KR20210148772A - Use of TCOF1 for the diagnosis or prognosis of colorectal cancer patients - Google Patents
Use of TCOF1 for the diagnosis or prognosis of colorectal cancer patients Download PDFInfo
- Publication number
- KR20210148772A KR20210148772A KR1020200066100A KR20200066100A KR20210148772A KR 20210148772 A KR20210148772 A KR 20210148772A KR 1020200066100 A KR1020200066100 A KR 1020200066100A KR 20200066100 A KR20200066100 A KR 20200066100A KR 20210148772 A KR20210148772 A KR 20210148772A
- Authority
- KR
- South Korea
- Prior art keywords
- tcof1
- catenin
- protein
- colorectal cancer
- level
- Prior art date
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57419—Specifically defined cancers of colon
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
- G01N33/6845—Methods of identifying protein-protein interactions in protein mixtures
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/04—Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Bioinformatics & Computational Biology (AREA)
- General Engineering & Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Description
본 발명은 대장암 환자의 진단 또는 예후 예측을 위한 TCOF1의 용도에 관한 것으로, 구체적으로 대장암에서 높은 수준으로 발현되는 β-카테닌(β-catenin)에 결합하는 단백질인 TCOF1을 확인함으로써, TCOF1을 이용한 대장암 진단용 바이오 마커 조성물 및 TCOF1와 β-카테닌(β-catenin)의 결합 억제제를 대장암 치료제로 제공하는 것이다.The present invention relates to the use of TCOF1 for diagnosis or prognosis of colorectal cancer patients. Specifically, by identifying TCOF1, a protein that binds to β-catenin expressed at a high level in colorectal cancer, TCOF1 To provide a biomarker composition for diagnosing colon cancer and a binding inhibitor of TCOF1 and β-catenin as a treatment for colon cancer.
대장암(Colorectal cancer, CRC)은 전세계적으로 흔한 암이다. 우리나라에서는 남자의 경우 위암, 폐암, 간암에 이어, 여자의 경우는 유방암, 위암에 이어 흔히 발생하는 암이다. 근래에 식생활이 서구화되면서 그 발생 빈도가 더욱 가파르게 증가하였다. 최근 10년 사이 대장암에 의한 사망률은 약 80%정도 증가하였고, 계속 증가하는 추세이다.Colorectal cancer (CRC) is a common cancer worldwide. In Korea, it is the most common cancer after gastric cancer, lung cancer, and liver cancer in men and breast cancer and gastric cancer in women. In recent years, as dietary habits have been westernized, the frequency of its occurrence has increased sharply. In the last 10 years, the mortality rate due to colorectal cancer has increased by about 80%, and it continues to increase.
세계보건기구 산하의 국제 암 연구기관(International Agency for Research on Cancer; IARC)에서는 전 세계 185개국 36개 암종에 대해 조사하였고, 그 결과 대장암 발병률이 전체의 10.2%이며, 암으로 사망한 사람의 9.2%가 대장암에 의한 사망자인 것으로 조사되었다. 또한, 국가암정보센터(National Cancer Information Center, Korea)에서 공개한 2017년 국내주요암 발생현황 보고서에 따르면 국내 대장암 발병률은 12.1%로 세계 평균 수준보다 높은 발병률을 나타내는 것으로 보고되었다.The International Agency for Research on Cancer (IARC) under the World Health Organization surveyed 36 carcinomas in 185 countries around the world. It was found that 9.2% of the deaths were due to colorectal cancer. In addition, according to the 2017 National Cancer Information Center (National Cancer Information Center, Korea) report on the incidence of major cancers in Korea, the incidence rate of colorectal cancer in Korea was 12.1%, which is higher than the global average.
NCCN(The National Comprehensive Cancer Network)의 가이드라인에 따르면, 대장암 환자에게 폴리닌산(folinic acid), 플루오로우라실(fluorouracil) 및 이리노테칸(irinotecan)으로 구성되는 FOLFIRI이나, 폴리닌산(folinic acid), 플루오로우라실(fluorouracil) 및 옥살리플라틴(oxaliplatin)으로 구성되는 FOLFOX이 권장되며, 류코보린(leucovorin), Erbitux, Vectibix와 같은 EGFR 표적 항암항체 치료제와 Avastin 혹은 Zaltrap과 같은 신생혈관 형성 억제제가 권장된다.According to the guidelines of The National Comprehensive Cancer Network (NCCN), FOLFIRI consisting of folinic acid, fluorouracil and irinotecan for colorectal cancer patients, folinic acid, fluorine FOLFOX, which consists of fluorouracil and oxaliplatin, is recommended, EGFR-targeted anticancer antibody therapeutics such as leucovorin, Erbitux, and Vectibix, and angiogenesis inhibitors such as Avastin or Zaltrap are recommended.
그러나, Erbitux 처방을 받은 환자에서의 치료 반응율은 20%로 매우 낮은 것으로 보고되었으며, 치료 효과를 나타낸 환자들은 3년 이내에 85% 정도가 대장암이 재발하였고, Erbitux에 대해 반응성을 나타내지 않거나, 약물 저항성이 생기는 것으로 보고되었다. 또한, Avastin을 처방을 받은 경우도 치료를 적용할 수 있는 환자가 제한적이기 때문에, 치료제 개발을 위한 대장암의 새로운 표적의 개발이 요구되고 있다.However, it has been reported that the treatment response rate in patients receiving Erbitux prescription is very low at 20%, and 85% of patients who showed treatment effect had colorectal cancer recurrence within 3 years. has been reported to occur. In addition, even when Avastin is prescribed, the number of patients to whom treatment can be applied is limited, so the development of a new target for colorectal cancer is required for the development of therapeutic agents.
한편, Wnt/β-catenin 신호 경로는 다양한 발생학적 현상들을 조절하는 경로이다. 이 경로에서 가장 중요한 β-카테닌(β-catenin)은 APC와 Axin과 같은 단백질들과 복합체를 형성하여 세포 증식 유전자를 조절하는 단백질로 알려져 있다. 암에서의 비정상적인 Wnt/β-catenin 신호 경로 작동은 β-카테닌(β-catenin)의 복합체 형성을 방해하여, 자유로운 β-카테닌(β-catenin)의 수준을 높여 세포 증식을 촉진하는 결과를 초래한다.On the other hand, the Wnt/β-catenin signaling pathway is a pathway that regulates various developmental phenomena. The most important β-catenin in this pathway is known as a protein that regulates cell proliferation genes by forming a complex with proteins such as APC and Axin. Abnormal Wnt/β-catenin signaling pathway operation in cancer disrupts β-catenin complex formation, resulting in increased levels of free β-catenin and promoting cell proliferation. .
본 발명은 대장암 환자의 진단 또는 예후 예측을 위한 TCOF1의 용도에 관한 것으로, 구체적으로 대장암 세포주에서 TCOF1이 β-카테닌(β-catenin)과 결합하는 단백질이며, TCOF1의 발현이 증가함에 따라 β-카테닌(β-catenin)의 활성이 증가하고, TCOF1 단백질은 β-카테닌(β-catenin)와 결합하여 β-카테닌(β-catenin)의 안정성을 증가시켜 β-카테닌(β-catenin)의 축적을 유도하므로, TCOF1 단백질 및 β-카테닌(β-catenin)의 결합된 TCOF1 단백질은 대장암을 진단 또는 예후예측을 위한 바이오 마커로 제공하고, TCOF1 단백질의 발현 수준 또는 TCOF1 단백질과 β-카테닌(β-catenin) 결합 수준을 측정함으로써, 대장암을 진단 또는 예후예측을 위한 정보를 제공 방법을 제공하는 것이다.The present invention relates to the use of TCOF1 for diagnosis or prognosis of colorectal cancer patients. Specifically, TCOF1 is a protein that binds to β-catenin in colorectal cancer cell lines. As the expression of TCOF1 increases, β -Catenin (β-catenin) activity increases, TCOF1 protein binds to β-catenin (β-catenin) and increases the stability of β-catenin (β-catenin) accumulation of β-catenin , the combined TCOF1 protein of TCOF1 protein and β-catenin provides a biomarker for diagnosis or prognosis of colorectal cancer, and the expression level of TCOF1 protein or TCOF1 protein and β-catenin (β -catenin) by measuring the binding level, to provide a method of providing information for diagnosing or prognosing colorectal cancer.
본 발명은 TCOF1 단백질의 발현 수준 또는 TCOF1 단백질과 β-카테닌(β-catenin) 결합 수준을 검출할 수 있는 제제를 유효성분으로 포함하는 대장암 진단용 키트를 제공한다.The present invention provides a kit for diagnosing colon cancer comprising, as an active ingredient, an agent capable of detecting the expression level of TCOF1 protein or the binding level of TCOF1 protein and β-catenin.
또한, 본 발명은 대장암으로 의심되는 대상체로부터 분리된 생물학적 시료에서 TCOF1 단백질의 발현 수준 또는 TCOF1 단백질과 β-카테닌(β-catenin) 결합 수준을 측정하는 제1단계; 및 상기 발현 수준 또는 결합 수준을 암이 존재하지 않은 정상인으로부터 분리된 생물학적 시료와 비교하는 제2단계;를 포함하는 대장암 진단 또는 예후예측을 위한 정보 제공 방법을 제공한다.In addition, the present invention provides a first step of measuring the expression level of TCOF1 protein or the binding level of TCOF1 protein and β-catenin in a biological sample isolated from a subject suspected of colon cancer; and a second step of comparing the expression level or binding level with a biological sample isolated from a normal person in which cancer does not exist; provides an information providing method for diagnosing or predicting a prognosis of colorectal cancer, including.
또한, 본 발명은 TCOF1 단백질 발현 억제제, TCOF1 단백질 분해제, 또는 TCOF1 단백질과 β-카테닌(β-catenin) 결합 억제제를 유효성분으로 포함하는 대장암 예방 또는 치료용 약학적 조성물을 제공한다.In addition, the present invention provides a TCOF1 protein expression inhibitor, a TCOF1 proteolytic agent, or a pharmaceutical composition for preventing or treating colon cancer comprising a TCOF1 protein and β-catenin binding inhibitor as an active ingredient.
또한, 본 발명은 대장암으로 의심되는 대상체로부터 분리된 생물학적 시료에서 TCOF1 단백질의 발현 수준 또는 β-카테닌(β-catenin) 수준을 측정하는 제1단계; 및 상기 생물학적 시료에 시험물질을 처리하고 TCOF1 단백질의 발현 수준 또는 β-카테닌(β-catenin) 수준이 시험물질을 처리하지 않은 시료에 비해 감소하면 대장암의 예방 또는 치료용 제제로 판단하는 제2단계;를 포함하는 대장암의 예방 또는 치료용 제제의 스크리닝 방법을 제공한다.In addition, the present invention provides a first step of measuring the expression level of TCOF1 protein or the level of β-catenin in a biological sample isolated from a subject suspected of colon cancer; And if the biological sample is treated with the test substance and the expression level of TCOF1 protein or the β-catenin level is decreased compared to the sample not treated with the test substance, a second determining agent for the prevention or treatment of colorectal cancer It provides a screening method of an agent for the prevention or treatment of colorectal cancer comprising;
또한, TCOF1 단백질 또는 β-카테닌(β-catenin)에 결합된 TCOF1 단백질을 포함하는 대장암에서 텐키라제(Tankyrase; poly (ADP-ribose) polymerase superfamily; PARP-5) 억제제 반응성 판단을 위한 바이오 마커 조성물을 제공한다.In addition, in colorectal cancer containing TCOF1 protein or TCOF1 protein bound to β-catenin, a biomarker for judging the reactivity of a tankyrase (poly (ADP-ribose) polymerase superfamily; PARP-5) inhibitor A composition is provided.
본 발명에 따르면, 대장암 세포주에서 TCOF1이 β-카테닌(β-catenin)과 결합하는 단백질이며, TCOF1의 발현이 증가함에 따라 β-카테닌(β-catenin)의 활성이 증가하고, TCOF1 단백질은 β-카테닌(β-catenin)와 결합하여 β-카테닌(β-catenin)의 안정성을 증가시켜 β-카테닌(β-catenin)의 축적을 유도하므로, TCOF1 단백질 및 β-카테닌(β-catenin)의 결합된 TCOF1 단백질은 대장암을 진단 또는 예후예측을 위한 바이오 마커로 제공하고, TCOF1 단백질의 발현 수준 또는 TCOF1 단백질과 β-카테닌(β-catenin) 결합 수준을 측정함으로써, 대장암을 진단 또는 예후예측을 위한 정보를 제공 방법을 제공할 수 있다.According to the present invention, in colorectal cancer cell lines, TCOF1 is a protein that binds to β-catenin, and as the expression of TCOF1 increases, the activity of β-catenin increases, and TCOF1 protein is β-catenin. - Since it binds to β-catenin and increases the stability of β-catenin to induce the accumulation of β-catenin, the binding of TCOF1 protein and β-catenin The TCOF1 protein provides a biomarker for diagnosis or prognosis of colorectal cancer, and can diagnose or predict colorectal cancer by measuring the expression level of TCOF1 protein or the binding level of TCOF1 protein and β-catenin. You can provide a method for providing information for
도 1은 대장암 세포주에서 β-카테닌(β-catenin)에 결합하는 단백질을 동정한 결과를 나타낸다. A는 면역침강법 및 질량 분석을 통해 β-카테닌(β-catenin)에 결합하는 단백질을 동정한 결과이고, B는 면역침강법을 통해 TCOF1과 β-카테닌(β-catenin)의 상호 결합을 확인한 결과이고, C는 세포분획기법을 통해 TCOF1 발현 위치를 확인한 결과이고, 세포분획기법 및 면역침강법을 통해 TCOF1과 β-카테닌(β-catenin)의 결합 위치를 확인한 결과이다.
도 2는 대장암 세포주에서 TCOF1 발현 프로파일을 분석한 결과이다. A는 Oncomine 데이터 베이스를 통한 대장암에서 TCOF1 RNA 발현 프로파일을 나타내는 그래프이고, B는 UALCAN 데이터 베이스를 통한 TCOF1 단백질 발현 프로파일을 나타내는 그래프이고, C는 대장암 세포주에서 TCOF1 단백질 발현을 분석한 결과이다.
도 3은 대장암 세포주에서 TCOF1의 발현 정도에 따른 세포 증식 변화를 평가한 결과이다. A 및 B는 TCOF1이 과발현된 세포주의 결과이고, C 및 D는 TCOF1의 발현이 억제된 세포주의 결과이다.
도 4는 TCOF1의 발현 정도에 따른 β-카테닌(β-catenin) 발현 변화를 평가한 결과이다. A는 TCOF1에 의한 β-catenin 및 하위 유전자 조절을 확인한 그래프이고, B는 TCOF1에 의한 β-catenin 활성 조절을 확인한 그래프이고, C는 TCOF1의 발현 정도에 따른 β-catenin 및 하위 단백질 조절을 확인한 그래프이다.
도 5는 TCOF1의 발현 정도에 따른 β-카테닌(β-catenin) 안전성 변화를 확인한 결과이다. A는 단백질 합성 저해제 Cycloheximide 처리에 따른 β-catenin의 반감기를 확인한 결과이고, B는 프로테아좀 저해제 MG132 처리에 따른 β-catenin의 변화를 확인한 결과이다.
도 6 및 7은 TCOF1의 발현 정도에 따른 텐키라제(Tankyrase; poly (ADP-ribose) polymerase superfamily; PARP-5) 억제제에 의한 β-카테닌(β-catenin)의 분해 변화를 확인한 결과이다.1 shows the results of identifying a protein that binds to β-catenin in colorectal cancer cell lines. A is the result of identification of a protein binding to β-catenin through immunoprecipitation and mass spectrometry, and B is the result of confirming the mutual binding of TCOF1 and β-catenin through immunoprecipitation. Result, C is the result of confirming the expression location of TCOF1 through cell fractionation method, and the result of confirming the binding location of TCOF1 and β-catenin through cell fractionation method and immunoprecipitation method.
2 is a result of analyzing the TCOF1 expression profile in colorectal cancer cell lines. A is a graph showing the TCOF1 RNA expression profile in colorectal cancer through the Oncomine database, B is a graph showing the TCOF1 protein expression profile through the UALCAN database, and C is the result of analyzing TCOF1 protein expression in colorectal cancer cell lines.
3 is a result of evaluating changes in cell proliferation according to the expression level of TCOF1 in colorectal cancer cell lines. A and B are results of a cell line overexpressing TCOF1, and C and D are results of a cell line in which expression of TCOF1 is suppressed.
4 is a result of evaluating β-catenin expression change according to the expression level of TCOF1. A is a graph confirming the regulation of β-catenin and sub-genes by TCOF1, B is a graph confirming the regulation of β-catenin activity by TCOF1, and C is a graph confirming the regulation of β-catenin and sub-proteins according to the expression level of TCOF1 to be.
5 is a result confirming the safety change of β-catenin (β-catenin) according to the expression level of TCOF1. A is the result of confirming the half-life of β-catenin according to the treatment with the protein synthesis inhibitor Cycloheximide, and B is the result of confirming the change of β-catenin according to the treatment of the proteasome inhibitor MG132.
6 and 7 are results confirming the degradation change of β-catenin (β-catenin) by the tenkyrase (Tankyrase; poly (ADP-ribose) polymerase superfamily; PARP-5) inhibitor according to the expression level of TCOF1.
본 명세서에서 사용되는 용어는 본 발명에서의 기능을 고려하면서 가능한 현재 널리 사용되는 일반적인 용어들을 선택하였으나, 이는 당 분야에 종사하는 기술자의 의도 또는 판례, 새로운 기술의 출현 등에 따라 달라질 수 있다. 또한, 특정한 경우는 출원인이 임의로 선정한 용어도 있으며, 이 경우 해당되는 발명의 설명 부분에서 상세히 그 의미를 기재할 것이다. 따라서 본 발명에서 사용되는 용어는 단순한 용어의 명칭이 아닌, 그 용어가 가지는 의미와 본 발명의 전반에 걸친 내용을 토대로 정의되어야 한다.The terms used in this specification have been selected as currently widely used general terms as possible while considering the functions in the present invention, but these may vary depending on the intention or precedent of a person skilled in the art, the emergence of new technology, and the like. In addition, in a specific case, there is a term arbitrarily selected by the applicant, and in this case, the meaning will be described in detail in the description of the corresponding invention. Therefore, the term used in the present invention should be defined based on the meaning of the term and the overall content of the present invention, rather than the name of a simple term.
다르게 정의되지 않는 한, 기술적이거나 과학적인 용어를 포함해서 여기서 사용되는 모든 용어들은 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에 의해 일반적으로 이해되는 것과 동일한 의미를 가지고 있다. 일반적으로 사용되는 사전에 정의되어 있는 것과 같은 용어들은 관련 기술의 문맥상 가지는 의미와 일치하는 의미를 가지는 것으로 해석되어야 하며, 본 출원에서 명백하게 정의하지 않는 한, 이상적이거나 과도하게 형식적인 의미로 해석되지 않는다.Unless defined otherwise, all terms used herein, including technical and scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Terms such as those defined in a commonly used dictionary should be interpreted as having a meaning consistent with the meaning in the context of the related art, and should not be interpreted in an ideal or excessively formal meaning unless explicitly defined in the present application. does not
수치 범위는 상기 범위에 정의된 수치를 포함한다. 본 명세서에 걸쳐 주어진 모든 최대의 수치 제한은 낮은 수치 제한이 명확히 쓰여 있는 것처럼 모든 더 낮은 수치 제한을 포함한다. 본 명세서에 걸쳐 주어진 모든 최소의 수치 제한은 더 높은 수치 제한이 명확히 쓰여 있는 것처럼 모든 더 높은 수치 제한을 포함한다. 본 명세서에 걸쳐 주어진 모든 수치 제한은 더 좁은 수치 제한이 명확히 쓰여 있는 것처럼, 더 넓은 수치 범위 내의 더 좋은 모든 수치 범위를 포함할 것이다.Numerical ranges are inclusive of the values defined in that range. Every maximum numerical limitation given throughout this specification includes all lower numerical limitations as if the lower numerical limitation were expressly written. Every minimum numerical limitation given throughout this specification includes all higher numerical limitations as if the higher numerical limitation were expressly written. All numerical limitations given throughout this specification will include all numerical ranges that are better within the broader numerical limits, as if the narrower numerical limitations were expressly written.
이하, 본 발명을 보다 상세하게 설명한다.Hereinafter, the present invention will be described in more detail.
본 발명자들은 이와 같은 점을 감안하여 대장암을 진단하고 치료제 개발을 위한 새로운 표적 물질로 β-카테닌(β-catenin)의 수준을 조절하는 단백질을 조사하였으며, TCOF1 단백질이 β-카테닌(β-catenin)에 결합하고 β-카테닌(β-catenin)의 수준에 영향을 미치는 것을 확인함으로써, 본 발명을 완성하였다.In consideration of this point, the present inventors investigated a protein regulating the level of β-catenin as a new target material for diagnosing colorectal cancer and developing a therapeutic agent, and the TCOF1 protein is β-catenin (β-catenin). ) and binding to β-catenin (β-catenin) by confirming that it affects the level, completed the present invention.
본 발명은 TCOF1 단백질을 유효성분으로 포함하는 대장암 진단 또는 예후예측용 바이오 마커를 제공한다.The present invention provides a biomarker for diagnosing or predicting colorectal cancer comprising TCOF1 protein as an active ingredient.
상기 TCOF1 단백질은 TCOF1 유전자에 암호화되며, TCOF1 유전자의 돌연변이는 트리처 콜린스 증후군(Treacher Collins syndrome, TCS)의 원인이라고 알려졌다.The TCOF1 protein is encoded in the TCOF1 gene, and mutations in the TCOF1 gene are known to cause Treacher Collins syndrome (TCS).
상기 TCOF1 단백질은 β-카테닌(β-catenin)에 결합된 상태일 수 있다.The TCOF1 protein may be in a state bound to β-catenin.
또한, 본 발명은 TCOF1 단백질의 발현 수준 또는 TCOF1 단백질과 β-카테닌(β-catenin) 결합 수준을 검출할 수 있는 제제를 유효성분으로 포함하는 대장암 진단용 키트를 제공한다.In addition, the present invention provides a kit for diagnosing colon cancer comprising, as an active ingredient, an agent capable of detecting the expression level of TCOF1 protein or the binding level of TCOF1 protein and β-catenin.
상기 제제는 TCOF1 단백질에 특이적으로 결합하는 항체, 펩타이드, 앱타머 또는 화합물일 수 있다.The agent may be an antibody, peptide, aptamer or compound that specifically binds to the TCOF1 protein.
상기 ‘단백질의 발현 수준’은 상기 단백질에 특이적으로 결합하는 항체, 펩타이드 또는 뉴클레오티드를 이용하여 측정할 수 있다.The 'expression level of the protein' can be measured using an antibody, peptide or nucleotide that specifically binds to the protein.
상기 항체는 다클론 항체, 단클론 항체, 재조합 항체 및 2개의 전체 길이의 경쇄 및 2개의 전체 길이의 중쇄를 가지는 완전한 형태뿐만 아니라 및 항체 분자의 기능적인 단편, 예를 들어, Fab, F(ab'), F(ab')2및 Fv를 모두 포함한다. 항체 생산은 본 발명이 속하는 분야에 널리 공지된 기술을 이용하여 용이하게 제조할 수 있고, 제조되어 상업적으로 판매되는 항체를 이용할 수 있다.The antibodies are polyclonal antibodies, monoclonal antibodies, recombinant antibodies and complete forms having two full-length light chains and two full-length heavy chains, as well as functional fragments of antibody molecules, e.g., Fab, F(ab'). ), F(ab')2 and Fv. Antibody production can be easily prepared using techniques well known in the art to which the present invention pertains, and commercially available antibodies can be used.
또한, 단백질의 수준은 면역분석법 또는 면역염색법에 의해 측정될 수 있다. 상기 방법은 시료에서 상기 바이오마커 단백질 또는 이의 단편을 검출할 수 있는 마이크로칩 또는 자동화된 마이크로어레이 시스템의 형태로 실시될 수 있다.In addition, the level of the protein can be measured by an immunoassay or immunostaining method. The method may be implemented in the form of a microchip or an automated microarray system capable of detecting the biomarker protein or a fragment thereof in a sample.
상기 면역분석법 또는 면역염색법은 방사능면역분석, 방사능면역침전, 면역침전, ELISA, 캡처-ELISA, 억제 또는 경쟁 분석, 샌드위치 분석, 유세포 분석, 면역형광염색 및 면역친화성 정제를 포함할 수 있다.The immunoassay or immunostaining method may include radioimmunoassay, radioimmunoprecipitation, immunoprecipitation, ELISA, capture-ELISA, inhibition or competition assay, sandwich assay, flow cytometry, immunofluorescence staining and immunoaffinity purification.
상기 단백질 수준은 다중 반응 모니터링(multiple reaction monitoring: MRM), 병행 반응 모니터링(parallel reaction monitoring: PRM), sequential windowed data independent acquisition of the total high-resolution(SWATH), 선택 반응 모니터링(selected reaction monitoring: SRM) 또는 면역 다중 반응 모니터링(immuno multiple reaction monitoring: iMRM)을 이용하여 측정될 수도 있다. MRM은 물질의 정확한 단편을 결정하여 이를 질량분석기에서 깬 후, 한 번 깨진 이온 중 특정 이온을 한 번 더 선택하여 연속적으로 연결된 검출기를 이용하여 그 수를 얻는 방법이다.The protein level was measured using multiple reaction monitoring (MRM), parallel reaction monitoring (PRM), sequential windowed data independent acquisition of the total high-resolution (SWATH), selected reaction monitoring (SRM) ) or using immune multiple reaction monitoring (iMRM). MRM is a method to determine the exact fragment of a substance, break it in a mass spectrometer, select a specific ion from among the broken ions once more, and obtain the number using a continuously connected detector.
또한, 본 발명은 대장암으로 의심되는 대상체로부터 분리된 생물학적 시료에서 TCOF1 단백질의 발현 수준 또는 TCOF1 단백질과 β-카테닌(β-catenin) 결합 수준을 측정하는 제1단계; 및 상기 발현 수준 또는 결합 수준을 암이 존재하지 않은 정상인으로부터 분리된 생물학적 시료와 비교하는 제2단계;를 포함하는 대장암 진단 또는 예후예측을 위한 정보 제공 방법을 제공한다.In addition, the present invention provides a first step of measuring the expression level of TCOF1 protein or the binding level of TCOF1 protein and β-catenin in a biological sample isolated from a subject suspected of colon cancer; and a second step of comparing the expression level or binding level with a biological sample isolated from a normal person in which cancer does not exist; provides an information providing method for diagnosing or predicting a prognosis of colorectal cancer, including.
또한, 본 발명은 TCOF1 단백질 발현 억제제, TCOF1 단백질 분해제, 또는 TCOF1 단백질과 β-카테닌(β-catenin) 결합 억제제를 유효성분으로 포함하는 대장암 예방 또는 치료용 약학적 조성물을 제공한다.In addition, the present invention provides a TCOF1 protein expression inhibitor, a TCOF1 proteolytic agent, or a pharmaceutical composition for preventing or treating colon cancer comprising a TCOF1 protein and β-catenin binding inhibitor as an active ingredient.
상기 TCOF1 단백질 발현 억제제는 TCOF1 단백질을 암호화하는 유전자의 mRNA에 특이적으로 결합하는 안티센스 올리고뉴클레오티드, 앱타머(aptamer), shRNA 또는 siRNA일 수 있고, 상기 TCOF1 단백질 분해제는 TCOF1 단백질에 특이적으로 결합하는 항체, 펩타이드, 앱타머 또는 화합물일 수 있고, 상기 TCOF1 단백질과 β-카테닌(β-catenin) 결합 억제제는 TCOF1 단백질 또는 β-카테닌(β-catenin)에 특이적으로 결합하는 항체, 펩타이드, 앱타머 또는 화합물일 수 있다.The TCOF1 protein expression inhibitor may be an antisense oligonucleotide, aptamer, shRNA or siRNA that specifically binds to the mRNA of a gene encoding TCOF1 protein, and the TCOF1 proteolytic agent specifically binds to TCOF1 protein It may be an antibody, peptide, aptamer or compound that specifically binds to TCOF1 protein or β-catenin, wherein the TCOF1 protein and β-catenin binding inhibitor are TCOF1 protein or β-catenin (β-catenin). It may be a tamer or a compound.
또한, 상기 약학적 조성물은 텐키라제(Tankyrase; poly (ADP-ribose) polymerase superfamily; PARP-5) 억제제의 β-카테닌(β-catenin) 분해능을 증가시켜 항암 효과가 향상될 수 있다.In addition, the pharmaceutical composition may improve the anticancer effect by increasing the β-catenin decomposition ability of the tenkyrase (Tankyrase; poly (ADP-ribose) polymerase superfamily; PARP-5) inhibitor.
상기 약학적 조성물은 크림, 젤, 패치, 분무제, 연고제, 경고제, 로션제, 리니멘트제, 파스타제 및 카타플라스마제로 이루어진 군으로부터 선택되는 하나 이상의 외용제 형태로 제형화될 수 있다.The pharmaceutical composition may be formulated in the form of one or more external preparations selected from the group consisting of creams, gels, patches, sprays, ointments, warning agents, lotions, liniments, pastas, and cataplasmas.
본 발명의 약학적 조성물은 제형화를 위해 추가로 있는 약학적으로 허용가능한 담체 및 희석제를 포함할 수 있다. 상기 약학적으로 허용가능한 담체 및 희석제는 전분, 당, 및 만니톨과 같은 부형제, 칼슘 포스페이트 등과 같은 충전제 및 증량제, 카르복시메틸셀룰로오스, 히드록시프로필셀룰로오스 등과 같은 셀룰로오스 유도체, 젤라틴, 알긴산염, 및 폴리비닐 피롤리돈 등과 같은 결합제, 활석, 스테아린산 칼슘, 수소화 피마자유 및 폴리에틸렌 글리콜과 같은 윤활제, 포비돈, 크로스포비돈과 같은 붕해제, 폴리소르베이트, 세틸알코올, 및 글리세롤 등과 같은 계면활성제를 포함하나, 이에 한정되지 않는다. 상기 약학적으로 허용가능한 담체 및 희석제는 대상체에게 생물학적 및 생리학적으로 친화적인 것일 수 있다. 희석제의 예로는 염수, 수용성 완충액, 용매 및/또는 분산제(dispersion media)를 들 수 있으나, 이에 제한되는 것은 아니다.The pharmaceutical composition of the present invention may further include a pharmaceutically acceptable carrier and diluent for formulation. The pharmaceutically acceptable carriers and diluents include starch, sugar, and excipients such as mannitol, fillers and extenders such as calcium phosphate, cellulose derivatives such as carboxymethylcellulose, hydroxypropylcellulose, gelatin, alginate, and polyvinyl blood. binders such as rolidone, lubricants such as talc, calcium stearate, hydrogenated castor oil and polyethylene glycol, disintegrants such as povidone, crospovidone, and surfactants such as polysorbates, cetyl alcohol, and glycerol does not The pharmaceutically acceptable carrier and diluent may be biologically and physiologically compatible with the subject. Examples of diluents include, but are not limited to, saline, aqueous buffers, solvents, and/or dispersion media.
본 발명의 약학적 조성물은 목적하는 방법에 따라 경구 투여하거나 비경구 투여(예를 들어, 정맥 내, 피하, 복강 내 또는 국소에 적용)할 수 있으며, 바람직하게는 경구 투여된다. 또한 본 발명의 약학적 조성물의 투여량은 대상체의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설율 및 질환의 중증도 등에 따라 그 범위가 다양하나, 이에 제한되는 것은 아니다.The pharmaceutical composition of the present invention may be administered orally or parenterally (eg, intravenously, subcutaneously, intraperitoneally or topically) according to a desired method, and is preferably administered orally. In addition, the dosage of the pharmaceutical composition of the present invention varies depending on the subject's body weight, age, sex, health status, diet, administration time, administration method, excretion rate and severity of disease, but is not limited thereto.
또한, 본 발명은 대상체의 대장암 조직에서 분리된 생물학적 시료에서 TCOF1 단백질의 발현 수준 또는 β-카테닌(β-catenin) 수준을 측정하는 제1단계; 및 상기 생물학적 시료에 시험물질을 처리하고 TCOF1 단백질의 발현 수준 또는 β-카테닌(β-catenin) 수준이 시험물질을 처리하지 않은 시료에 비해 감소하면 대장암의 예방 또는 치료용 제제로 판단하는 제2단계;를 포함하는 대장암의 예방 또는 치료용 제제의 스크리닝 방법을 제공한다.In addition, the present invention provides a first step of measuring the expression level of TCOF1 protein or the level of β-catenin in a biological sample isolated from a colorectal cancer tissue of a subject; And if the biological sample is treated with the test substance and the expression level of TCOF1 protein or the β-catenin level is decreased compared to the sample not treated with the test substance, a second determining agent for the prevention or treatment of colorectal cancer It provides a screening method of an agent for the prevention or treatment of colorectal cancer comprising;
상기 대장암의 예방 또는 치료용 제제의 스크리닝 방법은 제2단계 이후에 상기 생물학적 시료에 텐키라제(Tankyrase; poly (ADP-ribose) polymerase superfamily; PARP-5) 억제제를 처리하여 β-카테닌(β-catenin)의 수준이 시험물질을 처리하지 않은 시료에 비해 감소하면 대장암의 예방 또는 치료용 제제로 판단하는 제3단계를 추가적으로 더 포함할 수 있다.The screening method of the agent for the prevention or treatment of colorectal cancer is after the second step by treating the biological sample with a tenkyrase (Tankyrase; poly (ADP-ribose) polymerase superfamily; PARP-5) inhibitor to β-catenin (β When the level of -catenin) is reduced compared to the sample not treated with the test substance, the third step of determining the agent for the prevention or treatment of colorectal cancer may be additionally included.
또한, 본 발명은 TCOF1 단백질 또는 β-카테닌(β-catenin)에 결합된 TCOF1 단백질을 포함하는 대장암에서 텐키라제(Tankyrase; poly (ADP-ribose) polymerase superfamily; PARP-5) 억제제 반응성 판단을 위한 바이오 마커 조성물을 제공한다.In addition, the present invention is TCOF1 protein or β- catenin (β-catenin) tenkyrase (Tankyrase; poly (ADP-ribose) polymerase superfamily; PARP-5) inhibitor reactivity determination in colorectal cancer containing TCOF1 protein bound to It provides a biomarker composition for
본 발명에서 용어 “예방”이란 본 발명에 따른 조성물의 투여로 질환의 억제 또는 지연시키는 모든 행위를 말한다. 본 발명에서 용어 “치료”는 본 발명에 따른 조성물의 투여로 질환의 증세가 호전되거나 이롭게 변경하는 모든 행위를 말한다.In the present invention, the term “prevention” refers to any act of inhibiting or delaying a disease by administering the composition according to the present invention. In the present invention, the term “treatment” refers to any action that improves or beneficially changes the symptoms of a disease by administration of the composition according to the present invention.
이하, 본 발명의 이해를 돕기 위하여 실험예 및 실시예를 들어 상세하게 설명하기로 한다. 다만 하기의 실험예 및 실시예는 본 발명의 내용을 예시하는 것일 뿐 본 발명의 범위가 하기 실험예 및 실시예에 한정되는 것은 아니다. 본 발명의 실험예 및 실시예는 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이다.Hereinafter, experimental examples and examples will be described in detail to help the understanding of the present invention. However, the following experimental examples and examples are only to illustrate the content of the present invention, the scope of the present invention is not limited to the following experimental examples and examples. Experimental examples and examples of the present invention are provided to more completely explain the present invention to those of ordinary skill in the art.
<실험예> 실험 재료 및 방법<Experimental example> Experimental material and method
하기의 실험예들은 본 발명에 따른 각각의 실시예에 공통적으로 적용되는 실험예를 제공하기 위한 것이다.The following experimental examples are intended to provide experimental examples commonly applied to each embodiment according to the present invention.
1. 세포 배양1. Cell Culture
한국세포주은행(Korean Cell Line Bank)에서 대장암 세포주인 HCT116, RKO, DLD1, HCT15, SW480E, CaCO2, SW620, SW480, Colo320DM, HT29를 분양 받았다. 분양 받은 세포는 RPMI-1640 배지 (WELGENE, LM 001-01)에서 37℃, 5% CO2 조건에서 배양되었다.Colorectal cancer cell lines HCT116, RKO, DLD1, HCT15, SW480E, CaCO2, SW620, SW480, Colo320DM, and HT29 were received from the Korean Cell Line Bank. The received cells were cultured in RPMI-1640 medium (WELGENE, LM 001-01) at 37° C., 5% CO 2 conditions.
2. 세포 분획2. Cell Fractionation
배양된 세포들을 세포 분획 키트인 The subcellular protein fractionation kit (Thermo Fierce, cat. No. 78840)을 이용하여 파쇄하고, 세포막, 세포질 및 핵으로 분획하였다. 세포질 분획은 EDTA(Ethylenediaminetetraacetic acid)를 처리하고, CEB(Cytoplasmic Extraction Buffer) 용액과 상온에서 10분간 반응시켰다. 500 xg에서 원심분리하고, 깨끗한 상층액을 수득하였다. 세포막 핵 분획은 NEB(Nuclear Extraction Buffer) 용액과 상온에서 30분간 반응시키고, 300 xg로 원심분리하고, 깨끗한 상층액을 수득하였다.The cultured cells were disrupted using The subcellular protein fractionation kit (Thermo Fierce, cat. No. 78840), which is a cell fractionation kit, and fractionated into cell membrane, cytoplasm and nucleus. The cytoplasmic fraction was treated with Ethylenediaminetetraacetic acid (EDTA) and reacted with a Cytoplasmic Extraction Buffer (CEB) solution at room temperature for 10 minutes. Centrifugation was performed at 500×g and a clear supernatant was obtained. The cell membrane nuclear fraction was reacted with a Nuclear Extraction Buffer (NEB) solution at room temperature for 30 minutes, centrifuged at 300 x g, and a clean supernatant was obtained.
3. 웨스턴 블롯3. Western Blot
배양된 세포에 RIPA(Radioimmunoprecipitation assay) 용액(T&I, BRI-9001)으로 30분간 처리하여 파쇄하고, 13,000 rpm에서 10분간 원심분리하였다. 세포에서 분리한 단백질들은 8~10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDSPAGE)에 로딩하고, Immobilon-P membrane (EMD, IPVH00010)에 트랜스퍼 하였다. Membrane은 5% skim milk, 1차 항체 혼합물과 함께 4℃에서 12~18시간동안 반응시켰다. 1차 항체는 TCOF1 (11003-1-AP, proteintech), α-tubulin (sc-5286, santacruz), PARP(9542S, cell signaling), MYC tag(2276S, cell signaling), FLAG-tang(sc166355, santacruz,), β-catenin(sc59737, santacruz), P-β-catenin(9561, cell signaling), cyclinD1(sc8396, Santacruz)를 사용하고, 2차 항체는 2차 마우스 항체 (7076, cell signaling), 2차 래빗 항체 (7074, cell signaling)을 사용하여 상온에서 1시간 동안 반응시켰다. 이후, Membrane과 chemiluminescence(Amersham, RPN 2106)을 상온에서 1분 동안 반응하여 단백질을 검출하였다.The cultured cells were disrupted by treatment with RIPA (Radioimmunoprecipitation assay) solution (T&I, BRI-9001) for 30 minutes, and centrifuged at 13,000 rpm for 10 minutes. Proteins isolated from cells were loaded on 8-10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDSPAGE) and transferred to Immobilon-P membrane (EMD, IPVH00010). Membrane was reacted with 5% skim milk and primary antibody mixture at 4°C for 12 to 18 hours. Primary antibodies are TCOF1 (11003-1-AP, proteintech), α-tubulin (sc-5286, santacruz), PARP (9542S, cell signaling), MYC tag (2276S, cell signaling), FLAG-tang (sc166355, santacruz) ,), β-catenin (sc59737, santacruz), P-β-catenin (9561, cell signaling), and cyclinD1 (sc8396, Santacruz) are used, and the secondary antibody is a secondary mouse antibody (7076, cell signaling), 2 A primary rabbit antibody (7074, cell signaling) was used to react at room temperature for 1 hour. Thereafter, protein was detected by reacting membrane and chemiluminescence (Amersham, RPN 2106) at room temperature for 1 minute.
4. 플라스미드 형질 주입4. Plasmid Transfection
각 배양된 세포에 JetPRIME reagent (polyplus, 114-07)을 이용하여 플라스미드를 주입하였다. 100π 플레이트 기준으로 한 실험군당 500ul의 JetPRIME 용액을 준비하고, 플라스미드와 JetPRIME 시약을 혼합하여 10분 동안 상온에서 반응시킨 후, 형질을 주입하고자 하는 실험군 세포에 한 방울씩 처리하였다.A plasmid was injected into each cultured cell using JetPRIME reagent (polyplus, 114-07). 500ul of JetPRIME solution was prepared per test group based on 100π plate, and the plasmid and JetPRIME reagent were mixed and reacted at room temperature for 10 minutes, and then the cells of the test group to be transfected were treated dropwise.
TCOF1의 발현을 억제하기 위해 간섭 RNA(shTCOF1)는 염기 서열 5’- GCAAGACUGGGAAUUCCAUUCUCAUGGAAUUCCCAGUCUUGCUU -3’(서열번호 1)을 갖는 것을 사용하였다.In order to suppress the expression of TCOF1, the interfering RNA (shTCOF1) having the nucleotide sequence 5'-GCAAGACUGGGAAUUCCAUUCUCAUGGAAAUUCCCAGUCUUGCUU -3' (SEQ ID NO: 1) was used.
5. 세포 계수5. Cell Count
세포를 6 well plate (SPL, 30006)에 well당 3 X 105개로 배양하였다. 배양 후 24 시간, 48 시간, 72 시간에 세포를 trypsin-EDTA (gibco, 15400054) 로 분리하고, 800 rpm에서 3분 동안 원심분리하였다. Tryphan blue(gibco, 15250-061)와 세포를 1 : 1 부피 비율로 혼합하고, hematocytometer를 이용하여 살아있는 세포를 현미경으로 계수하였다.Cells were cultured in a 6 well plate (SPL, 30006) at 3
6. TOP/FOP flash6. TOP/FOP flash
세포를 6 well plate (SPL, 30006)에 well당 1X104개로 배양하였다. 각 well에 β-galactosidase 200ng, TOP plasmid 200ng, FOP plasmid 200ng, pCMV6 vector 300ng, pCMV6-TCOF1 vector 300ng을 처리하여 형질 전환하였다. 48시간 후, lysis buffer를 처리하고, 세포를 13,000 rpm에서 원심분리하여 세포를 침전시킨 후에 상층액을 수득하였다. 상층액을 96well(SPL, 30096)에 넣고 발광 기질 50μl을 첨가하여 480nm 및 420nm의 OD값에서 발광세기를 측정하였다.Cells were cultured in a 6-well plate (SPL, 30006) at 1X10 4 cells per well. Each well was transformed by treating 200ng of β-galactosidase, 200ng of TOP plasmid, 200ng of FOP plasmid, 300ng of pCMV6 vector, and 300ng of pCMV6-TCOF1 vector. After 48 hours, the lysis buffer was treated, and the cells were precipitated by centrifugation at 13,000 rpm to obtain a supernatant. The supernatant was placed in 96 well (SPL, 30096), 50 μl of a luminescent substrate was added, and the luminescence intensity was measured at OD values of 480 nm and 420 nm.
7. 역전사 중합효소 연쇄 반응(RT-PCR)7. Reverse Transcription Polymerase Chain Reaction (RT-PCR)
RT-PCR은 AccuPower RT-PCR premix & master mix (BIONEER, 20-k-2055)를 이용하였다. RNA를 70℃에서 5분간 반응시키고, AccuPower RT-PCR premix & master mix에 Oligo dT 10pmole 1ul, RNA 1ul, DEPC water 18ul(46-2224, Invitrogen)(총 부피: 20ul)을 넣고 42℃ 1시간 94℃ 5분을 통해 상보적 DNA를 합성하였다.For RT-PCR, AccuPower RT-PCR premix & master mix (BIONEER, 20-k-2055) was used. RNA was reacted at 70℃ for 5 minutes, Oligo dT 10pmole 1ul, RNA 1ul, DEPC water 18ul (46-2224, Invitrogen) (total volume: 20ul) was added to AccuPower RT-PCR premix & master mix, 42
8. 실시간 중합효소 연쇄 반응8. Real-time polymerase chain reaction
MicroAmp Fast96well Reaction Plate(0.1ml)(applied biosystem, 4346907)에 POWER SYBR Green PCR master mix(applied biosystem, 1906591) 10ul와 Forward primer 10pmole 1ul, Reverse primer 10pmole 1ul, DNA template 2ul, sterile water 7.8ul를 넣고 조건에 따라 진행하였다. 프라이머 세트는 하기 표 1과 같다.Put 10ul of POWER SYBR Green PCR master mix (applied biosystem, 1906591), 10pmole 1ul of Forward primer, 10pmole 1ul of Reverse primer, 2ul of DNA template, and 7.8ul of sterile water in MicroAmp Fast96well Reaction Plate (0.1ml) (applied biosystem, 4346907) proceeded according to Primer sets are shown in Table 1 below.
9. 약물 처리9. Drug Treatment
대장암 세포주를 5X105 개로 배양하고, 24시간 후 텐키라제(Tankyrase; poly (ADP-ribose) polymerase superfamily; PARP-5) 억제제인 NVP-TNKS656 (HY-13990)을 10μM씩 처리하였다.Colorectal cancer cell lines were cultured in 5X10 5 cells, and 10 μM of NVP-TNKS656 (HY-13990), which is a Tenkyrase (Tankyrase; poly (ADP-ribose) polymerase superfamily; PARP-5) inhibitor, was treated after 24 hours.
10. 통계 처리10. Statistical Processing
모든 실험은 3번 반복하였으며, two-tailed student’s t-검정을 통해 분석되었다. 0.05 P값은 유의미한 차이를 나타낸다.All experiments were repeated 3 times and analyzed by two-tailed student's t-test. A P value of 0.05 indicates a significant difference.
실시예 1. β-카테닌(β-catenin) 결합 단백질 동정Example 1. Identification of β-catenin binding protein
대장암 세포 내에서 β-카테닌(β-catenin)에 결합하는 단백질을 동정하기 위해, 대장암 세포주인 DLD1 세포를 이용하여 β-카테닌(β-catenin)에 결합하는 단백질을 조사하였다.To identify a protein binding to β-catenin in colorectal cancer cells, a protein binding to β-catenin was investigated using DLD1 cells, a colorectal cancer cell line.
도 1A에 나타난 바와 같이, 대장암 세포주를 면역침강법 및 질량 분석을 통해 β-카테닌(β-catenin)에 결합하는 단백질이 TCOF1 단백질로 동정되었다. 도 1B에 나타난 바와 같이, 웨스턴 블롯을 통해 β-카테닌(β-catenin)과 TCOF1 단백질의 상호 결합을 확인하였다.As shown in FIG. 1A , a protein binding to β-catenin was identified as TCOF1 protein through immunoprecipitation and mass spectrometry in colon cancer cell lines. As shown in FIG. 1B , the mutual binding between β-catenin and TCOF1 protein was confirmed through Western blot.
도 1C 및 도 1D에 나타난 바와 같이, TCOF1 단백질이 세포 핵에서 발현되는 것을 확인하였고, β-카테닌(β-catenin)과 TCOF1 단백질이 세포질과 핵에서 결합하는 것을 확인하였다.1C and 1D, it was confirmed that TCOF1 protein was expressed in the cell nucleus, and it was confirmed that β-catenin and TCOF1 protein were combined in the cytoplasm and nucleus.
실시예 2. TCOF1 발현Example 2. TCOF1 expression
대장암 세포에서 TCOF1 발현 프로파일을 데이터 베이스 상에서 분석하고, 다양한 대장암 세포주에서 TCOF1 단백질의 발현 여부를 분석하였다.The TCOF1 expression profile in colorectal cancer cells was analyzed on the database, and the expression of TCOF1 protein in various colorectal cancer cell lines was analyzed.
도 2에 나타난 바와 같이, Oncomine 데이터 베이스 및 UALCAN 데이터 베이스 분석 결과 TCOF1은 정상 조직에 비해 대장암 조직에서 발현량이 높게 나타났으며, 대장암 세포주인 HCT116, RKO, DLD1, HCT15, SW480E, CaCO2, SW620, SW480, Colo320DM, HT29의 TCOF1 단백질이 검출되는 것으로 확인되었다.As shown in FIG. 2, as a result of analysis of the Oncomine database and the UALCAN database, the expression level of TCOF1 was higher in colorectal cancer tissues than in normal tissues, and colon cancer cell lines HCT116, RKO, DLD1, HCT15, SW480E, CaCO2, SW620 , it was confirmed that the TCOF1 protein of SW480, Colo320DM, and HT29 was detected.
실시예 3. TCOF1의 암세포 증식능 평가Example 3. Evaluation of cancer cell proliferation ability of TCOF1
TCOF1의 발현 정도에 따른 암세포의 증식에 미치는 영향을 평가하기 위해, 대장암 세포주에 대장암 세포주에 pCMV-TCOF1을 이용하여 TCOF1로 형질 주입하거나, 간섭 RNA로 TCOF1의 발현을 억제하고, 배양 시간에 따른 세포 수를 측정하였다.In order to evaluate the effect of TCOF1 expression on the proliferation of cancer cells, colorectal cancer cell lines were transfected with TCOF1 using pCMV-TCOF1, or TCOF1 expression was inhibited with interfering RNA, The number of cells was measured accordingly.
도 3A 및 도 3B에 나타난 바와 같이, TCOF1 유전자 형질이 주입된 세포는 시간이 지남에 따라 세포수가 증가하는 것으로 나타났다. 반면, 도 3C 및 도 3D에 나타난 바와 같이, RNA 간섭으로 TCOF1의 발현이 억제된 세포는 시간이 지남에 따른 세포 증가가 억제되는 것으로 나타났다.As shown in FIGS. 3A and 3B , the cells transfected with the TCOF1 gene showed an increase in the number of cells over time. On the other hand, as shown in FIGS. 3C and 3D , cells in which the expression of TCOF1 was suppressed by RNA interference showed that cell growth over time was suppressed.
실시예 4. TCOF1 발현 여부에 따른 β-카테닌(β-catenin) 발현 변화Example 4. Changes in β-catenin expression depending on whether TCOF1 is expressed
TCOF1의 발현 정도에 따른 β-카테닌(β-catenin) 발현에 미치는 영향을 평가하기 위해, 대장암 세포주에 TCOF1로 형질 주입하거나, 간섭 RNA로 TCOF1의 발현을 억제하고, β-카테닌(β-catenin)의 발현 여부를 측정하였다.To evaluate the effect of TCOF1 expression on β-catenin expression, colon cancer cell lines were transfected with TCOF1, or TCOF1 expression was inhibited with interfering RNA, and β-catenin (β-catenin) was ) was measured.
도 4에 나타난 바와 같이, TCOF1 mRNA 수준의 변화는 β-카테닌(β-catenin) mRNA의 수준에 영향을 주지 않는 것으로 나타났다. 다만, β-카테닌(β-catenin)의 하위 유전자인 cyclinD1 mRNA의 발현 수준이 TCOF1 mRNA의 발현 수준과 비례하는 것으로 나타났다.As shown in FIG. 4 , the change in TCOF1 mRNA level did not appear to affect the level of β-catenin mRNA. However, the expression level of cyclinD1 mRNA, a subgene of β-catenin, was found to be proportional to the expression level of TCOF1 mRNA.
또한, β-카테닌(β-catenin)의 활성을 TOP/FOP flash을 이용한 형광 세기로 확인한 결과, TCOF1이 과발현된 세포주에서 형광 세기가 증가하고, TCOF1의 발현이 억제된 세포주에서는 형광의 세기가 감소하는 것으로 나타났다. 상기 결과는 TCOF1의 발현 정도가 β-카테닌(β-catenin)의 활성에 영향을 미친다는 것을 입증한다.In addition, as a result of confirming the activity of β-catenin by the fluorescence intensity using TOP/FOP flash, the fluorescence intensity increased in the cell line overexpressing TCOF1, and the fluorescence intensity decreased in the cell line in which the expression of TCOF1 was suppressed. appeared to do The above results demonstrate that the expression level of TCOF1 affects the activity of β-catenin.
또한, β-카테닌(β-catenin) 및 이의 분해 형태인 P-β-catenin, 및 cyclinD1 단백질 수준을 측정한 결과, TCOF1 단백질의 발현 수준이 증가할수록 β-카테닌(β-catenin)의 발현량이 증가하고, P-β-catenin의 발현은 감소하였고, cyclinD1 단백질의 수준도 증가하는 것으로 나타났다. 상기 결과는 TCOF1 단백질은 β-카테닌(β-catenin)의 활성을 단백질 수준에서 조절한다는 것을 입증한다.In addition, as a result of measuring the levels of β-catenin and its decomposed form, P-β-catenin, and cyclinD1, the expression level of β-catenin increases as the expression level of TCOF1 increases. And, the expression of P-β-catenin was decreased, and the level of cyclinD1 protein was also increased. The above results demonstrate that TCOF1 protein regulates the activity of β-catenin at the protein level.
실시예 5. TCOF1 발현 여부에 따른 β-카테닌(β-catenin) 안전성 변화Example 5. Changes in β-catenin safety according to whether or not TCOF1 is expressed
TCOF1의 발현 정도에 따른 β-카테닌(β-catenin) 안전성에 미치는 영향을 평가하기 위해, 대장암 세포주에 TCOF1로 형질 주입하거나, 간섭 RNA로 TCOF1의 발현을 억제하고, 단백질 합성 저해제 또는 프로테아좀 단백질 분해제를 처리하여 β-카테닌(β-catenin)의 수준 변화를 평가하였다.In order to evaluate the effect on the safety of β-catenin according to the expression level of TCOF1, transfected colon cancer cell lines with TCOF1, or inhibiting the expression of TCOF1 with interfering RNA, protein synthesis inhibitors or proteasome Changes in the level of β-catenin were evaluated by treatment with a proteolytic agent.
도 5에 나타난 바와 같이, TCOF1이 과발현된 세포주에서는 단백질 합성 저해제인 Cycloheximide를 처리하여도 β-카테닌(β-catenin)의 반감기가 증가하는 것으로 나타났다. 또한, TCOF1의 발현이 억제된 세포주에 프로테아좀 단백질 분해 저해제인 MG132를 처리한 결과 β-카테닌(β-catenin)의 발현 수준이 증가하는 것을 확인하였다. 상기 결과들은 TCOF1이 프로테아좀 단백질 분해에 관여하여 β-카테닌(β-catenin)의 안정성을 증가시킨다는 것을 입증한다.As shown in FIG. 5 , in the cell line overexpressing TCOF1, the half-life of β-catenin was increased even after treatment with Cycloheximide, a protein synthesis inhibitor. In addition, it was confirmed that the expression level of β-catenin increased as a result of treating MG132, a proteasome proteolysis inhibitor, in a cell line in which the expression of TCOF1 was suppressed. The above results demonstrate that TCOF1 is involved in proteasome proteolysis to increase the stability of β-catenin.
실시예 6. TCOF1 발현 여부에 따른 텐키라제 억제제 활성 변화Example 6. Changes in tenkyrase inhibitor activity according to TCOF1 expression
TCOF1의 발현 정도에 따른 텐키라제(Tankyrase; poly (ADP-ribose) polymerase superfamily; PARP-5) 억제제에 의한 β-카테닌(β-catenin) 분해에 미치는 영향을 평가하기 위해, 대장암 세포주에 TCOF1로 형질 주입하거나, 간섭 RNA로 TCOF1의 발현을 억제하고, 텐키라제 억제제인 NVP-TNKS656를 처리하였다.To evaluate the effect on β-catenin degradation by a tenkyrase (poly (ADP-ribose) polymerase superfamily; PARP-5) inhibitor according to the expression level of TCOF1, TCOF1 in colorectal cancer cell lines , or inhibited the expression of TCOF1 with interfering RNA, and treated with NVP-TNKS656, a tenkyrase inhibitor.
도 6 및 7에 나타난 바와 같이, TCOF1이 과발현된 세포주에서는 텐키라제 억제제를 처리하여도 β-카테닌(β-catenin)의 수준이 높게 나타났으나, TCOF1의 발현이 억제된 세포주에서는 β-카테닌(β-catenin)의 수준이 현저하게 감소하는 것으로 나타났다. 상기 결과는 TCOF1이 텐키라제(Tankyrase; poly (ADP-ribose) polymerase superfamily; PARP-5) 억제제에 의한 β-카테닌(β-catenin) 분해를 억제한다는 것을 입증한다.As shown in FIGS. 6 and 7 , in the cell line overexpressing TCOF1, the level of β-catenin was high even after treatment with a tenkyrase inhibitor, but in the cell line in which the expression of TCOF1 was suppressed, β-catenin (β-catenin) was found to be significantly reduced. The above results demonstrate that TCOF1 inhibits β-catenin degradation by a tankyrase (poly (ADP-ribose) polymerase superfamily; PARP-5) inhibitor.
즉, 상기 결과들은 대장암 세포주에서 TCOF1이 β-카테닌(β-catenin)과 결합하는 단백질이며, TCOF1의 발현이 증가함에 따라 β-카테닌(β-catenin)의 활성이 증가하고, TCOF1 단백질은 β-카테닌(β-catenin)와 결합하여 β-카테닌(β-catenin)의 안정성을 증가시켜 β-카테닌(β-catenin)의 축적을 유도하므로, TCOF1 단백질 및 β-카테닌(β-catenin)의 결합된 TCOF1 단백질은 대장암을 진단 또는 예후예측을 위한 바이오 마커로 사용될 수 있으며, TCOF1 단백질의 발현 수준 또는 TCOF1 단백질과 β-카테닌(β-catenin) 결합 수준을 측정함으로써, 대장암을 진단 또는 예후예측을 위한 정보를 제공할 수 있음을 입증하였다.That is, the above results show that TCOF1 is a protein that binds to β-catenin in colorectal cancer cell lines, and as the expression of TCOF1 increases, the activity of β-catenin increases, and TCOF1 protein is a β-catenin protein. - Since it binds to β-catenin and increases the stability of β-catenin to induce the accumulation of β-catenin, the binding of TCOF1 protein and β-catenin The TCOF1 protein can be used as a biomarker for diagnosing or predicting colorectal cancer, and by measuring the expression level of TCOF1 protein or the binding level of TCOF1 protein and β-catenin, the diagnosis or prognosis of colorectal cancer It has been demonstrated that information can be provided for
또한, 상기 결과들은 TCOF1 단백질 및 β-카테닌(β-catenin)의 결합된 TCOF1 단백질은 대장암의 치료를 위한 새로운 타겟으로 적용할 수 있음을 입증하였으며, TCOF1 단백질 발현 억제제, TCOF1 단백질 분해제, 또는 TCOF1 단백질과 β-카테닌(β-catenin) 결합 억제제가 대장암의 예방 또는 치료를 위한 약학적 제제로 사용될 수 있음을 시사한다.In addition, the above results demonstrated that TCOF1 protein and TCOF1 protein combined with β-catenin can be applied as a new target for the treatment of colorectal cancer, TCOF1 protein expression inhibitor, TCOF1 proteolytic agent, or It suggests that TCOF1 protein and β-catenin binding inhibitor can be used as a pharmaceutical agent for the prevention or treatment of colorectal cancer.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 즉, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다.As described above in detail a specific part of the present invention, for those of ordinary skill in the art, it is clear that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. do. That is, the substantial scope of the present invention is defined by the appended claims and their equivalents.
<110> University Of Ulsan <120> Use of TCOF1 for the diagnosis or prognosis of colorectal cancer patients <130> ADP-2020-0168 <160> 9 <170> KoPatentIn 3.0 <210> 1 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> shTCOF1 <400> 1 gcaagacugg gaauuccauu cucauggaau ucccagucuu gcuu 44 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 18S-f <400> 2 agtccctgcc ctttgtacac a 21 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 18S-r <400> 3 gatccgaggg cctcactaaa c 21 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> cyclinD1-f <400> 4 agctcctgtg ctgcgaagtg gaaac 25 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> cyclinD1-r <400> 5 agtgttcaat gaaatcgtgc ggggt 25 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> b-catenin-f <400> 6 acctttccca tcatcgtgag 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> b-catenin-r <400> 7 aatccactgg tgaaccaagc 20 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TCOF1-f <400> 8 gagtgaggaa gatggtgaag g 21 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> TCOF1-r <400> 9 agaggagaga ctgggatgg 19 <110> University of Ulsan <120> Use of TCOF1 for the diagnosis or prognosis of colorectal cancer patients <130> ADP-2020-0168 <160> 9 <170> KoPatentIn 3.0 <210> 1 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> shTCOF1 <400> 1 gcaagacugg gaauuccauu cucauggaau ucccagucuu gcuu 44 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 18S-f <400> 2 agtccctgcc ctttgtacac a 21 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 18S-r <400> 3 gatccgaggg cctcactaaa c 21 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> cyclinD1-f <400> 4 agctcctgtg ctgcgaagtg gaaac 25 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> cyclinD1-r <400> 5 agtgttcaat gaaatcgtgc ggggt 25 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> b-catenin-f <400> 6 acctttccca tcatcgtgag 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> b-catenin-r <400> 7 aatccactgg tgaaccaagc 20 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TCOF1-f <400> 8 gagtgaggaa gatggtgaag g 21 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> TCOF1-r <400> 9 agaggagaga ctgggatgg 19
Claims (11)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020200066100A KR20210148772A (en) | 2020-06-01 | 2020-06-01 | Use of TCOF1 for the diagnosis or prognosis of colorectal cancer patients |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020200066100A KR20210148772A (en) | 2020-06-01 | 2020-06-01 | Use of TCOF1 for the diagnosis or prognosis of colorectal cancer patients |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| KR20210148772A true KR20210148772A (en) | 2021-12-08 |
Family
ID=78867734
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020200066100A KR20210148772A (en) | 2020-06-01 | 2020-06-01 | Use of TCOF1 for the diagnosis or prognosis of colorectal cancer patients |
Country Status (1)
| Country | Link |
|---|---|
| KR (1) | KR20210148772A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116144669A (en) * | 2023-03-27 | 2023-05-23 | 青岛市妇女儿童医院（青岛市妇幼保健院、青岛市残疾儿童医疗康复中心、青岛市新生儿疾病筛查中心） | TCOF1 gene mutant and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20180092135A (en) | 2017-02-08 | 2018-08-17 | 가톨릭대학교 산학협력단 | Use of VLDLR for preventing, diagnosing or treating colorectal and rectal cancer |
-
2020
- 2020-06-01 KR KR1020200066100A patent/KR20210148772A/en unknown
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20180092135A (en) | 2017-02-08 | 2018-08-17 | 가톨릭대학교 산학협력단 | Use of VLDLR for preventing, diagnosing or treating colorectal and rectal cancer |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116144669A (en) * | 2023-03-27 | 2023-05-23 | 青岛市妇女儿童医院（青岛市妇幼保健院、青岛市残疾儿童医疗康复中心、青岛市新生儿疾病筛查中心） | TCOF1 gene mutant and application thereof |
| CN116144669B (en) * | 2023-03-27 | 2023-09-15 | 青岛市妇女儿童医院（青岛市妇幼保健院、青岛市残疾儿童医疗康复中心、青岛市新生儿疾病筛查中心） | TCOF1 gene mutant and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR20150008926A (en) | Histone deacetylase inhibitors sensitize cancer cells to epidermal growth factor inhibitors | |
| Wang et al. | CD24 mediates gastric carcinogenesis and promotes gastric cancer progression via STAT3 activation | |
| KR20150105297A (en) | Method for the diagnosis, prognosis and treatment of prostate cancer metastasis using c-maf | |
| Liu et al. | Overexpression of Tiam1 predicts poor prognosis in patients with esophageal squamous cell carcinoma | |
| Huang et al. | Irisin, an exercise myokine, potently suppresses tumor proliferation, invasion, and growth in glioma | |
| WO2012015937A2 (en) | Parp1 targeted therapy | |
| Wen et al. | EphA2 affects the sensitivity of oxaliplatin by inducing EMT in oxaliplatin-resistant gastric cancer cells | |
| WO2010040083A2 (en) | Gene expression predictors of chemoresistance | |
| Yuan et al. | USP39 mediates p21‐dependent proliferation and neoplasia of colon cancer cells by regulating the p53/p21/CDC2/cyclin B1 axis | |
| US20240248089A1 (en) | Method and device for detecting siglec12 | |
| Li et al. | Faciogenital Dysplasia 5 supports cancer stem cell traits in basal-like breast cancer by enhancing EGFR stability | |
| Wen et al. | Golgi phosphoprotein 3 (GOLPH3) promotes endometrial carcinoma cell invasion and migration by regulating the epithelial-mesenchymal transition | |
| Li et al. | Nav1. 6 promotes the progression of human follicular thyroid carcinoma cells via JAK-STAT signaling pathway | |
| Li et al. | MT1M regulates gastric cancer progression and stemness by modulating the Hedgehog pathway protein GLI1 | |
| KR20210148772A (en) | Use of TCOF1 for the diagnosis or prognosis of colorectal cancer patients | |
| Mao et al. | Overexpression of Derlin-1 is associated with poor prognosis in patients with non-small cell lung cancer | |
| Yuan et al. | The clinical significance, prognostic value and biological role of lncRNA LINC01793 in oral squamous cell carcinoma | |
| Wang et al. | The non‐coding RNA OTUB 1‐isoform2 promotes ovarian tumour progression and predicts poor prognosis | |
| KR102175929B1 (en) | Composition for diagnosis and treatment of thyroid cancer comprising Brn3a | |
| Ye et al. | Knockdown of casein kinase 1E inhibits cell proliferation and invasion of colorectal cancer cells via inhibition of the Wnt/beta-catenin signaling | |
| WO2006066826A1 (en) | Method of diagnosing cancer | |
| CN105861741B (en) | The diagnosis and treatment target of SENP3 gene and its expression product as the cancer of the esophagus | |
| US20130323231A1 (en) | Treatment and prognosis of solid tumour cancers | |
| EP3330710B1 (en) | Method and kit for evaluating prognosis, distant recurrence risk and invasion of glioma, and pharmaceutical composition for treating glioma | |
| KR101897322B1 (en) | A method for diagnosing a metastasis of a primary thyroid cancer and a diagnostic kit using the method |