KR102330595B1 - Acid Resistant Yeast Inhibited Ethanol Production and Method for Preparing Lactic Acid Using The Same - Google Patents

Abstract

The present invention relates to an acid-resistant yeast that is endowed with lactic acid production ability and suppressed an ethanol production pathway, and a method for producing lactic acid using the same. By expressing efficiently, lactic acid can be produced in high yield even at low pH without growth degradation.

Description

Acid Resistant Yeast Inhibited Ethanol Production and Method for Preparing Lactic Acid Using The Same

The present invention relates to a method for producing lactic acid using an acid-resistant yeast in which the ethanol production pathway is suppressed, and more particularly, to an acid-resistant yeast with lactic acid production ability and suppressed ethanol production pathway, and a method for producing lactic acid using the same.

PLA (Polylacic Acid) is a biodegradable polymer made by converting lactic acid to lactide and ring-opening polymerization thereof, and its raw material, lactic acid, is produced through fermentation. PLA can be widely used in disposable food containers, and it has the strength to be used alone or in the form of a composition or copolymer for various industrial plastics including the automobile industry. In addition, recently, it is a representative polymer used in 3D printing, and it is an eco-friendly polymer that generates less harmful gas and odor when using a 3D printer. These biodegradable polymers are promising polymers that can solve the reality that environmental destruction is accelerating due to waste plastics and microplastics, which are recently becoming global problems. Efforts are being made to improve the productivity of the monomer lactic acid.

The traditional lactic acid production process is produced using lactic acid bacteria, and by the accumulation of lactic acid produced by the lactic acid bacteria, the pH is adjusted using various types of Ca salts or neutralizing agents such as ammonia to prevent strain death or growth stop by acid. Fermentation proceeds while adjusting to a neutral pH of 6-8. When fermentation is complete, microorganisms are separated, and since it is difficult to separate from water and convert lactide in salt form, sulfuric acid is added to convert lactate into lactic acid, while Ca salt is removed in the form _{of CaSO 4 .} In this process, a larger amount of by-product CaSO ₄ than lactic acid is generated, which lowers the economical efficiency of the process.

On the other hand, lactate has L-type and D-type optical isomers. In the case of lactic acid bacteria that mainly produce L-type, about 5 to 10% of D-type is produced together in many cases. There is a group of microorganisms having a lot of diversity, such as existing in the form of co-producing (Ellen I. Garvie, Microbiological Reviews , 106-139, 1980).

Among these optical isomeric lactates, type D was mainly used for medical/drug delivery, but when applied to PLA, a phenomenon was found that the crystallization rate by type D lactide increased and the thermal properties improved. When stereocomplex PLA is structurally formed according to the processing conditions in which pure D-type polymer is mixed, new polymers with higher heat resistance than PE/PP as well as conventional PLA are discovered. Research and commercialization of how to do this is rapidly progressing, and the field of application of PLA is expanding.

PLA produces lactic acid through fermentation, and then undergoes a purification process to convert it to lactide. For lactide conversion, a process of converting lactic acid to hydrogenated form is required, and since the pH in general neutral fermentation is 6-7, it is converted to acidic pH using a large amount of sulfuric acid. In this process, a large amount of neutral flame is generated, and the economical efficiency is lowered due to the low value of the neutral flame along with the process investment cost for removing the neutral flame.

On the other hand, in the case of Lactobacillus , which produces lactic acid in nature, in order to produce lactic acid with commercial performance, a large amount of expensive nutrients must be used as a medium. In the case of using as an intermediate, it greatly impedes the lactide conversion process, and in order to obtain a high-yield, high-purity polymer or its precursor, purification process costs such as adsorption, distillation, and ion exchange are required, which is also a cause of high production cost. do. In order to solve this problem, a study using yeast was proposed as a suggested method. In the case of yeast, it is known that growth/fermentation proceeds smoothly even with low-cost nutrients, and its resistance to acid is known to be high.

When lactic acid is produced using yeast that grows well in acid (hereinafter referred to as acid-resistant yeast), the fermentation process is simplified because there is no need to maintain the medium at pH 6-7 using a neutralizer during fermentation. The purification process is eliminated. In addition, since yeast makes many components necessary for metabolism by itself, it can be cultured in a medium with a relatively low nutrient level compared to bacteria, particularly Lactobacillus, so many downstream purification processes can be omitted, and production cost can be greatly reduced.

However, there is a prerequisite for the lactic acid production technology using yeast, which in order to be applied to commercialization, the yield, productivity, and the concentration of lactic acid, which are indicators of the fermentation performance of the strain, must be maintained at a high level similar to the performance of the lactic acid bacteria.

In addition, many literatures claim to develop an acid-resistant lactic acid technology using yeast, but in reality, there are cases where high-performance fermentation is performed only when the pH is maintained at 3.7 or higher, which is more than the pKa value of lactic acid, accompanied by a neutralization reaction in fermentation. Because there are many, it is difficult to express it as an actual acid-resistant technology, and it is difficult to see the effect of reducing production cost in the process (Michael Sauer et al., Biotechnology and Genetic Engineering Reviews , 27:229-256, 2010).

Therefore, acid-resistant yeast that can reduce process costs must be able to finish fermentation at the pH of the fermentation broth below the pKa value while not using a neutralizing agent or using a minimum amount, and commercial application is meaningful only when the three major fermentation indicators achieve a level similar to that of lactic acid bacteria. have.

Normal yeast metabolizes ethanol as the main product when fermenting glucose, and lactic acid is rarely produced. In addition, since the probability of selecting a lactic acid-producing strain from a microorganism having high acid resistance is very low, the present inventors first selected a yeast strain with excellent acid resistance, and the selected strain was genetically engineered to have lactic acid-producing ability. In addition, all ethanol-producing strains were selected from the actually selected acid-resistant strain library.

The production metabolic cycle of lactic acid consists of a one-step reaction in pyruvate, which is generated by the lactate dehydrogenase enzyme and is then released out of the cell by active/diffusion through transport. In order to ferment such lactic acid as the main product, it is necessary to introduce the lactic acid production capacity and at the same time be accompanied by an operation to remove the existing ethanol production capacity. In general, the conversion of pyruvate to ethanol in yeast proceeds in a two-step reaction through acetaldehyde, and the general method is to remove the PDC gene that converts pyruvate to acetaldehyde and introduce LDH.

However, in the case of Crab-tree-positive yeast such as Saccharomyces cerevisiae, when PDC (pyruvate decarboxylase) is completely blocked, the supply of cytosolic acetyl-CoA required for lipid synthesis in cells does not proceed, and growth is greatly inhibited. If PDC is not completely blocked, ethanol production cannot be completely blocked by competition for the same substrate as LDH and pyruvate, and thus the yield cannot be increased to the level of lactic acid bacteria.

Accordingly, the present inventors selected an acid-resistant yeast and made diligent efforts to impart lactic acid-producing ability to the yeast. As a result, the ADH gene of the ethanol production metabolic pathway in the acid-resistant yeast is replaced with the LDH gene of the lactic acid production metabolic pathway. It was confirmed that the expression of LDH was significantly increased, and the ability to produce lactic acid was increased, and the present invention was completed.

SUMMARY OF THE INVENTION It is an object of the present invention to provide a recombinant acid-tolerant yeast having suppressed ethanol production and high lactic acid production ability.

Another object of the present invention is to provide a method for producing lactic acid using the recombinant acid-resistant yeast.

In order to achieve the above object, the present invention provides a recombinant strain having lactic acid-producing ability in which the g4423 gene is deleted or attenuated in the acid-resistant yeast YBC strain (KCTC13508BP) and a lactate dehydrogenase-encoding gene is introduced.

The present invention also comprises the steps of (a) culturing the recombinant strain to produce lactic acid; And (b) provides a method for producing lactic acid comprising the step of obtaining the produced lactic acid.

The present invention also provides a gene construct in which a promoter represented by the nucleotide sequence of SEQ ID NO: 2 and a gene encoding lactate dehydrogenase are operably linked, and a recombinant vector comprising the construct.

The present invention also provides a recombinant microorganism into which the gene construct or the recombinant vector is introduced.

The present invention also comprises the steps of (a) culturing the recombinant microorganism to produce lactic acid; And (b) provides a method for producing lactic acid comprising the step of obtaining the produced lactic acid.

According to the present invention, it is possible to effectively inhibit the production of ethanol in acid-resistant yeast, and to express the LDH enzyme with strong expression and high efficiency, so that lactic acid can be produced in a high yield without deterioration of growth even at low pH.

1 shows the result of comparing the resistance to lactic acid of the previously known S. cerevisiae strain and the YBC strain, which is an acid-resistant strain used in the present invention.
Figure 2 shows the results of confirming the expression level of the ADH candidate gene in the YBC strain.
3 shows the results of confirming the ethanol-producing ability of the wild-type YBC strain and the G4423 knockout strain.
4 is an example of a gene cassette for expressing LDH for each allele or removing a target gene. (a) is a cassette expressing LDH on allele1 of g4423, (b) is a cassette expressing LDH on allele2 of g4423, and (c) is an example of a cassette for removing a target gene.
5 shows the results of confirming the lactic acid production performance of the YBC recombinant strain introduced with LDH derived from three strains.
6 shows the results of confirming the lactic acid production ability of the recombinant strain in which 2 copies of the LDH gene was introduced into the locus of the g4423 gene of the YBC strain.
Figure 7 shows the results of comparing the lactic acid production ability for each pH of the recombinant strain in which 2 copies of the LDH gene was introduced into the locus of the g4423 gene of the YBC strain.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is those well known and commonly used in the art.

Acid-resistant yeast consumes sugar at a fast rate even at acidic pH, exhibits a high growth rate, and converts consumed sugar into a product under fermentation conditions. In the present invention, yeast having these characteristics was selected through several yeast libraries, and the selected strains showed high growth potential and sugar consumption rate even under conditions where the lactic acid concentration was 40 g/L to 80 g/L. Metabolic circuit regulation using genetic engineering was performed on these selected strains.

As mentioned above, many researchers have conducted research on reducing ethanol by removing the pyruvatae decarboxylase enzyme, which is a competitive reaction in pyruvate. (US7534597, US7141410B2, US9353388B2, JP4692173B2, JP2001-204464A, JP4095889B2, KR1686900B1). The effect of ethanol reduction by the removal of PDC is very direct and effective, but in the case of yeast, the removal of PDC has a serious side effect. larger (Yiming Zhang, et al. , Microbial Cell Factory, 14:116, 2015). Acetyl-CoA, an important metabolite in yeast, is supplied by the Pdh enzyme in mitochondria, but acetaldehyde is produced from sugar in the cytoplasm through the PDC pathway in metabolism. Therefore, when the PDC gene is removed, the supply of acetyl-CoA in the cytoplasm is stopped and, thereby, fatty acid production is stopped, causing cell growth inhibition, and respiration-related genes by glucose are suppressed, thereby weakening the TCA cycle in mitochondria. In the -tree positive strain, this phenomenon is greatly enhanced. This cytoplasmic acetyl-CoA can be supplied by other side reaction pathways, but due to severe growth inhibition, it leads to inhibition of the production rate of fermentation products, thereby losing its value as a commercial strain. For these side effects, strains with enhanced indirect acetyl-CoA supply circuits should be created through mutation/evolution, but this evolution requires a long-term study, and the effects may be different for each strain, and the exact mechanism is not known.

An alternative approach is to block the conversion of ethanol from acetaldehyde by blocking ADH as the next step in PDC. In this ADH blocking method, there is no growth inhibition due to insufficient supply of cytoplasmic acetyl-CoA, but by blocking ADH, acetaldehyde, a precursor and toxic substance of ethanol, is accumulated and growth is inhibited. Accumulation of acetaldehyde due to the blockade of ADH can be eliminated by introducing the lactate metabolic pathway to be strongly expressed. Since lactate metabolism is converted from pyruvate, which is an upstream reactant of acetaldehyde, the flux to PDC and ADH naturally decreases as this pathway is strengthened. . Against this background, the present invention has developed a yeast strain that increases lactate production while blocking ADH.

Accordingly, in one aspect, the present invention relates to a recombinant strain having lactic acid-producing ability into which the g4423 gene is deleted or attenuated in the acid-resistant yeast YBC strain (KCTC13508BP), and a lactate dehydrogenase-encoding gene is introduced.

The ethanol production ability of yeast is very strong, and especially in the case of yeast with Crab tree effect, if the sugar concentration is high, ethanol is produced even in the presence of oxygen and sugar is consumed. This strong ethanol-producing ability is possible due to the high activity of the enzyme and the action of a promoter that strongly expresses it. Therefore, in order to change this ethanol-producing ability into lactate-producing ability, a strong promoter must be used together with a strong LDH enzyme. To this end, the present inventors conducted a study to increase the expression amount by using various previously known promoters of Saccharomyces cerevisiae , but could not secure a promoter showing the desired expression amount. In general, promoters have a variety of regulatory mechanisms and are therefore often specialized for each strain. Therefore, in the present invention, the expression amount of the glycolysis and ethanol production gene of the YBC strain (KCTC13508BP), which is the target strain, is checked, and the most strongly expressed The g4423 gene was identified as the ADH gene. If the identified ADH gene (g4423 gene) is replaced with an LDH gene with strong activity and then expressed through the g4423 promoter, it was thought that the ethanol production flux of the YBC strain could be replaced with the lactate production flux. In addition, the LDH gene introduced into the YBC strain must also have strong enzyme activity, but it must have good selectivity for pyruvate because it has to compete with the PDC gene in the YBC strain for pyruvate as a substrate (Km Value is should be low). However, when measuring Km value in vitro , it is preferable to judge the selectivity of LDH based on the in vivo result because the difference in values depending on the measurement conditions is large. Therefore, it is necessary to select the LDH gene that produces lactate well through high activity and low Km value. By comparison, the optimal gene was selected.

In the present invention, the gene encoding the lactate dehydrogenase may be introduced so as to be regulated by the promoter (SEQ ID NO: 3 or SEQ ID NO: 4) of the g4423 gene.

In the present invention, the gene encoding the lactate dehydrogenase may be derived from Lactobacillus plantarum, and may be characterized as a gene encoding the amino acid sequence represented by SEQ ID NO: 1.

In the present invention, the parent strain YBC strain (KCTC13508BP) by deletion or attenuation of the g4423 gene It may be characterized in that the ethanol production capacity is further reduced.

In one aspect of the present invention, 57.1 g/L of lactate was produced in a recombinant strain of YBC in which the LDH-derived Lactobacillus plantarum was inserted by replacing the g4423 gene.

Therefore, in another aspect, the present invention comprises the steps of (a) culturing the recombinant strain to produce lactic acid; And (b) relates to a method for producing lactic acid comprising the step of obtaining the produced lactic acid.

Through the present invention, it is possible to secure an excellent acid-resistant strain in which lactate production is greatly increased and ethanol production is greatly reduced.

In another aspect, the present invention provides a gene construct in which a promoter represented by the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 4 and a gene encoding lactate dehydrogenase are operably linked, and a recombinant vector comprising the construct is about

In the present invention, the genetic construct may be characterized in that it further comprises a terminator represented by the nucleotide sequence of SEQ ID NO: 5 or SEQ ID NO: 6.

In the present invention, the gene encoding the lactate dehydrogenase may be characterized as a gene encoding the amino acid sequence shown in SEQ ID NO: 1.

In another aspect, the present invention is a recombinant microorganism into which the gene construct or the recombinant vector is introduced, and (a) culturing the recombinant microorganism to produce lactic acid; And (b) relates to a method for producing lactic acid comprising the step of obtaining the produced lactic acid.

The g4423 promoter preferably has at least 90%, at least 92%, at least 93%, at least 95%, at least 97%, at least 98%, at least 99% or 100% sequence homology with the sequence of SEQ ID NO: 3 or SEQ ID NO: 4. It may have a sequence representing

If it has 90% or more homology with the g4423 promoter of the present invention and exhibits an equivalent level of expression efficiency, it can be said to be a substantially equivalent promoter.

In some cases, the g4423 promoter according to the present invention may be mutated by applying a technique known in the art to increase the expression efficiency of the target gene.

In the present invention, the recombinant yeast may be characterized in that it has acid resistance, and in order to produce an acid-resistant recombinant yeast suitable for the present invention, it is preferable to use a host yeast having acid resistance to an organic acid.

The acid-resistant yeast may be a yeast having acid resistance selected from the group consisting of the genus Saccharomyces, Saccharomyces Saccharomyces and Candida, for example, Saccharomyces cerevisiae ( Saccharomyces cerevisiae ), Cassac Stania exigua ( Kazachstania exigua ), Kazachstania bulderi ( Kazakhstania bulderi ), and Candida humilis may be characterized as selected from the group consisting of, but is not limited thereto.

'Acid-resistant yeast' refers to yeast having resistance to organic acids such as 3-HP or lactic acid, and acid resistance can be confirmed by evaluating growth in a medium containing various concentrations of organic acids. That is, 'acid-resistant yeast' refers to a yeast that exhibits a higher growth rate and biomass consumption rate than general yeast in a medium containing a high concentration of organic acid.

In the present invention, 'acid-resistant yeast' means at least 10% of organic acid (especially lactic acid) in the medium at a pH less than the pKa value of the organic acid, compared to the case where the medium does not contain organic acid. It is defined as a yeast capable of maintaining a mass consumption rate (such as a sugar consumption rate) or a specific growth rate of at least 10%. More specifically, in the present invention, 'acid-resistant yeast' refers to yeast that can maintain a biomass consumption rate (sugar consumption rate, etc.) of at least 10% or a specific growth rate of at least 10% at pH 2-4 compared to the case of pH 7. define.

The recombinant yeast according to the present invention can be produced by inserting the gene into the chromosome of the host yeast according to a conventional method, or by introducing a vector including the gene into the host yeast.

As the host yeast, host cells with high DNA introduction efficiency and high expression efficiency of the introduced DNA are commonly used. Any type of yeast may be used as long as it can be expressed.

The recombinant yeast can be prepared according to any transformation method. "Transformation" refers to a phenomenon in which DNA is introduced into a host and DNA can be replicated as a factor of chromosomes or by chromosomal integration completion. The conversion method includes an electroporation method, a lithium acetate-PEG method, and the like.

In addition, as a method of inserting a gene into the chromosome of a host microorganism in the present invention, any conventionally known genetic manipulation method may be used, for example, retroviral vector, adenoviral vector, adeno-associated viral vector, herpes simplex. There is a method using a rex virus vector, a pox virus vector, a lentiviral vector, a non-viral vector, and the like. "Vector" means a DNA preparation containing a DNA sequence operably linked to suitable regulatory sequences capable of expressing the DNA in a suitable host. A vector can be a plasmid, a phage particle or simply a potential genomic insert. Upon transformation into an appropriate host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Plasmid is the most commonly used form of the current vector, and Linearized DNA is also a form commonly used for genome integration of yeast.

Typical plasmid vectors include (a) an origin of replication that allows efficient replication to include a plasmid vector per host cell, and (b) an antibiotic resistance gene or auxotrophic marker that allows selection of host cells transformed with the plasmid vector. It has a structure including an auxotrophic marker gene and (c) a restriction enzyme cleavage site that allows a foreign DNA fragment to be inserted. Even if an appropriate restriction enzyme cleavage site does not exist, the vector and foreign DNA can be easily ligated by using a synthetic oligonucleotide adapter or linker according to a conventional method.

In addition, the gene is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. It can be a gene and regulatory sequence(s) linked in such a way as to enable gene expression when an appropriate molecule (eg, a transcriptional activation protein) is bound to the regulatory sequence(s). For example, DNA for a pre-sequence or secretory leader is operably linked to DNA for a polypeptide when expressed as a preprotein that participates in secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or the ribosome binding site is operably linked to a coding sequence if it affects transcription of the sequence; or the ribosome binding site is operably linked to a coding sequence when positioned to facilitate translation.

In general, "operably linked" means that the linked DNA sequences are in contact and, in the case of a secretory leader, in contact and in reading frame. However, the enhancer does not need to be in contact. The ligation of these sequences is accomplished by ligation (ligation) at convenient restriction enzyme sites. When such a site does not exist, a synthetic oligonucleotide adapter or linker according to a conventional method is used.

Of course, not all vectors function equally well in expressing the DNA sequences of the present invention, and likewise not all hosts function equally for the same expression system. However, those skilled in the art can apply it by appropriately selecting from among other vectors, expression control sequences and hosts without departing from the scope of the present invention without undue experimental burden. For example, in selecting a vector, the host must be taken into account, since the vector must be replicated therein, the number of copies of the vector, its ability to control the number of copies, and other proteins encoded by the vector, e.g. For example, expression of antibiotic markers should also be considered.

In the present invention, the carbon source may be one or more selected from the group consisting of glucose, xylose, arabinose, sucrose, fructose, cellulose, galactose, glucose oligomer and glycerol, but is not limited thereto.

In the present invention, the culture may be performed under conditions such that microorganisms, for example, E. coli, do not function any more (eg, metabolite production is impossible). For example, the culture may be characterized in pH 1.0 to 6.5, preferably pH 1.0 to 6.0, more preferably 2.6 to 4.0, but is not limited thereto.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.

Example 1: Selection and effect of acid-resistant strain YBC

The present inventors have selected a strain group having acid resistance through tests on various yeast strains (Korean Patent Publication No. 2017-0025315). With respect to the selected yeast, lactic acid was added to the medium at the beginning of the culture to check the growth and sugar consumption rate of microorganisms, and the strain with the best acid resistance was selected. At this time, the inoculation OD was 4, the medium was YP medium (20g/L Peptone, 10g/L yeast extract), and 3.5% glucose was used. The experiment was conducted with 50ml flask culture at 30℃, 100rpm conditions, and the lactic acid concentration was It was cultured at an initial 60 g/L. The results were compared and analyzed to select the YBC strain, which has the best acid resistance, and deposited it as (KCTC13508BP) at the Korea Research Institute of Bioscience and Biotechnology (KCTC13508BP) as of April 11, 2018.

Through phylogenetic analysis, it was confirmed that the YBC strain is a strain similar to S. cerevisiae , has diploid genes (Diploid), and has a Crab-tree positive characteristic.

In order to confirm the acid resistance of the selected acid-resistant YBC strain, S. cerevisiae (CEN.PK 113-7D) was cultured under the same conditions as the strain. Followed by the addition of lactic acid of 30g / L and 60g / L, respectively in YP medium of the glucose concentration of 40g / L 30 ℃, and incubated between 50 o'clock at 200rpm, was compared to the OD value of the culture, as shown in Figure 1, In the case of the YBC strain, it can be confirmed that growth is possible even in a high concentration of lactic acid of 60 g/L, whereas the S. cerevisiae CEN.PK strain does not grow at all at a concentration of lactic acid of 60 g/L.

Example 2: Confirmation of the main expression gene by confirming the expression rate of the alcohol-producing gene in the YBC strain

In this example, in order to select a gene with high effect without affecting growth when replacing the corresponding gene with strong expression for glycolysis and ethanol production-related genes that are strongly expressed in the presence of glucose in the YBC strain, the ADH gene was targeted. In particular, in order not to directly affect the growth of microorganisms, genes related to the glycolysis process should be avoided. This is because if the genes related to the glycolysis process are deleted or weakened, the production of pyruvate, which is important for the growth of microorganisms, is suppressed or the balance of the chain reaction is caused. This is because it affects the growth of Therefore, as an endogenous gene for gene replacement, when the target strain is an ethanol-producing strain, either the PDC gene or the ADH gene is selected. Considering the negative effect of PDC knockout (K/O), ADH is selected and removed was selected to do.

In strains with strong ethanol fermenting ability such as yeast, ADHs with various strengths and roles exist. Among the ADHs of YBC strains, the main ADH responsible for ethanol production is identified and YBC's genomic information is used to use the promoter. and S. cerevisiae by comparing known ADH gene information, several candidate genes were selected, and qPCR was performed on them.

Seven ADH gene candidates present in the genome of YBC strain were selected using S. cerevisiae and Bioinformatics information from Genome Full Sequencing Data, and RT-qPCR was performed by designing an oligomer specific for the selected gene.

Seven ADH gene candidates were selected from the genome-wide sequence data of S. cerevisiae using bioinformatics information (Table 1), and oligomers specific to the selected gene were designed (Table 2), and RT-qPCR was performed.

S. cerevisiae gene Homolog in YBC Identity-%
(protein) Genomic location* Targetingsignal ADH1 g4423 89.1% ADH5 no ADH2 g4423 77.2% ADH5 no ADH3 g2289 80.4% ADH3 mitochondrial ADH4 No homologs ADH5 g4423 74.4% ADH5 no SFA1 g4117 79.5% SFA1 ADH6 g5126 63.4% - no g1044 64.1% - no g4395 64.0% - no g727 63.7% - no g2807 60.4% - no ADH7 g5126 63.0% - no g1044 60.0% - no g4395 61.8% - no g727 62.1% - no g2807 58.0% - no

* A gene with a similar gene sequence in YBC compared to the S. cerevisiae genome

Primers for qPCR name SEQ ID NO: Sequence Explanation oSK-1318 11 CGGACTTTAGAGCCTTGTAGAC g4423 qPCR fwd oSK-1319 12 ATCTGGTTACACTCACGATGG g4423 qPCR rev oSK-1320 13 CCAAGTACGTTAGAGCTAACGG g4423 qPCR 2 fwd oSK-1321 14 GAGCTTCTCTGGTATCAGCT g4423 qPCR 2 rev oSK-1322 15 AGCTTTAGCAAACATTAGACCC g1044 qPCR fwd oSK-1323 16 ATTCCATCCGAATATGCTGGT g1044 qPCR rev oSK-1324 17 GGAACCTAAATGACTGTTGGCA g1044 qPCR 2 fwd oSK-1325 18 AGGATGTTGATTTCGACTCGT g1044 qPCR 2 rev oSK-1326 19 TTCCAAAGGGTACCAATTTAGCTG g2289 qPCR fwd oSK-1327 20 GTACCGCTAATGAACCTAAACCA g2289 qPCR rev oSK-1328 21 AGAGTGACACTAGAGAGAGCC g2289 qPCR 2 fwd oSK-1329 22 GATGTGTCTACGACGTATCTACC g2289 qPCR 2 rev oSK-1330 23 GTACTGGTAACGTCCAAGTC g4117 qPCR fwd oSK-1331 24 GAACCCTTCCATACTCTACCA g4117 qPCR rev oSK-1332 25 TTCAGTTCGTGCTACTCAAGG g4117 qPCR 2 fwd oSK-1333 26 TCAATTGCAACGACAGAGAC g4117 qPCR 2 rev oSK-1334 27 CCGTACCCTGAAGGTTTACTG g2807 qPCR fwd oSK-1335 28 CAACCATAGATTCACGAATTGCTC g2807 qPCR rev oSK-1336 29 AGTGGATTTGGATTAATGGGTG g2807 qPCR 2 fwd oSK-1337 30 GCTTCTGTAACACCTTTAACAC g2807 qPCR 2 rev oSK-1338 31 AAATTGGTGACCGTGTTGGT g727 qPCR fwd oSK-1339 32 AACCACCTTTACTACGGTAACCA g727 qPCR rev oSK-1340 33 TTTAGTCGTCATCTGTTCAGGT g727 qPCR 2 fwd oSK-1341 34 GAGACACCTAACAAACCAAATGG g727 qPCR 2 rev oSK-1342 35 GATTCAAGCTTCTTCTCGTATCGG g3610 qPCR fwd (ALG9 homolog) oSK-1343 36 GGAATGATACCATTCACGACCT g3610 qPCR rev (ALG9 homolog) oSK-1350 37 GTTCCGTCAAAGAAATCAAGCA g5126 qPCR fwd oSK-1351 38 TGGTAAACCTGTATCTGACATCAC g5126 qPCR rev oSK-1352 39 TTTAGTTGTCATTTGTGCCGGT g5126 qPCR 2 fwd oSK-1353 40 GACACCTAACAAACCAAACGGA g5126 qPCR 2 rev oSK-1386 41 CTTTGAGTGCAAGTATCGCC ALG9 qPCR fwd oSK-1387 42 TGTGTAATTGTTCACCAAAGCC ALG9 qPCRrev

As a result, as shown in FIG. 2 , the expression level of the g4423 gene was significantly high, and g4423 was confirmed as the main ethanol-producing gene.

Example 3: Confirmation of ethanol production lowering effect by removing g4423 from YBC strain

A recombinant strain in which g4423, the main ADH of the YBC strain identified in Example 2, was knocked out was prepared, and the effect of ADH removal on the growth of the strain was confirmed.

Based on the information of g4423 and UTR, a gene cassette similar to FIG. 4(c) with the g4423 ORF removed and 5' and 3' UTRs and antibiotic markers was prepared and used as donor DNA. For the production of donor DNA, the cloning method using restriction enzymes and the method using Gibson assembly were used as described above. Using the primer for ORF (Primer forward ( SEQ ID NO: 43): GAGATAGCACACCATTCACCA, Primer reverse (SEQ ID NO: 44): CAACGTTAAGTACTCTGGTGTTTG) for introducing the prepared Donor DNA and confirming g4423 against the colonies grown on the plate corresponding to the marker gene It was confirmed that the ORF was removed.

150ml of the prepared g4423 knockout strain was cultured in YP medium having a glucose concentration of 40g/L and cultured at 30°C and 200rpm.

As a result, as shown in FIG. 3, it can be seen that the g4423 knockout strain (B in FIG. 3) has a significantly reduced ethanol production ability compared to the wild-type YBC strain (A in FIG. 3), and NADH oxidation according to the weakening of ADH activity The reaction was limited, and the glucose uptake ability was reduced, and thus the growth was reduced and glycerol production was increased to compensate for this.

Example 4: Expression of known LDH gene using g4423 promoter and selection of optimal LDH

Candidate genes for the LDH gene to be introduced into the YBC strain were selected through the literature (N. Ishida et. al. , Appl. Environ. Micobiol. , 1964-1970, 2005; M. Sauer et al., Biotechnology and Genetic Engineering Reviews). , 27:1, 229-256, 2010), L. helveticus- derived LDH gene, R. oryzae- derived LDH gene, and L. plantarum- derived LDH gene were selected for a total of three genes.

For the gene of each enzyme, LDH, which has good expression level and produces lactate well when expressed in yeast, was selected in the above literature, and the performance difference at general pH is smaller than pH > pKa in acidic conditions where pH < pKa is possible. The enzyme was selected. In addition, genes that do not require Fructose-1,6-diphosphate as a coenzyme other than NADH were selected. Regarding the Km value of the gene, it can be compared in many literatures, and the Km value is relatively low, so the one that can make a lot of flux when competing with the PDC enzyme inside YBC was selected. However, in the case of Km value, when measured in-vitro, the value changes depending on media, substate concentration, coenzyme concentration, etc., so the actual performance should be confirmed with the result of direct fermentation within each strain.

Therefore, each of the three selected genes was introduced into the YBC strain to prepare a recombinant strain using the g4423 promoter, and the lactic acid-producing ability of each recombinant strain was confirmed.

Based on the information of g4423 and UTR, the g4423 ORF was removed and the gene cassette of FIG. 4(a) with 5' and 3' UTR and antibiotic markers was prepared. The sequence optimized by usage (with the gene sequence of SEQ ID NOs: 2, 8, and 10 and the amino acid sequence of SEQ ID NOs: 1, 7 and 9, each Lactobacillus plantarum, Lactobacillus helveticus, Rhizopus oryzae After synthesizing LDH of introduced.

Primer forward ORF inside (SEQ ID NO: 45): CAACGTTAAGTACTCTGGTGTTTG, Primer reverse ORF inside (SEQ ID NO: 46): GAGATAGCACACCATTCACCA, Primer forward ORF outside (SEQ ID NO: 47) 5': GGATTCCTGTAATGACAACGCGAG, Primer reverse ORF outside (SEQ ID NO: 48) 3': TGGATACATTACAGATTCTCTATCCT) The presence of the ORF of each LDH was introduced in 1 copy using the following primers confirmed that it was.

L. helveticus Primer forward (SEQ ID NO: 49): ATGAAAATTTTTGCTTATGG

L. helveticus Primer reverse (SEQ ID NO: 50): TTAATATTCAACAGCAATAG;

R. oryzae Primer forward (SEQ ID NO: 51): ATGGTTTTGCATTCTAAAGT

R. oryzae Primer reverse (SEQ ID NO: 52): TTAACAAGAAGATTTAGAAA

L. plantarum Primer forward (SEQ ID NO: 53): ATGTCTTCTATGCCAAATCA

L. plantarum Primer reverse (SEQ ID NO: 54): TTATTTATTTTCCAATTCAG

Since the YBC strain is a Diploid strain, even when one LDH gene is inserted, the other g4423 gene is operating, and accordingly, the amount of ethanol production is not reduced as much as in the completely knocked out (K/O) strain.

The prepared recombinant strain was cultured with shaking at 30° C./100 rpm for 24 hours in a flask in which 4% glucose and 150 mg/L Uracil were added to YP medium.

Lactate and ethanol in the culture medium were confirmed through HPLC. Glucose, ethanol, and L-lactate concentrations in the culture were analyzed by attaching a Bio-Rad Aminex 87-H column to a Waters 1525 binary HPLC pump. Glucose and ethanol were analyzed using a Waters 2414 Refractive Index detector, and L-lactate was analyzed using a Waters 2489 UV/Visible Detector (210 nm). The concentration was calculated by writing it, and the specific analysis conditions are as follows.

1. Mobile Phase Condition: 0.005M H2SO4 solution

2. Flow rate: 0.6 mL/min

3. Run time: 40 min

4. Column Oven temperature: 60ㅀC

5. Detector temperature: 40ㅀC

6. Injection volume: 10 μL

7. Auto sampler tray temperature: 4ㅀC

As a result, as shown in FIG. 5 and Table 3, it was confirmed that all of the substituted target genes exhibit LDH activity, and the strain into which the LDH gene derived from L. plantarum was introduced showed the highest lactic acid production ability.

Table 3 shows the literature-reported Km values of the corresponding LDHs. However, this number can only be used as a comparison between enzymes tested under the same conditions and has no absolute meaning. Even in this experiment, the Km value was relatively high It was confirmed that LDH expressed from a gene derived from L. plantarum competed with the PDC gene in the strain to produce lactate well. In addition, through the above results, it was confirmed that the gene exhibiting the highest lactic acid production ability while competing with PDC in the acid-resistant strain YBC was the LDH gene derived from L. plantarum.

L-LDH L. helveticus R. oryzae L. plantarum Km value of enzyme 0.25① 1.3~4.8② 4.3③ Lactate (g/L) 2.3 0.8 6.0

① Kirsi savijoki and Airi Palva, Applied and Environmental Microbiology, 2850-2856, 1997

② Christopher DS et al ., Enzyme and Microbial Technology 44(2009) 242-247, 2009

③ Anna Feldman-Salit et al., The Journal of Biological Chemistry, 288, 21295-21306. 2013

Example 5: Using the selected LDH to block ethanol production and confirm the lactate production ability

A recombinant strain was prepared in which 2 copies of the LDH gene derived from L. plantarum selected in Example 4 were introduced into the locus of the g4423 gene of the YBC strain, and the lactic acid production ability was confirmed.

The YBC strain is dipoloid and contains diploid genes. The present inventors completed the donor DNA having different antibiotic resistance genes as shown in FIGS. 4 (a) and (b) for each allele by the production method of Example 4, and then introduced into the YBC strain twice for each Allele. did. Thereafter, it was confirmed that the g4423 ORF was completely removed using the ORF Primer of g4423, and it was confirmed that 2 copies of the gene were introduced as each antibiotic resistance gene was present. If there is an antibiotic resistance gene, future genetic manipulation is not possible, so each antibiotic was removed using the Cre-loxP method introduced into the cassette.

Lactic acid production ability was confirmed in the fermenter using the recombinant strain. As a medium, Hestrin and Schramme medium (Glucose 120g/L, Peptone 5g/L, Yeast extract 5g/L, citric acid 1.15 g/L, K2HPO4 2.7g/L, MgSO4 7H2O 1g/L) was used, and the volume of 1L was fermenter. was cultured at a sugar concentration of 120 g/L. The culture temperature was 30° C., and the pH was adjusted to 3 and maintained at a level of 350 to 450 rpm.

As a result, as shown in FIG. 6, growth inhibition by acetaldehyde, which is generally seen in the strain from which ADH has been removed, was not confirmed, and no increase in glycerol production was observed, so the oxidation of NADH by the newly expressed LDH enzyme was well It can be confirmed that the internal redox balance is well balanced. In addition, when additional LDH is expressed, the oxidation rate of NADH is further accelerated, and it is considered that lactate productivity and concentration can be further increased.

The above result is a significant advance compared to the result using the known ADH blockade and related LDH expression (Kenro Tokuhiro et al., Applied Microbiology and Biotechnology , 82:883-890, 2009). First, it can be seen that even though ethanol production is greatly reduced, sugar is smoothly consumed and converted to lactate, and the low level of glycerol shows that the oxidation reaction of NADH is faithfully performed by the strongly expressed LDH, and the culture medium From the OD value of , it was confirmed that the acid resistance by lactic acid was maintained, and the toxic effect of acetaldehyde, an intermediate product, was very small according to the ethanol blockade. These performance indicators also show that when converting to lactate by further blocking ethanol production, the three major indicators of yield, concentration, and fermentation rate will smoothly increase, thereby achieving the goal of developing a strain that can be used commercially. .

To explain in more detail using the existing technology as an example, as described above, when ADH is blocked, ethanol production can be reduced, but in proportion to the decrease, acetaldehyde, a precursor of pyruvate and ethanol, accumulates and toxicity to cells tends to increase. There is this. In addition, when ADH is blocked, the oxidation reaction of NADH generated through ADH is inhibited, resulting in a severe reduction in the rate of sugar consumption and an increase in the production of glycerol, another reducing material, to solve this, which leads to a decrease in the productivity of lactic acid and an increase in by-products. . In this case, when LDH is effectively expressed, this phenomenon is reduced due to the oxidation of NADH by LDH. However, since the Km value of LDH competes with the PDC enzyme in the cell, lactate can be produced smoothly and a sufficient amount of the enzyme is strongly expressed. Only then can NADH be oxidized to the extent that it does not inhibit the rate of sugar consumption and growth inhibition, and the problem caused by blocking ADH can be solved. Existing technologies were difficult to solve this problem, and they tried to alleviate this by operating the TCA cycle through strong aeration to promote the oxidation of NADH, but it was difficult to completely solve the problem of reducing the rate of sugar consumption.

Relevant examples are shown in Tables 4 and 5 below.

When LDH is expressed in a strain in which major ADH is blocked (Adh1(pLdhA68X)), it can be seen that the yield, productivity and concentration show significantly lower values. Therefore, strong expression of LDH in the existing technology and ADH blocking in case of not selecting an appropriate LDH You can see the difficulty of lactate production through In addition, it is more difficult to implement this technology in an acid-resistant strain to smoothly produce lactic acid at low pH.

As a comparison group, when LDH was expressed as an ADH1 promoter in a strain in which ADH was not blocked, it was found that lactate production and strain growth due to LDH were well (ethanol production decreased due to competition between Ldh and PDC). It can be seen that the above negative effects are caused by blocking ADH. However, it is a self-evident fact that in the strain in which ethanol is not blocked in this way, further yield improvement is impossible due to the yield competition between lactate and ethanol from pyruvate.

In addition, for reference, a study was also attached to express LDH in a strain in which the activity of PDC remains at a level of 2% compared to that of the wild-type strain to produce lactic acid while LDH is responsible for the oxidation of NADH. The corresponding strain (YSH 4.123.-1C(pLdhA68X)) left 2% of PDC activity compared to the wild type for the supply of cytoplasmic acetyl-CoA as described above. Due to this, it was confirmed that ethanol is being produced at 10 g/L, and this value has a yield loss of 10/92X90.08/46.07 = 0.21 based on lactic acid production. PDC activity control using this knock down It can be seen that it is difficult to block the production of ethanol during the production of lactic acid. In addition, it is a well-known fact that, when PDC activity is completely removed, there is a serious inhibition of cell growth due to restriction of the supply of cytosolic acetyl coA as reported in the literature.

strains and plasmids strain Description YBC-001 YBC wt YBC-Ldh1 YBC Δg4423::ldh InvSc1 Saccharomyces cerevisiae , Diploid, Matα, his3Δ1, leu2, trp1-289, ura3-52 (Invitrogen Corp)
- Adh is intact Adh1 Saccharomyces cerevisiae , Haploid, Matα, can1-100, ade2-1, lys2-1, ura3-52, leu2-3/112, trp1- Δ901, adh1-0 (Institut fur Mikrobiologie, Frankfurt am Main) YSH 4.123.-1C Saccharomyces cerevisiae , Haploid, Matα, leu2-3/112, trp1-92, tra3-52, pdc1-14 (Gφteborg University): PDC activity remained 2% pLdhA68X Plasmid containing R. oryzae LDH in S. cerevisiae Adh1 promoter

Lactate-producing ability of strains Lactic acid (g/L) Yield (g/g) Productivity (g/L/hr) Reference InvSc1 (pLdhA68X) 38.0 0.445 1.2 Christopher D. Skory, J. Ind Microbiol Biotechnol (2003) 30:22-27: Under the condition of pH > pKa, the lactic acid yield is further reduced when the pH is lowered. Adh1 (pLdhA68X) 17.0 0.17 0.25 same as above YSH 4.123.-1C (pLdhA68X) 31.0 0.336 0.72 same as above YBC-LDH1 57.1 0.53 1.78 the present invention

Through the present invention, it was possible to secure an excellent acid-resistant strain in which lactate production was greatly increased and ethanol production was greatly reduced.

In order to confirm the acid resistance of the recombinant strain of the present invention, the pH conditions during fermentation were compared by fermenting while adjusting the pH conditions during fermentation to pH 4 and pH 5, which is more than the pKa value of lactic acid using NaOH as a base. As a result, as shown in FIG. 7 , it can be confirmed that the strain exhibits similar performance to that at high pH even at a pH lower than pKa, which is the performance at a pH below pKa shown in the lactic acid-producing strain using the existing yeast. As a result of no degradation, the acid resistance of the strain is well shown. In addition, the recombinant strain of the present invention showed the performance of consuming all of 120 g/L of sugar at pH 3, pH 4 and pH 5, which can also be said to be a result of well showing the acid resistance of the strain. Table 6 shows an example of performance degradation according to pH, which appears in the development of a lactic acid-producing strain using a common yeast.

Performance by pH of lactic acid producing strains using general yeast Yeast LDH pH < pKa
performance pH > pKa performance Reference S. cerevisiae B. taurus
(multicopy plasmid) 6.1 g/L Lactic acid,
0.23 g/L/hr productivity 11.4 g/L Lactic acid, 0.3 g/L/hr productivity Michael Sauer et al., Biotechnology and Genetic Engineering Reviews , 27:229-256, 2010 K. marxianus L. helveticus
(integrated into PDC1 locus) 9.1 g/L Lactic acid, 0.13 g/L/hr productivity 99g/L Lactic acid, 2g/L/hr productivity same as above P. stiptis L. helveticus (integrated, 1 copy) 15 g/L Lactic acid, 0.17 g/L/hr productivity 58 g/L Lactic acid, 0.39 g/L/hr productivity same as above S. cerevisiae L. mesenteroides 48.9 g/L Lactic acid, 0.41 g/L/hr productivity 112 g/L Lactic acid, 2.2 g/L/hr productivity Seung Ho Baek, et al., Appl Microbiol Biotechnol, 2016 Mar; 100(6):2737-48.

As described above in detail a specific part of the content of the present invention, for those of ordinary skill in the art, this specific description is only a preferred embodiment, and it is clear that the scope of the present invention is not limited thereby. something to do. Accordingly, it is intended that the substantial scope of the present invention be defined by the appended claims and their equivalents.

Name of deposit institution: Korea Research Institute of Bioscience and Biotechnology

Accession number: KCTC13508BP

Deposit date: 20180411

<110> SK Innovation <120> Acid Resistant Yeast Inhibited Ethanol Production and Method for Preparing Lactic Acid Using The Same <130> P18-B060 <160> 54 <170> KopatentIn 2.0 <210> 1 <211> 320 <212> PRT <213> Lactobacillus plantarum <400> 1 Met Ser Ser Met Pro Asn His Gln Lys Val Val Leu Val Gly Asp Gly 1 5 10 15 Ala Val Gly Ser Ser Tyr Ala Phe Ala Met Ala Gln Gln Gly Ile Ala 20 25 30 Glu Glu Phe Val Ile Val Asp Val Val Lys Asp Arg Thr Lys Gly Asp 35 40 45 Ala Leu Asp Leu Glu Asp Ala Gln Ala Phe Thr Ala Pro Lys Lys Ile 50 55 60 Tyr Ser Gly Glu Tyr Ser Asp Cys Lys Asp Ala Asp Leu Val Val Ile 65 70 75 80 Thr Ala Gly Ala Pro Gln Lys Pro Gly Glu Ser Arg Leu Asp Leu Val 85 90 95 Asn Lys Asn Leu Asn Ile Leu Ser Ser Ile Val Lys Pro Val Val Asp 100 105 110 Ser Gly Phe Asp Gly Ile Phe Leu Val Ala Ala Asn Pro Val Asp Ile 115 120 125 Leu Thr Tyr Ala Thr Trp Lys Phe Ser Gly Phe Pro Lys Glu Arg Val 130 135 140 Ile Gly Ser Gly Thr Ser Leu Asp Ser Ser Arg Leu Arg Val Ala Leu 145 150 155 160 Gly Lys Gln Phe Asn Val Asp Pro Arg Ser Val Asp Ala Tyr Ile Met 165 170 175 Gly Glu His Gly Asp Ser Glu Phe Ala Ala Tyr Ser Thr Ala Thr Ile 180 185 190 Gly Thr Arg Pro Val Arg Asp Val Ala Lys Glu Gin Gly Val Ser Asp 195 200 205 Asp Asp Leu Ala Lys Leu Glu Asp Gly Val Arg Asn Lys Ala Tyr Asp 210 215 220 Ile Ile Asn Leu Lys Gly Ala Thr Phe Tyr Gly Ile Gly Thr Ala Leu 225 230 235 240 Met Arg Ile Ser Lys Ala Ile Leu Arg Asp Glu Asn Ala Val Leu Pro 245 250 255 Val Gly Ala Tyr Met Asp Gly Gln Tyr Gly Leu Asn Asp Ile Tyr Ile 260 265 270 Gly Thr Pro Ala Ile Ile Gly Gly Thr Gly Leu Lys Gln Ile Ile Glu 275 280 285 Ser Pro Leu Ser Ala Asp Glu Leu Lys Lys Met Gln Asp Ser Ala Ala 290 295 300 Thr Leu Lys Lys Val Leu Asn Asp Gly Leu Ala Glu Leu Glu Asn Lys 305 310 315 320 <210> 2 <211> 963 <212> DNA <213> Lactobacillus plantarum <400> 2 atgtcttcta tgccaaatca tcaaaaagtt gttttggttg gtgatggtgc tgttggttct 60 tcttatgctt ttgctatggc tcaacaaggt attgctgaag aatttgttat tgttgatgtt 120 gttaaagata gaactaaagg tgatgctttg gatttggaag atgctcaagc ttttactgct 180 ccaaaaaaaa tttattctgg tgaatattct gattgtaaag atgctgattt ggttgttatt 240 actgctggtg ctccacaaaa accaggtgaa tctagattgg atttggttaa taaaaatttg 300 aatattttgt cttctattgt taaaccagtt gttgattctg gttttgatgg tatttttttg 360 gttgctgcta atccagttga tattttgact tatgctactt ggaaattttc tggttttcca 420 aaagaaagag ttattggttc tggtacttct ttggattctt ctagattgag agttgctttg 480 ggtaaacaat ttaatgttga tccaagatct gttgatgctt atattatggg tgaacatggt 540 gattctgaat ttgctgctta ttctactgct actattggta ctagaccagt tagagatgtt 600 gctaaagaac aaggtgtttc tgatgatgat ttggctaaat tggaagatgg tgttagaaat 660 aaagcttatg atattattaa tttgaaaggt gctacttttt atggtattgg tactgctttg 720 atgagaattt ctaaagctat tttgagagat gaaaatgctg ttttgccagt tggtgcttat 780 atggatggtc aatatggttt gaatgatatt tatattggta ctccagctat tattggtggt 840 actggtttga aacaaattat tgaatctcca ttgtctgctg atgaattgaa aaaaatgcaa 900 gattctgctg ctactttgaa aaaagttttg aatgatggtt tggctgaatt ggaaaataaa 960 taa 963 <210> 3 <211> 988 <212> DNA <213> Artificial Sequence <220> <223> g4423 promoter region Allele 1 <400> 3 gttaactcag ttttctctct ttccctccac cccacgttac tctgcgaaca aaaatacgca 60 cagaatgaac atctgattga ttaatattta tatattactt agtggcaccc ctacaaacaa 120 accaattttg aatatttctc accatcatga tatttattta gggcaagaat ttcatgtaca 180 tacgtgcgtg tactgcatag ttttgttata tgtaaataac cagcaatata tcaccaatga 240 taaatgctca gtaatttatt tggaaccaaa atagtttcag taatcaaata atacaataac 300 taacaagtgc tgattataca acagctgtta acaacacaaa cacgctctct tctattctct 360 tccctgcttg ttcgtgtggt atattcccga atttgcaatt tagaaattat attttttaaa 420 agaattgttc tccattttct ggtagtcgta agtggcaaat tggatcataa gacacaatct 480 tgttagttcg actgctaaca ccagacaaga ccgaacgaaa acagaaaaaa aagataattt 540 tgttattctg ttcaattctc tctctctttt taaggtatct ttacattaca ttacatatcc 600 caaattacaa caagagcaag aaatgaagca caacaacacg ccatctttcg tgattatttt 660 atcatttcta tatcgtaact aaattaacaa atgctatgtt tcttaatttt taatgataaa 720 tctaactgct accttaattt ctcatggaaa gtggcaaata cagaaattat atattcttat 780 tcattttctt ataattttta tcaattacca aatatata aatgcaatta attgattgtt 840 cctgtcacat aatttttttt gtttgttacc tttattcttt atccatttag tttagttctt 900 atatctttct tttctatttc tctttttcgt ttaatctcac cgtacacata tatatccata 960 tatcaataca aataaaaatc atttaaaa 988 <210> 4 <211> 961 <212> DNA <213> Artificial Sequence <220> <223> g4423 promoter region Allele 2 <400> 4 gttaactcag ttttctctct ttccctccac cccacgttac tctgcgaaca aaaaatacgc 60 acagaatgaa catctgattg attaatattt atatattact cagtggcacc cctacaaaca 120 aaccaatttt gaatattgtt caccatcatg atatttattt agggcaagaa tttcatgtac 180 atacgtgcgt gtactgcata gttttgttat atgaaaataa ccagcaatat atcaccaatg 240 aataaattct caataattta tttggaacca aataatgcaa taactagcaa actaagtggt 300 gattatacaa cagctgttaa caacacaaac atacgctctc ttctattatc tcttccctgc 360 ttgttcgtgt ggtatattca cgaatttgca atttagaaat tatatttttt aaaagaattg 420 ttctccattt tctggtagtc gtaagtggca aattggatca taagacacaa tcttgttagt 480 tcgactgcta acaccagaca acaccgaacg aaaacaagaa aaaataatta ttctctctct 540 ttttaaggta tcttacatta catatcccaa attacaacaa gagcaagaaa tgaggcacaa 600 caacacacca tcatctttcg tgattatttt tatcatttct atcatgtaat taaattaaca 660 aatgttaagt ttattaattt ttaatgataa atctagttgc taccttaatt tctcatggaa 720 agtggcaaat actgaaatta tttaattcta ctttcatttt cttataattt ttatcaatta 780 ccaaatatat ataaatgcaa ttaattgatt gttcctgtca cataattttt tttgtttgtt 840 acctttattc tttatccatt taatttattt cttgtatctt tcttttctat ttctcttttc 900 tgtttaatct caccgtacac atatatatcc atatatcaat acaaataaaa atcatttaaa 960 a 961 <210> 5 <211> 1017 <212> DNA <213> Artificial Sequence <220> <223> g4423 terminator region Allele 1 <400> 5 taagtcattt aatttattct tttagaatat atttattttg tctttatttt tgaaatgtta 60 atagtctttt ttttttactt tgaacaaaaa aaagtaaaat taaaacttat cttatatacg 120 cttttaaaca ttaaactcgt taacgaatta tataatgatt ttatcgaact actttatgtt 180 tttttaatag aataatcttc tttattaata taacttacta cttcttaatc ttgttgtcct 240 ccattcgaaa ctcgagtgga acattttctg agtatctctc gcgtctgttc gtaccgtttt 300 tccaatttct ttcgggaaac ggaactggac gcattttatt tgactgttga aagggagatt 360 taatatttat atagcgagat ataacaacta acttataagt ttacacaggc tgttatcaca 420 tatatata tatatcaaca gaggactagc tcactagact aacattagat atgtcgatgc 480 tgaaccgttt gtttggtgtt agatccattt cacaatgtgc tactcgttta caacgttcta 540 cagggacaaa tatatcagaa ggtccactaa gaattattcc acaattacaa actttctatt 600 ctgctaatcc aatgcatgat aacaatatcg acaagctaga aaatcttcta cgtaaatata 660 tcaagttacc aagtacaaac aatttattga agacacatgg gaatacatct acagaaattg 720 atccaacaaa attattacaa tcacaaaatt cttcacgtcc tttatggtta tcattcaagg 780 attatacagt gattggaggt ggttcacgtt taaaacctac tcaatacacg gaacttttat 840 ttctattgaa taaactacat agtatcgatc cacaattaat gaatgatgat attaagaacg 900 aattagctca ttattataag aatacttcac aggaaactaa taaagtcacc atccctaaat 960 tggatgaatt cggtagaagt attggaatcg gtagaaggaa atccgcaact gcaaaag 1017 <210> 6 <211> 1018 <212> DNA <213> Artificial Sequence <220> <223> g4423 terminator region Allele 2 <400> 6 taagtcattt aatttattct tttagaatat atttattttg tctttatttt tgaaatgtta 60 atagtctttt ttttactttg aaaaaaaaaa aaagtaaaat taaacttatc ttatatacgc 120 ttttaaacat taaactcgtt aacgaattat ataatgattt tatcgaacta ctttatgttt 180 ttttaataga ataatcttct ttattaatat aacttactac ttcttaatct tgttgtcctc 240 cattcgaaac tcgagaggaa caatttctga gtctctctcg caccctttcg tacgtaccgt 300 ttttccaatt tctttcggga aacggaactg gacgcatttt atttgactgt tgaaagggag 360 atttaatatt tatatagaga gatataacaa ctaacttata agtttataca ggctgttatc 420 acatatatat atatatcaac agaggactag ctcaatagaa taacattaga tatgtcgatg 480 ctgaaccgtt tgtttggtgt tagatccatt tcacaatgtg ctactcgttt acaacgttct 540 acagggacaa atatatcaga aggtccacta agaattattc cacaattaca aactttctat 600 tctgctaatc caatgcatga taacaatatc gacaagctag aaaatcttct acgtaaatat 660 atcaagttac caagtacaaa taacttattg aagacacatg ggaatacatc tacagaaatc 720 gatccaacaa aattattaca atcacaaaat tcttcacgtc ctttatggtt atcattcaag 780 gattatacag tgattggagg tggttcacgt ttaaaaccta ctcaatacac agaactttta 840 tttctattga ataaactaca tagtatcgat ccacaattaa tgaatgatga tattaagaac 900 gaattagctc attattataa gaatacttca caggaaacta ataaagtcac catccctaaa 960 ttggatgaat tcggtagaag tattggaatc ggtagaagga aatccgcaac tgcaaaag 1018 <210> 7 <211> 323 <212> PRT <213> Lactobacillus helveticus <400> 7 Met Ala Arg Glu Glu Lys Pro Arg Lys Val Ile Leu Val Gly Asp Gly 1 5 10 15 Ala Val Gly Ser Thr Phe Ala Phe Ser Met Val Gln Gln Gly Ile Ala 20 25 30 Glu Glu Leu Gly Ile Ile Asp Ile Ala Lys Glu His Val Glu Gly Asp 35 40 45 Ala Ile Asp Leu Ala Asp Ala Thr Pro Trp Thr Ser Pro Lys Asn Ile 50 55 60 Tyr Ala Ala Asp Tyr Pro Asp Cys Lys Asp Ala Asp Leu Val Val Ile 65 70 75 80 Thr Ala Gly Ala Pro Gln Lys Pro Gly Glu Thr Arg Leu Asp Leu Val 85 90 95 Asn Lys Asn Leu Lys Ile Leu Ser Ser Ile Val Glu Pro Val Val Glu 100 105 110 Ser Gly Phe Glu Gly Ile Phe Leu Val Val Ala Asn Pro Val Asp Ile 115 120 125 Leu Thr His Ala Thr Trp Arg Met Ser Gly Phe Pro Lys Asp Arg Val 130 135 140 Ile Gly Ser Gly Thr Ser Leu Asp Thr Gly Arg Leu Gln Lys Val Ile 145 150 155 160 Gly Lys Met Glu Asn Val Asp Pro Ser Ser Val Asn Ala Tyr Met Leu 165 170 175 Gly Glu His Gly Asp Thr Glu Phe Pro Ala Trp Ser Tyr Asn Asn Val 180 185 190 Ala Gly Val Lys Val Ala Asp Trp Val Lys Ala His Asn Met Pro Glu 195 200 205 Ser Lys Leu Glu Asp Ile His Gln Glu Val Lys Asp Met Ala Tyr Asp 210 215 220 Ile Ile Asn Lys Lys Gly Ala Thr Phe Tyr Gly Ile Gly Thr Ala Ser 225 230 235 240 Ala Met Ile Ala Lys Ala Ile Leu Asn Asp Glu His Arg Val Leu Pro 245 250 255 Leu Ser Val Pro Met Asp Gly Glu Tyr Gly Leu His Asp Leu His Ile 260 265 270 Gly Thr Pro Ala Val Val Gly Arg Lys Gly Leu Glu Gln Val Ile Glu 275 280 285 Met Pro Leu Ser Asp Lys Glu Gln Glu Leu Met Thr Ala Ser Ala Asp 290 295 300 Gln Leu Lys Lys Val Met Asp Lys Ala Phe Lys Glu Thr Gly Val Lys 305 310 315 320 Val Arg Gln <210> 8 <211> 972 <212> DNA <213> Lactobacillus helveticus <400> 8 atggctagag aagaaaaacc aagaaaagtt attttggttg gtgatggtgc tgttggttct 60 acttttgctt tttctatggt tcaacaaggt attgctgaag aattgggtat tattgatatt 120 gctaaagaac atgttgaagg tgatgctatt gatttggctg atgctactcc atggacttct 180 ccaaaaaata tttatgctgc tgattatcca gattgtaaag atgctgattt ggttgttatt 240 actgctggtg ctccacaaaa accaggtgaa actagattgg atttggttaa taaaaatttg 300 aaaattttgt cttctattgt tgaaccagtt gttgaatctg gttttgaagg tatttttttg 360 gttgttgcta atccagttga tattttgact catgctactt ggagaatgtc tggttttcca 420 aaagatagag ttattggttc tggtacttct ttggatactg gtagattgca aaaagttatt 480 ggtaaaatgg aaaatgttga tccatcttct gttaatgctt atatgttggg tgaacatggt 540 gatactgaat ttccagcttg gtcttataat aatgttgctg gtgttaaagt tgctgattgg 600 gttaaagctc ataatatgcc agaatctaaa ttggaagata ttcatcaaga agttaaagat 660 atggcttatg atattattaa taaaaaaggt gctacttttt atggtattgg tactgcttct 720 gctatgattg ctaaagctat tttgaatgat gaacatagag ttttgccatt gtctgttcca 780 atggatggtg aatatggttt gcatgatttg catattggta ctccagctgt tgttggtaga 840 aaaggtttgg aacaagttat tgaaatgcca ttgtctgata aagaacaaga attgatgact 900 gcttctgctg atcaattgaa aaaagttatg gataaagctt ttaaagaaac tggtgttaaa 960 gttagacaat aa 972 <210> 9 <211> 320 <212> PRT <213> Rhizopus oryzae <400> 9 Met Val Leu His Ser Lys Val Ala Ile Val Gly Ala Gly Ala Val Gly 1 5 10 15 Ala Ser Thr Ala Tyr Ala Leu Met Phe Lys Asn Ile Cys Thr Glu Ile 20 25 30 Ile Ile Val Asp Val Asn Pro Asp Ile Val Gln Ala Gln Val Leu Asp 35 40 45 Leu Ala Asp Ala Ala Ser Ile Ser His Thr Pro Ile Arg Ala Gly Ser 50 55 60 Ala Glu Glu Ala Gly Gin Ala Asp Ile Val Val Ile Thr Ala Gly Ala 65 70 75 80 Lys Gln Arg Glu Gly Glu Pro Arg Thr Lys Leu Ile Glu Arg Asn Phe 85 90 95 Arg Val Leu Gln Ser Ile Ile Gly Gly Met Gln Pro Ile Arg Pro Asp 100 105 110 Ala Val Ile Leu Val Val Ala Asn Pro Val Asp Ile Leu Thr His Ile 115 120 125 Ala Lys Thr Leu Ser Gly Leu Pro Pro Asn Gln Val Ile Gly Ser Gly 130 135 140 Thr Tyr Leu Asp Thr Thr Arg Leu Arg Val His Leu Gly Asp Val Phe 145 150 155 160 Asp Val Asn Pro Gln Ser Val His Ala Phe Val Leu Gly Glu His Gly 165 170 175 Asp Ser Gln Met Ile Ala Trp Glu Ala Ala Ser Ile Gly Gly Gln Pro 180 185 190 Leu Thr Ser Phe Pro Glu Phe Ala Lys Leu Asp Lys Thr Ala Ile Ser 195 200 205 Lys Ala Ile Ser Gly Lys Ala Met Glu Ile Ile Arg Leu Lys Gly Ala 210 215 220 Thr Phe Tyr Gly Ile Gly Ala Cys Ala Ala Asp Leu Val His Thr Ile 225 230 235 240 Met Leu Asn Arg Lys Ser Val His Pro Val Ser Val Tyr Val Glu Lys 245 250 255 Tyr Gly Ala Thr Phe Ser Met Pro Ala Lys Leu Gly Trp Arg Gly Val 260 265 270 Glu Gln Ile Tyr Glu Val Pro Leu Thr Glu Glu Glu Glu Ala Leu Leu 275 280 285 Val Lys Ser Val Glu Ala Leu Lys Ser Val Glu Tyr Ser Ser Thr Lys 290 295 300 Val Pro Glu Lys Lys Val His Ala Thr Ser Phe Ser Lys Ser Ser Cys 305 310 315 320 <210> 10 <211> 963 <212> DNA <213> Rhizopus oryzae <400> 10 atggttttgc attctaaagt tgctattgtt ggtgctggtg ctgttggtgc ttctactgct 60 tatgctttga tgtttaaaaa tatttgtact gaaattatta ttgttgatgt taatccagat 120 attgttcaag ctcaagtttt ggatttggct gatgctgctt ctatttctca tactccaatt 180 agagctggtt ctgctgaaga agctggtcaa gctgatattg ttgttattac tgctggtgct 240 aaacaaagag aaggtgaacc aagaactaaa ttgattgaaa gaaattttag agttttgcaa 300 tctattattg gtggtatgca accaattaga ccagatgctg ttattttggt tgttgctaat 360 ccagttgata ttttgactca tattgctaaa actttgtctg gtttgccacc aaatcaagtt 420 attggttctg gtacttattt ggatactact agattgagag ttcatttggg tgatgttttt 480 gatgttaatc cacaatctgt tcatgctttt gttttgggtg aacatggtga ttctcaaatg 540 attgcttggg aagctgcttc tattggtggt caaccattga cttcttttcc agaatttgct 600 aaattggata aaactgctat ttctaaagct atttctggta aagctatgga aattattaga 660 ttgaaaggtg ctacttttta tggtattggt gcttgtgctg ctgatttggt tcatactatt 720 atgttgaata gaaaatctgt tcatccagtt tctgtttatg ttgaaaaata tggtgctact 780 ttttctatgc cagctaaatt gggttggaga ggtgttgaac aaatttatga agttccattg 840 actgaagaag aagaagcttt gttggttaaa tctgttgaag ctttgaaatc tgttgaatat 900 tcttctacta aagttccaga aaaaaaagtt catgctactt ctttttctaa atcttcttgt 960 taa 963 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 11 cggactttag agccttgtag ac 22 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 12 atctggttac actcacgatg g 21 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 13 ccaagtacgt tagagctaac gg 22 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 14 gagcttctct ggtatcagct 20 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 15 agctttagca aacattagac cc 22 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 16 attccatccg aatatgctgg t 21 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 17 ggaacctaaa tgactgttgg ca 22 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 18 aggatgttga tttcgactcg t 21 <210> 19 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 19 ttccaaaggg taccaattta gctg 24 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 20 gtaccgctaa tgaacctaaa cca 23 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 21 agagctgaca ctagagaagc c 21 <210> 22 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 22 gatgtgtcta cgacgtatct acc 23 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 23 gtactggtaa cgtccaagtc 20 <210> 24 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 24 gaacccttcc atactctacc a 21 <210> 25 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 25 ttcagttcgt gctactcaag g 21 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 26 tcaattgcaa cgacagagac 20 <210> 27 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 27 ccgtaccctg aagagtttac tg 22 <210> 28 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 28 caaccataga ttcacgaatt gctc 24 <210> 29 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 29 agtggatttg gattaatggg tg 22 <210> 30 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 30 gcttctgtaa cacctttaac ac 22 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 31 aaattggtga ccgtgttggt 20 <210> 32 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 32 aaccaccttt actacggtaa cca 23 <210> 33 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 33 tttagtcgtc atctgttcag gt 22 <210> 34 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 34 gagacaccta acaaaccaaa tgg 23 <210> 35 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 35 gattcaagct tcttctcgta tcgg 24 <210> 36 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 36 ggaaatgata ccattcacga cct 23 <210> 37 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 37 gttccgtcaa agaaatcaag ca 22 <210> 38 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 38 tggtaaacct gtatctgaca tcac 24 <210> 39 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 39 tttagttgtc atttgtgccg gt 22 <210> 40 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 40 gacacctaac aaaccaaacg ga 22 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 41 ctttgagtgc aagtatcgcc 20 <210> 42 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for qPCR <400> 42 tgtgtaattg ttcaccaaag cc 22 <210> 43 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 43 gagatagcac accattcacc a 21 <210> 44 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 44 caacgttaag tactctggtg tttg 24 <210> 45 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 45 caacgttaag tactctggtg tttg 24 <210> 46 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 46 gagatagcac accattcacc a 21 <210> 47 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 47 ggattcctgt aatgacaacg cgag 24 <210> 48 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 48 tggatacatt acagattctc tatcct 26 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 49 atgaaaattt ttgcttatgg 20 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 50 ttaatattca acagcaatag 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 51 atggttttgc attctaaagt 20 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 52 ttaacaagaa gatttagaaa 20 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 53 atgtcttcta tgccaaatca 20 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 54 ttatttattt tccaattcag 20

Claims (7)

A gene construct in which a promoter represented by the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 4 and a gene encoding lactate dehydrogenase represented by SEQ ID NO: 1 are operably linked.
delete The genetic construct according to claim 1, further comprising a terminator represented by the nucleotide sequence of SEQ ID NO: 5 or SEQ ID NO: 6.
A recombinant vector comprising the genetic construct of claim 1 .
A recombinant microorganism into which the gene construct of claim 1 or the recombinant vector of claim 4 is introduced.
The recombinant microorganism according to claim 5, characterized in that it is yeast.
A method for producing lactic acid comprising the steps of;
(a) generating lactic acid by culturing a recombinant microorganism into which the gene construct of claim 1 or a recombinant vector comprising the gene construct of claim 1 is introduced; and
(b) obtaining the produced lactic acid.

Images