KR102294552B1 - Loop Mediated Isothermal Amplification Primer Set for Detection of Plum Pox Virus and Uses Thereof - Google Patents

Loop Mediated Isothermal Amplification Primer Set for Detection of Plum Pox Virus and Uses Thereof Download PDF

Info

Publication number
KR102294552B1
KR102294552B1 KR1020190165084A KR20190165084A KR102294552B1 KR 102294552 B1 KR102294552 B1 KR 102294552B1 KR 1020190165084 A KR1020190165084 A KR 1020190165084A KR 20190165084 A KR20190165084 A KR 20190165084A KR 102294552 B1 KR102294552 B1 KR 102294552B1
Authority
KR
South Korea
Prior art keywords
primer set
seq
gombovirus
detection
isothermal amplification
Prior art date
Application number
KR1020190165084A
Other languages
Korean (ko)
Other versions
KR20210074078A (en
Inventor
조인숙
양창열
권선정
윤주연
권태룡
Original Assignee
대한민국
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대한민국 filed Critical 대한민국
Priority to KR1020190165084A priority Critical patent/KR102294552B1/en
Publication of KR20210074078A publication Critical patent/KR20210074078A/en
Application granted granted Critical
Publication of KR102294552B1 publication Critical patent/KR102294552B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 자두곰보바이러스의 검출을 위한 고리매개 등온증폭 프라이머 세트 및 이의 용도에 관한 것으로, 자두곰보바이러스에 민감하고 특이적이므로, 자두곰보바이러스의 효과적인 검출에 따른 자두곰보바이러스의 현장 진단에 유용하게 활용될 수 있다.The present invention relates to a ring-mediated isothermal amplification primer set for the detection of P. gombovirus and its use, and since it is sensitive and specific to P. gombovirus, it is usefully used for on-site diagnosis of P. gombovirus according to the effective detection of P. gombovirus can be

Description

자두곰보바이러스의 검출을 위한 고리매개 등온증폭 프라이머 세트 및 이의 용도{Loop Mediated Isothermal Amplification Primer Set for Detection of Plum Pox Virus and Uses Thereof}Loop Mediated Isothermal Amplification Primer Set for Detection of Plum Pox Virus and Uses Thereof

본 발명은 자두곰보바이러스의 검출을 위한 고리매개 등온증폭 프라이머 세트 및 이의 용도에 관한 것이다.The present invention relates to a set of loop-mediated isothermal amplification primers for the detection of P. gombovirus and uses thereof.

자두곰보바이러스(Plum pox virus, PPV)는 핵과류의 잎과 과일에 괴저, 심한 모자이크, 원형반점 증상을 나타내는 자두곰보병의 원인이다. 자두곰보병은 식물 바이러스병으로는 국내 유일 검역 금지급 병이며(Shin과 Lee, 2013), 기후 품종, 바이러스 발생 계통 등에 따라 수확량이 75 내지 100% 감소한다고 보고되었다(Cambra 등, 2006; Dunez와 Sutic, 1998; Garcia 등, 2014; Nemeth, 1994). 2014년 전후로 세계적으로 약 50개국에서 발생하고 있다. 유럽에서는 지난 30년 동안 자두곰보병 확산 방지를 위하여 약 1억 주의 나무가 제거되었고, 10억 유로의 경제적 피해가 나타난 것으로 보고되었다(Cambra 등, 2006; Mumford, 2006; Myrta 등, 2006; Ramel 등, 2006; Speich, 2006). 미국 펜실베이니아 주의 경우 2000 내지 2006년 D 계통의 자두곰보바이러스 발생에 의해 나무 2,595주가 제거되었고, 29백만 달러의 비용 손실이 나타난 것으로 보고되었다(Redding, 2010). 즉, 자두곰보바이러스의 확산을 방지하기 위하여, 자두곰보바이러스의 감염 여부를 조기에 확인하여 감염주를 제거하는 것이 중요하다.Plum pox virus (PPV) is the cause of Plum pneumonia, which presents with gangrene, severe mosaicism, and circular spots on the leaves and fruits of nuclear fruits. Prunus prunus disease is the only plant virus disease in Korea that cannot be quarantined (Shin and Lee, 2013), and it has been reported that the yield decreases by 75 to 100% depending on the climate variety and virus generation line (Cambra et al., 2006; Dunez and colleagues). Sutic, 1998; Garcia et al., 2014; Nemeth, 1994). Since 2014, it has occurred in about 50 countries worldwide. In Europe, it has been reported that about 100 million trees were removed to prevent the spread of Prunus Prunus pneumoniae over the past 30 years, and an economic loss of 1 billion euros occurred (Cambra et al., 2006; Mumford, 2006; Myrta et al., 2006; Ramel et al. , 2006; Speich, 2006). In the case of Pennsylvania, USA, 2,595 trees were removed due to the Plumgombovirus outbreak of strain D from 2000 to 2006, and a cost loss of $29 million was reported (Redding, 2010). That is, in order to prevent the spread of P. P. Gombo virus, it is important to check whether P. Gombo virus is infected at an early stage and remove the infected strain.

최근까지 개발된 중합효소 연쇄 반응(polymerase chain reaction: PCR) 방법의 종류로는, 증폭에 소요되는 시간을 줄인 래피드 PCR(rapid PCR), 시료의 정제 과정을 생략하는 직접 PCR(direct PCR), 역전사 반응과 PCR을 결합시켜 RNA를 주형으로 사용한 역전사 효소-PCR(reverse transcriptase PCR; RT-PCR), 상온에서 일어나는 비특이 증폭을 획기적으로 감소시켜 PCR 반응의 특이성(specificity)을 개선시킨 핫-스타트 PCR(hot-start PCR), PCR 반응의 실시간 모니터링(monitering)이 가능한 실시간 PCR(real-time PCR) 등이 있다. 이외에도 다양한 PCR 방법 및 관련 기술이 개발되었다.The types of polymerase chain reaction (PCR) methods developed until recently include rapid PCR, which reduces the time required for amplification, direct PCR, which omits the purification process of the sample, and reverse transcription. Reverse transcriptase PCR (RT-PCR) using RNA as a template by combining the reaction and PCR, and hot-start PCR that dramatically reduces non-specific amplification that occurs at room temperature and improves the specificity of the PCR reaction (hot-start PCR) and real-time PCR (real-time PCR) capable of real-time monitoring of a PCR reaction. In addition, various PCR methods and related technologies have been developed.

그러나, 기존의 PCR 방법은 사이클의 반복에 의해 증폭이 진행되므로, 증폭에 많은 시간이 소요되며, 증폭에 사용되는 장치의 구성이 복잡하다. 또한, 증폭을 위한 온도 등의 조건을 최적화하는 데에도 많은 시간이 소요되며, 이에 숙련된 기술을 필요로 하므로, 신속한 바이러스의 검출에 기존의 PCR 방법을 사용하는 것은 적합하지 못하다.However, in the conventional PCR method, amplification is performed by repetition of a cycle, so it takes a lot of time for amplification, and the configuration of a device used for amplification is complicated. In addition, it takes a lot of time to optimize conditions such as temperature for amplification, and it requires skilled techniques, so it is not suitable to use the conventional PCR method for rapid virus detection.

한편, 고리매개 등온증폭(Loop mediated isothermal amplification, LAMP)은 기본적으로 6개의 프라이머를 이용하여, 양끝을 루프모양처럼 합성하여 유전자의 특정 부위를 무한대로 증폭하고, 증폭된 DNA 산물을 형광 검출용 시약을 이용하거나 침전 반응시켜 증폭유무를 확인하는 방법이다. LAMP는 기존 PCR법과 달리 PCR 사이클이 필요하지 않은 Bst 중합효소를 이용하여 등온의 조건에서 반응을 수행하기 때문에, 대상 물질을 60분 내에 신속하게 검출할 수 있다. 또한, 등온에서 증폭을 진행하기 때문에, 증폭 장치를 간단하게 구성할 수 있어, 휴대하기 용이한 형태로 제작이 가능하므로, 현장에서 신속한 검출에 적합하다.On the other hand, loop mediated isothermal amplification (LAMP) basically uses six primers to synthesize both ends like a loop to infinitely amplify a specific region of a gene, and to use the amplified DNA product as a reagent for fluorescence detection It is a method to confirm the presence or absence of amplification by using or precipitation reaction. Unlike the conventional PCR method, LAMP uses Bst polymerase, which does not require a PCR cycle, and performs the reaction under isothermal conditions, so that a target substance can be quickly detected within 60 minutes. In addition, since amplification is carried out at isothermal temperature, the amplification device can be easily constructed and can be manufactured in a portable form, which is suitable for rapid detection in the field.

이에 본 발명자들은 자두곰보바이러스를 특이적으로 검출할 수 있는 LAMP용 프라이머 세트를 제작하고, 이를 이용하여 자두곰보바이러스를 검출함으로써, 본 발명을 완성하였다.Accordingly, the present inventors completed the present invention by preparing a primer set for LAMP capable of specifically detecting Prungombovirus, and detecting Plumgombovirus using the primer set.

대한민국 특허공개 제10-2014-0076707호Korean Patent Publication No. 10-2014-0076707

본 발명의 하나의 목적은 서열번호 1 내지 6의 염기서열로 이루어진 자두곰보바이러스(plum pox virus, PPV) 검출용 고리매개 등온증폭(Loop mediated isothermal amplification, LAMP) 프라이머 세트를 제공하는 것이다.One object of the present invention is to provide a loop mediated isothermal amplification (LAMP) primer set for detecting plum pox virus (PPV) consisting of the nucleotide sequences of SEQ ID NOs: 1 to 6.

본 발명의 다른 목적은 서열번호 25 내지 30의 염기서열로 이루어진 자두곰보바이러스(plum pox virus, PPV) 검출용 고리매개 등온증폭(Loop mediated isothermal amplification, LAMP) 프라이머 세트를 제공하는 것이다.Another object of the present invention is to provide a loop mediated isothermal amplification (LAMP) primer set for detecting plum pox virus (PPV) consisting of the nucleotide sequence of SEQ ID NOs: 25 to 30.

본 발명의 또 다른 목적은 상기 고리매개 등온증폭 프라이머 세트를 포함하는 자두곰보바이러스 검출용 조성물을 제공하는 것이다.Another object of the present invention is to provide a composition for detecting Prunus gombovirus comprising the ring-mediated isothermal amplification primer set.

본 발명의 또 다른 목적은 시료에서 RNA를 분리하는 단계; 및 상기 RNA를 주형으로 하고, 제 1 항 또는 제 2 항의 프라이머 세트를 이용하여 고리매개 등온증폭반응을 수행하여 표적 서열을 증폭하는 단계를 포함하는 자두곰보바이러스의 검출 방법을 제공하는 것이다.Another object of the present invention is to isolate RNA from a sample; and using the RNA as a template and performing a ring-mediated isothermal amplification reaction using the primer set of claim 1 or 2 to amplify the target sequence.

본 발명의 일 양상은 서열번호 1 내지 6의 염기서열로 이루어진 자두곰보바이러스(plum pox virus, PPV) 검출용 고리매개 등온증폭(Loop mediated isothermal amplification, LAMP) 프라이머 세트를 제공한다.One aspect of the present invention provides a set of loop mediated isothermal amplification (LAMP) primers for detecting plum pox virus (PPV) consisting of the nucleotide sequences of SEQ ID NOs: 1 to 6.

본 발명의 다른 양상은 서열번호 25 내지 30의 염기서열로 이루어진 자두곰보바이러스(plum pox virus, PPV) 검출용 고리매개 등온증폭(Loop mediated isothermal amplification, LAMP) 프라이머 세트를 제공한다.Another aspect of the present invention provides a loop mediated isothermal amplification (LAMP) primer set for detecting plum pox virus (PPV) consisting of the nucleotide sequence of SEQ ID NOs: 25 to 30.

자두곰보바이러스(PPV)는 660 내지 770nm 사상형의 single stranded RNA 바이러스로 Potyvirus 과에 속하며(Adams 등, 2011; Lopez-Moya 등, 1999), 주로 조팝나무진딧물, 복숭아혹진딧물 등 20종의 진딧물에 의한 비영속 전염 및 바이러스에 감염된 대목 또는 접수를 통해 전염이 된다고 보고되었다(Fereres와 Moreno, 2009; Goytia 등, 2006; Lopez-Moya 등, 1995). 자두곰보바이러스는 혈청학적 및 분자학적으로 지금까지 9개 계통(D, M, Rec, EA, C, T, W, CR, An)이 보고되었으며(Glasa 등, 2013), 그 중 D(Dideron) 계통은 세계적으로 가장 많이 발생하는 계통으로 진딧물, 접목 전염이 되며, 확산 속도가 느린 것으로 보고되었다(Dallot 등, 1998; Damsteegt 등, 2007; Labonne 등, 1994). M(Marcus) 계통은 유럽, 캐나다 및 2016년 일본 매실에서 발생하는 것으로 보고되었으며(Oishi 등, 2018), 진딧물, 접목, 즙액, 종자전염이 되고, 확산 속도가 빠른 것으로 보고되었다(Candresse 등, 1993). 그 외에 D 계통과 M 계통의 재조합 Rec 계통(Glasa 등, 2002), C(Cherry), CR 체리에 발생되는 계통 등이 보고되었다(Glasa 등, 2013). Prunus gombovirus (PPV) is a 660-770 nm filamentous single-stranded RNA virus belonging to the Potyvirus family (Adams et al., 2011; Lopez-Moya et al., 1999). It has been reported that non-persistent transmission by infection and transmission through virus-infected stocks or receptions (Fereres and Moreno, 2009; Goytia et al., 2006; Lopez-Moya et al., 1995). Nine strains (D, M, Rec, EA, C, T, W, CR, An) have been reported serologically and molecularly for P. gombovirus so far (Glasa et al., 2013), of which D (Dideron) The lineage is the most common line in the world and is transmitted by aphids and grafting, and it has been reported that the rate of spread is slow (Dallot et al., 1998; Damsteegt et al., 2007; Labonne et al., 1994). The M (Marcus) strain was reported to occur in European, Canadian and Japanese plums in 2016 (Oishi et al., 2018), and was reported to be transmitted by aphids, grafts, sap, and seeds, and to spread rapidly (Candresse et al., 1993). ). In addition, D and M strains of recombinant Rec strains (Glasa et al., 2002), C (Cherry), and CR strains occurring in cherries have been reported (Glasa et al., 2013).

고리매개등온 증폭법은 기존의 중합효소연쇄반응법(PCR)과는 달리 가닥 치환 활성(strand displacement activity)이 높은 Bst 중합효소를 사용하여 3단계의 온도변화 없이 일정한 온도에서 접합 및 신장이 가능하기 때문에, 반응 시간이 60분 내외로 짧고, 온도변화에 따른 DNA 손실 및 손상이 없으며, 일정온도만 유지하면 되기 때문에 고가의 장비가 필요없어 현장 활용성이 높다. 또한 증폭하고자 하는 유전자 서열의 6개 부위를 인지하는 특이적인 6개의 프라이머를 이용하기 때문에 표적 유전자에 대한 특이성이 매우 높다.Unlike the existing polymerase chain reaction (PCR), the ring-mediated isothermal amplification method uses a Bst polymerase with high strand displacement activity to enable conjugation and elongation at a constant temperature without changing the temperature in three steps. Therefore, the reaction time is short (about 60 minutes), there is no DNA loss or damage due to temperature change, and since it only needs to maintain a constant temperature, it does not require expensive equipment and thus has high field applicability. In addition, the specificity for the target gene is very high because 6 specific primers that recognize 6 sites of the gene sequence to be amplified are used.

본 발명의 자두곰보바이러스에 특이적인 LAMP 프라이머 세트는 자두곰보바이러스에 민감하고 특이적이기 때문에 이를 효과적으로 구분하여 검출할 수 있다. 따라서, 본 발명의 LAMP 프라이머 세트는 자두곰보바이러스 감염 진단에 유용하게 활용될 수 있다.Since the LAMP primer set specific for Prungombovirus of the present invention is sensitive and specific to Plumgombovirus, it can be effectively discriminated and detected. Therefore, the LAMP primer set of the present invention can be usefully used for diagnosing P. gombovirus infection.

본 발명에 따른 표적 유전 물질의 고리매개 등온증폭은 하기의 과정으로 수행될 수 있다.The ring-mediated isothermal amplification of the target genetic material according to the present invention may be performed by the following process.

우선, 핵산 성분을 포함하는 표적 유전물질이 포함되어 있는지 판단하고자 하는 시료를 전처리한다.First, a sample to be determined whether a target genetic material including a nucleic acid component is included is pretreated.

본 발명의 일 구체예에 따르면, 상기 시료는 복숭아 나무일 수 있다.According to one embodiment of the present invention, the sample may be a peach tree.

시료의 전처리 방법은 예를 들어, 자동핵산추출기(NucliSENS easyMAG system, bioMerieux)를 사용하여 바이러스 배양액으로부터 RNA를 추출하거나, QIAamp® Viral RNA Mini Kit(50)(QIAGEN, 독일)를 사용한 통상적인 RNA 추출 과정일 수 있으나, 이에 한정되는 것은 아니다.The sample pretreatment method is, for example, extracting RNA from the virus culture using an automatic nucleic acid extractor (NucliSENS easyMAG system, bioMerieux), or conventional RNA extraction using the QIAamp® Viral RNA Mini Kit (50) (QIAGEN, Germany). It may be a process, but is not limited thereto.

다음으로, 전처리된 시료와 표적 유전물질에 반응하는 시약을 혼합한다. 예를 들어, 표적 유전 물질에 결합하는 6개의 프라이머 세트(F3, B3, LoopF, LoopB, FIP 및 BIP)와 10X Bst 버퍼, Bst 폴리머라아제, AMV 역전사효소, MgSO4 등의 시약이 사용될 수 있다. 프라이머 세트로는 서열번호 1 내지 6의 염기서열로 이루어진 프라이머 세트 및/또는 서열번호 25 내지 30의 염기서열로 이루어진 프라이머 세트가 사용된다.Next, the pretreated sample and a reagent reacting with the target genetic material are mixed. For example, a set of six primers (F3, B3, LoopF, LoopB, FIP, and BIP) binding to the target genetic material and reagents such as 10X Bst buffer, Bst polymerase, AMV reverse transcriptase, MgSO 4 may be used. . As the primer set, a primer set consisting of a nucleotide sequence of SEQ ID NOs: 1 to 6 and/or a primer set consisting of a nucleotide sequence of SEQ ID NOs: 25 to 30 are used.

본 발명에서는 자두곰보바이러스 RNA를 특이적으로 증폭시킬 수 있는 프라이머 세트를 확인하기 위하여 선별을 진행하였다. 그 결과, 서열번호 1 내지 6의 염기서열로 이루어진 프라이머 세트 및 서열번호 25 내지 30의 염기서열로 이루어진 프라이머 세트가 자두곰보바이러스에 특이적임을 확인하였다.In the present invention, selection was performed to confirm a primer set capable of specifically amplifying Prunus gombovirus RNA. As a result, it was confirmed that the primer set consisting of the nucleotide sequences of SEQ ID NOs: 1 to 6 and the primer set consisting of the nucleotide sequences of SEQ ID NOs: 25 to 30 were specific to Prunus Gombovirus.

그 후, 시약을 혼합한 전처리된 시료를 MiniOpticon Real-Time machine과 같은 장비를 사용하여 실시간으로 증폭, 예를 들어, 60분 동안 반응시켜 증폭할 수 있다.Thereafter, the pretreated sample mixed with the reagent may be amplified in real time using equipment such as a MiniOpticon Real-Time machine, for example, by reacting for 60 minutes.

본 발명의 일 구체예에 따르면, 상기 등온증폭반응은 65℃에서 수행될 수 있다.According to one embodiment of the present invention, the isothermal amplification reaction may be performed at 65 °C.

등온증폭반응은 서열번호 1 내지 6의 염기서열로 이루어진 프라이머 세트 또는 서열번호 25 내지 30의 염기서열로 이루어진 프라이머 세트를 사용하여 60℃ 내지 65℃에서 수행될 수 있으며, 바람직하게는, 65℃에서 수행될 수 있다.The isothermal amplification reaction may be carried out at 60° C. to 65° C. using a primer set consisting of a nucleotide sequence of SEQ ID NOs: 1 to 6 or a primer set consisting of a nucleotide sequence of SEQ ID NOs: 25 to 30, preferably at 65° C. can be performed.

본 발명의 일 구체예에 따르면, 상기 등온증폭반응은 60분 동안 수행될 수 있다.According to one embodiment of the present invention, the isothermal amplification reaction may be performed for 60 minutes.

등온증폭반응은 서열번호 1 내지 6의 염기서열로 이루어진 프라이머 세트 또는 서열번호 25 내지 30의 염기서열로 이루어진 프라이머 세트를 사용하여 40분 내지 60분 동안 수행될 수 있고, 바람직하게는, 50분 내지 60분 동안 수행될 수 있으며, 가장 바람직하게는 60분 동안 수행될 수 있다.The isothermal amplification reaction may be performed for 40 minutes to 60 minutes using a primer set consisting of a nucleotide sequence of SEQ ID NOs: 1 to 6 or a primer set consisting of a nucleotide sequence of SEQ ID NOs: 25 to 30, preferably, from 50 minutes to It may be carried out for 60 minutes, and most preferably, it may be carried out for 60 minutes.

본 발명의 각 프라이머에는 검출의 편의성을 높이기 위해, 검출용 표지가 추가로 포함될 수 있다. 검출용 표지는 프라이머에 연결, 결합, 또는 부착시켜 통상적인 방식으로 증폭산물의 밀도, 농도, 양 등을 확인할 수 있는 화합물, 생체 분자 또는 생체 분자 유사체 등일 수 있다.In order to increase the convenience of detection, each primer of the present invention may further include a detection label. The detection label may be a compound, a biomolecule, or a biomolecule analog, etc. capable of confirming the density, concentration, amount, etc. of an amplification product in a conventional manner by linking, binding, or attaching to a primer.

본 발명의 또 다른 양상은 상기 고리매개 등온증폭 프라이머 세트를 포함하는 자두곰보바이러스 검출용 조성물을 제공한다.Another aspect of the present invention provides a composition for detecting Plum gombovirus comprising the ring-mediated isothermal amplification primer set.

본 발명의 일 구체예에 따른 LAMP 조성물은 LAMP를 위한 중합효소(polymerase), dNTP 혼합물 및/또는 반응완충액(buffer)이 더 포함될 수 있다. 자두곰보바이러스는 RNA 바이러스이기 때문에 증폭을 위해서는 역전사(reverse transcription)과정이 추가된 역전사 고리매개 등온증폭법(RT-LAMP)이 이용될 수 있다.The LAMP composition according to an embodiment of the present invention may further include a polymerase for LAMP, a dNTP mixture, and/or a reaction buffer. Since prunes gombovirus is an RNA virus, reverse transcription loop-mediated isothermal amplification (RT-LAMP) with a reverse transcription process can be used for amplification.

또한, 본 발명의 일 구체예에 따른 LAMP 조성물은 검출의 편의성을 높이기 위해, 검출용 표지 화합물이 더 포함될 수 있다. 검출용 표지 화합물은 증폭과정에서 증폭산물에 포함되거나 증폭산물에 물리적으로 삽입되어 통상적인 방식으로 증폭산물의 밀도, 농도, 양 등을 확인할 수 있는 화합물일 수 있다. 예를 들어, 검출 민감도 등을 고려하여 SyberGreen과 같은 fluorescent DNA binding dye가 사용될 수 있다.In addition, the LAMP composition according to an embodiment of the present invention may further include a labeling compound for detection in order to increase the convenience of detection. The detection label compound may be a compound that is included in the amplification product during the amplification process or is physically inserted into the amplification product to confirm the density, concentration, amount, etc. of the amplification product in a conventional manner. For example, a fluorescent DNA binding dye such as SyberGreen may be used in consideration of detection sensitivity and the like.

본 발명의 또 다른 양상은 서열번호 1 내지 6의 염기서열로 이루어진 자두곰보바이러스 검출용 고리매개 등온증폭 프라이머 세트를 포함하는 자두곰보바이러스 검출용 키트를 제공한다.Another aspect of the present invention provides a kit for detecting Prungombovirus comprising a ring-mediated isothermal amplification primer set for detecting Plumgombovirus consisting of the nucleotide sequences of SEQ ID NOs: 1 to 6.

본 발명의 또 다른 양상은 서열번호 25 내지 30의 염기서열로 이루어진 자두곰보바이러스 검출용 고리매개 등온증폭 프라이머 세트를 포함하는 자두곰보바이러스 검출용 키트를 제공한다.Another aspect of the present invention provides a kit for detecting Prungombovirus comprising a ring-mediated isothermal amplification primer set for detecting Prungombovirus consisting of the nucleotide sequences of SEQ ID NOs: 25 to 30.

본 발명의 키트는 증폭 반응을 수행하기 위해 Bst Polymerase, dNTPs 및/또는 완충액 등을 포함할 수 있다 또한, 본 발명의 키트는 최적의 반응 수행 조건을 기재한 사용자 설명 및/또는 LAMP를 수행하는데 부수적으로 필요한 도구나 시약 등이 더 포함될 수 있다.The kit of the present invention may include Bst Polymerase, dNTPs, and/or a buffer, etc. for carrying out an amplification reaction. In addition, the kit of the present invention is a user description describing optimal conditions for performing the reaction and/or is incidental to performing LAMP. As such, necessary tools or reagents may be further included.

본 발명의 일 구체예에 따르면, 상기 검출은 복숭아 나무의 자두곰보바이러스 검출일 수 있다.According to one embodiment of the present invention, the detection may be the detection of Plum Gombovirus in peach trees.

본 발명의 프라이머 세트는 자두곰보바이러스 중 특히 복숭아 나무에 감염된 자두곰보바이러스의 검출에 특히 유용하게 활용될 수 있다.The primer set of the present invention can be particularly usefully used to detect Prungomboviruses infected with peach trees, among Plumgomboviruses.

본 발명의 또 다른 양상은 시료에서 RNA를 분리하는 단계; 및 상기 RNA를 주형으로 하고, 제 1 항 또는 제 2 항의 프라이머 세트를 이용하여 고리매개 등온증폭반응을 수행하여 표적 서열을 증폭하는 단계를 포함하는 자두곰보바이러스의 검출 방법을 제공한다.Another aspect of the present invention comprises the steps of isolating RNA from a sample; and using the RNA as a template and performing a ring-mediated isothermal amplification reaction using the primer set of claim 1 or 2 to amplify the target sequence.

본 발명의 자두곰보바이러스의 검출 방법에 있어서, 전술한 내용과 중복되는 부분은 전술한 의미와 동일한 의미로 사용될 수 있다.In the method for detecting Prunus gombovirus of the present invention, portions overlapping with the above description may be used with the same meaning as the above description.

상기 증폭 산물의 검출은 예를 들어, 탁색도, 침전물 생성, SyberGreen을 이용한 형광 측정, DNA laddering, 모세관 전기영동, DNA 칩, 겔 전기영동, 방사성 측정, 형광 측정 또는 인광 측정을 통하여 수행될 수 있으나, 이에 한정되지 않는다.The detection of the amplification product may be performed, for example, through turbidity, precipitate generation, fluorescence measurement using SyberGreen, DNA laddering, capillary electrophoresis, DNA chip, gel electrophoresis, radiometric measurement, fluorescence measurement or phosphorescence measurement. , but not limited thereto.

검출의 편의성을 높이기 위해 프라이머에 검출용 표지를 추가하거나 별도의 검출용 표지 화합물을 사용할 수 있다. 예를 들어, 작업의 용이성, 검출 민감도 등을 고려하여 SyberGreen과 같은 fluorescent DNA binding dye를 사용할 수 있다. 이 경우, 반응액 중 형광염색제를 실시간으로 검출할 수 있는 장비를 이용하여 별도의 전기영동(electrophoresis)이나 SyberGreen등의 추가 없이 실시간으로 증폭을 확인하고, anneal peak를 통해서 표적서열의 증폭 여부를 확인할 수 있다. 형광염색제를 검출할 수 있는 장비 중에는 현재 휴대가 용이하도록 가볍고 작은 크기로 이루어진 장비들이 있으므로, 이러한 장비를 이용하여 본 발명의 검출방법을 수행하면 야외에서도 신속하게 자두곰보바이러스의 검출이 가능하다.In order to increase the convenience of detection, a detection label may be added to the primer or a separate detection label compound may be used. For example, a fluorescent DNA binding dye such as SyberGreen may be used in consideration of easiness of operation and detection sensitivity. In this case, using equipment that can detect the fluorescent dye in the reaction solution in real time, check the amplification in real time without additional electrophoresis or SyberGreen, and check whether the target sequence is amplified through the anneal peak. can Among the equipment capable of detecting a fluorescent dye, there are currently light and small-sized equipment for easy portability.

본 발명의 일 구체예에 따르면, 상기 시료는 복숭아 나무일 수 있다.According to one embodiment of the present invention, the sample may be a peach tree.

따라서, 본 발명의 자두곰보바이러스에 특이적인 프라이머 세트를 사용한 검출 방법을 통하여, 야외에서 자두곰보바이러스를 특이적으로 신속하게 진단할 수 있으며, 신속면역진단기법(Rapid immunodiagnostic test, RIDT) 보다는 민감하고 정확하게, 역전사중합효소연쇄반응법(RT-PCR) 보다는 민감하고 신속하게 자두곰보바이러스를 검출할 수 있으므로, 자두곰보바이러스의 신속진단 및 감염 진단법으로 유용하게 활용될 수 있다.Therefore, through the detection method using the primer set specific for P. gombo virus of the present invention, P. gombo virus can be specifically and quickly diagnosed outdoors, and it is more sensitive than the rapid immunodiagnostic test (RIDT). Precisely, since it can detect P. gombovirus more sensitively and more quickly than reverse transcriptase chain reaction (RT-PCR), it can be usefully used as a rapid diagnosis and infection diagnosis method for P. gombovirus.

자두곰보바이러스의 검출을 위한 고리매개 등온증폭 프라이머 세트 및 이의 용도에 따르면, 자두곰보바이러스에 민감하고 특이적이므로, 자두곰보바이러스의 효과적인 검출에 따른 자두곰보바이러스의 현장 진단에 유용하게 활용될 수 있다.According to the ring-mediated isothermal amplification primer set for detection of P. gombovirus and its use, since it is sensitive and specific to P. gombovirus, it can be usefully used for on-site diagnosis of P. gombovirus according to the effective detection of P. gombovirus.

도 1은 자두곰보바이러스 검출을 위한 고리매개 등온증폭(LANP) 프라이머 세트를 선별한 결과를 나타낸 그림이다.
도 2는 자두곰보바이러스 검출을 위한 LANP 반응의 최적 프라이머 농도, 온도 및 시간 조건을 나타낸 그림이다.
도 3은 자두곰보바이러스 검출을 위한 LANP 반응의 최적 형광 발색 조건을 나타낸 그림이다.
도 4는 자두곰보바이러스 검출을 위한 LANP 반응의 검출 민감도를 나타낸 그림이다.
도 5는 복숭아 나무에서 본 발명의 LAMP 프라이머 세트를 사용하여 자두곰보바이러스를 검출한 결과를 나타낸 사진이다.1 is a diagram showing the results of screening a set of loop-mediated isothermal amplification (LANP) primers for detecting Plum gombovirus.
Figure 2 is a diagram showing the optimal primer concentration, temperature, and time conditions of the LANP reaction for detecting Plum gombovirus.
3 is a diagram showing the optimal fluorescence conditions for LANP reaction for detection of Plumgombovirus.
4 is a diagram showing the detection sensitivity of the LANP reaction for detecting Plum Gombovirus.
5 is a photograph showing the result of detecting Plum gombovirus using the LAMP primer set of the present invention in peach trees.

이하 본 발명을 하나 이상의 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail through one or more embodiments. However, these examples are for illustrative purposes of the present invention, and the scope of the present invention is not limited to these examples.

실시예 1. 복숭아 감염주 자두곰보바이러스 분리 및 RNA 추출Example 1. Peach-infected strain Prungombovirus isolation and RNA extraction

복숭아 감염주에서 분리한 자두곰보바이러스로부터 RNA를 추출하기 위하여 자동핵산추출기(NucliSENS easyMAG system, bioMerieux)를 사용하여 바이러스 배양액으로부터 RNA를 추출하였다.RNA was extracted from the virus culture medium using an automatic nucleic acid extractor (NucliSENS easyMAG system, bioMerieux) in order to extract RNA from Prungombovirus isolated from peach-infected strains.

실시예 2. LAMP 진단 특이 프라이머 제작Example 2. Preparation of LAMP diagnostic-specific primers

표적 유전물질을 LAMP를 통해 검출하기 위하여, 실시예 1에서 분리한 복숭아 감염주 자두곰보바이러스(plum pox virus, PPV)의 전체 RNA 염기서열(GenBank number: LC333553, Plum pox virus D Peach-J762 genomic RNA, complete genome Coat protein region(8431-9420))을 기반으로, Primer Explore(http://primerexplorer.jp/e/index.html)를 사용하여 고리매개 등온증폭(Loop mediated isothermal amplification, LAMP) 프라이머를 제작하였다. 제 1 프라이머 세트 내지 제 6 프라이머세트는 자체 제작하였고 제 7 프라이머 세트는 국외 논문(Varga 등, 2006)에 게재된 프라이머 세트를 사용하였으며, 프라미머 세트 중 자두곰보바이러스에 특이적으로 증폭하는 프라이머 서열을 선별하였다.In order to detect the target genetic material through LAMP, the total RNA sequence (GenBank number: LC333553, Plum pox virus D Peach-J762 genomic RNA of the peach infectious strain plum pox virus, PPV) isolated in Example 1 , complete genome Coat protein region (8431-9420)), using Primer Explore (http://primerexplorer.jp/e/index.html), loop mediated isothermal amplification (LAMP) primers were produced. The first to sixth primer sets were self-made, and the seventh primer set used a primer set published in an international paper (Varga et al., 2006). Among the primer sets, a primer sequence specifically amplifying P. gombovirus. was selected.

하기 표 1은 LAMP에 사용한 각 프라이머 세트의 염기서열을 나타낸 것이다.Table 1 below shows the nucleotide sequence of each primer set used for LAMP.

프라이머명Primer name LAMP 프라이머 염기서열(5'→3')LAMP primer sequence (5'→3') 서열번호SEQ ID NO: 제 1
프라이머 세트No. 1
Primer set F3-1F3-1 TTCAGTAACGTTGCTGAAGCGTTCAGTAACGTTGCTGAAGCG 서열번호 1SEQ ID NO: 1 B3-1B3-1 TTGCGATTAACATCACCAGCGTTGCGATTAACATCACCAGCG 서열번호 2SEQ ID NO: 2 FIP-1FIP-1 CATATCTGGCGAGGCTGTAGTAGCATACATGCCAAGGTATGGACATATTCTGGCGAGGCTGTAGTAGCATACATGCCAAGGTATGGA 서열번호 3SEQ ID NO: 3 BIP-1BIP-1 GCACGTGAAGCTCATATCCAGGACGTTTCCATCCAAGCCAAAGCACGTGAAGCTCATATCCAGGACGTTTCCATCCAAGCCAAA 서열번호 4SEQ ID NO: 4 LoopF-1LoopF-1 CTGTCAGGTTGCGCTGAATCTGTCAGGTTGCGCTGAAT 서열번호 5SEQ ID NO: 5 LoopB-1LoopB-1 ATGAAGGCAGCAGCATTGAGATGAAGGCAGCAGCATTGAG 서열번호 6SEQ ID NO: 6 제 2
프라이머 세트2nd
Primer set F3-1F3-1 CAGCAACAACTCAACCAGCACAGCAACAACTCAACCAGCA 서열번호 7SEQ ID NO: 7 B3-1B3-1 GCCTTTCCCTTCACCTTTGGGCCTTTCCCTTCACCTTTGG 서열번호 8SEQ ID NO: 8 FIP-1FIP-1 CGCGTTTGAGTTGCTAGGTGTTCCACAGGTGTCAGGACCCGCGTTTGAGTTGCTAGGTGTTCCACAGGTGTCAGGACC 서열번호 9SEQ ID NO: 9 BIP-1BIP-1 GTCAACACAAACAGAGACAGGGCCTTCAAGCGTGGCACTGGTCAACACAAACAGAGACAGGGCCTTCAAGCGTGGCACTG 서열번호 10SEQ ID NO: 10 LoopF-1LoopF-1 AGGCATCCTCATTACCATGTGTAGGCATCCTCATTACCATGTGT 서열번호 11SEQ ID NO: 11 LoopB-1LoopB-1 GATGCAGGATCAATTGGCACTTGATGCAGGATCAATTGGCACTT 서열번호 12SEQ ID NO: 12 제 3
프라이머 세트third
Primer set F3-1F3-1 AGCATACATGCCAAGGTATGGAAGCATACATGCCAAGGTATGGA 서열번호 13SEQ ID NO: 13 B3-1B3-1 TTGCGATTAACATCACCAGCGTTGCGATTAACATCACCAGCG 서열번호 14SEQ ID NO: 14 FIP-1FIP-1 GGTGTCGTTGAAGTCATTTCGTAGCGCAACCTGACAGACTGGTGTCGTTGAAGTCATTTCGTAGCGCAACCTGACAGACT 서열번호 15SEQ ID NO: 15 BIP-1BIP-1 GCACGTGAAGCTCATATCCAGGACGTTTCCATCCAAGCCAAAGCACGTGAAGCTCATATCCAGGACGTTTCCATCCAAGCCAAA 서열번호 16SEQ ID NO: 16 LoopF-1LoopF-1 GGCATATCTGGCGAGGCTGGCATATCTGGCGAGGCT 서열번호 17SEQ ID NO: 17 LoopB-1LoopB-1 ATGAAGGCAGCAGCATTGAGATGAAGGCAGCAGCATTGAG 서열번호 18SEQ ID NO: 18 제 4
프라이머 세트4th
Primer set F3-1F3-1 CACGCCAGCAACAACTCAACACGCCAGCAACAACTCAA 서열번호 19SEQ ID NO: 19 B3-1B3-1 CTGTGCAGGACTATAATGTGCCCTGTGCAGGACTATAATGTGCC 서열번호 20SEQ ID NO: 20 FIP-1FIP-1 GTCCCTGTCTCTGTTTGTGTTGACACATGGTAATGAGGATGCCTGTCCCTGTCTCTGTTTGTGTTGACACATGGTAATGAGGATGCCT 서열번호 21SEQ ID NO: 21 BIP-1BIP-1 GATGCAGGATCAATTGGCACTTTTCCCTTCACCTTTGGCAGAGATGCAGGATCAATTGGCACTTTTCCCTTCACCTTTGGCAGA 서열번호 22SEQ ID NO: 22 LoopF-1LoopF-1 ACTAGCGCGTTTGAGTTGCACTAGCGCGTTTGAGTTGC 서열번호 23SEQ ID NO:23 LoopB-1LoopB-1 CAGTGCCACGCTTGAAGGCAGTGCCACGCTTGAAGG 서열번호 24SEQ ID NO: 24 제 5
프라이머 세트5th
Primer set F3-1F3-1 TTCAGTAACGTTGCTGAAGCGTTCAGTAACGTTGCTGAAGCG 서열번호 25SEQ ID NO: 25 B3-1B3-1 TTGCGATTAACATCACCAGCGTTGCGATTAACATCACCAGCG 서열번호 26SEQ ID NO: 26 FIP-1FIP-1 AATCAAAGGCATATCTGGCGAGATGCCAAGGTATGGAATTCAGCAATCAAAGGCATATCTGGCGAGATGCCAAGGTATGGAATTCAGC 서열번호 27SEQ ID NO: 27 BIP-1BIP-1 GCACGTGAAGCTCATATCCAGGACGTTTCCATCCAAGCCAAAGCACGTGAAGCTCATATCCAGGACGTTTCCATCCAAGCCAAA 서열번호 28SEQ ID NO: 28 LoopF-1LoopF-1 GCTGTAGTCTGTCAGGTTGCGCTGTAGTCTGTCAGGTTGC 서열번호 29SEQ ID NO: 29 LoopB-1LoopB-1 ATGAAGGCAGCAGCATTGAGATGAAGGCAGCAGCATTGAG 서열번호 30SEQ ID NO: 30 제 6
프라이머 세트6th
Primer set F3-1F3-1 ATGCCAAGGTATGGAATTCAGCATGCCAAGGTATGGAATTCAGC 서열번호 31SEQ ID NO: 31 B3-1B3-1 TTGCGATTAACATCACCAGCGTTGCGATTAACATCACCAGCG 서열번호 32SEQ ID NO: 32 FIP-1FIP-1 GGTGTCGTTGAAGTCATTTCGTGCAACCTGACAGACTACAGCGGTGTCGTTGAAGTCATTTCGTGCAACCTGACAGACTACAGC 서열번호 33SEQ ID NO: 33 BIP-1BIP-1 GCACGTGAAGCTCATATCCAGGACGTTTCCATCCAAGCCAAAGCACGTGAAGCTCATATCCAGGACGTTTCCATCCAAGCCAAA 서열번호 34SEQ ID NO: 34 LoopF-1LoopF-1 AATCAAAGGCATATCTGGCGAGAATCAAAGGCATATCTGGCGAG 서열번호 35SEQ ID NO: 35 LoopB-1LoopB-1 ATGAAGGCAGCAGCATTGAGATGAAGGCAGCAGCATTGAG 서열번호 36SEQ ID NO: 36 제 7
프라이머 세트7th
Primer set F3-1F3-1 GGAATGTGGGTGATGATGGGGAATGTGGGTGATGATGG 서열번호 37SEQ ID NO: 37 B3-1B3-1 AGGCTGTAGTCTGCTAGGAGGCTGTAGTCTGCTAGG 서열번호 38SEQ ID NO: 38 FIP-1FIP-1 TTGTCTAAAAGTGGGTTTCGCATTTTAAACACAAGTGGAGTATCCAATTTGTCTAAAAGTGGGTTTCGCATTTTAAACACAAGTGGAGTATCCAAT 서열번호 39SEQ ID NO: 39 BIP-1BIP-1 ATGGCACATTTCAGTAACGTGGTTTTGAATCCCATACCTTGGCATGATGGCACATTTCAGTAACGTGGTTTTGAATCCCATACCTTGGCATG 서열번호 40SEQ ID NO: 40 LoopF-1LoopF-1 GATCCAACAATGGCGATCCAACAATGGC 서열번호 41SEQ ID NO: 41 LoopB-1LoopB-1 CTGAAGCGTATATTGCTGAAGCGTATATTG 서열번호 42SEQ ID NO: 42

실시예 3. 자두곰보바이러스 검출을 위한 LANP 프라이머 세트 선별 Example 3. LANP Primer Set Selection for Plumgombovirus Detection

실시예 2에서 제작한 LAMP용 프라이머 세트가 자두곰보바이러스에 특이적으로 증폭되어 검출이 가능한지 확인하기 위하여, LAMP 반응을 분석하였다.In order to confirm that the primer set for LAMP prepared in Example 2 was specifically amplified for P. gombovirus and detectable, the LAMP reaction was analyzed.

구체적으로, 10X Bst 버퍼 2.5㎕, Bst 폴리머라아제 1㎕, AMV 역전사효소 0.2㎕, MgSO4 1㎕ 및 초순수정제수 5.3㎕를 혼합하여 LAMP 반응액을 제조하였다. 반응액을 제조한 후, 자두곰보바이러스 RNA 1㎕(100ng/㎕)를 혼합하여 사용하였다. 그 후, LAMP 반응액에 표 1의 프라이머 세트를 각각 첨가한 다음(F3 10pmol, B3 10pmol, FIP 40pmol, BIP 40pmol, LoopF 10pmol 및 LoopB 10pmol), 초순수정제수로 최종 부피 25㎕가 되도록 하였으며, 음성 대조군으로는 초순수정제수를 사용하였다. LAMP 반응은 65℃에서 30분 동안 BIO-RAD의 MiniOpticon Real-Time machine을 사용하여, 자두곰보바이러스를 넣은 것과 음성 대조군의 증폭을 실시간으로 비교하였다.Specifically, a LAMP reaction solution was prepared by mixing 2.5 μl of 10X Bst buffer, 1 μl of Bst polymerase, 0.2 μl of AMV reverse transcriptase, 1 μl of MgSO 4 and 5.3 μl of ultrapure water. After preparing the reaction solution, 1 μl (100 ng/μl) of prunes gombovirus RNA was mixed and used. After that, each of the primer sets in Table 1 was added to the LAMP reaction solution (F3 10 pmol, B3 10 pmol, FIP 40 pmol, BIP 40 pmol, LoopF 10 pmol and LoopB 10 pmol), and the final volume was 25 μl with ultrapure purified water, and negative control Ultrapure purified water was used for this. The LAMP reaction was compared in real time with the addition of P. gombovirus and the amplification of the negative control using BIO-RAD's MiniOpticon Real-Time machine for 30 minutes at 65°C.

그 결과, 제 1 프라이머 세트 및 제 5 프라이머 세트에 의하여 자두곰보바이러스가 증폭되었으며, 증폭에 따른 음성대조군과의 뚜렷한 차이를 확인하여 각 프라이머 세트는 자두곰보바이러스에 대하여 특이적으로 반응함을 확인하였다(도 1). 반면, 제 2 프라이머 세트, 제 3 프라이머 세트, 제 4 프라이머 세트, 제 6 프라이머 세트 및 제 7 프라이머 세트를 사용한 경우, 증폭에 따른 음성대조군과의 뚜렷한 차이는 나타나지 않았다. 따라서, 제 1 프라이머 세트 및 제 5 프라이머 세트를 선별하여, 최적화 조건 및 특이성을 확인하였다.As a result, P. gombovirus was amplified by the first primer set and the fifth primer set, and it was confirmed that each primer set reacted specifically to P. gombovirus by confirming a clear difference from the negative control group according to the amplification. (Fig. 1). On the other hand, when the second primer set, the third primer set, the fourth primer set, the sixth primer set, and the seventh primer set were used, there was no significant difference from the negative control group according to amplification. Therefore, the first primer set and the fifth primer set were selected to confirm optimization conditions and specificity.

실시예 4. 자두곰보바이러스 검출을 위한 LANP 반응의 프라이머 농도, 온도 및 시간 조건 최적화Example 4. Optimization of Primer Concentration, Temperature and Time Conditions of LANP Reaction for Plumbovirus Detection

복숭아 감염주에서 추출한 실시예 1의 자두곰보바이러스에 특이적으로 증폭하는 제 1 프라이머 세트 및 제 5 프라이머 세트를 각각 이용하여, 자두곰보바이러스 증폭의 최적 온도를 확인하였다.The optimal temperature for amplification of Plum gombovirus was confirmed by using the first and fifth primer sets that specifically amplify Prungombovirus of Example 1 extracted from the peach-infected strain, respectively.

구체적으로, IO-RAD의 MiniOpticon Real-Time machine을 이용하여 표 2의 조건으로 LAMP 반응을 수행한 것을 제외하면, 실시예 3과 동일한 방법으로 LAMP 반응을 수행하였으며, BIO-RAD의 CFX Manager 3.1를 통하여 온도 최적화 분석을 진행하였다.Specifically, the LAMP reaction was performed in the same manner as in Example 3, except that the LAMP reaction was performed under the conditions of Table 2 using the MiniOpticon Real-Time machine of IO-RAD, and CFX Manager 3.1 of BIO-RAD was performed. Temperature optimization analysis was carried out through

항목item 조건condition 프라이머 농도비
(F3, B3, LoopF, LoopB) : (FIP, BIP)Primer Concentration Ratio
(F3, B3, LoopF, LoopB) : (FIP, BIP) 1:11:1 1:21:2 1:31:3 1:41:4 증폭 온도(℃)Amplification temperature (℃) 5050 5555 6060 6565 7070 증폭 시간(분)Amplification time (min) 2020 3030 4040 5050 6060

그 결과, 복숭아 감염주에서 추출한 자두곰보바이러스에서는 1:4의 (F3, B3, LoopF, LoopB) : (FIP, BIP) 프라이머 농도비, 65℃의 증폭 온도 및 60분의 증폭 시간이 최적 조건인 것으로 확인되었다(도 2).As a result, in the Prungombovirus extracted from the peach-infected strain, a 1:4 (F3, B3, LoopF, LoopB): (FIP, BIP) primer concentration ratio, an amplification temperature of 65°C, and an amplification time of 60 minutes were found to be optimal conditions. was confirmed (FIG. 2).

실시예 5. 자두곰보바이러스 검출을 위한 LANP 반응의 형광 발색 조건 설정Example 5. Fluorescence condition setting of LANP reaction for detection of Plumgombovirus

자두곰보바이러스의 실시간 검출을 위하여, LANP 반응의 형광 발색 조건을 확인하였다.For real-time detection of P. gombovirus, the conditions for fluorescence in the LANP reaction were confirmed.

구체적으로, 제 1 프라이머 세트 및 제 5 프라이머세트를 사용하여, 복숭아 감염주에서 추출한 실시예 1의 자두곰보바이러스 RNA에 실시예 4에서 확인된 최적조건으로 LAMP 반응을 수행한 다음, 증폭산물에 SyberGreen를 ×10,000, ×1.000, ×100, ×10, ×1, 또는 ×0.1 조건으로 처리하고, 육안 및 UV 상에서 형광 발색의 차이를 관찰하였다.Specifically, using the first primer set and the fifth primer set, the Prungombovirus RNA of Example 1 extracted from the peach-infected strain was subjected to a LAMP reaction under the optimal conditions identified in Example 4, and then the amplified product was subjected to SyberGreen was treated under the conditions of ×10,000, ×1.000, ×100, ×10, ×1, or ×0.1, and the difference in fluorescence color development was observed with the naked eye and UV.

그 결과, SyberGreen ×1,000 조건에서, 자두곰보바이러스가 존재하지 않을 경우에는 붉은 색이 나타났으나, 자두곰보바이러스가 존재할 경우에는 녹색 형광색이 나타나는 것으로 확인되었다. 또한, SyberGreen ×1,000 조건에서, UV상에서의 발광이 나타나, 자두곰보바이러스의 검출이 가능한 것으로 확인되었다(도 3).As a result, in the SyberGreen × 1,000 condition, it was confirmed that a red color appeared when Plum gombovirus was not present, but a green fluorescent color appeared when Plumgombovirus was present. In addition, under the condition of SyberGreen × 1,000, UV light emission appeared, confirming that P. gombovirus could be detected ( FIG. 3 ).

실시예 6. 자두곰보바이러스 검출을 위한 LANP 반응의 검출 민감도 확인Example 6. Confirmation of Detection Sensitivity of LANP Reaction for Detection of Plum Gombovirus

병원균의 검출 방법은 미량 농도의 병원균 DNA 및 RNA에도 유의적인 검출이 가능한 것이 요구되므로, 다양한 농도의 자두곰보바이러스 RNA에 대하여 LAMP 반응을 수행하여 제 1 프라이머 세트 및 제 5 프라이머 세트의 민감도를 분석하였다.Since the detection method of pathogens requires significant detection even in trace concentrations of pathogen DNA and RNA, a LAMP reaction was performed on various concentrations of P. gombovirus RNA to analyze the sensitivity of the first primer set and the fifth primer set. .

구체적으로, 복숭아 감염주에서 추출한 실시예 1의 자두곰보바이러스 RNA 100ng/㎕를 100 내지 10-10배로 희석하여 사용한 것을 제외하면, 실시예 4에서 확인된 최적조건으로 LAMP 반응을 수행하여 검출 민감도를 확인하였다.Specifically, the exemplary extracted from Peach State Example 1 infection Plum Pox Virus RNA 100ng / ㎕ to 10 0 to 10 -10, except for using diluted times, Example 4. The optimum conditions for detection sensitivity by performing the LAMP reaction obtained from the was confirmed.

그 결과, 제 1 프라이머 세트 또는 제 5 프라이머 세트를 사용하여 10pg의 자두곰보바이러스 RNA의 검출이 가능한 것으로 확인되었다(도 4).As a result, it was confirmed that 10 pg of P. gombovirus RNA could be detected using the first primer set or the fifth primer set ( FIG. 4 ).

또한, 복숭아주의 자두곰보바이러스 감염 여부의 실시간 진단이 가능한지 확인하기 위하여, 자두곰보바이러스에 감염되지 않은 복숭아 무감염주 및 자두곰보바이러스에 감염된 복숭아 감염주에서 추출한 핵산 1㎕을 각각 사용하여, 실시예 6에서 확인된 최적조건에서, 실시예 3의 방법으로 LAMP 반응을 수행하고, 실시예 5의 최적조건으로 형광발색을 유도하여 육안으로 자두곰보바이러스의 감염 여부의 구별이 가능한지 확인하였다.In addition, in order to confirm whether a real-time diagnosis of P. gombovirus infection of a peach line is possible, 1 μl of nucleic acid extracted from a peach-infected line not infected with Plum gombo virus and a peach-infected line infected with Plum gombo virus was used, respectively, in Example 6 Under the optimal conditions confirmed in Example 3, the LAMP reaction was performed, and fluorescence was induced under the optimal conditions of Example 5 to confirm whether it was possible to visually distinguish whether P. gombovirus was infected.

그 결과, 제 1 프라이머 세트 또는 제 5 프라이머 세트 모두 감염주에서는 녹색 형광색이, 건전주에서는 감염주에서는 붉은 색이 나타난 것으로 확인되어, 육안으로, 복숭아주에서 자두곰보바이러스의 실시간 육안 검출이 가능한 것으로 확인되었다(도 5).As a result, both the first primer set and the fifth primer set showed green fluorescence in the infected strain and red in the infected strain in the intact strain. was confirmed (FIG. 5).

이제까지 본 발명에 대하여 그 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.Up to now, the present invention has been looked at focusing on the embodiments thereof. Those of ordinary skill in the art to which the present invention pertains will understand that the present invention can be implemented in modified forms without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments are to be considered in an illustrative rather than a restrictive sense. The scope of the present invention is indicated by the claims rather than the foregoing description, and all differences within the scope equivalent thereto should be construed as being included in the present invention.

<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Loop Mediated Isothermal Amplification Primer Set for Detection of Plum Pox Virus and Uses Thereof <130> RDA-P190108 <160> 42 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer set 1_F3-1 <400> 1 ttcagtaacg ttgctgaagc g 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer set 1_B3-1 <400> 2 ttgcgattaa catcaccagc g 21 <210> 3 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> primer set 1_FIP-1 <400> 3 catatctggc gaggctgtag tagcatacat gccaaggtat gga 43 <210> 4 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> primer set 1_BIP-1 <400> 4 gcacgtgaag ctcatatcca ggacgtttcc atccaagcca aa 42 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer set 1_LoopF-1 <400> 5 ctgtcaggtt gcgctgaat 19 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer set 1_LoopB-1 <400> 6 atgaaggcag cagcattgag 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer set 2_F3-1 <400> 7 cagcaacaac tcaaccagca 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer set 2_B3-1 <400> 8 gcctttccct tcacctttgg 20 <210> 9 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer set 2_FIP-1 <400> 9 cgcgtttgag ttgctaggtg ttccacaggt gtcaggacc 39 <210> 10 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer set 2_BIP-1 <400> 10 gtcaacacaa acagagacag ggccttcaag cgtggcactg 40 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer set 2_LoopF-1 <400> 11 aggcatcctc attaccatgt gt 22 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer set 2_LoopB-1 <400> 12 gatgcaggat caattggcac tt 22 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer set 3_F3-1 <400> 13 agcatacatg ccaaggtatg ga 22 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer set 3_B3-1 <400> 14 ttgcgattaa catcaccagc g 21 <210> 15 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer set 3_FIP-1 <400> 15 ggtgtcgttg aagtcatttc gtagcgcaac ctgacagact 40 <210> 16 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> primer set 3_BIP-1 <400> 16 gcacgtgaag ctcatatcca ggacgtttcc atccaagcca aa 42 <210> 17 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer set 3_LoopF-1 <400> 17 ggcatatctg gcgaggct 18 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer set 3_LoopB-1 <400> 18 atgaaggcag cagcattgag 20 <210> 19 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer set 4_F3-1 <400> 19 cacgccagca acaactcaa 19 <210> 20 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer set 4_B3-1 <400> 20 ctgtgcagga ctataatgtg cc 22 <210> 21 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> primer set 4_FIP-1 <400> 21 gtccctgtct ctgtttgtgt tgacacatgg taatgaggat gcct 44 <210> 22 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> primer set 4_BIP-1 <400> 22 gatgcaggat caattggcac ttttcccttc acctttggca ga 42 <210> 23 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer set 4_LoopF-1 <400> 23 actagcgcgt ttgagttgc 19 <210> 24 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer set 4_LoopB-1 <400> 24 cagtgccacg cttgaagg 18 <210> 25 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer set 5_F3-1 <400> 25 ttcagtaacg ttgctgaagc g 21 <210> 26 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer set 5_B3-1 <400> 26 ttgcgattaa catcaccagc g 21 <210> 27 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> primer set 5_FIP-1 <400> 27 aatcaaaggc atatctggcg agatgccaag gtatggaatt cagc 44 <210> 28 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> primer set 5_BIP-1 <400> 28 gcacgtgaag ctcatatcca ggacgtttcc atccaagcca aa 42 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer set 5_LoopF-1 <400> 29 gctgtagtct gtcaggttgc 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer set 5_LoopB-1 <400> 30 atgaaggcag cagcattgag 20 <210> 31 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer set 6_F3-1 <400> 31 atgccaaggt atggaattca gc 22 <210> 32 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer set 6_B3-1 <400> 32 ttgcgattaa catcaccagc g 21 <210> 33 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> primer set 6_FIP-1 <400> 33 ggtgtcgttg aagtcatttc gtgcaacctg acagactaca gc 42 <210> 34 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> primer set 6_BIP-1 <400> 34 gcacgtgaag ctcatatcca ggacgtttcc atccaagcca aa 42 <210> 35 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer set 6_LoopF-1 <400> 35 aatcaaaggc atatctggcg ag 22 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer set 6_LoopB-1 <400> 36 atgaaggcag cagcattgag 20 <210> 37 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer set 7_F3-1 <400> 37 ggaatgtggg tgatgatgg 19 <210> 38 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer set 7_B3-1 <400> 38 aggctgtagt ctgctagg 18 <210> 39 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> primer set 7_FIP-1 <400> 39 ttgtctaaaa gtgggtttcg cattttaaac acaagtggag tatccaat 48 <210> 40 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> primer set 7_BIP-1 <400> 40 atggcacatt tcagtaacgt ggttttgaat cccatacctt ggcatg 46 <210> 41 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> primer set 7_LoopF-1 <400> 41 gatccaacaa tggc 14 <210> 42 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> primer set 7_LoopB-1 <400> 42 ctgaagcgta tattg 15 <110> REPUBLIC OF KOREA (MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Loop Mediated Isothermal Amplification Primer Set for Detection of Plum Pox Virus and Uses Thereof <130> RDA-P190108 <160> 42 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer set 1_F3-1 <400> 1 ttcagtaacg ttgctgaagc g 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer set 1_B3-1 <400> 2 ttgcgattaa catcaccagc g 21 <210> 3 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> primer set 1_FIP-1 <400> 3 catatctggc gaggctgtag tagcatacat gccaaggtat gga 43 <210> 4 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> primer set 1_BIP-1 <400> 4 gcacgtgaag ctcatatcca ggacgtttcc atccaagcca aa 42 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer set 1_LoopF-1 <400> 5 ctgtcaggtt gcgctgaat 19 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer set 1_LoopB-1 <400> 6 atgaaggcag cagcattgag 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer set 2_F3-1 <400> 7 cagcaacaac tcaaccagca 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer set 2_B3-1 <400> 8 gcctttccct tcacctttgg 20 <210> 9 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer set 2_FIP-1 <400> 9 cgcgtttgag ttgctaggtg ttccacaggt gtcaggacc 39 <210> 10 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer set 2_BIP-1 <400> 10 gtcaacacaa acagagacag ggccttcaag cgtggcactg 40 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer set 2_LoopF-1 <400> 11 aggcatcctc attaccatgt gt 22 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer set 2_LoopB-1 <400> 12 gatgcaggat caattggcac tt 22 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer set 3_F3-1 <400> 13 agcatacatg ccaaggtatg ga 22 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer set 3_B3-1 <400> 14 ttgcgattaa catcaccagc g 21 <210> 15 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer set 3_FIP-1 <400> 15 ggtgtcgttg aagtcatttc gtagcgcaac ctgacagact 40 <210> 16 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> primer set 3_BIP-1 <400> 16 gcacgtgaag ctcatatcca ggacgtttcc atccaagcca aa 42 <210> 17 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer set 3_LoopF-1 <400> 17 ggcatatctg gcgaggct 18 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer set 3_LoopB-1 <400> 18 atgaaggcag cagcattgag 20 <210> 19 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer set 4_F3-1 <400> 19 cacgccagca acaactcaa 19 <210> 20 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer set 4_B3-1 <400> 20 ctgtgcagga ctataatgtg cc 22 <210> 21 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> primer set 4_FIP-1 <400> 21 gtccctgtct ctgtttgtgt tgacacatgg taatgaggat gcct 44 <210> 22 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> primer set 4_BIP-1 <400> 22 gatgcaggat caattggcac ttttcccttc acctttggca ga 42 <210> 23 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer set 4_LoopF-1 <400> 23 actagcgcgt ttgagttgc 19 <210> 24 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer set 4_LoopB-1 <400> 24 cagtgccacg cttgaagg 18 <210> 25 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer set 5_F3-1 <400> 25 ttcagtaacg ttgctgaagc g 21 <210> 26 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer set 5_B3-1 <400> 26 ttgcgattaa catcaccagc g 21 <210> 27 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> primer set 5_FIP-1 <400> 27 aatcaaaggc atatctggcg agatgccaag gtatggaatt cagc 44 <210> 28 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> primer set 5_BIP-1 <400> 28 gcacgtgaag ctcatatcca ggacgtttcc atccaagcca aa 42 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer set 5_LoopF-1 <400> 29 gctgtagtct gtcaggttgc 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer set 5_LoopB-1 <400> 30 atgaaggcag cagcattgag 20 <210> 31 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer set 6_F3-1 <400> 31 atgccaaggt atggaattca gc 22 <210> 32 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer set 6_B3-1 <400> 32 ttgcgattaa catcaccagc g 21 <210> 33 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> primer set 6_FIP-1 <400> 33 ggtgtcgttg aagtcatttc gtgcaacctg acagactaca gc 42 <210> 34 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> primer set 6_BIP-1 <400> 34 gcacgtgaag ctcatatcca ggacgtttcc atccaagcca aa 42 <210> 35 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer set 6_LoopF-1 <400> 35 aatcaaaggc atatctggcg ag 22 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer set 6_LoopB-1 <400> 36 atgaaggcag cagcattgag 20 <210> 37 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer set 7_F3-1 <400> 37 ggaatgtggg tgatgatgg 19 <210> 38 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer set 7_B3-1 <400> 38 aggctgtagt ctgctagg 18 <210> 39 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> primer set 7_FIP-1 <400> 39 ttgtctaaaa gtgggtttcg cattttaaac acaagtggag tatccaat 48 <210> 40 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> primer set 7_BIP-1 <400> 40 atggcacatt tcagtaacgt ggttttgaat cccatacctt ggcatg 46 <210> 41 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> primer set 7_LoopF-1 <400> 41 gatccaacaa tggc 14 <210> 42 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> primer set 7_LoopB-1 <400> 42 ctgaagcgta tattg 15

Claims (8)

서열번호 1 내지 6의 염기서열로 이루어진 자두곰보바이러스(plum pox virus, PPV) 검출용 고리매개 등온증폭 (Loop mediated isothermal amplification, LAMP) 프라이머 세트.
A loop mediated isothermal amplification (LAMP) primer set for detecting plum pox virus (PPV) consisting of the nucleotide sequences of SEQ ID NOs: 1 to 6.
 서열번호 25 내지 30의 염기서열로 이루어진 자두곰보바이러스(plum pox virus, PPV) 검출용 고리매개 등온증폭 (Loop mediated isothermal amplification, LAMP) 프라이머 세트.
A loop mediated isothermal amplification (LAMP) primer set for detecting plum pox virus (PPV) consisting of the nucleotide sequence of SEQ ID NOs: 25 to 30.
 제 1 항 또는 제 2 항에 따른 고리매개 등온증폭 프라이머 세트를 포함하는 자두곰보바이러스 검출용 조성물.
A composition for detecting prunes gombovirus comprising the ring-mediated isothermal amplification primer set according to claim 1 or 2.
 제 3 항에 있어서, 상기 검출은 복숭아 나무의 자두곰보바이러스 검출인 것인 자두곰보바이러스 검출용 조성물.
The composition for detecting Plum gombovirus according to claim 3, wherein the detection is Plumgombovirus detection in peach trees.
 시료에서 RNA를 분리하는 단계; 및
상기 RNA를 주형으로 하고, 제 1 항 또는 제 2 항의 프라이머 세트를 이용하여 고리매개 등온증폭반응을 수행하여 표적 서열을 증폭하는 단계
를 포함하는 자두곰보바이러스의 검출 방법.
isolating RNA from the sample; and
Amplifying the target sequence by using the RNA as a template and performing a ring-mediated isothermal amplification reaction using the primer set of claim 1 or 2
A method for detecting Plum Gombovirus comprising a.
 제 5 항에 있어서, 상기 시료는 복숭아 나무인 것인 자두곰보바이러스의 검출 방법.
The method according to claim 5, wherein the sample is a peach tree.
 제 5 항에 있어서, 상기 등온증폭반응은 65℃에서 수행되는 것인 자두곰보바이러스의 검출 방법.
The method according to claim 5, wherein the isothermal amplification reaction is performed at 65°C.
 제 5 항에 있어서, 상기 등온증폭반응은 60분 동안 수행되는 것인 자두곰보바이러스의 검출 방법.The method according to claim 5, wherein the isothermal amplification reaction is performed for 60 minutes.
KR1020190165084A 2019-12-11 2019-12-11 Loop Mediated Isothermal Amplification Primer Set for Detection of Plum Pox Virus and Uses Thereof KR102294552B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020190165084A KR102294552B1 (en) 2019-12-11 2019-12-11 Loop Mediated Isothermal Amplification Primer Set for Detection of Plum Pox Virus and Uses Thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020190165084A KR102294552B1 (en) 2019-12-11 2019-12-11 Loop Mediated Isothermal Amplification Primer Set for Detection of Plum Pox Virus and Uses Thereof

Publications (2)

Publication Number Publication Date
KR20210074078A KR20210074078A (en) 2021-06-21
KR102294552B1 true KR102294552B1 (en) 2021-08-27

Family

ID=76600062

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020190165084A KR102294552B1 (en) 2019-12-11 2019-12-11 Loop Mediated Isothermal Amplification Primer Set for Detection of Plum Pox Virus and Uses Thereof

Country Status (1)

Country Link
KR (1) KR102294552B1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220118316A (en) 2021-02-18 2022-08-25 한국과학기술원 Composition for multiplexed detection of target nucleic acid based on isothermal amplification and fluorescent ring patterns, and detection method using them
KR20230138683A (en) 2022-03-24 2023-10-05 전북대학교산학협력단 Composition for Detecting Target Gene based on cDNA Synthesis using a Ligation Method that does not use Reverse Transcription, and Method for multiple Ligation-Assisted Recombinase Polymerase Amplification

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101552222B1 (en) 2012-12-13 2015-09-10 한국생명공학연구원 Probe set for specifically diagnosing or detecting Eggplant mottled dwarf virus and uses thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Varga 등. Journal of Virological Methods. Vol. 138, 페이지 184-190 (2006.09.29.)*

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220118316A (en) 2021-02-18 2022-08-25 한국과학기술원 Composition for multiplexed detection of target nucleic acid based on isothermal amplification and fluorescent ring patterns, and detection method using them
KR20230138683A (en) 2022-03-24 2023-10-05 전북대학교산학협력단 Composition for Detecting Target Gene based on cDNA Synthesis using a Ligation Method that does not use Reverse Transcription, and Method for multiple Ligation-Assisted Recombinase Polymerase Amplification

Also Published As

Publication number Publication date
KR20210074078A (en) 2021-06-21

Similar Documents

Publication Publication Date Title
US10006095B2 (en) Method of detecting heat-resistant fungus
KR102294552B1 (en) Loop Mediated Isothermal Amplification Primer Set for Detection of Plum Pox Virus and Uses Thereof
CN110863058A (en) RPA primer for identifying potato rot stem nematode and application thereof
Abou-Jawdah et al. Almond witches'-broom phytoplasma: a potential threat to almond, peach, and nectarine
KR102135169B1 (en) Primer set for loop-mediated isothermal amplification reaction for Bursaphelenchus xylophilus detection
Bianco et al. Detection of phytoplasmas associated with grapevine flavescence dorée disease using real-time PCR
KR102424329B1 (en) Primer Set for recombinase polymerase amplification reaction for detecting Tomato spotted wilt virus and Method for detecting Tomato spotted wilt virus using the same
CN113637804A (en) Kit for detecting RB-N1 genotype citrus tristeza virus based on RT-PCR technology and detection method thereof
Lin et al. Development of a multiplex TaqMan real-time RT-PCR assay for simultaneous detection of Asian prunus viruses, plum bark necrosis stem pitting associated virus, and peach latent mosaic viroid
KR102173154B1 (en) Loop Mediated Isothermal Amplification Primer Set for Detection of Dengue Virus Serotype 1 or 3 and Uses Thereof
KR20200002310A (en) Primer set for simultaneous detection of three viruses in Cherry plant and use thereof
CN112048573B (en) RPA primer and kit for detecting cotton leaf curl virus, and detection method and application thereof
KR102213231B1 (en) Primer set for detecting of virus infected Pepper, and uses thereof
KR102254155B1 (en) Method for detecting nervous necrosis virus, and primer-probe set, composition and kit for the same
KR102212379B1 (en) Primer set for simultaneous detection of three viruses in Grapevine and method for detecting three viruses in Grapevine using the same
KR102143795B1 (en) Loop Mediated Isothermal Amplification Primer Set for Detection of Dengue Virus Serotype 2 or 4 and Uses Thereof
KR102657952B1 (en) Primer set for detecting Peach latent mosaic viroid and Method for detecting Peach latent mosaic viroid
KR101844656B1 (en) LAMP primer set for diagnosing bean pod mottle virus and diagnostic kit comprising the same
KR101844654B1 (en) LAMP primer set for diagnosing bean common mosaic necrosis virus and diagnostic kit comprising the same
KR102565505B1 (en) Primer and probe set for recombinase polymerase amplification for phytoplasma detection
KR101425725B1 (en) Primer composition for loop-mediated isothermal amplification reaction for detecting Sweet potato leaf curl virus, and use thereof
KR102429938B1 (en) Primer Set for recombinase polymerase amplification reaction for detecting stone fruits virus and Method for diagnosing stone fruits virus disease using the same
KR101844657B1 (en) LAMP primer set for diagnosing strawberry latent ringspot virus and diagnostic kit comprising the same
KR101398286B1 (en) Primer composition for loop-mediated isothermal amplification reaction for detecting Tobacco leaf curl virus, and use thereof
KR20220085502A (en) Primer set for detection of Heterodera glycines, and detection method by using the same

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant