KR101763820B1 - Method for production of 2,3-butanediol with suppressed production of glycerol - Google Patents

Abstract

The present invention relates to a process for the production of 2,3-butanediol, and the production technology of 2,3-butanediol using conventional saccharomyces cerevisiae (yeast) And glycerol as a by-product. However, the yeast strain of the present invention can produce 2,3-butanediol in high purity, high yield and high productivity under the condition that the production of glycerol as a by-product is inhibited.

Description

Method for production of 2,3-butanediol with suppressed production of glycerol < RTI ID = 0.0 >

The present invention relates to a process for producing 2,3-butanediol, and more particularly to a process for producing 2,3-butanediol in which production of glycerol, which is a by-product of 2,3-butanediol production, is suppressed .

Biochemical materials production technology is a technology to produce raw materials of various chemicals and polymers using biomass as raw material.

2,3-butanediol is a material that can be converted to synthetic rubber 1,3-butadiene, which is the material of automobile tires. It can also be used for the production of methyl ethyl ketone (MEK) as a liquid fuel additive through dehydrogenation. In addition, it can be converted to materials used in pharmaceuticals, cosmetics, etc. through esterification reaction.

When 2,3-butanediol is to be produced by biological methods, it is necessary to develop a strain for producing 2,3-butanediol using a metabolic engineering technique and a fermentation process using the same. In particular, for the industrial and economic production of 2,3-butanediol, it is necessary to develop strains which can be produced with high yield, productivity and purity.

The production of 2,3-butanediol through microbial fermentation is mainly induced by Krebsiella oxytoca (Klebsiella oxytoca), Klebsiella pneumoniae (Klebsiella pneumoniae), Bacillus Subtilis (Bacillus subtilis) And the like. However, most of these bacterial strains are classified as pathogenic microorganisms, thus limiting safety and industrialization.

Thus, recently, a method for producing 2,3-butanediol using yeast, a GRAS microorganism, has been developed. This technology prevents the production of ethanol from yeast, removes the pyruvate decarboxylase gene or regulates the expression level of the core gene to increase production of 2,3-butanediol, By introducing the 3-butanediol biosynthetic pathway, it succeeded in producing 2,3-butanediol in high concentration.

However, the 2,3-butanediol producing strain produces 2,3-butanediol and glycerol as a by-product, and when glycerol is contained in the fermentation product, there arises a problem that additional costs are incurred in the purification process .

Therefore, in order to produce 2,3-butanediol more economically and commercially, it is necessary to develop a 2,3-butanediol producing strain inhibiting the production of glycerol.

Korean Patent Publication No. 10-2015-0068581 (published on June 22, 2015) discloses that the biosynthesis pathway of 2,3-butanediol is 2 (2) with a recombinant yeast with metabolic engineering (3-butanediol), wherein pyruvate decarboxylase activity is inhibited and 2,3-butanediol biosynthesis-related foreign genes and xylose metabolism-related foreign genes are introduced Discloses a technique for producing 2,3-butanediol from glucose or xylose with high productivity using recombinant yeast.

The present invention provides a method for producing 2,3-butanediol in high purity and high productivity under the condition that the production of glycerol, which is a by-product generated in the production of 2,3-butanediol, is suppressed.

The present invention is determined in 2,3-butane diol produced saccharide as MY process three Levy jiae for, remove all of the genes GPD1 and GPD2 gene involved in the biosynthesis of glycerol and, NADH oxidase (NADH oxidase) encoding gene is introduced to the Lt; RTI ID = 0.0 > Saccharomyces < / RTI > cerevisiae . Remove all the genes GPD1 and GPD2 gene, NADH oxidase by introducing the gene coding for (NADH oxidase), 2,3-butane diol, without production of high-purity glycerol, in high yield, and to present this can produce a productivity It has been confirmed through experiments of the invention.

The saccharomyces cerevisiae for the production of the 2,3-butanediol of the present invention means saccharomyces cerevisiae with pathways for the production of 2,3-butanediol through various genetic manipulations (Ng et al., Production of 2,3-butanediol in Saccharomyces cerevisiae by in silico aided metabolic engineering, Microbial Cell Factories, 2012, 11:68), preferably acetolactate synthase, and acetolactate decarboxylase, Is transformed to express butanediol dehydrogenase, and is preferably transformed so as to express the butanediol dehydrogenase.

At this time, the transformation to express the acetolactate synthase is preferably accomplished by introducing the gene alsS encoding alpha-acetolactate synthase, and the acetolactate synthase Transformation to express acetolactate decarboxylase is preferably achieved by introducing the gene alsD encoding alpha-acetolactate decarboxylase, and the butanediol dehydrogenase (butanediol dehydrogenase) is preferably expressed by overexpressing BDH1 , a gene encoding 2,3-butanediol dehydrogenase, possessing Saccharomyces cerevisiae itself .

On the other hand, in the recombinant Saccharomyces cerevisiae of the present invention, the saccharomyces cerevisiae for producing 2,3-butanediol is a pyruvate decarboxylase decarboxylase is lost and Candida tropicallis ( Candida it is preferable that a gene PDC1 coding for pyruvate decarboxylase derived from tropicalis is introduced. More preferably, the function loss of the pyruvate decarboxylase is caused by partially cleaving one or more genes selected from the genes PDC1 , PDC5 and PDC6 encoding pyruvate decarboxylase Or all of them are removed. In addition, the PDC1 gene coding for the pyruvate kinase Cartesian acid la is, it is appropriate that are preferably expressed under the promoter GPD2.

The introduction of Pdc derived from Candida tropicallis, which is less active than pyruvate decarboxylase (Pdc), into the microorganism is possible, but the synthesis of acetyl-CoA is possible without ethanol production, And the rate of substrate consumption can be increased, and ultimately the productivity of 2,3-butanediol can be greatly improved (Korean Patent Application No. 10-2015-0124845).

On the other hand, my process to the three recombinant Saccharomyces according to the present invention Levy jiae (Saccharomyces cerevisiae ), the NADH oxidase is preferably an NADH oxidase derived from Lactobacillus lactis .

In the recombinant Saccharomyces cerevisiae of the present invention, the gene coding for the NADH oxidase is preferably inserted into a p426GPD plasmid, which is a multi-copy plasmid, and the TDH3 gene Lt; / RTI > promoter is preferably used. This is because the activity of NADH oxidase was very high under these conditions.

Meanwhile, the present invention provides a method for producing an acetolactate synthase, which is transformed to express acetolactate synthase, which is transformed to express an acetolactate decarboxylase, and a method for producing butanediol decarboxylase a dehydrogenase) that can be transformed to express, the genes GPD1 and GPD2 gene involved in the biosynthesis of glycerol is removed, and encoding gene is introduced to the NADH oxidase (NADH oxidase); Butanediol characterized in that the recombinant Saccharomyces cerevisiae is cultured in a medium supplemented with glucose. According to the 2,3-butanediol production method of the present invention, 2,3-butanediol can be produced with high purity, high yield and high productivity without the production of glycerol, which is a by-product.

On the other hand, in the production method of 2,3-butanediol of the present invention, the recombinant Saccharomyces cerevisiae preferably has the function of pyruvate decarboxylase disappeared, It is preferable to use a plasmid in which PDC1 gene encoding pyruvate decarboxylase derived from Candida tropicalis is introduced.

On the other hand, the production method of the 2,3-butanediol of the present invention is preferably carried out while continuously supplying oxygen. By supplying oxygen, NADH is consumed and the concentration of NADH in the cytoplasm can be lowered. That is, GPD1 and Due to the removal of GPD2 it can consume NADH accumulated in the cytoplasm. At this time, it is preferable that the continuous supply of oxygen is more preferably continuously fed by lowering the amount of oxygen supplied to the middle of fermentation compared to the initial stage of fermentation. In the early stage of fermentation, since the cell growth and the glucose consumption rate are high, the amount of NADH supplied in the cytoplasm is large and the NADH must be consumed by supplying a large amount of oxygen. However, after the early stage of fermentation, The amount of oxygen needed to consume NADH is reduced. At this time, when excess oxygen is supplied, acetone, which is an oxidized form of 2,3-butanediol, may accumulate as a by-product, so it is preferable to reduce the amount of oxygen after the initial stage of fermentation.

On the other hand, in the method for producing 2,3-butanediol of the present invention, it is preferable that the culture is preferably a fed-batch culture in which glucose is continuously supplied. The production of 2,3-butanediol can be maximized through fed-batch cultivation.

The production technology of 2,3-butanediol using conventional recombinant Saccharomyces cerevisiae (yeast) produced a large amount of glycerol as a by-product with the production of 2,3-butanediol. However, when the recombinant Saccharomyces cerevisiae strain of the present invention is used, 2,3-butanediol can be produced with high purity, high yield and high productivity under the condition of inhibiting the production of glycerol.

FIG. 1 shows the results of in vitro titration of NADH oxidase expressing strains. BD5_p426TDH3, G1; BD5_p406GPD2_Llox, C2; BD5_p426CYC1_Llnox, T1; BD5_p406TDH3_LlnOx, G2; BD5_p426GPD2_Llox, T2; BD5_p426TDH3_Llnox.
FIG. 2 shows the result of confirming the change in the fermentation behavior of 2,3-butanediol in NADH oxidase-expressing strain through batch culture. A; BD5_p426TDH3 (control group), B; BD5_p426TDH3_Llnox.
FIG. 3 shows changes in 2,3-butanediol fermentation behavior of the strain BD5_Ctnox according to the amount of oxygen supplied. A) 25% air injection, B) 50% air injection, C) 100% air injection.
FIG. 4 shows the measurement results of changes in intracellular coenzyme NADH and NAD ⁺ concentration according to the oxygen supply amount.
5 is a flow-through culture profile using BD5_Ctnox strain.
Fig. 6 is a map of the Cas9 expression plasmid.
7 is a schematic diagram showing a point mutation process for GPD1 gene deletion.
8 is a schematic diagram showing a point mutation process for GPD2 gene deletion.
Figure 9 shows the GPD1 gene sequence with no activity, with the underlined portion representing the mutated portion.
Fig. 10 shows the GPD1 gene sequence in which the activity is removed, wherein the underlined portion represents the mutated portion.
Fig. 11 shows the fermentation profile of the GPD gene- cleaving strain. A, BD5_p426TDH3_Llnox; B, BD5_T2nox_dGPD1; C, BD5_T2nox_dGPD2; D, BD5_T2nox_dGPD1dGPD2.
12 is a high-concentration 2,3-butanediol fermentation profile using BD5_T2nox_dGPD1dGPD2 strain. A, batch culture; B, fed-batch culture.

Hereinafter, the present invention will be described in more detail with reference to the following Examples and Experimental Examples. However, the scope of the present invention is not limited to the following embodiments, and includes modifications of equivalent technical ideas.

The recombinant Saccharomyces cerevisiae strains for the production of 2,3-butanediol in the prior art can be used for the introduction of the 2,3-butanediol biosynthetic pathway using alpha-acetolactate synthase derived from Bacillus subtilis (alpha-acetolactate sythase, alsS), alpha-acetolactate Cartesian acid la dehydratase (alpha-acetolactate decarboxylase, alsD) is introduced, through 2,3-butane diol to the hard of yeast itself dehydratase (2,3 butanediol dehydrogenase ( BDH1 ) gene is overexpressed. The inventors of the present invention have found that a strain producing Saccharomyces (BD5) strain that has been disrupted by the PDC1 , PDC5 , and PDC6 genes of the pyruvate decarboxylase (Pdc) gene that the S. cerevisiae strain itself possesses, and furthermore , it is more active than the self-contained Pdc Low Candida Tropicalis ( Candida There tropicalis) developed a pyruvate kinase called Cartesian acid (pyruvate decarboxylase) strain ( 'BD5_G1CtPDC1' strain) PDC1 gene coding for the introduction of the resulting bars (refer to Fig. 1).

[Reference Figure 1]

However, in the present invention, the NADH oxidase ( NoxE ) gene derived from Lactobacillus lactis was expressed in addition to the yeast strain for producing 2,3-butanediol, and glycerol biosynthesis through dihydro having glycerol-3-phosphate which is involved to prepare a dehydratase (glycerol-3-phosphate dehydrogenase, GPD1, GPD2) yeast strains disrupted for by the gene, all the newly produced 2,3-dimethyl butane production (refer to Fig. 2 ).

When using NADH as a coenzyme remove GPD1 or GPD2 gene involved in the glycerol biosynthetic, to the glycerol yield decreased. However, mothayeo NADH has not been consumed, the NADH in the cytoplasm and accumulated, this means the strain does not grow smoothly A problem arises. However, in the present invention, NADH can be consumed because NADH oxidase capable of oxidizing NADH is overexpressed.

Therefore, the present invention is to produce a high purity, high yield and high productivity while still completely inhibiting, 2,3-butane diol production of glycerol by removing all of GPD1 and GPD2 gene. (See Fig. 2).

[Reference Figure 2]

On the other hand, in the present invention, it was confirmed that the activity of the strain introduced with NADH oxidase constructed according to the present invention was controlled according to the amount of oxygen supplied into the incubator, and also the production of 2,3-butanediol was affected. In addition, 2,3-butanediol production technology with high concentration / high yield / high productivity was developed through optimization of culture process such as sugar concentration and oxygen supply control.

Hereinafter, the present invention will be described in more detail with reference to the following Examples and Experimental Examples. However, the scope of the present invention is not limited to the following embodiments and experimental examples, and includes modifications of equivalent technical ideas.

[ Example  One: NADH  Production of Oxidase Expression Strain]

A yeast strain for the production of 2,3-butanediol was prepared in a previous study of the present inventors (Korean Patent Laid-open No. 10-2015-0068581, Korean Patent Application No. 10-2015-0124845) As a parent strain (" BD5 " strain). The parent strains were obtained by removing the pyruvate decarboxylase (Pdc) gene PDC1 , PDC5 and PDC6 from S. cerevisiae strains and by isolating the alpha -derase from Bacillus subtilis - alpha-acetolactate decarboxylase (AlsD) and alpha-acetolactate synthase (AlsS) and 2,3-butanediol dehydrogenase of Saccharomyces cerevisiae 2,3-butanediol dehydrogenase (Bdh1) has been introduced or enhanced to form a 2,3-butanediol biosynthetic pathway.

On the other hand, expression plasmids and gene cloning were performed to introduce NADH oxidase into the parent strain. Five expression plasmids were constructed for expression.

A single copy plasmid, pRS406 (Mumberg et al., Yeast vectors for heterologous proteins in different genetic backgrounds. Gene 156 (1), 119-122) Sac I, Bam HI restriction enzyme site of the plasmid was inserted in the saccharide GPD2 as MY gene promoter of three access Levy jiae 1144 bp, Sac I, Xba I restriction enzyme in 655 bp TDH3 gene promoter place.

Also, a multi-copy plasmid, p426GPD plasmid (Mumberg et al., Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene 156 (1), 119-122)SheetI,BamSakai Maisse Serebiji on HICYC1 Gene promoter 289 bp,GPD2 Gene promoter 1144 bp,SheetI,XbaI placeTDH3 655 bp of the gene promoter was inserted.

NADH oxidase gene cloned from the Lactobacillus lactis subsp. Cremoris MG1363 strain by the PCR method was added to 5 kinds of expression plasmids (p406GPD2, p406TDH3, p426CYC1, p426GPD2, p426TDH3) SEQ ID NO: 1) was inserted.

Through these procedures, 5 kinds of 2,3-butanediol producing strains (BD5_p406GPD2_Llnox, BD5_p406TDH3_Llnox, BD5_p426CYC1_Llnox, BD5_p426GPD2_Llnox, BD5_p426TDH3_Llnox) expressing NADH oxidase were produced.

In addition, the pyruvate decarboxylase gene used to increase the glucose consumption rate and cell growth rate of the Pdc-deficient yeast strain was introduced in the prior art. This was expressing NADH oxidase using the antibiotic Leo brother Dean Bridge A single copy plasmid TDH3 promoter and the CYC1 terminator by having a resistance gene for (aureobasidin A) to, Candida Tropical faecalis (Candida tropicalis) the pyruvate kinase called Cartesian acid (pyruvate decarboxylase, CtPDC1) was derived from the expression under GPD2 promoter. The gene coding for pyruvate decarboxylase (CtPDC1) derived from Candida tropicalis is shown in SEQ ID NO: 2.

From the above procedure, BD5_Ctnox strains simultaneously expressing NADH oxidase and pyruvate decarboxylase could be constructed.

The primers used for the construction of NADH oxidase expression plasmids Primers Restriction
site Sequence
Cloning of S. cerevisiae promoters F_CYC1P Sheet I c GAGCTC atttggcgagcgttg R_CYC1P Bam HI cgc GGATCC ttagtgtgtgtatttgtgtttgc F_GPD2P Sheet I c GAGCTC caaaaacgacatatctattatagtg R_GPD2P Bam HI cgc GGATCC ctttgagtgcagttgtgttt Cloning of L. lactis noxE F_nox Bam HI cgc GGATCC aaaatgaaaatcgtagttatcggta R_XhoI_nox Xho I ccg CTCGAG tttatttggcattcaaagct R_SalI_nox Sal I acgc GTCGAC tttatttggcattcaaagct

The CYC1 promoter is shown in SEQ ID NO: 3, and GPD2 The promoter is shown in SEQ ID NO: 4, and the TDH3 promoter is shown in SEQ ID NO:

[ Example  2: NADH  Of the strain expressing the oxidase in vitro  enzyme Potency  Measure]

The plasmid for expression of NADH oxidase prepared in Example 1 was designed to have different activity. Thus, in vitro enzyme activity measurements were performed to compare the expression levels of NADH oxidase in the strains produced.

Cells of approximately 1 x 10 ⁹ logarithmic growths cultured in a medium containing 80 g / L of glucose and 0.5 g / L of ethanol in a YNB medium (6.7 g / L of the yeast nitrogen base, 1.4 g / L of the amino acid mixture) Respectively.

After the intracellular enzymes were extracted using Yeast Protein Extraction Reagent (Y-PER, Thermo Scientific, MA), the supernatant was used for the determination of NADH oxidase. Measurement of NADH oxidase activity was carried out at 30 ° C., and the reaction was carried out under the condition that 0.4 mM NADH and 0.3 mM EDTA were contained in 50 mM potassium phosphate buffer (pH 7.0), and the absorbance was measured at 340 nm. Protein concentrations in crude extracts were measured by the 'bradford' method. 1 unit was expressed as 1 μmol of NADH oxidized per minute.

As a result of the experiment, as shown in Fig. 1, different NADH oxidase activity was exhibited depending on the promoter and the number of copies used for expression. The control group was BD5 strain (Kim et al., Expression of Lactococcus lactis NADH oxidase increases 2,3-butanediol production in Pdc-deficient Saccharomyces cerevisiae , Bioresource Technology 191 (2015) 512-519), a strain in which the p426TDH3 vector was inserted was used. The activity of BD5_p406GPD2_Llnox was 11.2 mU / mg protein and the activity of BD5_p426TDH3_Llnox was about 900 times 9153 mU / mg protein compared to that of BD5_p406GPD2_Llnox. Respectively.

FIG. 1 shows the results of in vitro titration of NADH oxidase expressing strains. BD5_p426TDH3, G1; BD5_p406GPD2_Llox, C2; BD5_p426CYC1_Llnox, T1; BD5_p406TDH3_LlnOx, G2; BD5_p426GPD2_Llox, T2; BD5_p426TDH3_Llnox.

[ Example  3: NADH  The activity of 2,3- Butanediol  Confirmed changes in fermentation pattern]

The Pdc-deficient yeast strain for the production of 2,3-butanediol, when producing 2,3-butanediol from sugar, accumulates NADH in the cytoplasm, which is limited to be oxidized through respiration, Is produced as a by-product.

Therefore, in the present invention, introduction of NADH oxidase and further pathway for oxidizing NADH were introduced. If such a prediction is successful, it will reduce the accumulation of glycerol as a by-product and increase the production of 2,3-butanediol.

Batch fermentation experiments were conducted to confirm this. The medium containing 80 g / L of initial glucose and 0.5 g / L of ethanol was used for YNB, and the fermentation temperature was maintained at 30 ° C. And stirred at 80 rpm in a 250 mL working flask in a 250 mL flask. The initial cell inoculation concentration was 1.0 at an optical density (OD) of 600 nm.

The experimental results are shown in FIG. 2 and Table 2. Both the control and experimental groups consumed 80 g / L of glucose within about 76 hours. In the control group, the production yield of glycerol was 0.278 g _Glycerol / g _Glucose whereas that of BD5_p426TDH3_Llnox was decreased to 0.209 g _Glycerol / g _Glucose . The yield of 2,3-butanediol was 0.332 g _{2 , 3- Butanediol} / g _Glucose in the control group and 0.367 g _{2 , 3- Butanediol} / g _Glucose in the BD5_p426TDH3_Llnox strain. Thus, the yield of glycerol decreased and the yield of 2,3-butanediol increased through the expression of NADH oxidase. At this time, the effect was increased as the amount of NADH oxidase expression increased.

FIG. 2 shows the result of confirming the change in the fermentation behavior of 2,3-butanediol in NADH oxidase-expressing strain through batch culture. A; BD5_p426TDH3 (control group), B; BD5_p426TDH3_Llnox.

Batch fermentation results using NADH oxidase expression strain Parameter ^* Value (mean ± standard deviation) BD5
_p426TDH3 BD5
_p406GPD2
_Llnox BD5_
p426CYC1
_Llnox BD5
_p406TDH3
_Llnox BD5
_p426GPD2
_Llnox BD5
_p426TDH3
_Llnox DCW (g / L) 2.09
± 0.10 1.93
± 0.07 1.74
± 0.11 1.55
± 0.09 1.68
± 0.04 1.69
± 0.03 Y _glycerol (g / g) 0.278
± 0.011 0.266
± 0.010 0.229
± 0.001 0.231
± 0.005 0.216
± 0.009 0.209
± 0.004 Y _{2 , 3- BD} (g / g) 0.332
± 0.000 0.338
± 0.001 0.359
± 0.000 0.359
± 0.001 0.364
± 0.003 0.367
± 0.002 Y _acetone (g / g) 0.010
± 0.001 0.009
± 0.001 0.012
± 0.001 0.011
± 0.001 0.010
± 0.000 0.012
± 0.001 V _glucose (g / L · h ^-1 ) 1.10
± 0.03 1.11
± 0.02 1.06
± 0.01 1.13
± 0.00 1.07
± 0.02 1.10
± 0.00 P _{2 , 3- BD} (g / L · h ^-1 ) 0.364
± 0.011 0.374
± 0.008 0.381
± 0.003 0.404
± 0.002 0.391
± 0.006 0.403
± 0.002

[ Example  4: 2,3- Butanediol  Confirmation of changes in fermentation pattern]

The NADH oxidase used in this study reacts with NADH using oxygen as a substrate and produces water and NAD ⁺ . Therefore, it is possible to control the activity of NADH oxidase through the amount of oxygen supplied to the medium during fermentation, in addition to controlling the amount of NADH oxidase enzyme expression.

In this Example, the activity of NADH oxidase was changed according to the supply of oxygen, and a batch culture experiment was performed in which oxygen conditions were different from each other in order to examine the effect of the NADH oxidase activity on the fermentation of 2,3-butanediol.

The medium used was a medium containing 90 g / L of glucose in YP (Yeast extract 10 g / L, Peptone 20 g / L). The oxygen supply conditions were varied so that 25%, 50%, and 100% air was introduced by mixing nitrogen into the air supplied into the medium. The fermentation temperature was kept at 30 ° C and air and air / nitrogen mixed gas was injected at 2 vvm and stirred at 500 rpm. A 1 L size fermenter was used and the working volume was 500 mL. The strain BD5_Ctnox was used.

The experimental results are shown in Table 3 and FIG. As shown in Table 3, the production of 2,3-butanediol changed depending on the amount of oxygen supplied. As the oxygen supply was increased, the glycerol production decreased and the acetone production increased. The production yield of 2,3-butanediol was the largest at 50% air. The cell growth was not significantly different under the three conditions, but the glucose uptake rate decreased with 100% air injection compared to the other two conditions.

FIG. 3 shows changes in 2,3-butanediol fermentation behavior of the strain BD5_Ctnox according to the amount of oxygen supplied. A) 25% air injection, B) 50% air injection, C) 100% air injection.

Changes in 2,3-butanediol fermentation behavior of BD5_Ctnox strain by oxygen supply Parameters DCW _max Glycerol Acetone 2,3-BD Glycerol
yield 2,3-BD
Yield 2,3-BD
productivity (g / L) (g / L) (g / L) (g / L) (g / g) (g / g) (g / L · h ^-1 ) 25% 3.0 19.2 2.0 31.4 0.216 0.363 1.42 50% 3.3 11.3 2.2 33.1 0.128 0.374 1.44 100% 3.4 3.7 14.2 17.7 0.050 0.237 0.71

[ Example  5: Intracellular NADH / NAD ⁺ Coenzyme  Concentration change measurement]

The concentration of NADH and NAD ^{+ in} the cells was measured using the 20-hour-old cells obtained in Example 4. Approximately 4 × 10 ⁷ cells were used for the measurement and were measured using a kit for NAD ⁺ / NADH measurement (BioAssay Systems, CA).

The experimental results are shown in Fig. As shown in FIG. 4, when the air ratio was 100%, the concentration of NADH decreased and the concentration of NAD ⁺ increased. That is, as the oxygen supply was increased, the activity of intracellular NADH oxidase was increased, and it was found that NADH oxidized directly by acting on NADH in the cells.

FIG. 4 shows the measurement results of changes in intracellular coenzyme NADH and NAD ⁺ concentration according to the oxygen supply amount.

[ Example  6: Oil price formula  High concentration and high productivity through regulation of oxygen supply in culture process 2,3- Butanediol  Fermentation]

In order to determine the possibility of BD5_Ctnox strain as a strain for the mass production of 2,3-butanediol, a fed-batch culture was carried out in which glucose was added in the middle of fermentation. The activity of NADH oxidase was regulated to reduce glycerol production and the fermentation intermediate oxygen feed to maximize 2,3-butanediol production. YP medium was used as the medium. The initial glucose concentration was 330 g / L, and 800 g / L of glucose solution was added in the middle of fermentation. The initial cell inoculation concentration was 2.0 g / L and the fermentation temperature was maintained at 30 degrees. Oxygen was supplied from the beginning to the middle of fermentation under the conditions of 2 vvm and 500 rpm, and then oxygen was supplied at 1 vvm and 200 rpm. As a result, at the end of the incubation time of 78 hours, 154.3 g / L of 2,3-butanediol was produced and the productivity was 1.98 g _{2,3- Butanediol} / L / h (see FIG. 5 and Table 4). At this time, the yield of _{2,3-butanediol} production was 0.404 g _{2,3-Butanediol} / g _Glucose .

5 is a flow-through culture profile using BD5_Ctnox strain.

Result of oil-fed culture using BD5_Ctnox strain Parameters DCW _Max Glucose
consumed Glycerol 2,3-BD Ethanol Glycerol
yield 2,3-BD
yield 2,3-BD
productivity (g / L) (g / L) (g / L) (g / L) (g / L) (g / g) (g / g) (g / L · h ^-1 ) BD5_Ctnox 6.2 404.3 32.5 154.3 0.1 0.088 0.404 1.98

[ Example  7: GPD1 , GPD2  The removed 2,3- Butanediol  Production strain]

Saccharide over a hydro-3-phosphate to glycerol in my process three Levy jiae dehydratase (Glycerol-3-phosphate dehydrogenase, Gpd) is a key metabolic enzyme for glycerol production, it is expressed by the GPD1, GPD2 gene.

The GPD1 and the recombinant 2,3-butane diol for the production of yeast strain removing the GPD2 gene was constructed to 2,3-butane diol production when, completely inhibiting the occurrence of glycerol in the invention. It was applied to Cas9-CRISPR way to achieve this, to remove the GPD1 and GPD2 gene activity in a manner to switch the GPD1 and GPD2 codon of ORF middle of the gene stop codon. In order to apply the Cas9-CRISPR method, a Cas9 gene sequence was inserted into a plasmid containing an AUR1-C gene resistant to Aureobasidin A antibiotics and expressed in yeast, and the mutant part of each of GPD1 and GPD2 a guide target DNA and the DNA repair is the NADH oxidase by the transformed in 2,3-butane diol-producing strain expressing the conversion activity of GPD1, GPD2 remove strain BD5_T2nox_dGPD1, BD5_T2nox_dGPD2, BD5_T2nox_dGPD1dGPD2 was produced that.

In addition, Candida tropicallis expressed in the BD5_T2nox_dGPD1dGPD2 strain by the GPD2 promoterCandida tropicalis) Pyruvate decarboxylase was introduced to prepare BD5_T2nox_dGPD1dGPD2_CtPDC1 strain.

Fig. 6 is a map of the Cas9 expression plasmid. 7 is a schematic diagram showing a point mutation process for GPD1 gene deletion. 8 is a schematic diagram showing a point mutation process for GPD2 gene deletion. Figure 9 shows the GPD1 gene sequence with no activity, with the underlined portion representing the mutated portion. Fig. 10 shows the GPD1 gene sequence in which the activity is removed, wherein the underlined portion represents the mutated portion.

[ Example  8: NADH  Without oxidase activity GPD1  And GPD2  Preparation of a Strain to be Removed]

To prepare a 2,3-butanediol producing strain lacking the NADH oxidase activity by the method of removing the NADH oxidase expression plasmid from the BD5_T2nox_dGPD1, BD5_T2nox_dGPD2, and BD5_T2nox_dGPD1dGPD2 strains produced in Example 7.

For this purpose, BD5_T2nox_dGPD1, BD5_T2nox_dGPD2 and BD5_T2nox_dGPD1dGPD2 strains were repeatedly subcultured in a medium containing uracil, which is a marker of an NADH oxidase expression plasmid, and cultured in a culture medium containing uracil and uracil, the replica plating was used to select strains from which the NADH oxidase plasmid was removed.

As a result, in the case of BD5_T2nox_dGPD1 strain, NADH oxidase was removed from 5 out of 16 strains, and in case of BD5_T2nox_dGPD2 strain, NADH oxidase was eliminated from 6 strains out of 16 strains (see Table 5 and FIG. 11 ).

However, in the case of the strain BD5_T2nox_dGPD1dGPD2, strains in which NADH oxidase was removed from 120 strains were not obtained. This means that NADH oxidase is an essential enzyme for the growth of Pdc-deficient Gpd-deficient 2,3-butanediol yeast strains. NADH oxidase plays a role in oxidizing NAD ⁺ to NAD ⁺ , which is caused by the removal of GPD gene, so that the recombinant strain can grow. FIG. 11 shows the results of plasmid curing of strains BD5_T2nox_dGPD1, BD5_T2nox_dGPD2, and BD5_T2nox_dGPD1_dGPD2.

Plasmid curing test results of BD5_T2nox_dGPD1, BD5_T2nox_dGPD2, BD5_T2nox_dGPD1_dGPD2 strain Strains Ura-cell / Total cells BD5_T2nox_dGPD1 5/16 - BD5_T2nox_dGPD2 6/16 - BD5_T2nox_dGPD1_dGPD2 0/24 0/96

[ Example  9: GPD  Lt; RTI ID = 0.0 > 2,3- Butanediol  Fermentation]

Batch culturing was carried out using the yeast strain for 2,3-butanediol production prepared in Example 7. YP medium was used. Initial 100 g / L of glucose and 0.7 g / L of ethanol were supplied as a carbon source. Inoculation cell concentration, culture temperature, culture conditions and the like were the same as in Example 3.

In the case of glycerol yield, the strain that removed GPD1 from 0.166 g _Glycerol / g _Glucose of the control group was reduced to 0.086 g _Glycerol / g _Glucose , and the strain that removed GPD2 decreased to 0.083 g _Glycerol / g _Glucose . In the case of the strain in which both GPD1 and GPD2 were removed, no glycerol was observed, and the yield of _{2,3-butanediol was} 0.363 g _{2,3-Butanediol} / g _Glucose, which was increased by 10% 11, Table 6).

Fig. 11 shows the fermentation profile of the GPD gene- cleaving strain. A, BD5_p426TDH3_Llnox; B, BD5_T2nox_dGPD1; C, BD5_T2nox_dGPD2; D, BD5_T2nox_dGPD1dGPD2.

Results of Fermentation of GPD Gene Removal Strain Parameters DCW _max Glycerol Acetone 2,3-BD Glycerol
yield 2,3-BD
yield 2,3-BD
productivity (g / L) (g / L) (g / L) (g / L) (g / g) (g / g) (g / L · h ^-1 ) BD5_T2nox 1.3 15.7 1.9 31.5 0.166 0.333 0.33 BD5_T2nox
_dGPD1 1.1 6.4 5.6 22.3 0.086 0.302 0.19 BD5_T2nox
_dGPD2 1.1 6.4 5.1 24.3 0.083 0.317 0.20 BD5_T2nox
_dGPD1_dGPD2 1.0 0 1.7 16.5 0 0.363 0.14

[ Example  10: Batch , Oil price formula  Production of high concentration and high productivity 2,3-butanediol through culture method and oxygen supply control]

To examine the industrial applicability of the 2,3-butanediol producing strain produced in Example 9, high-concentration 2,3-butanediol was produced through a batch-type, fed-batch culture method. The strain used BD5_T2nox_dGPD1dGPD2_CtPDC1 and the initial cell inoculation concentration was 3.4 gDCW / L. The fermentation temperature was maintained at 30 캜. For the batch culture in YP medium, 300 g / L of glucose was added at the initial stage. For the fed-batch culture, 100 g / L of glucose was added and 150 g / L of glucose was added at the middle of fermentation. The initial oxygen supply was 2 vvm, 400 rpm, and the oxygen supply was reduced to 1 vvm, 200 rpm and 2 vvm 300 rpm in the middle of fermentation.

The experimental results are shown in Fig. 12 and Table 7.

As a result of the batch culture, 237.9 g / L of glucose was consumed in 300 g / L of glucose and 99.4 g / L of 2,3-butanediol was produced therefrom. At this time, the yield of 2,3-butanediol was 0.418 g, _{2,3- butanediol} / g _Glucose , and the productivity was 0.62 g _{2,3- Butanediol} / L / h.

As a result of the fed-batch culture, 108.6 g / L of 2,3-butanediol was produced during 70 hours of culture. At this time, the yield of 2,3-butanediol was 0.495, which was 99% of the theoretical yield. No byproducts of glycerol, acetic acid, and ethanol were produced at all and 3.5 g / L of acetone was produced. The productivity of 2,3-butanediol could be improved by minimizing the inhibitory effect of Gpd-depleted strains by glucose at high concentration through fed-batch culture. In addition, the amount of oxygen fed into the medium could regulate NADH oxidase activity, thereby assisting the growth of the strain and minimizing the production of acetone by-products.

12 is a high-concentration 2,3-butanediol fermentation profile using BD5_T2nox_dGPD1dGPD2 strain. A, batch culture; B, fed-batch culture.

Results of fermentation of BD5_T2nox_dGPD1dGPD2 strain producing high concentration of 2,3-butanediol Condition Glucose
consumed Glycerol Acetone 2,3-BD Acetate Ethanol Glycerol
yield 2,3-BD
yield 2,3-BD
productivity (g / L) (g / L) (g / L) (g / L) (g / L) (g / L) (g / g) (g / g) (g / L · h ^-1) Batch 237.9 0.5 11.3 99.4 1.3 0.2 0.002 0.418 0.62 Dumping 235.1 0.2 3.5 108.6 0.1 0 0.001 0.495 1.55

<110> SNU R & D FOUNDATION <120> Method for production of 2,3-butanediol with suppressed          production of glycerol <130> AP-2015-0193 <160> 5 <170> Kopatentin 2.0 <210> 1 <211> 1341 <212> DNA <213> Lactococcus lactis subsp. cremoris MG1363 <400> 1 atgaaaatcg tagttatcgg tacaaaccac gcaggcattg ctacagcgaa tacattactt 60 gaacaatatc ccgggcatga aattgtcatg attgaccgta atagcaacat gagttatcta 120 ggttgtggca cagcaatttg ggttggaaga caaattgaaa aaccagatga attattttat 180 gccaaagcag aggattttga ggcaaaaggg gtaaaaattt tgactgaaac agaagtttca 240 gaaattgatt ttgctaataa gaaagtttat gcaaaaacta aatctgatga tgaaataatt 300 gaagcttacg acaagcttgt tttagcaaca ggttcacgtc caattattcc taatctacca 360 ggcaaagacc ttaagggaat tcattttctg aaactttttc aagaaggtca agcaattgac 420 gcagaatttg ccaaagaaaa agtcaagcgt atcgcagtca ttggtgcagg atatatcggt 480 acagagattg cggaagcagc taaacgtcgg ggtaaagaag ttcttctctt tgacgctgaa 540 aatacttcac ttgcatcata ttatgatgaa gaatttgcca aaggaatgga tgaaaacctt 600 gctcaacatg gaattgaact tcattttgga gaactggcca aagaatttaa agcgaatgag 660 gaaggttatg tatcacaaat cgtaaccaac aaggcgactt atgatgttga tcttgtcatc 720 aattgtattg gttttactgc caacagtgcc ttggcaagtg ataagttagc taccttcaaa 780 aatggcgcaa tcaaggtgga taagcatcaa caaagtagtg atccagatgt ttacgcggta 840 ggtgatgttg cgacaattta ttctaatgcc ttgcaagatt ttacttatat cgctcttgcc 900 tcaaacgctg ttcggtcagg aattgtcgca ggacacaata ttggtggaaa agaattagaa 960 tctgttggtg ttcaaggttc taatggtatt tcgatttttg gttacaatat gacttctaca 1020 ggactttctg ttaaagctgc taaaaaatta ggtttagaag tttcatttag tgattttgaa 1080 gataaacaaa aagcttggtt tcttcatgaa aacaacgata gtgtgaaaat tcgtatcgta 1140 tatgagacaa aaagtcgcag aattattgga gcacaacttg ctagtaaaag tgagataatt 1200 gcaggaaata taaatatgtt cagtttagcg attcaagaga aaaaaacaat tgatgaacta 1260 gctttgcttg atttattctt tctcccccac ttcaacagtc catataatta tatgacagtt 1320 gcagctttga atgccaaata a 1341 <210> 2 <211> 1704 <212> DNA <213> Candida tropicalis <400> 2 atgtctgaaa ttactttggg tagattcttc tttgaaagat tgcaccaatt gcaagttgac 60 accgttttcg gtttaccagg tgattttaac ttggctttat tagataaaat ctacgaagtc 120 gatggtatga gatgggctgg taacgccaat gaattgaacg ctggttacgc tgctgatggt 180 tacgccagag ttaatccaaa tggtttggct gctttagtct ccaccttcgg tgttggtgaa 240 ttgtctttga ctaacgccat tgctggttct tactctgaac acgttggtat cattaacttg 300 gttggtgttc catcttcttc tgctcaagct aaacaattgt tgttgcacca caccttgggt 360 aacggtgatt tcactgtttt ccacagaatg ttcaagaaca tttctcaaac ttctgctttc 420 atctccgacc caaacactgc tgcttctgaa attgacagat gtatcagaga tgcttacgtt 480 taccaaagac cagtttacat tggtttgcca tctaacttgg ttgatgttaa agttccaaaa 540 tctttgttgg acaaaaaaat tgacttgtcc ttgcatccaa atgaaccaga atcccaagct 600 gaagttgttg aaaccgttga aaaattcatt tctgaagctt ctaacccagt tatcttggtt 660 gatgcttgtg ctatcagaca caactgtctt aaagaagttg ctgaattgat tgctgaaact 720 caattcccag tcttcaccac tccaatgggt aaatcaagtg ttgatgaatc caacccaaga 780 ttcggtggtg tttacgttgg ttctttgtct tctccagatg ttaaagaagc cgttgaaagt 840 gctgacttgg tcttatctgt tggtgctatg ttgtctgatt tcaacactgg tgctttctct 900 tacaactaca agaccagaaa tgttgttgaa ttccactctg attacaccaa gatcagacaa 960 gctactttcc caggtgtcca aatgaaagaa gctttgcaag ttttgttgaa gactgtcaag 1020 aaatctgtca atccaaaata cgtcccagct ccagttccag ctaccaaagc tattaccact 1080 ccaggtaaca acgacccagt ctctcaagaa tacttgtgga gaaaagtttc tgactggttc 1140 caagaaggtg atgttatcat ttctgaaacc ggtacctctg ctttcggtat tgtccaatct 1200 aaattcccaa agaatgccat tggtatttcc caagtcttgt ggggttctat tggttacgct 1260 actggtgcta cttgtggtgc tgctatggct gctcaagaaa ttgacccaaa gaagagagtt 1320 atcttgttca ctggtgatgg ttctttgcaa ttgactgtcc aagaaatctc taccatgtgt 1380 aaatgggatt gttacaacac ctatctttac gttttgaaca acgatggtta caccattgaa 1440 agattgattc acggtgaaaa agctcaatat aacgacattc aaccatggaa caacttgcaa 1500 cttttgccat tgttcaacgc taagaaatac gaaaccaaga gaatttctac tgttggtgaa 1560 ttgaacgatt tgttcactaa caaagaattt gctgttccag acagaattag aatggttgaa 1620 attatgttgc cagttatgga tgctccagct aacttggttg cccaagctaa acaatctgct 1680 gctaccaacg ctgctcaaga ataa 1704 <210> 3 <211> 289 <212> DNA <213> Saccharomyces cerevisiae <400> 3 atttggcgag cgttggttgg tggatcaagc ccacgcgtag gcaatcctcg agcagatccg 60 ccaggcgtgt atatatagcg tggatggcca ggcaacttta gtgctgacac atacaggcat 120 atatatatgt gtgcgacgac acatgatcat atggcatgca tgtgctctgt atgtatataa 180 aactcttgtt ttcttctttt ctctaaatat tctttcctta tacattagga cctttgcagc 240 ataaattact atacttctat agacacgcaa acacaaatac acacactaa 289 <210> 4 <211> 1144 <212> DNA <213> Saccharomyces cerevisiae <400> 4 caaaaacgac atatctatta tagtggggag agtttcgtgc aaataacaga cgcagcagca 60 agtaactgtg acgatatcaa ctcttttttt attatgtaat aagcaaacaa gcacgaatgg 120 ggaaagccta tgtgcaatca ccaaggtcgt cccttttttc ccatttgcta atttagaatt 180 taaagaaacc aaaagaatga agaaagaaaa caaatactag ccctaaccct gacttcgttt 240 ctatgataat accctgcttt aatgaacggt atgccctagg gtatatctca ctctgtacgt 300 tacaaactcc ggttatttta tcggaacatc cgagcacccg cgccttcctc aacccaggca 360 ccgcccccag gtaaccgtgc gcgatgagct aatcctgagc catcacccac cccacccgtt 420 gatgacagca attcgggagg gcgaaaaata aaaactggag caaggaatta ccatcaccgt 480 caccatcacc atcatatcgc cttagcctct agccatagcc atcatgcaag cgtgtatctt 540 ctaagattca gtcatcatca ttaccgagtt tgttttcctt cacatgatga agaaggtttg 600 agtatgctcg aaacaataag acgacgatgg ctctgccatt gttatattac gcttttgcgg 660 cgaggtgccg atgggttgct gaggggaaga gtgtttagct tacggaccta ttgccattgt 720 tattccgatt aatctattgt tcagcagctc ttctctaccc tgtcattcta gtattttttt 780 tttttttttt tggttttact tttttttctt cttgcctttt tttcttgtta ctttttttct 840 agtttttttt ccttccacta agctttttcc ttgatttatc cttgggttct tctttctact 900 cctttagatt ttttttttat atattaattt ttaagtttat gtattttggt agattcaatt 960 ctctttccct ttccttttcc ttcgctcccc ttccttatca atgcttgctg tcagaagatt 1020 aacaagatac acattcctta agcgaacgca tccggtgtta tatactcgtc gtgcatataa 1080 aattttgcct tcaagatcta ctttcctaag aagatcatta ttacaaacac aactgcactc 1140 aaag 1144 <210> 5 <211> 655 <212> DNA <213> Saccharomyces cerevisiae <400> 5 agtttatcat tatcaatact cgccatttca aagaatacgt aaataattaa tagtagtgat 60 tttcctaact ttatttagtc aaaaaattag ccttttaatt ctgctgtaac ccgtacatgc 120 ccaaaatagg gggcgggtta cacagaatat ataacatcgt aggtgtctgg gtgaacagtt 180 tattcctggc atccactaaa tataatggag cccgcttttt aagctggcat ccagaaaaaa 240 aaagaatccc agcaccaaaa tattgttttc ttcaccaacc atcagttcat aggtccattc 300 tcttagcgca actacagaga acaggggcac aaacaggcaa aaaacgggca caacctcaat 360 ggagtgatgc aacctgcctg gagtaaatga tgacacaagg caattgaccc acgcatgtat 420 ctatctcatt ttcttacacc ttctattacc ttctgctctc tctgatttgg aaaaagctga 480 aaaaaaaggt tgaaaccagt tccctgaaat tattccccta cttgactaat aagtatataa 540 agacggtagg tattgattgt aattctgtaa atctatttct taaacttctt aaattctact 600 tttatagtta gtcttttttt tagttttaaa acaccagaac ttagtttcga cggat 655

Claims (13)

In Saccharomyces cerevisiae for the production of 2,3-butanediol,
The GPD1 GPD2 genes and genes involved in the biosynthesis of glycerol is removed and all,
A gene encoding NADH oxidase is introduced,
Its own pyruvate decarboxylase function is lost,
A recombinant Saccharomyces cerevisiae characterized by introducing a gene PDC1 encoding pyruvate decarboxylase derived from Candida tropicalis .
The method according to claim 1,
The saccharomyces cerevisiae for the production of 2,3-butanediol,
It is transformed to express acetolactate synthase,
Acetolactate decarboxylase is transformed to be expressed,
A recombinant Saccharomyces cerevisiae characterized by being transformed to express butanediol dehydrogenase.
3. The method of claim 2,
Transforming the expression of acetolactate synthase may be accomplished by using a gene encoding alpha-acetolactate synthasealsS, &Lt; / RTI &gt;
Transforming the acetolactate decarboxylase to be expressed may be accomplished by introducing a gene encoding alpha-acetolactate decarboxylasealsD(Butanediol dehydrogenase) is expressed by introducing 2,3-butanediol hardenase (2,3-dicarboxylic anhydride) having saccharomyces cerevisiae itself, butanediol dehydrogenase)BDH1&Lt; / RTI &gt; of the recombinant Saccharomyces cerevisiae.
delete The method according to claim 1,
The loss of function of the pyruvate decarboxylase may be caused by,
A recombinant Saccharomyces cerevisiae characterized in that it is achieved by partially cleaving or completely removing any one or more genes selected from the genes PDC1 , PDC5 and PDC6 encoding pyruvate decarboxylase.
The method according to claim 1,
The gene PDC1 encoding the pyruvate decarboxylase,
Wherein the recombinant Saccharomyces cerevisiae is expressed under the GPD2 promoter.
The method according to claim 1,
The NADH oxidase may be,
A recombinant Saccharomyces cerevisiae characterized in that it is an NADH oxidase derived from Lactobacillus lactis .
The method according to claim 1,
The gene coding for the NADH oxidase may be,
The recombinant Saccharomyces cerevisiae is inserted into a p426GPD plasmid, which is a multi-copy plasmid, and uses a promoter of the TDH3 gene as a promoter.
It has been transformed to express acetolactate synthase,
Acetolactate decarboxylase is transformed to express acetolactate decarboxylase,
Butanediol dehydrogenase is transformed to be expressed,
The GPD1 GPD2 genes and genes involved in the biosynthesis of glycerol is removed,
A gene encoding NADH oxidase is introduced,
Its own pyruvate decarboxylase function is lost,
A gene PDC1 encoding the pyruvate decarboxylase derived from Candida tropicalis was introduced; Wherein the recombinant Saccharomyces cerevisiae is cultured in a medium supplemented with glucose.
delete 10. The method of claim 9,
The production method of 2,3-butanediol is not particularly limited,
Oxygen is continuously supplied to the reaction system.
12. The method of claim 11,
The continuous supply of oxygen,
Wherein the amount of oxygen fed in the middle of fermentation is kept lower than the initial amount of fermentation to continuously supply the 2,3-butanediol.
10. The method of claim 9,
The above-
Wherein the culture medium is a fed-batch culture in which glucose is continuously supplied.

Images