protein. may include

As used herein, the term "antibody" refers to a substance that specifically binds to an antigen and causes an antigen-antibody reaction. For the purposes of the present invention, an antibody refers to an antibody that specifically binds to a protein of VLDLR. Antibodies of the present invention include polyclonal antibodies, monoclonal antibodies and recombinant antibodies. The antibody can be readily prepared using techniques well known in the art. For example, the polyclonal antibody can be produced by a method well known in the art, including the process of injecting the colorectal cancer and rectal cancer marker protein antigen into an animal and collecting blood from the animal to obtain a serum containing the antibody. . Such polyclonal antibodies can be prepared from any animal such as goat, rabbit, sheep, monkey, horse, pig, cow, dog, and the like. In addition, monoclonal antibodies can be prepared using the hybridoma method well known in the art (see Kohler and Milstein (1976) European Journal of Immunology 6:511-519), or the phage antibody library technology (Clackson et al, Nature, 352). :624-628, 1991; Marks et al, J. Mol. Biol., 222:58, 1-597, 1991). The antibody prepared by the above method may be separated and purified using methods such as gel electrophoresis, dialysis, salt precipitation, ion exchange chromatography, and affinity chromatography. In addition, the antibodies of the present invention include functional fragments of antibody molecules as well as complete forms having two full-length light chains and two full-length heavy chains. A functional fragment of an antibody molecule means a fragment having at least an antigen-binding function, and includes Fab, F(ab'), F(ab') ₂ and Fv.

As used herein, the term "PNA (Peptide Nucleic Acid)" refers to an artificially synthesized, DNA or RNA-like polymer, and was first introduced by Professors Nielsen, Egholm, Berg and Buchardt of the University of Copenhagen, Denmark in 1991. Whereas DNA has a phosphate-ribose sugar backbone, PNA has a repeated N-(2-aminoethyl)-glycine backbone linked by peptide bonds, which greatly increases binding strength and stability to DNA or RNA, resulting in molecular biology , diagnostic assays and antisense therapy. PNA is described in Nielsen PE, Egholm M, Berg RH, Buchardt O (December 1991). "Sequence-selective recognition of DNA by strand displacement with a thymine-substituted polyamide". Science 254 (5037): 1497-1500.

As used herein, the term "aptamer" is an oligonucleic acid or peptide molecule, and the general description of an aptamer is described in Bock LC et al., Nature 355(6360):5646(1992); Hoppe-Seyler F, Butz K "Peptide aptamers: powerful new tools for molecular medicine". J Mol Med. 78(8):42630(2000); Cohen BA, Colas P, Brent R. "An artificial cell-cycle inhibitor isolated from a combinatorial library". Proc Natl Acad Sci USA. 95(24): 142727 (1998).

As used herein, the term "measuring the expression level of mRNA" refers to a process of determining the presence and expression level of mRNA of genes encoding proteins for diagnosis of colorectal and rectal cancer in a biological sample for diagnosing colorectal cancer and rectal cancer. means to measure Analysis methods for this include reverse transcription polymerase reaction (RT-PCR), competitive reverse transcription polymerase reaction (Competitive RT-PCR), real-time reverse transcription polymerase reaction (Real-time RT-PCR), RNase protection assay (RPA; RNase protection) assay), Northern blotting, and a DNA chip, but is not limited thereto.

In the composition for diagnosing colorectal cancer and rectal cancer according to the present invention, the agent for measuring the mRNA expression level of a gene encoding a VLDLR protein includes a primer, a probe, or an antisense nucleotide that specifically binds to the mRNA of a gene encoding the VLDLR protein do. Since information on the VLDLR protein according to the present invention is known from UniProt, etc., those skilled in the art will be able to easily design a primer, probe or antisense nucleotide that specifically binds to the mRNA of the gene encoding the protein based on this information.

As used herein, the term "primer" is a fragment recognizing a target gene sequence, including a pair of forward and reverse primers, but preferably, a primer pair that provides analysis results with specificity and sensitivity. High specificity can be conferred when the primer's nucleic acid sequence is a sequence that is inconsistent with a non-target sequence present in the sample, thus amplifying only the target gene sequence containing the complementary primer binding site and not causing non-specific amplification. .

As used herein, the term “probe” refers to a substance capable of specifically binding to a target substance to be detected in a sample, and refers to a substance capable of specifically confirming the presence of a target substance in a sample through the binding. . The type of probe is not limited as a material commonly used in the art, but preferably PNA (peptide nucleic acid), LNA (locked nucleic acid), peptide, polypeptide, protein, RNA or DNA. More specifically, the probe is a biomaterial derived from or similar thereto, or manufactured in vitro, and includes, for example, enzymes, proteins, antibodies, microorganisms, animal and plant cells and organs, neurons, DNA, and It may be RNA, DNA includes cDNA, genomic DNA, and oligonucleotides, RNA includes genomic RNA, mRNA, and oligonucleotides, and examples of proteins include antibodies, antigens, enzymes, peptides, and the like.

As used herein, the term "antisense" means that an antisense oligomer hybridizes with a target sequence in RNA by Watson-Crick base pairing, allowing the formation of a typically mRNA and RNA:oligomeric heteroduplex within the target sequence of nucleotide bases. It refers to an oligomer having a sequence and an inter-subunit backbone. An oligomer may have exact sequence complementarity or approximate complementarity to a target sequence.

In addition, the composition for diagnosing colorectal cancer and rectal cancer according to the present invention may further include an agent for measuring the expression level of miR-200c.

The composition of the present invention enables more effective and more accurate diagnosis of colorectal and rectal cancer by combining the measurement values of two markers, namely, VLDLR and miR-200c.

In addition, the present invention provides a kit for diagnosing colon cancer and rectal cancer comprising the composition for diagnosing colon cancer and rectal cancer.

Preferably, the kit may be an RT-PCR kit, a DNA chip kit, an ELISA kit, a protein chip kit, a rapid kit, or a multiple reaction monitoring (MRM) kit.

The colorectal cancer and rectal cancer diagnostic kit may further include one or more other component compositions, solutions or devices suitable for the analysis method. Preferably, the diagnostic kit may further include essential elements necessary for performing the reverse transcription polymerase reaction. The reverse transcription polymerase reaction kit includes a pair of primers specific for a gene encoding a marker protein. The primer is a nucleotide having a sequence specific to the nucleic acid sequence of the gene, and may have a length of about 7 bp to 50 bp, more preferably about 10 bp to 30 bp. It may also include a primer specific for the nucleic acid sequence of the control gene. Other reverse transcription polymerase reaction kits include test tubes or other suitable containers, reaction buffers (with varying pH and magnesium concentrations), deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitor DEPC -Water (DEPC-water), sterile water, etc. may be included.

In addition, the diagnostic kit of the present invention may include essential elements necessary for performing a DNA chip. The DNA chip kit may include a substrate to which cDNA or oligonucleotide corresponding to a gene or fragment thereof is attached, and reagents, agents, enzymes, etc. for preparing a fluorescently-labeled probe. The substrate may also contain cDNA or oligonucleotides corresponding to control genes or fragments thereof.

In addition, the diagnostic kit of the present invention may include essential elements necessary for performing ELISA. The ELISA kit contains an antibody specific for this protein. Antibodies are antibodies with high specificity and affinity for a marker protein and little cross-reactivity with other proteins, and are monoclonal antibodies, polyclonal antibodies, or recombinant antibodies. The ELISA kit may also include an antibody specific for a control protein. Other ELISA kits include reagents capable of detecting bound antibody, for example, labeled secondary antibodies, chromophores, enzymes (eg, conjugated with an antibody) and their substrates or capable of binding the antibody. other materials and the like.

Furthermore, the present invention provides a method for diagnosing colon cancer and rectal cancer using the composition for diagnosing colon cancer and rectal cancer or the kit for diagnosing colon cancer and rectal cancer. The diagnostic method comprises the steps of:

(a) obtaining a sample from a subject to be diagnosed with colorectal cancer and colorectal cancer; (b) measuring the expression level of a very low density lipoprotein receptor (VLDLR) gene mRNA or protein thereof from the sample; (c) comparing the measured expression level of the mRNA or protein thereof of the VLDLR gene with the expression level in a normal control sample; And (d) as a result of the comparison of step (c), when the expression level of the mRNA or protein thereof of the VLDLR gene in the subject to be diagnosed with colorectal cancer and rectal cancer is lower than the expression level in the normal control, colorectal cancer and rectal cancer The stage of determining that the possibility of the onset is high.

In the method, "sample" is a biological sample (biological sample), and a sample such as tissue, cell, blood, serum, plasma, saliva, cerebrospinal fluid or urine in which the protein expression level or gene expression level is different due to the onset of colorectal cancer and rectal cancer. and the like, and preferably means blood, serum or plasma.

Since the mRNA of the VLDLR gene or its protein has a characteristic that the expression level in colorectal cancer and rectal cancer patients is decreased compared to the expression level in the normal control group, the VLDLR gene in a subject to be diagnosed with colorectal cancer or rectal cancer. If the mRNA or protein thereof is lower than the expression level of the protein or gene in the normal control group in colorectal cancer and rectal cancer patients, it can be determined that the likelihood of developing colorectal cancer is high.

The 'VLDLR gene mRNA or protein of the VLDLR gene in a subject to be diagnosed with colorectal cancer or rectal cancer is lower than the expression level in the normal control group in colorectal cancer and rectal cancer patients' can be measured by various methods. When the expression level of the VLDLR gene or its protein in a subject to be diagnosed with colorectal cancer and rectal cancer is 1.0-fold, or 1.5-fold, or 2-fold, the expression level in colorectal cancer and rectal cancer patients is 1.0-fold, or 1.5-fold, or 2-fold, or a 3-fold, or 5-fold or 10-fold decrease.

In the method of the present invention, measurement or comparison of the mRNA expression level of the VLDLR gene may be performed using a reverse transcriptase polymerase reaction, a competitive reverse transcriptase polymerase reaction, a real-time reverse transcriptase polymerase reaction, an RNase protection assay, Northern blotting or a DNA chip. However, the present invention is not limited thereto. Through the above measurement methods, it is possible to check the mRNA expression level in the normal control group and the mRNA expression level of the target to diagnose whether colon cancer or rectal cancer occurs, and by comparing these expression levels, it is possible to diagnose or predict the possibility of colorectal cancer and rectal cancer. can

In addition, in the method of the present invention, the protein expression level can be measured and compared using an antibody that specifically binds to the protein. A method of allowing the antibody and the corresponding protein in the biological sample to form an antigen-antibody complex and detecting the antibody is used.

As used herein, the term “antigen-antibody complex” refers to a combination of a protein antigen and an antibody that recognizes the protein antigen for confirming the presence or absence of a corresponding gene in a biological sample. The detection of the antigen-antibody complex can be detected using methods known in the art, for example, spectroscopic, photochemical, biochemical, immunochemical, electrical, optical, chemical and other methods.

For the purpose of the present invention, the protein expression level measurement or comparative analysis method includes protein chip analysis, immunoassay, ligand binding assay, MALDI-TOF (Matrix Assisted Laser Desorption/Ionization Time of Flight Mass Spectrometry) analysis, SELDI-TOF (Sulface Enhanced Laser Desorption/Ionization Time of Flight Mass Spectrometry) analysis, radioimmunoassay, radioimmunodiffusion method, Oukteroni immunodiffusion method, rocket immunoelectrophoresis, tissue immunostaining, complement fixation assay, 2D electrophoresis analysis, liquid phase Chromatography-mass spectrometry (LC-MS), LC-MS/MS (liquid chromatography-Mass Spectrometry/ Mass Spectrometry), Western blot and ELISA (enzyme linked immunosorbent assay), etc., but are limited thereto no.

Through the above analysis methods, it is possible to compare the protein expression level in the normal control group with the protein expression level in colorectal cancer and rectal cancer individuals, and by determining whether or not there is a significant increase or decrease in the expression level of the protein in the colon cancer and rectal cancer marker genes, the colon It can diagnose the possibility of developing cancer and rectal cancer.

In addition, the present invention provides a method for diagnosing colorectal cancer and rectal cancer by combining miR-200c, which is known as a conventional colorectal cancer and rectal cancer marker, in addition to VLDLR. The method comprises the steps of:

(a) obtaining a sample from a subject to be diagnosed with colorectal cancer and colorectal cancer; (b) measuring the expression level of a very low density lipoprotein receptor (VLDLR) gene mRNA or protein thereof from the sample; (c) comparing the measured expression level of the mRNA or protein thereof of the VLDLR gene with the expression level in a normal control sample; (d) measuring the expression level of miR-200c from the sample; (e) comparing the measured expression level of miR-200c with the expression level in a normal control sample; And (f) as a result of the comparison of steps (c) and (e), the expression level of the mRNA of the VLDLR gene or its protein in the subject to be diagnosed with colorectal cancer and rectal cancer is lower than the expression level in the normal control group, When the expression level of miR-200c is higher than the expression level in the normal control group, determining that the possibility of developing colorectal cancer and rectal cancer is high.

Steps (d) and (e) in the above method may be performed in a manner similar to that described with respect to the above-described mRNA of the VLDLR gene.

On the other hand, the present invention provides a method for providing information necessary for diagnosing colorectal cancer and rectal cancer,

(a) obtaining a sample from a subject to be diagnosed with colorectal cancer and colorectal cancer; (b) measuring the expression level of a very low density lipoprotein receptor (VLDLR) gene mRNA or protein thereof from the sample; and; and (c) comparing the expression level of the mRNA or protein thereof of the VLDLR gene with the expression level in a normal control sample.

The method of providing information necessary for diagnosing colon cancer and rectal cancer,

measuring the expression level of miR-200c from a subject to be diagnosed with colorectal cancer and rectal cancer; and comparing the measured expression level of miR-200c with the expression level in a normal control sample.

The present invention also provides a composition for preventing or treating colorectal and rectal cancer comprising a very low density lipoprotein receptor (VLDLR) gene, a vector including the gene, or a transformed cell line transformed with the vector.

The present invention also provides the use of VLDLR for the manufacture of a pharmaceutical composition for the prevention or treatment of colorectal cancer and rectal cancer.

According to the present invention, the expression of VLDLR is down-regulated in colorectal cancer and rectal cancer cells, and tissues, and the expression of VLDLR is regulated by miR-200c. A vector containing a gene or a transformed cell line transformed with the vector may be used.

In the present invention, the "vector" refers to a genetic construct comprising an external DNA inserted into a genome encoding a polypeptide.

The vector related to the present invention is a vector in which a nucleic acid sequence inhibiting the gene is inserted into the genome, and these vectors include a DNA vector, a plasmid vector, a cosmid vector, a bacteriophage vector, a yeast vector, or a viral vector.

In addition, miR-200c binds to 243-249 bp of 3'-UTR of VLDLR and decreases VLDLR expression, thereby down-regulating VLDLR expression. It can be used as a medicament for preventing or treating colon and rectal cancer.

Therefore, the composition for preventing or treating colorectal cancer and rectal cancer of the present invention may further include a miR-200c inhibitor.

The miR-200c inhibitor may be a substance capable of inhibiting miR-200c activity. The substance capable of inhibiting the activity of miR-200c is a substance capable of inhibiting the regulation of VLDLR expression of miR-200c, and the substance capable of inhibiting the activity of miR-200c may inhibit the expression of miR-200c. It may be a material that can be

The inhibitor of miR-200c is a nucleic acid molecule capable of binding to all or part of the nucleotide sequence of miR-200c, and such nucleic acid molecule is, for example, RNA, DNA, antagomere, antisense molecule, siRNA, shRNA, 2' -O-modified oligonucleotides, phosphorothioate-backbone deoxyribonucleotides, phosphorothioate-backbone ribonucleotides, decoy oligonucleotides, peptide nucleic acid (PNA) oligonucleotides or LNA (locked nucleic acid) oligonucleotides. It is not limiting.

More specifically, the inhibitor of miR-200c may be a sequence of 243-249 bp of 3'-UTR of VLDLR (5'-caguauu-3'). The sequence may be used without modification, or may include one or more modifications in consideration of the effect according to the present application, for example, one or more nucleotides constituting the same are LNA, or the sugar of one or more nucleotides constituting the same is 2'-O - methylation, or one or more phosphothioates in its backbone, or a combination thereof.

As used herein, the term "antisense oligonucleotide" includes a nucleic acid-based molecule capable of forming a duplex with a miRNA by having a sequence complementary to all or part of the seed sequence of a targeted miRNA, particularly a miRNA. will be. Thus, herein, the term “antisense oligonucleotide” may be referred to as “complementary nucleic acid-based inhibitor”. The antisense oligonucleotide includes various molecules, for example, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), antagomere, 2'-O-modified oligonucleotide, phosphorothioate-backbone deoxyribonucleotide, phosphoro Thioate-backbone ribonucleotides, peptide nucleic acid (PNA) oligonucleotides, or locked nucleic acid (LNA) oligonucleotides. Preferably, it is ribonucleic acid. The ribonucleic acid includes double-stranded small interfering RNA (siRNA), short hairpin RNA (shRNA) and ribozyme. LNA is a modified ribonucleotide and has a locked form by including an additional bridge between the 2' to 4' carbons of the ribose sugar moiety, and the oligonucleotide with LNA has improved thermal stability. Peptide nucleic acids (PNAs) contain a peptide-based backbone instead of a sugar-phosphate backbone. The 2'-O-modified oligonucleotide is preferably a 2'-O-alkyl oligonucleotide, more preferably a 2'-OC _1-3 alkyl oligonucleotide, most preferably a 2'-O-methyl oligonucleotide All. The antisense oligonucleotide includes, in a narrow sense, antisense oligonucleotides, antagomere and inhibitory RNA molecules. As used herein, the term "antagomere" is a single-stranded chemically modified oligonucleotide, and is used for the silence of endogenous microRNA. Antagomere contains a non-complementary sequence at the Arganoute 2 (Ago 2) cleavage site, or the base is modified with, for example, 2' methoxy group, 3' cholesterol group, phosphorothioate to inhibit Ago2 cleavage. and has a complementary sequence to the target sequence. The antagomere according to the present application has a sequence that is at least partially or completely complementary to miR-200c. In one embodiment the antagomere comprises one or more modifications (eg, a 2'-0-methyl-sugar modification, or a 3' cholesterol modification). In other embodiments, the antagomere comprises one or more phosphorothioate linkages and is at least partially with a phosphorothioate backbone. The length of an antagomere suitable for inhibiting miR-200-c according to the present application is 7-50 nucleotides, in particular 10-40 nucleotides, more particularly 15-30 nucleotides, even more particularly 15-25 nucleotides, in particular 16-19 nt, It is not limited thereto.

As used herein, the term "complementary" means that an antisense oligonucleotide is sufficiently complementary to selectively hybridize to a miR-200c target under certain hybridization or annealing conditions, preferably physiological conditions, and is partially or partially substantially complementary. It has a meaning encompassing both substantially complementary and perfectly complementary, and preferably means completely complementary. Substantially complementary, although not completely complementary, refers to a degree of complementarity sufficient to bind to a target sequence and produce an effect sufficient to interfere with the effect according to the present application, that is, miR-200c activity.

As used herein, the term "nucleic acid" includes polynucleotides, oligonucleotides, DNA, RNA, and analogs and derivatives thereof, and includes, for example, peptide nucleic acids (PNA) or mixtures thereof. In addition, the nucleic acid may be single or double-stranded, and may encode a molecule including a polypeptide, mRNA, miRNA, or siRNA.

In one embodiment according to the present application, the substance capable of inhibiting the activity of miR-200c is capable of inhibiting its activity by complementary binding to all or part of the precursor and/or mature sequence of miR-200c, in particular the seed sequence. antisense oligonucleotides. Inhibition of the activity is to inhibit the transcription of miR-200c and/or the binding of miR-200c to the target mRNA. The antisense oligonucleotide according to the present disclosure may or may not include one or more of the following modifications in the nucleotides constituting it or the backbone (backbone) connecting the nucleotides. That is, in the antisense oligonucleotide, one or more nucleotides constituting the same are LNA, or the sugar of one or more nucleotides constituting the same is 2'-O-methylated, or one or more phosphothioates may be included in the backbone thereof.

In one embodiment according to the present application, the antisense oligonucleotide or nucleic acid molecule of the present application comprises a sequence complementary to all or part of the seed sequence of miR-200c. The seed sequence is a conserved sequence in various species that is very important for the recognition of target molecules of miRNAs (Krenz, M. et al., J. Am. Coll. Cardiol. 44:2390-2397 (2004); H. Kiriazis, et al. al., Annu. Rev. Physiol. 62:321 (2000)). Since miRNA binds to the target through the seed sequence, when the interaction of the seed sequence with the target is inhibited, translation of the target mRNA can be effectively inhibited.

In addition, the composition for preventing or treating colon cancer and rectal cancer of the present invention may further include a pharmaceutically acceptable carrier.

The pharmaceutically acceptable carrier includes carriers and vehicles commonly used in the pharmaceutical field, and specifically, ion exchange resin, alumina, aluminum stearate, lecithin, serum protein (eg, human serum albumin), buffer material (eg, Various phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids), water, salts or electrolytes (eg protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride and zinc salts), colloidal silica, magnesium trisilicate, polyvinylpyrrolidone, cellulosic matrix, polyethylene glycol, sodium carboxymethylcellulose, polyarylate, wax, polyethylene glycol or wool paper, and the like.

In addition, the composition of the present invention may further include a lubricant, a wetting agent, an emulsifier, a suspending agent, or a preservative in addition to the above components.

In one embodiment, the composition according to the present invention can be prepared as an aqueous solution for parenteral administration, preferably a buffered solution such as Hank's solution, Ringer's solution or physically buffered saline. can be used Aqueous injection suspensions may contain a substrate capable of increasing the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol or dextran.

The composition of the present invention may be administered systemically or locally, and may be formulated into a formulation suitable for such administration by a known technique. For example, when administered orally, it may be administered by mixing with an inert diluent or an edible carrier, sealing it in a hard or soft gelatin capsule, or pressing it into a tablet. For oral administration, the active compound can be mixed with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers and the like.

Various formulations for injection, parenteral administration, etc. can be prepared according to techniques known in the art or commonly used techniques. Formulation administration may include intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, transdermal administration, and the like.

A suitable dosage of the composition of the present invention may be variously prescribed depending on factors such as formulation method, administration method, age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and response sensitivity of the patient. have. For example, an appropriate dosage may vary depending on the amount of drug accumulated in the patient's body and/or the specific degree of efficacy of the polynucleotide used. In general, it can be calculated based on the EC ₅₀ measured to be effective in an in vivo animal model and in vitro, for example, it can be 0.01 μg to 1 g per 1 kg of body weight, and in a unit period of daily, weekly, monthly or annual , may be administered once to several times per unit period, or may be administered continuously for a long period of time using an infusion pump. The number of repeated administrations is determined in consideration of the time the drug stays in the body, the concentration of the drug in the body, and the like. According to the course of disease treatment, the composition may be administered for relapse even after treatment has been completed.

In addition, the present invention provides a method for treating colorectal cancer and rectal cancer, comprising administering to a subject a composition for preventing or treating colorectal cancer and rectal cancer comprising a pharmaceutically effective amount of VLDLR.

Since the pharmaceutical composition and administration method used in the method for treating colorectal cancer and rectal cancer have been described above, descriptions of common contents between the two will be omitted in order to avoid excessive complexity of the present specification.

On the other hand, the subject to which the pharmaceutical composition for the prevention or treatment of colorectal cancer and rectal cancer can be administered includes all animals. For example, it may be a non-human animal such as a dog, a cat, or a mouse.

The present invention also relates to a case in which a very low density lipoprotein receptor (VLDLR) gene or a VLDLR protein is brought into contact with a candidate drug, and the candidate material promotes the mRNA expression level of the VLDLR gene or enhances the function or activity of the VLDLR protein, colorectal cancer and Provided is a screening method for a medicament for the treatment of colorectal cancer and rectal cancer, which includes determining as a therapeutic agent for rectal cancer.

According to the screening method of the present invention, first, a candidate substance to be analyzed can be brought into contact with colon cancer and rectal cancer cells containing the gene or protein. The candidate substance is estimated to have potential as a substance that promotes or inhibits transcription or translation from the VLDLR gene sequence to mRNA or protein, or a drug that enhances or inhibits the function or activity of the VLDLR protein according to a conventional selection method, or It may be randomly selected individual nucleic acids, proteins, peptides, other extracts or natural products, compounds, and the like.

Thereafter, the expression level of the gene, the amount of the protein or the activity of the protein can be measured in the cells treated with the candidate substance, and as a result of the measurement, when it is measured that the expression level of the gene, the amount of the protein or the activity of the protein is increased The candidate material may be determined as a therapeutic agent for colorectal cancer and rectal cancer.

Such candidate materials for colorectal cancer and rectal cancer treatment will act as a leading compound in the process of developing a treatment for colorectal cancer and rectal cancer, and the lead material may have an effect of promoting the function of the VLDLR gene or protein expressed therefrom. By modifying and optimizing its structure, it is possible to develop new therapeutic agents for colorectal and rectal cancer.

In the above, the method for measuring the expression level of the gene, the amount of the protein, or the activity of the protein can be performed through various methods known in the art, and as described above, the common content is to avoid excessive complexity of the present specification, omit the description.

Matters related to genetic engineering in the present invention include Sambrook et al. (Sambrook, et al . Molecular Cloning, A Laboratory Manual, Cold Spring Harbor laboratory Press, Cold Spring Harbor, NY (2001)) and Frederick et al. M. Ausubel et al. , Current protocols in molecular biology volume 1, 2, 3, John Wiley & Sons, Inc. (1994)) makes it clearer.

Advantages and features of the present invention, and methods for achieving them, will become apparent with reference to the embodiments described below in detail. However, the present invention is not limited to the embodiments disclosed below, but will be implemented in a variety of different forms, and only these embodiments allow the disclosure of the present invention to be complete, and common knowledge in the technical field to which the present invention belongs It is provided to fully inform the possessor of the scope of the invention, and the present invention is only defined by the scope of the claims.

<Example>

tissue sample

All CRC and non-tumor colon tissue samples were obtained from the Department of Pathology, The Catholic University of Korea. For analysis, all samples were approved by the Ethics Review Board (IRB) affiliated with the Catholic University of Korea Medical School.

Cell culture and reagents

All colorectal cancer cells (DLD-1, HT29, SNU-C4, HCT116, SW620, and d LoVo) were purchased from the Korea Cell Line Bank, and in an incubator at 37° C., 5% CO ₂ condition, Roswell Park Memorial containing 10% FBS. Institute-1640 Medium (Invitrogen). The full-length VLDLR cDNA construct was obtained from Sino biological. Each miR-200c mimic and negative mimic were purchased from Dharmacon.

transfection experiment

The full-length VLDLR-cDNA construct was transfected into DLD1, HT29, SNU-C4 and SW620 cells using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer's instructions. For over-expression of miR-200c, miR-200c mimics were transfected into DLD1 and HT29 cells using DharmaFECT 1 transfection reagent (Dharmacon) according to the manufacturer's instructions. Negative mimetics were used as controls. After 48 or 72 hours of incubation, cells were harvested and used for total RNA or protein extraction.

Prediction of miRNA targeting VLDLR

To search for miRNAs targeting VLDLR, miRBase (http://www.mirbase.org/) and TargetScan version 7.0 (http://www.targetscan.org/) databases were used.

miRNA-specific qRT-PCR

Total RNA was extracted from CRC tissues using Trizol reagent (Invitrogen) according to the manufacturer's instructions. cDNA was synthesized using the Mir-X ^™ miRNA First-strand synthesis kit (Clontech) according to the manufacturer's instructions. The following primers were used to amplify miR-200c and U6, respectively:

5'ATAATACTGCCGGGTAATGATGGA3' and

5'TGGCCCCTGCGCAAGGATG3'

The relative expression of miR-200c was measured compared to the expression of U6 micronuclear RNA using the comparative ComCt method.

RT-PCR and qRT-PCR

Total RNA was isolated from cells and CRC tissues using Trizol reagent (Invitrogen) according to the manufacturer's instructions, and reverse-transcribed into cDNA using PrimeScript 1st strand cDNA Synthesis kit (Takara). RT-PCR and qRT-PCR were performed using Thermal Cycler-100 (MJ Research) and CFX96 (Bio-Rad Laboratories), respectively. All expression levels were normalized compared to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene expression using the comparative ComCt method. The primer sequences are as follows:

VLDLR F, 5'-CCAATTCCAGTGCACAAATG-3' and R, 5'-TGAACCATCTTCGCAGTCAG-3';

GAPDH F, 5'-GAGTCAACGGATTTGGTCGTT-3' and R, 5'-TTGATTTTGGAGGGATCTCG-3'.

The results are expressed as the average of three independent experiments measured in two replicates.

Western blot analysis

DLD1, HT29, SNU-C4 and SW620 cells transfected with VLDLR-cDNA were harvested from the plate 48 hours after transfection. Then, according to standard methods, radioimmunoprecipitation assay buffer (150 mM sodium chloride, 1% NP-40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate, 50 mM Tris-HCl [pH 8.0]) was added. was used to separate the total protein extract. Cell lysates were subjected to 10% SDS-PAGE and then transferred to a nitrocellulose membrane. The membranes were then incubated with rabbit polyclonal VLDLR antibody (1:1000, Thermofisher) or mouse polyclonal β-Actin antibody (1:5000, Santa Cruz) according to standard protocols. Protein bands were visualized using an enhanced chemiluminescence system (ECL, Amersham Bioscience).

Wound healing assay

DLD1, SNU-C4 and SE620 cells were seeded in a 60 mm culture dish at 90% confluency, and VLDLR-cDNA was transfected using Lipofectamine 2000 reagent according to the manufacturer's instructions. At 24 hours post-transfection, the middle of the plate was scratched using a P10 pipette tip. Then, each cell was incubated with mitomycin C (4 μ/mL) to inhibit proliferation. After washing 3 times, the cells were incubated at 37° C., and the moving distance was measured using IMAGEJ software after 48 hours.

Plasmid construction

The full length of 3'-UTR of VLDLR was amplified from cDNA obtained from total RNA of DLD1 cells by PCR using PrimeSTAR DNA Polymerase (Takara). Then, the PCR product was cloned into pGEMT-easy vector, and subcloned into psiCHECK-2 vector DNA (Promega) using a Not I cloning site. To generate a mutation control containing a specific site deletion of the VLDLR 3'-UTR, the QuikChange Site-Directed Mutagenesis Kit (Stratagene) was used according to the manufacturer's instructions. The gene-specific primers are as follows:

VLDLR 3'-UTR F, 5'-ACTTCTGTGACAAATGTTGACCTTT-3' and R, 5'-AGTCAAGCTAGATCATCATCTGT-3';

VLDLR 3'-UTR (3262-3268 bp deletion) F, 5'-TCTGTAACCCTTGAATTTCTAGAGCCACCTCTGGC-3' and R, 5'-GCCAGAGGTGGCTCTAGAAATTCAAGGGTTAGAGA-3'.

Luciferase reporter assay

DLD1 and HT29 cells were seeded in 60 mm culture dishes to 70% confluency. After 24 hours, cells were co-transfected with a reporter construct containing 50 nM miR-200c mimic and 1 μg of VLDLR 3'UTR or a deletion mutant plasmid thereof using Lipofectamine 2000 reagent. Luciferase activity was measured 48 hours after transfection using Dual-Luciferase Reporter Assay reagent (Promega).

statistical analysis

P values were measured using Student's t-tests, and values of p < 0.05 were considered statistically significant.

<Example 1> VLDLR expression level evaluation in CRC

First, the expression of VLDLR in various cancer tissues was investigated using the TCGA database ( http://firebrowse.org ).

It was found that VLDLR expression is decreased in various cancers, including breast cancer, colorectal cancer, esophageal cancer, rectal cancer, gastric cancer, thyroid cancer and thymic cancer ( FIG. 1 ). In contrast, VLDLR over-expression was detected in cholangiocarcinoma, renal renal cell carcinoma and pheochromocytoma and paraganglioma, suggesting that altered expression of VLDLR is cancer-specific.

Changes in VLDLR expression in various cancers (TCGA database) Tumor name tumor (n) normal (n) fold change Bladder urothelial carcinoma 408 19 0.539 Breast invasive carcinoma 1100 112 0.334 Cervical and endocervical cancers 306 3 1.08 Cholangiocarcinoma 36 9 4.11 Colon adenocarcinoma 459 41 0.313 Colorectal adenocarcinoma 626 51 0.31 Esophageal carcinoma 185 11 0.275 Head and Neck squamous cell carcinoma 522 44 0.534 Kidney Chromohobe 66 25 2.81 Pan-kidney cohort (KICH+KIRC+KIRP) 891 129 1.42 Kidney renal clear cell carcinoma 534 72 1.35 Kidney renal papillary cell carcinoma 291 32 1.34 Liver hepatocellular carcinoma 369 50 1.22 Lung adenocarcinoma 517 59 0.549 Lung squamous cell carcinoma 501 51 0.772 Pancreatic adenocarcinoma 179 4 0.816 Pheochromocytoma and Paraganglioma 184 3 1.72 Prostate adenocarcinoma 498 52 0.934 Rectum adenocarcinoma 167 10 0.255 Sarcoma 263 2 0.519 Stomach adenocarcinoma 415 35 0.336 Stomach and Esophageal carcinoma 600 46 0.274 Thyroid carcinoma 509 59 0.396 Thymoma 120 2 0.295 Uterine Corpus Endometrial Carcinoma 546 35 0.957

Next, since the expression of VLDLR was significantly down-regulated in both colorectal and rectal cancer, the expression of VLDLR in CRC was further investigated. To test whether the expression level of VLDLR is actually changed in CRC, first, the Gene Expression Omnibus (GEO) database (http://www.ncbi.nlm.nih.gov/geo/, accession numbers: GSE32323, GSE21510, GSE37364) , GSE41657, GSE41258, and GSE44076) in 6 CRC cohorts were analyzed.

Interestingly, VLDLR expression was significantly down-regulated in all 6 CRC cohorts compared to normal tissues (Figures 2A-F).

Additionally, expression levels of VLDLR in CRC were assessed using qRT-PCR in CRC samples and compared to paired adjacent non-tumor samples collected from 23 CRC patients.

Consistent with the GEO data, the expression level of VLDLR in CRC samples was significantly reduced compared to the corresponding non-tumor tissue ( FIG. 2G ). Twenty-one tumors (91.3%) of 23 CRC samples showed reduced expression of VLDLR compared to adjacent normal tissues, and 16 CRCs showed a reduction of more than 50%.

In addition, expression of VLDLR was tested in various CRC cell lines (DLD1, HT29, SNU-C4, HCT116, CoLo-320 DM and LoVo) and normal colon cells (CCD-18Co) using RT-PCR.

Similar to CRC patients, all CRC cell lines tested showed reduced expression of VLDLR compared to normal human colon cells ( FIG. 2H ).

In addition, the expression of VLDLR in colorectal cancer was investigated by identification using an immunohistochemical method using a tissue array. For this purpose, human tissue array-colon tumor (Genetex) was purchased. Array slides were incubated with VLDLR antibody (1:100, Santa Cruz) for overnight at 4°C. After washing 3 times with PBS, each slide was incubated with horseradish peroxidase-conjugated antibody (Dako) for 1 hour at room temperature. After the color reaction using diaminobenzidine (Dako) as the chromogen, the signal was detected under a fluorescence microscope (Olympus).

As shown in Figure 2I, it was confirmed that the low expression of VLDLR compared to the surrounding normal cells in colorectal cancer.

Taken together, these results suggest that down-regulation of VLDLR is associated with the development of CRC.

<Example 2> Effect of VLDLR over-expression on proliferation and migration of CRC cells

Most CRCs result from the progression of colorectal adenoma, a benign adenoma, through a traditional adenoma-sarcoma sequence. Since adenoma is a precursor lesion for CRC development, we additionally analyzed the GEO databases (GSE8671, GSE37364 and GSE41657).

All three cohorts showed that the expression of VLDLR was significantly down-regulated in colorectal adenomas ( FIGS. 3A-C ).

Therefore, we hypothesized that reduced expression of VLDLR may be associated with early CRC development by regulating cell proliferation. To measure the function of VLDLR in CRC cells, proliferation assay was performed using the VLDLR over-expression system because the basal expression of VLDLR is low in CRC cells. CRC cells were transfected with the VLDLR-cDNA construct.

As shown in FIG. 3D , over-expression of VLDLR was confirmed.

As shown in Figures 3E and G, VLDLR over-expression correlated with a decreased number of CRC cells in all three cell lines tested. Compared to controls, the three cell lines showed a 25-40% reduction in viable cell numbers in VLDLR-transfected cells.

In addition, since VLDLR is known to cause neuronal migration in the brain, we investigated whether over-expression of VLDLR affects the migratory ability of CRC cells using a wound healing assay.

The SW620 cell line showed much slower wound healing rates, but all three tested cell lines showed the same pattern of delayed wound healing rates observed in VLDLR over-expressing cells compared to control cells ( FIGS. 3F and H ). These results suggest that VLDLR can inhibit both proliferation and migration of CRC cells.

<Example 3> Investigation of miRNR targeting VLDLR in CRC

A recent study revealed that the expression of VLDLR is down-regulated by miR-135a to promote proliferation of gallbladder cancer cells. Based on this information, we hypothesized that the presence of specific miRNAs that down-regulate VLDLR expression in CRC would affect the proliferation of cells. To identify such miRNAs, we first investigated miRNAs that are up-regulated in CRC as they have a conserved binding site in the VLDLR 3'-UTR region as well as reduce VLDLR expression in CRC.

Using computer algorithm-based prediction software, such as miRBase and TargetScan, we found that miR-200c and miR-182 had potential binding sites in the VLDLR 3'-UTR (Fig. 4A).

Recently, both miRNAs were found to be elevated in CRC patients. To test whether miR-200c and miR-182 affect VLDLR expression in CRC, we measured the relative expression levels of VLDLR mRNA in CRC cells transfected with miR-200c or miR-182 mimetics.

qRT-PCR showed that over-expression of miR-200c induced reduced expression of VLDLR in CRC cells, DLD1 and HT29, compared to negative mimic-transfected cells (Fig. 4B, C). In contrast, over-expression of miR-182 did not affect VLDLR expression (Fig. 4B, C).

Next, the colorectal cancer cell lines (DLD1 and HT29 cells) were transfected with miR-200c inhibitory RNA (Dharmacon) and cultured for 48 hours, then total RNA was extracted and qRT-PCR was performed to compare the relative amounts. All expression levels were normalized to GAPDH gene expression values using the comparative ΔΔCt method. Experimental results are shown as the average value of three replicated double-measured experiments.

As shown in FIG. 4D , as a result of treatment with miR-200c inhibitory RNA in colorectal cancer cell lines, the expression of VLDLR was increased. These results show that miR-200c regulates VLDLR expression.

In addition, to investigate whether inhibition of VLDLR expression by miR-200c is mediated through its binding site in 3'-UTR, the full-length 3'-UTR of VLDLR was cloned into a psi-CHECK-2 dual luciferase vector, A luciferase reporter assay was performed.

Consistent with mRNA expression, these assays showed that miR-200c significantly inhibited the luciferase activity of VLDLR 3'-UTR in DLD1 and HT29 cells, whereas miR-182 did not. It was re-confirmed that it did not regulate VLDLR expression ( FIGS. 4E and F ). The predicted binding region of miR-200c was located at 243-249 bp of VLDLR 3'-UTR, as shown in FIG. 4G .

To determine whether miR-200c inhibits VLDLR expression by direct binding of the predicted binding region of 3'-UTR, a reporter construct containing a deletion (nt243-249) of the miR-200c putative binding site was generated.

Reporter analysis after transfection showed that when CRC cells were transfected with a deletion mutant of the miR-200c binding site of VLDLR 3'-UTR, miR-200c did not affect luciferase activity. (Fig. 4H).

These results suggest that VLDLR expression is directly targeted by miR-200c in CRC cells.

<Example 4> Analysis of correlation between expression of VLDLR and miR-200c in CRC patients

The correlation between VLDLR and miR-200c expression in CRC cells was investigated using the cell NCI 60 database ( http://discover.nci.nih.gov/cellminer ).

Expression of VLDLR and miR-200c was found to be inversely correlated in 7 CRC cell lines. A total number of CRC cell lines are present in this database ( R =-0.658 in Figure 5A).

Next, we investigated miR-200c expression in CRC tissues using the GEO database (GSE10259 and GSE50194), so that the expression of miR-200c was non-tumorous in GSE10259 ( p = 0.0294, Fig. 5B) and GSE50194, Fig. 5C, respectively. It was significantly increased or showed an increased trend in CRC compared to .

In addition, miR-200c expression levels were measured and the relationship with VLDLR was analyzed in CRC tumors and corresponding adjacent non-tumor tissues obtained from 23 patients.

We found that miR-200c expression was frequently up-regulated in CRC tissues ( FIG. 5D ), and VLDLR expression inversely correlated with miR-200c expression in these patients ( R = -0.3583, FIG. 5E ). These results show that VLDLR expression in both CRC cell lines and tissues inversely correlates with endogenous miR-200c expression.

Taken together, we find that VLDLR expression is frequently reduced in CRC, and since over-expression of VLDLR inhibits both proliferation and migration of CRC cells, VLDLR inhibits proliferation and migration of CRC cells, thus playing an important role in the inhibition of CRC development. It appears that VLDLR acts as a tumor suppressor in CRC.

In addition, miR-200c is up-expressed in CRC, and VLDLR expression is directly inhibited by miR-200c in CRC cell lines by targeting the 3'UTR of its mRNA, thereby reducing CRC generation by regulation of tumor growth and invasion. there will be a connection

Claims (7)

delete delete Measuring the expression level of a very low density lipoprotein receptor (VLDLR) gene mRNA or protein thereof from a subject's blood, serum or plasma sample; and
A method of providing information necessary for diagnosing colorectal cancer and rectal cancer, comprising the step of diagnosing colorectal cancer and rectal cancer when the measured expression level of the mRNA or protein thereof of the VLDLR gene is down-regulated compared to the expression level in a normal control sample .
4. The method of claim 3,
measuring the expression level of miR-200c from the subject's blood, serum or plasma sample; and diagnosing colorectal cancer and rectal cancer when the measured expression level of miR-200c is up-regulated by comparing it with the expression level in a normal control sample.
A composition for preventing or treating colon cancer and rectal cancer, comprising a very low density lipoprotein receptor (VLDLR) gene, a vector including the gene, or a transformed cell line transformed with the vector.
6. The method of claim 5,
A composition for preventing or treating colon cancer and rectal cancer, further comprising a miR-200c inhibitor, wherein the miR-200c inhibitor comprises an antisense oligonucleotide capable of inhibiting miR-200c activity.
contacting a very low density lipoprotein receptor (VLDLR) gene or VLDLR protein with a candidate drug;
A screening method for a medicament for the treatment of colorectal cancer and rectal cancer, comprising determining that the candidate drug promotes the mRNA expression level of the VLDLR gene or enhances the function or activity of the VLDLR protein.

Images