KR102346076B1 - Transformed methanotrophs for producing α-bisabolene production from methane and uses thereof - Google Patents

Abstract

The present invention relates to a transgenic methanogen having the ability to produce alpha-bisabolene and a method for producing alpha-bisabolene using the same. It can be used throughout the industry by producing alpha-bisabolene in an environmentally friendly and economical way.

Description

Transformed methanotrophs for producing α-bisabolene production from methane and uses thereof}

The present invention relates to the development of methanogenic bacteria with improved productivity of α-bisabolene from methane, and more particularly, bisabolene, a direct precursor of bisabolane used as D2 biodiesel. ) to how to produce it.

Recently, research on the production of chemicals and fuels through bioconversion of C1 compounds is being actively conducted, which is expected to bring about changes in the production methods of chemicals and fuels in industrial fields in the future. In particular, Methanotrophs are microorganisms that use methane as the sole carbon and energy source, and are evaluated as promising biocatalysts for the biological conversion of methane.

Attempts have been made to produce various high-value compounds using methanotrophs, but the lack of understanding of the physiological properties of methanotrophs, low growth rate and lack of genetic tools, etc. acted as a limiting point in developing it into an industrial strain. However, recently, through several studies, metabolic engineering improvement has been made possible for type I methanogenic bacteria, and lactic acid and 2,3-butanediol have been successfully produced using this, but the potency and productivity are still low, so improvement is needed.

Isoprenoids are the most extensive group of hydrocarbon compounds that exist in nature, and can be widely applied to pharmaceuticals, cosmetics and biofuels. Of the isoprenoids, Bisabolene, a C15-series sesquiterpenes, is mostly contained in natural vegetable oils such as lemon oil, lime oil, bergamot oil, camphor oil, pine needle oil, sesame oil, enteric oil, and sandalwood oil. have. α-bisabolene, a direct precursor of bisabolane used as D2 biodiesel, is being studied for biosynthesis using various microorganisms in addition to chemical synthesis. has never been

KR 10-2019-0049575 A

An object of the present invention, fir tree (Abies hrandis)-derived alpha-bisabolene synthaes (α-bisabolene synthaes, agBs), farnesyl diphosphate synthase (farnesyl diphosphate synthase, ispA ) Genes encoding the introduced or amplified , to provide a transformed methanogen having the ability to produce α-bisabolene.

Another object of the present invention is to convert the transformed methanogen to 1-deoxy-Dxylulose-5-phosphate synthase ( dxs ), (E)-4-hyde Combines with roxy-3-methylbut-2-enyl-diphosphate synthase ((E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase, IspG), nDXP enzyme (RibB-G108S) and linker DSAGSAGSAG By further introducing or amplifying the gene encoding the 1-deoxy-D-xylulose-5-phosphate reductase (ispC), the MEP pathway was enhanced It is to provide a transformed methanogenic bacteria characterized in that.

Another object of the present invention is to provide a composition for producing alpha-bisabolene by culturing the transformed methanogen in a culture medium containing methane.

Another object of the present invention is to provide a method for producing alpha-bisabolene from a methane substrate using the transformed methanogen.

In order to achieve the object of the present invention as described above, the present invention is an alpha-bisabolene synthase (α-bisabolene syntase, agBs ); farnesyl diphosphate synthase ( ispA ); 1-deoxy-Dxylulose-5-phosphate synthase ( dxs ), (E) -4- Hydroxy-3-methylbut-2-enyl-diphosphate synthesis enzyme ((E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase, IspG); Methanealpha-bisabolene ( α- ) with enhanced nDXP pathway enzyme (ribB) and 1-deoxy-D-xylulose-5-phosphate reductoisomerase (IspC) activity. bisabolene) for producing transformed methanogens.

More specifically, Wild-type methane magnetization bacteria, fir (Abies hrandis) derived from the alpha into the Methylomicrobium alcaliphilum 20Z - Ibiza Vollenhoven synthase (α-bisabolene synthaes, agBs) and Ipanema chamber diphosphate synthase The activity-enhanced alpha (farnesyl diphosphate synthase, ispA) -Provides a transformed methanogen for production of bisabolene.

In addition, the present invention provides a higher level of α-bisabolene of a transformed methanogen with enhanced activity of the α-bisabolene synthaes (agBs) and farnesyl diphosphate synthetase. 1-deoxy-Dxylulose-5-phosphate synthase (1-deoxy-Dxylulose) to enhance the pool of precursor 1-deoxy-Dxylulose-5-phosphate -5-phosphate synthase: dxs ), (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase ((E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase , IspG) from ribose-5-phosphate (Ru5P), a metabolite of the pentose metabolic pathway, with enhanced activity of 1-deoxy-dexylulose-5-phosphate (1-deoxy-Dxylulose) nDXP enzyme (RibB, G108S) that directly converts -5-phosphate (DXP) and 1-deoxy-D-xylulose-5-phosphate reductase (1-deoxy-D-xylulos 5-phosphate) with linker DSAGSAGSAG reductase, ispC) provides a transformed methanogen with enhanced activity

In addition, the present invention provides a composition for the production of alpha-bisabolene using the transformed methanotrophs. The composition for producing α-bisabolene may include 1 to 50% by volume of methane as a carbon source.

In addition, the present invention provides a method for producing alpha-bisabolene using the transformed methanogen in a culture medium containing 1 to 50% by volume of methane.

Hereinafter, terms used in the present invention will be described.

As used herein, the term “methanotrophs” refers to bacteria using methane as a major carbon source or energy source, and the methanotrophs refer to host strains to be transformed in the present invention.

As used herein, the term “vector” refers to a circular DNA that can be amplified by introducing a desired DNA fragment into a host bacteria in a DNA recombination experiment, and refers to a cloning carrier.

The term “transformation” used in the present invention means that a microorganism receives DNA given from the outside and the genetic properties of the microorganism are changed.

As used herein, the term “metabolic pathway” refers to a series of processes leading to anabolic action of biosynthesis of organic molecules such as proteins, nucleic acids, amino acids, etc. and catabolism of decomposing organic molecules through enzyme-mediated biochemical reactions.

As used in the present invention, the term “composition” is a mixture of various materials for producing a target material, and it means that a microbial culture medium, a carbon source, a trace element and a microbial seed are included.

Hereinafter, the present invention will be described in more detail.

Methanotroph of the present invention refers to bacteria that use methane (or methanol) as a carbon source or nutrient source during culture, and the methanotroph used in the present invention is not limited thereto, but the genus Methylomonas (Methylomonas), Methylomicrobium, Methylobacter, Methylococcus, Methylosphaera, Methylocaldum, Methyloglobus Methyloglobus, Methylosarcina, Methyloprofundus, Methylothermus, Methylohalobius, Methylogaea , genus Methylomarinum, genus Methylovulum, genus Methylomarinovum, genus Methylorubrum, genus Methyloparacoccus, genus Methylocinus ( Methylosinus), Methylocystis, Methylocella, Methylocapsa, Methylofurula, Methylacidiphilum and Methylacidiphilum It may be at least one selected from the group consisting of the genus (Methylacidimicrobium), and more preferably, may be the genus Methylomicrobium. In an embodiment of the present invention, an experiment was performed using Methylomicrobium alcaliphilum 20Z, but the present invention is not limited thereto.

The methanotrophs of the present invention, for the production of alpha-bisabolene, alpha-bisabolene synthaes, agBs, SEQ ID NO: 1 from fir tree (Abies hrandis) and farnesyl diphosphate synthase ( ispA, SEQ ID NO: 2) were overexpressed to obtain a transformed methanogen 20Z-Bs-1.

In addition, 1-deoxy-Dxylulose-5-phosphate, DXP, which is an upper precursor of α-bisabolene of the transformed methanogen 20Z-Bs-1 ) to improve the pool, 1-deoxy-dexylulose-5-phosphate synthase (1-deoxy-Dxylulose-5-phosphate synthase: dxs, SEQ ID NO: 3), (E) -4-hydroxy- 3-methylbut-2-enyl-diphosphate synthase ((E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase, isp G, SEQ ID NO: 4), librose, a metabolite of the pentose metabolic pathway nDXP enzymes (RibB, G108S, SEQ ID NO: 5) and 1-deoxy-D-xylulose-5-phosphate reductase (1-deoxy-D-xylulos 5-phosphate reductase, ispC, SEQ ID NO: 6) to which the linker DSAGSAGSAG was attached. A magnetobacter 20Z-Bs-2 strain was obtained.

The present invention relates to a transformed methanogenic bacterium having the ability to produce α-bisabolene and a method for producing α-bisabolene using the same, and more specifically, to a method for producing α-bisabolene using methane as a carbon source. As a method of producing α-bisabolene using a transformed methanogen, the production method of α-bisabolene with improved economic efficiency and efficiency can be used throughout the industry.

1 is a gas chromatography-mass of alpha-bisabolene production using wild-type methanogen 20Z-WT and a transformed transgenic methanogen 20Z-Bs-1 strain overexpressed with agBs and ispA. The results of analysis through a gas chromatograph mass (GC-MS) are shown.
FIG. 2 shows the results of comparison of the amount of alpha-bisabolene produced by wild-type methanogen 20Z-WT and transformed methanogen 20Z-Bs-1.
3 shows the alpha-bisabolene biosynthetic pathway of the transformed methanogen 20Z-Bs-2 overexpressing the enzymes of the MEP pathway and the nDXP pathway.
4 shows wild-type methanocytes (20Z-WT), transformed methanogens overexpressed with agBs and ispA (20Z-Bs-1), and transformed methanocytes overexpressed with enzymes of the MEP and nDXP pathways (20Z- Bs-2) shows the results of comparing the amount of alpha-bisabolene produced.

Hereinafter, the present invention will be described in more detail by way of Examples. These examples are merely for illustrating the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited to these examples.

<Experiment method>

(1) strain preparation and culture conditions

The strains used in the present invention are shown in Table 1 below. The M. alcaliphilum 20Z strain was cultured in a 500 ml baffled flask with 50 ml NMS provided and the inlet was sealed using a screw cap. As a carbon source, methane was added in an amount of 1 to 50% by volume of the culture medium using a gas substituent, preferably 25 to 50% by volume, more preferably 45 to 50% by volume. As a substitute for methane, methanol may be added in an amount of 0.1 to 1% by weight of the culture medium, preferably 0.5 to 1% by weight, more preferably 0.9 to 1% by weight. With the same concentration of the culture medium and carbon source as described above, the culture was performed with shaking at 30°C and 230 rpm. The absorbance of the cell culture medium was measured using a 1.5 ml cuvette, and the cell concentration was confirmed using the measured absorbance. The cultured strain was inoculated into a plate medium containing kanamycin at a concentration of 50 μg/ml, and methanogenic bacteria and Escherichia coli containing the recombinant plasmid were selected.

strain characteristic Reference Escherichia coli Novagen M. alcaliphilum 20Z strains for injection DMSZ 20Z-Bs-1 agBs introduction and ispA overexpression the present invention 20Z-Bs-2 Overexpression of ispC-DSAG-RibB (G108S) and ispA, dxs, ispG, and agBs the present invention

(2) Materials and tools for transformation

gDNA of M. alcaliphilum 20Z was isolated using the Wizard Genomic DNA Purification kit (Promega), and PCR was performed using the primers in Table 2 and Lamp Pfu polymerase (BioFACT). product was used. Oligomer synthesis and DNA sequence analysis were commissioned by Macrogen.

primer base sequence Characteristic pAWP89-For TAGTTGTCGGGAAGATGCGT For amplifying pAWP89 backbone which contained P _tac promoter and SD sequence pAWP89-Rev AGCTGTTTCCTGTGTGAATA agB.s-For TTCACACAGGAAACAGCTATGGCGGGTGTTTCTGCG For construction of pBS01 vector. AgB.s and ispA from 20Z were amplified and ligated into pAWP89 backbone agB.s-Rev ACTCAGATCTTACAGCGGCAGCGGTTC ispA-20Z-For CCGCTGTAAGATCTGAGTACCTCTAGAAAATAAGGA ispA-20Z-Rev GCATCTTCCCGACAACTATTAATGATCTCGCTGGATAA ribB-KpnI-For CTGGTCTGTTTGTGGTACAGGAAACAGCTATGAATCAGACGCTACTT
TCCTCT For construction of ribB-G108S via site-directed mutagenesis ribB-KpnI-Rev CGTAGATCTTCTAGAGGTACTCAGCTGGCTTTACGCTCAT ribB-G108S-Rev GGCAGAAACCGAGGTAGTCA ribB-G108S-For TGACTACCTCGGTTTCTGCC ispG-For TTCGCGTGATACCGGTACAGCAATAGAGAATATAAACACTAAGGAG
GTCAAACATGTCAATCAGCCCAAGAAA For construction of pBS02 vector, ispG, dxs, ribB-G108S and ispC were amplified and ligated into pBS01 vector. ribB-108S and ispC was fused by DSAGSAGSAG linker) ispG-Rev CCGGTGAGCTCGCATGCACTACTGAGCTGTGGTTTCCGT dxs-20Z-For GAGATCATTAATACGCGTACAATCCCCATATCTCACAAAATATATAAGGAGGTCAACATGAAAATCACAGGAAATTTCCCCC dxs-20Z-Rev CCGGTGAGCTCGCATGCATCACGCGCAAAATTGCTCG ribB-89-For CGGAACCACAGCCAGTAGAGGAAACAGCTATGAATCAGACGCTACTTTC ribB-DSAG-Rev ACCAGCACTACCAGCACTACCAGCACTATCGCTGGCTTTACGCTCATGTG ispC-DSGA-For GATAGTGCTGGTAGTGCTGGTAGTGCTGGTAAAGGTATTTGTATTTTGGGCGC ispC-89-Rev GCATCTTCCCGACAACTATTAACGCTTAAGTTCTTCGACGA

(3) M. alcaliphilum Electroporation-based genetic manipulation method of 20Z

50 ml of the culture medium was cultured to OD ₆₀₀ = 0.4 to 0.6, and the cultured strains were centrifuged at 5000 × g, 4° C. for 10 minutes, and the recovered cells were resuspended in 50 ml of sterile water (repeated twice). The recovered cell pellet was resuspended in 100 μL of sterile strain, and 500 ng DNA plasmid was added to 50 μL of cell suspension and mixed, followed by transformation using the electroporation method. Electroporation was performed at 1.3 kV, 25 μF and 200 Ω using a Gene Pulser Xcell™ electroporation system (Bio-Rad). Immediately after electroporation, 1 ml of NMS was added to the cells, and the recovered cells were transferred to 10 ml of NMS medium containing 0.1% methanol, incubated at 30° C. for 24 hours, and then the cells were centrifuged at 5000 g in a centrifuge for 10 minutes. were plated on NMS agar medium supplemented with antibiotics.

(3) Analysis method

Alpha-bisabolene was analyzed using GC-MS (gaschromatograph-mass spectrometer, Agilent, USA) equipped with an HP-5MS column. Helium was used as the mobile phase, the split ratio was 8:1, and the flow rate was 2.2 ml/min. The inlet and detector temperatures were 250° C., and the oven temperature was maintained at 80° C. for 3 minutes, raised to 240° C. at a rate of 16° C./minute per minute, and then maintained at 240° C. for 2 minutes. For quantification, standard alpha-bisabolene was used.

Experimental Example 1. For the production of alpha-bisabolene M. alcaliphilum Metabolic Engineering of 20Z

M. alcaliphilum 20Z naturally produces prenyl phosphate (FPP) and can produce alpha-bisabolene through heterologous expression of alpha-bisabolene synthetase. Prenyl phosphate (FPP) is produced by condensing two molecules of isopentenyl pyrophosphate (IPP) and one molecule of dimethylallyl pyrophosphate (DMAPP) with ispA, so that IPP and DMAPP are formed. It is also an important intermediate in the MEP metabolic pathway. To biosynthesize α-bisabolene using M. alcaliphilum 20Z as a host, α-bisabolene synthetase from Abies hrandis was codoned to fit M. alcaliphilum 20Z. A pBS01 vector introduced with optimized agBs (α-bisabolene synthaes, agBs) and ispA was constructed and transformed into a wild-type strain to obtain 20Z-Bs-1.

Bisabolene production was confirmed as a two-phase system by adding 20 wt% of dodecane to a culture medium provided with methane as a carbon source. As a result of GC-MS analysis by culturing the wild-type strain and the transformed methanogen 20Z-Bs-1 strain, it was confirmed that alpha-bisabolene was produced only in the transformed strain ( FIGS. 1 and 2 ), and the Alpha-bisabolene was 12.8 mg/L ( FIG. 2 ).

Experimental Example 2. Redesign of MEP pathway and introduction of nDXP pathway for alpha-bisabolene productivity improvement

1-deoxy-Dxylulose-5-phosphate synthase (Dxs) is known to inhibit transcription and translation by prenyl phosphate (FPP). We tried to overexpress Dxs and MEP pathway-related enzymes. In addition, through the introduction of the nDXP pathway capable of direct conversion from Ru5P, a metabolite of the pentdandan pathway, to 1-deoxy-Dxylulose-5-phosphate (DXP), the enzyme tried to solve the above-mentioned inhibition problem.

As shown in FIG. 3, the present invention further introduces the dxs, lspG and RibB (G108S) genes related to the MEP pathway and the ispC gene to which the linker DSAGSAGSAG is attached into the pBS01 vector, and then transforms it into a wild-type methanogen. A methanogen 20Z-Bs-2 was obtained. The alpha-bisabolene productivity of the transformed methanogenic bacterium 20Z-Bs-2 was increased twice that of the 20Z-Bs-1 strain, producing 24.55 mg/L of alpha-bisabolene (FIG. 4).

<110> University-Industry Cooperation Group of Kyung Hee University <120> Transformed methanotrophs for producing alpha bisabolene production from methane and uses thereof <130> PN1910-469 <160> 24 <170> KoPatentIn 3.0 <210> 1 <211> 2454 <212> DNA <213> Unknown <220> <223> A. grandis agBs gene <400> 1 atggcgggtg tttctgcggt ttctaaagtt tcttctctgg tttgcgacct gtcttctacc 60 tctggtctga tccgtcgtac cgcgaacccg cacccgaacg tttggggtta cgacctggtt 120 cactctctga aatctccgta catcgactct tcttaccgtg aacgtgcgga agttctggtt 180 tctgaaatca aagcgatgct gaacccggcg atcaccggtg acggtgaatc tatgatcacc 240 ccgtctgcgt acgacaccgc gtgggttgcg cgtgttccgg cgatcgacgg ttctgcgcgt 300 ccgcagttcc cgcagaccgt tgactggatt ctgaaaaacc agctgaaaga cggttcttgg 360 ggtatccagt ctcacttcct gctgtctgac cgtctgctgg cgaccctgtc ttgcgttctg 420 gttctgctga aatggaacgt tggtgacctg caggttgaac agggtatcga gttcatcaaa 480 tctaacctgg aactggttaa aagacgaaacc gaccaggact ctctggttac cgacttcgaa 540 atcatcttcc cgtctctgct gcgtgaagcg cagtctctgc gtctgggtct gccgtacgac 600 ctgccgtaca tccacctgct gcagaccaaa cgtcaggaac gtctggcgaa actgtctcgt 660 gaagaaatct acgcggttcc gtctccgctg ctgtactctc tggaaggtat ccaggacatc 720 gttgaatggg aacgtatcat ggaagttcag tctcaggacg gttctttcct gtcttctccg 780 gcgtctaccg cgtgcgtttt catgcacacc ggtgacgcga aatgcctgga gttcctgaac 840 tctgttatga tcaaattcgg taacttcgtt ccgtgcctgt acccggttga cctgctggaa 900 cgtctgctga tcgttgacaa catcgttcgt ctgggtatct accgtcactt cgaaaaagaa 960 atcaaagaag cgctggacta cgtttaccgt cactggaacg aacgtggtat cggttggggt 1020 cgtctgaacc cgatcgcgga cctggaaacc accgcgctgg gtttccgtct gctgcgtctg 1080 caccgttaca acgtttctcc ggcgatcttc gacaacttca aagacgcgaa cggtaaattc 1140 atctgctcta ccggtcagtt caacaaagac gttgcgtcta tgctgaacct gtaccgtgcg 1200 tctcagctgg cgtttccggg tgaaaacatc ctggacgaag cgaaatcttt cgcgaccaaa 1260 tacctgcgtg aagcgctgga aaaatctgaa acctcttctg cgtggaacaa caaacagaac 1320 ctgtctcagg aaatcaaata cgcgctgaaa acctcttggc acgcgtctgt tccgcgtgtt 1380 gaagcgaaac gttactgcca ggtttaccgt ccggactacg cgcgtatcgc gaaatgcgtt 1440 tacaaactgc cgtacgttaa caacgaaaaa ttcctggaac tgggtaaact ggacttcaac 1500 atcatccagt ctatccacca ggaagaaatg aaaaacgtta cctcttggtt ccgtgactct 1560 ggtctgccgc tgttcacctt cgcgcgtgaa cgtccgctgg agttctactt cctggttgcg 1620 gcgggtacct acgaaccgca gtacgcgaaa tgccgtttcc tgttcaccaa agttgcgtgc 1680 ctgcagaccg ttctggacga catgtacgac acctacggta ccctggacga actgaaactg 1740 ttcaccgaag cggttcgtcg ttgggacctg tctttcaccg aaaacctgcc ggactacatg 1800 aaactgtgct accagattta ctacgacatc gttcacgaag ttgcgtggga agcggaaaaa 1860 gaacagggtc gtgaactggt ttctttcttc cgtaaaggtt gggaagacta cctgctgggt 1920 tactacgaag aagcggaatg gctggcggcg gaatacgttc cgaccctgga cgaatacatc 1980 aaaaacggta tcacctctat cggtcagcgt atcctgctgc tgtctggtgt tctgatcatg 2040 gacggtcagc tgctgtctca ggaagcgctg gaaaaagttg actatccggg tcgtcgtgtt 2100 ctgaccgaac tgaactctct gatctctcgt ctggcggacg acaccaaaac ctacaaagcg 2160 gaaaaagcgc gtggtgaact ggcgtcttct atcgaatgct acatgaaaga ccacccggaa 2220 tgcaccgaag aagaagcgct ggaccacatc tactctatcc tggaaccggc ggttaaagaa 2280 ctgacccgtg agttcctgaa accggacgac gttccgttcg cgtgcaaaaa aatgctgttc 2340 gaagaaaccc gtgttactat ggttatcttc aaagacggtg acggtttcgg tgtttctaaa 2400 ctggaagtta aagaccacat caaagaatgc ctgatcgaac cgctgccgct gtaa 2454 <210> 2 <211> 897 <212> DNA <213> Unknown <220> <223> M. alcaliphilum 20Z ispA gene <400> 2 atgagtaacg cactgaaaga ctatctctcc ttttgtcaaa accgtgtcga aagagccttg 60 gaagcccgac tgccaagcga aaaccaaatt ccgacaaaat tgcacgaagc gatgcgctat 120 tgcgtgctgg acggcggtaa acgcatgcgt ccgatgctaa cctactgtac aggaaaagcc 180 gtgggcattg caccggaaga tttagatggc gcggcctgtg cggttgaatt cattcatgtt 240 tattcgttga tacatgacga tttgccggcc atggacgacg acgacctcag acgcggaaag 300 ccgacctgtc atatcgctta tgatgaagcg accgccattt tgaccggcga cgctttacaa 360 gcattggcat tcaaggtctt ggctgacgac cctaccatcc gagccgatgc cgaaagccgt 420 ctaaaaatga ttacgttgct ggctaaggct agcggctctc aaggcatggt cggcggccaa 480 gccatcgatt tagaatcggt cggcacgatg ctgacgctgc ctcagcttga aaatatgcat 540 atccacaaga ccggagcgtt aattcgagcc agcgtcaaca tggcgacgtt aacgagaccc 600 gatatcgacc cgaaacaggc cgaagggctc gatcattacg caaaatgcat cggcctatcc 660 ttccaagtca aggatgatat tttggacgaa gaaagcgata ccgcaacact cggcaaaacc 720 caaggcaagg acaaagacaa cgacaagccg acttaccctg ccttactcgg cttggccggc 780 gcaaagcaaa aagctcagga acttcatgag caagccattg aaagcttaaa cggattcggc 840 cccgaagccg atctgcttcg tgacttgtcg ctttatatta tccagcgaga tcattaa 897 <210> 3 <211> 1863 <212> DNA <213> Unknown <220> <223> M. alcaliphilum 20Z dxs gene <400> 3 atgaaaatca caggaaattt ccccctacta gacagcatca agctcccctc cgaccttaga 60 aaactgccaa aggaacgatt aaaaccgctt gccaaagaac ttcgcgagtt tctgacccac 120 acagtcagta tttccggcgg gcatttttcg gcaggcctcg gcaccgtaga gttgactgtg 180 gcgctgcatt acgtattcga cacgccgcgc gatcaattgg tttgggatgt cggccatcag 240 gcctatccgc ataagatcct gaccggacgc aaggagcgca tgacgacaat tcgcacccgc 300 gacggctttt gcccctttcc aaaccgttcc aagagcgaat acaatgcctt cggcgtcggc 360 cattcgagca cgtcaattag cgcggcctta ggcatggcga tcgcatccgg tttacgcggc 420 gaggacaagc actgtgtcgc gatcattggc gacggcagca tcaccggcgg catggccttc 480 aaagcaatga accatgccgg tgcgatcgat gcaaatctgt tggtgatctt gaacgacaac 540 aatttgtcaa tttctccaaa tgtcggcccg ttgaaaaatt atctgactaa aattctgtcg 600 agtaaaattt attcttcggt acgcgaaaaa agcaaaaaag ctctcaccag catgccaagc 660 gtctgggagc tggcgcgcaa aaccaaaaag cacatgaaag gcatggtcgt gcccggcacc 720 ttgttcaagg aaatggggtt caattatatc ggtccaatcg acggccatga cctggacatg 780 ctggtgtcaa ccctggaaaa tctaaaacac atttccggcc cgcgtttctt gcatatcgtc 840 accaagaaag gcaagggcta tgcgccggcc gagaaagacc cgctcgccta tcacggcgtg 900 ccggccttcg acccgagccg cgattgtctg ccgaaatcgg ccccttctcc gcacccgacg 960 tatacgcagg tattcggaca atggctctgc gacatggccg agcaggacga gcgcttgttg 1020 ggcattaccc cggcaatgcg cgaaggctcg ggcctggtcg ctttttccga acgctttccg 1080 aagcgttatt tcgatgtcgc catcgccgag cagcatgccg tgaccttagc ggcgggcctg 1140 gcctgcgagg gcggcaaacc ggtcgtcgcg atctattcaa ccttcttaca acgcggctac 1200 gatcaattga tacacgatgt ggtcttgcag gacctggacg tattgtttgc gctcgaccgc 1260 gcaggtttag tcggcccgga cggcccgacc catgccggca gtttcgatta cacctacat 1320 cgctgcctgc cgaacatgct aatcatggca ccggccgacg agaacgaatg ccggcagatg 1380 ctctataccg gttatctgca taaaggcccg gcttcggtac gctatccgcg cggcaaaggc 1440 ccgggcgtgc cggtcgattg caccatgacc gcgctaccga tcggcaaggc cgaattgcgc 1500 catcaaggcg gccgcatcgc gattctggcg ttcggcagca tggttacgcc gtcggtcgag 1560 gtcggtaagc agctcggcgc gaccgtcgtc aatatgcgct tcgtcaagcc gctcgatgaa 1620 gcgttgattc tggaactggc caagagtcac gatatcatcg tcacggtcga agaaaacgtc 1680 attgccggcg gcgccggcag cgcggtcaac gaatttctgc aggcacaaag aatcgtgatg 1740 ccggtcttga atatcggtct gcccgatgcc ttcatcgaac aaggcacgcg cgaagaatta 1800 ctgagttttt gcggattaga tacccaaggc atattgcaga gcatcgagca attttgcgcg 1860 tga 1863 <210> 4 <211> 1227 <212> DNA <213> Unknown <220> <223> M. alcaliphilum 20Z ispG gene <400> 4 atgtcaatca gcccaagaaa aattacccat caagttcaaa tcggcgacat caaagtgggc 60 ggcggcgcgc caatcgtcgt tcaatcaatg accaataccg ataccgccga tatcaaagca 120 acagtcaacc aagtcatgga actgtcgaag gccggatcgg aaatcgtccg tattaccgtc 180 aactccgaag acgcggctaa agccgttcct gaaatccgca accaactcaa tcaaaaaggc 240 tttaccgttc cgatcgtcgg cgatttccat tttaacggac ataaattact cgaaaaatac 300 cccgcctgcg ccgaagcctt agataaatat cgcatcaatc ccggaaatgt cggacgaggt 360 aaaaaccgcg atccacaatt tcaacaaatg atcgagttcg cttgccgcta cgacaagccc 420 gttcgaatcg gcgttaacgg cggtagcctg gatcaagcgg ttttaacgcg ccttttggat 480 gaaaacagac aaaaagaaaa tccggacgaa ctacctgccg ttactcgaga agcaatcatc 540 gtttcggcac tcgaaagcgc ggcccgcgcc gaagaaatag gcctacccgc caacaaaatt 600 ttattgtctt gtaaaatcag caacgttcag gaattgatca gaatttatca agatctaagt 660 aaacgctgcg attacgcgtt acacctcggc ctaaccgaag ccggcatggg ctcgaaaggc 720 atcgtggcat cttcggccgc tctatccgtg cttatgcaac agggcatcgg agacacgatt 780 cgcatctcgc taacaccgga acccggcacg gccagaaccc aagaagttgt agtcgcacag 840 gaaatcttgc aaaccatggg ctttcgttcc tttactccga tggttatcgc ctgcccaggc 900 tgcggccgaa caaccagcga ctatttccaa aaattggcga tggaaattca aaattatcta 960 cgcgtcagta tgccgtcttg gcgcactaaa tatcccggcg tcgaagaaat ggaagtcgcg 1020 gtcatgggtt gtgtcgtcaa tggtcccgga gaaagtaaga atgccagcat cggcatcagc 1080 ttgcccggca ccggagaaac cccggttgct ccggtttatg aagacggtgt caaaacagtg 1140 accttgaaag gcgatcatat agccgaagaa tttcaagcgc tggtcgaacg ctatattgaa 1200 acgcactacg gaaccacagc tcagtag 1227 <210> 5 <211> 654 <212> DNA <213> Unknown <220> <223> Mutated ribB encoding RibB-G108S gene <400> 5 atgaatcaga cgctactttc ctcttttggt acgcctttcg aacgtgttga aaatgcactg 60 gctgcgctgc gtgaaggacg cggtgtaatg gtgcttgatg atgaagaccg tgaaaacgaa 120 ggtgatatga tcttcccggc agaaaccatg actgttgagc agatggcgct gaccattcgc 180 cacggtagcg gtattgtttg cctgtgcatt actgaagatc gccgtaaaca actcgatctg 240 ccaatgatgg tagaaaataa caccagcgcc tatggcaccg gttttaccgt gaccattgaa 300 gcagctgaag gtgtgactac cggtgtttct gccgctgacc gtattacgac cgttcgcgca 360 gcgattgccg atggcgcaaa accgtcagat ctgaatcgtc ctggccacgt tttcccactt 420 cgcgctcagg caggtggtgt actgacgcgt ggcggtcata ctgaagcaac tattgatctg 480 atgacgctgg caggctttaa accggctggt gtactgtgtg agctgactaa tgacgatggc 540 acgatggcgc gtgcaccaga gtgtattgag tttgccaata aacaaatat ggcgctcgtg 600 actattgaag acctggtggc ataccgtcag gcacatgagc gtaaagccag ctga 654 <210> 6 <211> 1181 <212> DNA <213> Unknown <220> <223> M. alcaliphilum 20Z ispC gene <400> 6 atgaaaggta tttgtatttt gggcgcgacc ggttctatcg gtgtcagcac gctggatgtg 60 gttgctcgcc attcgaatcg gtatagagtc gttgcgttga ccgcgaacaa taatatcgac 120 ctgctgtacg accaatgcat cgtccatcgt cctgactatg ttgtcgtggt tgatgaaaat 180 aaggctaaac aatttgcaga gcgcattgct acatcgccgg tatccgatat aaaggtgtta 240 tcgggagccg aatcgttgca gcaagtagct acactggata gtgttgattc ggtaatggcg 300 gcaatcgtcg gcgcggctgg tctattacca actttggcgg ctgctaaagc cggtaaaacc 360 gtattgctgg caaataaaga agcgttggtg atgtccggcg atatttttat gaaagcggtt 420 accgagtccg gtgcccattt gctgccgatc gatagcgagc ataatgccat ttttcaatgc 480 atgccggcag attactgtgc gggtcaagag gctaaggagg cgcggcgaat tttgttgact 540 gcctcgggtg gcccgttcag aactaagccg gtagaagagt tggtcgatgt cactccggat 600 caagccgtcg cgcatccgaa ttgggatatg gggcgtaaga tttctgtcga ttctgcgacg 660 atgatgaata aagggcttga attgattgaa gcctgtttat tgttcaatat gtcgccggat 720 aaaattcagg tggtgatcca tccgcaaagc gtgattcatt caatggtcga ttatgtcgac 780 ggcactgtgt tggcgcaaat gggtaacccc gatatgcgaa tacccattgc gcatgcgatg 840 gcgtggccgg aacgcttcga ctccggtgcg gcgccgctga atatattcga cgttaagcac 900 atggatttcg aacaacccga tcttcagcgt ttcccttgtt tacgcttggc gattgaagcc 960 gtcgaggcag gcggtattat gccggctgtg ttaaatgccg ctaatgaaat cgcggttgct 1020 gcctttttgg acgagaaagt ccgttttacc gacatccctt acattatga acggagcatg 1080 catcaattcg aagccgatcc ggcggatacg ctggatattg tattggcagc cgatagcaaa 1140 gcccgggaag tggctgagcg tatcgtcgaa gaacttaagg t 1181 <210> 7 <211> 20 <212> DNA <213> Unknown <220> <223> pAWP89-For <400> 7 tagttgtcgg gaagatgcgt 20 <210> 8 <211> 20 <212> DNA <213> Unknown <220> <223> pAWP89-Rev <400> 8 agctgtttcc tgtgtgaata 20 <210> 9 <211> 36 <212> DNA <213> Unknown <220> <223> agB.s-For <400> 9 ttcacacagg aaacagctat ggcgggtgtt tctgcg 36 <210> 10 <211> 27 <212> DNA <213> Unknown <220> <223> agB.s-Rev <400> 10 actcagatct tacagcggca gcggttc 27 <210> 11 <211> 36 <212> DNA <213> Unknown <220> <223> ispA-20Z-For <400> 11 ccgctgtaag atctgagtac ctctagaaaa taagga 36 <210> 12 <211> 38 <212> DNA <213> Unknown <220> <223> ispA-20Z-Rev <400> 12 gcatcttccc gacaactatt aatgatctcg ctggataa 38 <210> 13 <211> 53 <212> DNA <213> Unknown <220> <223> ribB-KpnI-For <400> 13 ctggtctgtt tgtggtacag gaaacagcta tgaatcagac gctactttcc tct 53 <210> 14 <211> 40 <212> DNA <213> Unknown <220> <223> ribB-KpnI-Rev <400> 14 cgtagatctt ctagaggtac tcagctggct ttacgctcat 40 <210> 15 <211> 20 <212> DNA <213> Unknown <220> <223> ribB-G108S-Rev <400> 15 ggcagaaacc gaggtagtca 20 <210> 16 <211> 20 <212> DNA <213> Unknown <220> <223> ribB-G108S-For <400> 16 tgactacctc ggtttctgcc 20 <210> 17 <211> 74 <212> DNA <213> Unknown <220> <223> ispG-For <400> 17 ttgcgcgtga tacgcgtaca gcaatagaga atataaacac taaggaggtc aaacatgtca 60 atcagcccaa gaaa 74 <210> 18 <211> 38 <212> DNA <213> Unknown <220> <223> ispG-Rev <400> 18 ccggtgagct cgcatgcact actgagctgt ggttccgt 38 <210> 19 <211> 82 <212> DNA <213> Unknown <220> <223> dxs-20Z-For <400> 19 gagatcatta atacgcgtac aatccccata tctcacaaaa tatataagga ggtcaacatg 60 aaaatcacag gaaatttccc cc 82 <210> 20 <211> 37 <212> DNA <213> Unknown <220> <223> dxs-20Z-Rev <400> 20 ccggtgagct cgcatgcatc acgcgcaaaa ttgctcg 37 <210> 21 <211> 49 <212> DNA <213> Unknown <220> <223> ribB-89-For <400> 21 cggaaccaca gccagtagag gaaacagcta tgaatcagac gctactttc 49 <210> 22 <211> 50 <212> DNA <213> Unknown <220> <223> ribB-DSAG-Rev <400> 22 accagcacta ccagcactac cagcactatc gctggcttta cgctcatgtg 50 <210> 23 <211> 53 <212> DNA <213> Unknown <220> <223> ispC-DSGA-For <400> 23 gatagtgctg gtagtgctgg tagtgctggt aaaggtattt gtattttggg cgc 53 <210> 24 <211> 41 <212> DNA <213> Unknown <220> <223> ispC-89-Rev <400> 24 gcatcttccc gacaactatt aacgcttaag ttcttcgacg a 41

Claims (10)

alpha-bisabolene synthaes (a-bisabolene synthaes, agBs) consisting of the nucleotide sequence of SEQ ID NO: 1 derived from fir trees ( Abies hrandis); Farnesyl diphosphate synthase (ispA) consisting of the nucleotide sequence of SEQ ID NO: 2; 1-deoxy-dexylulose-5-phosphate synthase consisting of the nucleotide sequence of SEQ ID NO: 3 (1-deoxy-Dxylulose-5-phosphate synthase: dxs); (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase ((E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase consisting of the nucleotide sequence of SEQ ID NO: 4; ispG); nDXP enzyme consisting of the nucleotide sequence of SEQ ID NO: 5 (RibB-G108S); And 1-deoxy-D-xylulose-5-phosphate reductase (1-deoxy-Dxylulos 5-phosphate reductase, ispC) coupled to the linker DSAGSAGSAG consisting of SEQ ID NO: 6; a gene encoding a gene is introduced or amplified , , alpha-bisabolene (α-bisabolene) transformed methanogenic bacterium Methylomicrobium alkaline phyllium 20Z (Methylomicrobium alcaliphilum 20Z) having a production ability. delete delete delete delete delete The methanogen of claim 1 or a culture solution thereof; And alpha-bisabolene (α-bisabolene) production composition comprising methane or methanol as a substrate. 8. The method of claim 7,
The composition is alpha-bisabolene (α-bisabolene) production composition, characterized in that it contains 1 to 50% by volume of methane or 0.1 to 1% by weight of methanol as a substrate. The method for producing alpha-bisabolene from a methane substrate by culturing the methanogen of claim 1 in a medium containing methane or methanol. 10. The method of claim 9,
The methane or methanol is a method of producing alpha-bisabolene (α-bisabolene) by adding 1 to 50% by volume of methane or 0.1 to 1% by weight of methanol to the culture medium.

Images