KR102280870B1 - DLEC1 methylation marker for predicting prognosis of intrahepatic cholangiocarcinoma - Google Patents
DLEC1 methylation marker for predicting prognosis of intrahepatic cholangiocarcinoma Download PDFInfo
- Publication number
- KR102280870B1 KR102280870B1 KR1020200000721A KR20200000721A KR102280870B1 KR 102280870 B1 KR102280870 B1 KR 102280870B1 KR 1020200000721 A KR1020200000721 A KR 1020200000721A KR 20200000721 A KR20200000721 A KR 20200000721A KR 102280870 B1 KR102280870 B1 KR 102280870B1
- Authority
- KR
- South Korea
- Prior art keywords
- methylation
- intrahepatic cholangiocarcinoma
- prognosis
- cpg dinucleotide
- sequence
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
본원은 간내담관암의 예후 예측용 DLEC1 유전자 프로모터의 메틸화 마커를 개시한다. 암의 개인별 맞춤치료를 위해서는 선결과제는 질환의 예후를 정확하게 예측하는 예후 표지자의 발굴이다. 이런 측면에서 본원에 따른 DLCE1 메틸화 마커는 간내담관암의 예후예측 표지자로서 화학치료, 방사선치료, 면역치료를 비롯한 치료제 선택, 치료 방법, 치료의 적극성에 대한 차별화 등을 통한 삶의 질의 향상, 불필요한 치료의 방지 등의 측면에서 예후적 특성에 따른 개인별 맞춤치료방법 개발에 유용하게 사용될 수 있다.The present application discloses a methylation marker of the DLEC1 gene promoter for predicting the prognosis of intrahepatic cholangiocarcinoma. For personalized cancer treatment, a prerequisite is the discovery of prognostic markers that accurately predict the prognosis of the disease. In this respect, the DLCE1 methylation marker according to the present application is a prognostic marker for intrahepatic cholangiocarcinoma, and improvement of quality of life through selection of therapeutic agents including chemotherapy, radiation therapy, and immunotherapy, treatment method, differentiation of therapeutic activity, etc. In terms of prevention, etc., it can be usefully used in the development of personalized treatment methods according to prognostic characteristics.
Description
본원은 간내담관암의 예후 예측 표지자와 관련된 기술이다. The present application relates to a technology related to a prognostic predictor of intrahepatic bile duct cancer.
담관암은 간에서 발생하는 암 중 두 번째로 흔하고 담관암중 간내에서 발생하는 간내담관암은 간문부암과는 달리 다양한 세포에서 기원한다. 간내 담관암은 조직학적으로 LD (large bile duct, 대담관) 유형, SD (small bile duct 소담관) 유형, 그리고 BD (bile ductule, 담세관) 유형의 세가지 아형이 존재한다. Biliary duct cancer is the second most common cancer occurring in the liver. Among cholangiocarcinomas, intrahepatic cholangiocarcinoma originates from various cells, unlike hierarchical cancer. Histologically, intrahepatic cholangiocarcinoma has three subtypes: LD (large bile duct) type, SD (small bile duct small bile duct) type, and BD (bile ductule, bile duct) type.
이러한 세가지 조직학적인 유형의 간내담관암은 바이러스 감염여부를 비롯한 여러 임상적인 소견과 관련하여 차별성을 보인다. 예를 들어 SD와 BD는 점액성의 부재, 만성 간염, IDH1/2 돌연변이와 연관되어 있는 반면에 LD는 점액의 존재 및 KRAS 돌연변이와 밀접한 관련성을 지니고 있다. These three histological types of intrahepatic cholangiocarcinoma show differentiation in relation to various clinical findings including viral infection. For example, SD and BD are associated with absence of mucin, chronic hepatitis, and IDH1/2 mutations, whereas LD is strongly associated with presence of mucin and KRAS mutations.
간내담관암은 불량한 예후를 가지는 간암이지만 서구에서는 드문 암종이라 그동안 학계의 관심을 받지 못하였고, 간내담관암만을 위한 고유한 TNM staging은 7차 개정판에서 처음으로 개발되었다. 그러나, 7차 개정판의 TNM staging은 간내담관암의 예후를 제대로 예측하지 못하는 것으로 알려졌고, 8차 개정판의 TNM staging이 발표되었지만, 간내담관암의 예후를 제대로 예측하는지에 대해선 아직 연구결과가 많이 부족한 형편이다. 또한, 간내담관암의 예후 예측 표지자에 대한 연구결과가 적고, 현재까지 발표된 간내담관암 예후예측 표지자중 재현된 연구결과가 발표된 것은 거의 없다. Although intrahepatic cholangiocarcinoma is a liver cancer with a poor prognosis, it has not received much attention from academia because it is a rare carcinoma in the West, and a unique TNM staging for intrahepatic cholangiocarcinoma was developed for the first time in the 7th revision. However, it is known that TNM staging in the 7th revision does not properly predict the prognosis of intrahepatic cholangiocarcinoma, and although TNM staging in the 8th revision has been published, research results are still lacking as to whether it predicts the prognosis of intrahepatic cholangiocarcinoma properly. In addition, there are few research results on prognostic markers of intrahepatic cholangiocarcinoma, and few of the reproducible research results of prognostic markers of intrahepatic cholangiocarcinoma published to date have been published.
나아가 간내담관암종은 수술적 치료외에 수술후 보조적 항암화학치료방법으로서 환자의 예후를 개선할 수 있는 항암치료방법이 없다. 간내담관암종은 이질적인 암종으로서, 기원세포도 다양하고, 조직학적 유형이나 육안 유형에 따른 생물학적 특성이 이질적이다.Furthermore, there is no chemotherapy method that can improve the patient's prognosis as an adjuvant chemotherapy method after surgery other than surgical treatment for intrahepatic cholangiocarcinoma. Intrahepatic cholangiocarcinoma is a heterogeneous carcinoma, the cells of origin are diverse, and the biological characteristics according to histological and gross types are heterogeneous.
간내담관암종 이러한 이질적인 속성에도 불구하고 동일한 치료방법을 적용함으로 인해 맞춤형 치료를 통한 최선의 치료결과를 창출하지 못하고 있다.Intrahepatic cholangiocarcinoma Despite these heterogeneous properties, the best treatment results through customized treatment have not been created due to the application of the same treatment method.
최근에는 DNA 메틸화 측정을 통하여 암 자체를 진단하는 방법들이 제시되고 있다. DNA 메틸화는 주로 특정 유전자의 프로모터 부위의 CpG 아일랜드(CpG island)의 사이토신(cytosine)에서 일어나고, 그로 인하여 전사인자의 결합이 방해를 받게 되어 특정 유전자의 발현이 차단(gene silencing)되는 것으로, 코딩서열(coding sequence)에 돌연변이가 없이도 그 유전자의 기능이 소실되는 주요 기전이다. 전립선암, 결장암, 자궁암, 유방암 등 다양한 암 세포에서 CpG 아일랜드에서의 이러한 비정상적인 메틸화/탈메틸화가 보고되었으며, 특히 암 발생의 초기 단계에서 특정 유전자의 프로모터 부위에 과메틸화가 일어나는 것으로 알려져 있다. 최근 종양 관련 유전자의 프로모터 메틸화를 조사하여 각종 암 진료에 사용하려는 시도가 활발하게 이루어지고 있다. 하지만 특정 암에서 아형에 따른 예후 예측인자에 대한 연구결과는 없다.Recently, methods for diagnosing cancer itself by measuring DNA methylation have been proposed. DNA methylation mainly occurs in the cytosine of CpG island of the promoter region of a specific gene, thereby interfering with the binding of transcription factors and blocking the expression of a specific gene (gene silencing). It is the main mechanism by which the function of the gene is lost even without a mutation in the coding sequence. Abnormal methylation/demethylation in CpG islands has been reported in various cancer cells such as prostate cancer, colon cancer, uterine cancer, and breast cancer, and it is known that hypermethylation occurs in the promoter region of specific genes in the early stages of cancer development. Recently, attempts have been made to investigate promoter methylation of tumor-related genes and use them in various cancer treatments. However, there are no studies on prognostic predictors according to subtypes in specific cancers.
한국 등록특허 제1504069호는 담관선암 검출 또는 진단용 메틸화 마커 및 방법에 관한 것으로, 담관선암 검출 또는 진단을 위한 다양한 유전자 메틸화 마커를 개시하나, 내담관선암의 수술 후 예후예측에 관한 마커는 개시하고 있지 않다. Korean Patent Registration No. 1504069 relates to a methylation marker and method for detecting or diagnosing cholangiocarcinoma, and discloses various gene methylation markers for detecting or diagnosing cholangiocarcinoma, but does not disclose markers related to prognosis after surgery for endothelial ductal adenocarcinoma. not.
미국 공개특허공보 제2009-0053706호는 인간 대장암에서 CpG 아일랜드의 메틸화 양태와 연관된 DNA 메틸화 마커에 관한 것으로 대장암의 진단에 사용될 수 있는 마커를 제공한다. US Patent Publication No. 2009-0053706 relates to a DNA methylation marker associated with the methylation aspect of CpG islands in human colorectal cancer, and provides a marker that can be used in the diagnosis of colorectal cancer.
한국 공개특허공보 제2012-0058163호는 암 진단을 위한 메틸화 바이오 마커 및 이의 용도에 관한 것으로, TESC 유전자 프로모터의 메틸화 상태를 확인하여 암을 진단하는 방법을 개시한다.Korean Patent Application Laid-Open No. 2012-0058163 relates to a methylation biomarker for cancer diagnosis and its use, and discloses a method for diagnosing cancer by confirming the methylation status of a TESC gene promoter.
따라서, 메틸화 분석을 통한 간내담관암종의 예후를 예측하여 예후적 특성에 따른 맞춤치료방법을 개발에 유용하게 사용될 수 있는 마커의 개발이 절실하다. Therefore, there is an urgent need to develop a marker that can be usefully used to predict the prognosis of intrahepatic cholangiocarcinoma through methylation analysis and develop a customized treatment method according to the prognostic characteristics.
본원은 DLEC1 유전자의 발현을 조절하는 프로모터 부위의 DNA 메틸화를 측정을 통해 간내담관암의 메틸화 수준을 측정함으로써 맞춤치료방법을 개발에 유용하게 사용될 수 있는 메틸화 마커를 제공하고자 한다. The present application aims to provide a methylation marker that can be usefully used in the development of a customized treatment method by measuring the methylation level of intrahepatic cholangiocarcinoma by measuring DNA methylation of the promoter region that regulates the expression of the DLEC1 gene.
한 양태에서 본원은 DLEC1 유전자 프로모터의 CpG 다이뉴클레오타이드 모티브의 메틸화 검출용 물질을 포함하는, 간내담관암 예후 예측용 조성물을 제공한다.In one aspect, the present application provides a composition for predicting prognosis of intrahepatic cholangiocarcinoma, comprising a substance for detecting methylation of the CpG dinucleotide motif of the DLEC1 gene promoter.
일 구현예에서 본원에 따른 조성물 또는 방법은은 특히 상기 간내담관암은 조직학적 유형중 소담관 유형의 간내담관암 예후 예측일 수 있다.In one embodiment, the composition or method according to the present disclosure may predict the prognosis of intrahepatic cholangiocarcinoma of the small bile duct type among histological types of intrahepatic cholangiocarcinoma.
다른 구현예에서 본원에 따른 조성물 또는 방법에 따른 예후 예측은 간내담관암 특이적 생존 또는 암비특이적 무재발 생존에 대한 예측일 수 있다.In another embodiment, the prognostic prediction according to the composition or method according to the present application may be a prediction of intrahepatic cholangiocarcinoma-specific survival or cancer non-specific recurrence-free survival.
다른 양태에서 본원은 간내담관암 예후 예측에 대한 정보를 제공하기 위해,In another aspect, the present application provides information on the prognosis of intrahepatic bile duct cancer,
상기 소담관 유형의 간내담관암의 예후 예측이 필요한 대상체 유래의 생물학적 시료를 제공하는 단계; 상기 생물학적 시료에서 추출된 DNA로부터 DLEC1 프로모터의 CpG 다이뉴클레오타이드 모티브의 메틸화 유무를 검출하는 단계; 및 대조군의 결과와 비교하여 상기 생물학적 시료의 상기 모티브의 매틸화 유무를 상기 간내담관암의 예후와 연관시키는 단계를 포함하는, 간내담관암의 메틸화 분석 방법을 제공한다.providing a biological sample derived from a subject in need of predicting the prognosis of intrahepatic bile duct cancer of the small bile duct type; detecting the presence or absence of methylation of the CpG dinucleotide motif of the DLEC1 promoter from the DNA extracted from the biological sample; and correlating the presence or absence of methylation of the motif in the biological sample with the prognosis of the intrahepatic cholangiocarcinoma as compared with the result of the control group.
본원에 따른 방법의 상기 연관시키는 단계에서, 상기 생물학적 시료에서 메틸화 검출된 경우, 상기 생물학적 시료가 유래된 환자의 간내담관암의 예후가 양호한 것으로 예측할 수 있다.In the associating step of the method according to the present application, when methylation is detected in the biological sample, the prognosis of intrahepatic cholangiocarcinoma of the patient from which the biological sample is derived may be predicted.
다른 구현예에서 상기 예후 예측은 간내담관암 특이적 생존 또는 암비특이적 무재발 생존이며, 메틸화가 검출된 경우, 암특이적 생존 또는 암비특이적 무재발 생존이 양호하다.In another embodiment, the prognostic prediction is intrahepatic cholangiocarcinoma-specific survival or cancer non-specific recurrence-free survival, and when methylation is detected, cancer-specific survival or cancer non-specific recurrence-free survival is good.
다른 구현예에서 본원에 따른 방법에 사용되는 생물학적 시료는 간내담관암 생검 또는 적출 조직을 포함할 수 있다.In another embodiment, the biological sample used in the method according to the present disclosure may include an intrahepatic cholangiocarcinoma biopsy or excised tissue.
본원에 따른 방법에서 메틸화 검출에 사용되는 방법은 생물학적 시료에서 유래된 유전체 DNA의 비-메틸화 사이토신 잔기를 선택적으로 변형시키거나, 또는 메틸화 사이토신 잔기를 선택적으로 변형시키는 화합물과 접촉하고, 상기 접촉에 의해 생성된 산물의 검출에 의한 것일 수 있다. The method used for the detection of methylation in the method according to the present invention comprises contacting with a compound that selectively modifies non-methylated cytosine residues or selectively modifies methylated cytosine residues of genomic DNA derived from a biological sample, the contacting It may be by detection of a product produced by
다른 구현예에서 메틸화 검출은 메틸화 특이적 증폭 방법에 의한 것으로,In another embodiment, the detection of methylation is by a methylation-specific amplification method,
상기 증폭방법은 변형된 비-메틸화 CpG 다이뉴클레오타이드 모티브를 포함하는 서열에는 결합하나, 비변형된 메틸화 CpG 다이뉴클레오타이드 모티브를 포함하는 서열에는 결합하지 않는 적어도 하나의 프라이머를 포함하는 프라이머 세트를 이용하여 증폭산물을 생성하거나, 또는 비변형된 메틸화 CpG 다이뉴클레오타이드 모티브를 포함하는 서열에는 결합하나, 변형된 비-메틸화 CpG 다이뉴클레오타이드 모티브를 포함하는 서열에는 결합하지 않는 적어도 하나의 프라이머를 포함하는 프라이머 세트를 이용하여 증폭산물을 생성하는 것을 포함한다.The amplification method is amplified using a primer set comprising at least one primer that binds to a sequence comprising a modified non-methylated CpG dinucleotide motif but does not bind to a sequence comprising an unmodified methylated CpG dinucleotide motif. Using a primer set comprising at least one primer that produces a product or binds to a sequence comprising an unmodified methylated CpG dinucleotide motif but does not bind to a sequence comprising a modified non-methylated CpG dinucleotide motif. to produce an amplification product.
다른 구현예에서는 프라이머 세트는 프로브와 함께 사용될 수 있으며, 프로브는 비변형된 메틸화 CpG 다이뉴클레오타이드 모티브를 포함하는 서열에는 결합하나, 변형된 비-메틸화 CpG 다이뉴클레오타이드 모티브를 포함하는 서열에는 결합하지 않거나 또는 그 반대일 수 있다.In other embodiments, a primer set may be used in conjunction with a probe, wherein the probe binds to a sequence comprising an unmodified methylated CpG dinucleotide motif, but does not bind to a sequence comprising a modified unmethylated CpG dinucleotide motif, or It could be the other way around.
암의 개인별 맞춤치료를 위한 선결과제는 질환의 예후를 정확하게 예측하는 예후 표지자의 발굴이다. 간내담관암의 경우 예후예측 표지자로 개발된 것이 없어 개인별 맞춤치료의 개발에 한계가 있었다. 본원에 따른 간내담관암의 예후 예측용 DLEC1 유전자 프로모터의 메틸화 마커는 간내담관암의 예후예측 표지자로서 개인별 맞춤치료의 개발을 위해 유용하게 사용될 수 있다. 예후가 양호한 환자와 그렇지 않은 환자를 구분하여, 화학치료, 방사선치료, 면역치료를 비롯한 치료제 선택, 치료 방법, 치료의 적극성에 대한 차별화 등을 통한 삶의 질의 향상, 불필요한 치료의 방지 등의 측면에서 예후적 특성에 따른 맞춤치료방법 개발에 유용하게 사용될 수 있다.A prerequisite for personalized cancer treatment is the discovery of prognostic markers that accurately predict the prognosis of the disease. In the case of intrahepatic cholangiocarcinoma, there was no development as a prognostic marker, limiting the development of personalized treatment for each individual. The methylation marker of the DLEC1 gene promoter for predicting the prognosis of intrahepatic cholangiocarcinoma according to the present application can be usefully used for the development of personalized treatment as a prognostic predictor of intrahepatic cholangiocarcinoma. Differentiate between patients with good prognosis and those with poor prognosis, in terms of improving the quality of life and preventing unnecessary treatment through selection of therapeutic agents including chemotherapy, radiation therapy, and immunotherapy, and differentiation of treatment methods and aggressiveness of treatment It can be usefully used to develop customized treatment methods according to prognostic characteristics.
도 1은 간내담관암의 조직학적 형태에 따른 유전자의 메틸화 수준의 변화를 나타내는 결과로, DLEC1을 비롯한 12개의 유전자 프로모터의 메틸화가 조직학적 형태에 따른 차이를 보였다.
도 2는 DLEC1 프로모터의 메틸화 수준에 따른 생존분석 결과이다. a,c,e, 그리고 g는 암특이적인 생존을, b,d,f, 그리고 h는 무재발 생존을 측정한 것이다. 또한 a,b는 간내담관암에서 생존분석, c,d는 MF type 간내 담관암에서의 생존분석, e,f는 SD type 간내 담관암에서의 생존분석, 그리고 g,h는 BD type 간내 담관암에서의 생존분석 결과이다.
도 3은 (a) DLEC1 프로모터 메틸화를 포함시키기전 기존의 진단 플로우 차트, (b) DLEC1 프로모터 메틸화 측정을 포함시킨 새로운 예후 진단의 플로우 차트를 나타낸다.
도 4는 일 구현예에서 본원에 따른 메틸화부위의 메틸화 정도를 분석할 수 있는 메틸라이트 분석방법을 도식적으로 나타낸 것이다.1 is a result showing the change in gene methylation level according to the histological type of intrahepatic cholangiocarcinoma, and the methylation of 12 gene promoters including DLEC1 showed a difference according to the histological type.
2 is a result of survival analysis according to the methylation level of the DLEC1 promoter. a, c, e, and g measure cancer-specific survival, and b, d, f, and h measure recurrence-free survival. Also, a and b are survival analysis in intrahepatic cholangiocarcinoma, c and d are survival analysis in MF type intrahepatic cholangiocarcinoma, e and f are survival analysis in SD type intrahepatic cholangiocarcinoma, and g and h are survival analysis in BD type intrahepatic cholangiocarcinoma. It is the result.
Figure 3 shows (a) a flow chart of the existing diagnosis before including DLEC1 promoter methylation, and (b) a flow chart of a new prognostic diagnosis including measurement of DLEC1 promoter methylation.
4 schematically shows a methylite analysis method capable of analyzing the degree of methylation of a methylation site according to the present disclosure in one embodiment.
본원은 간내담관암종의 예후를 예측할 수 있는 DLEC1 메틸화 마커의 발견에 근거한 것이다.The present application is based on the discovery of a DLEC1 methylation marker that can predict the prognosis of intrahepatic cholangiocarcinoma.
이에 한 양태에서 본원은 DLEC1 유전자 프로모터의 메틸화 마커 및 간내담관암종 예후 예측 용도에 관한 것이다.Accordingly, in one aspect, the present application relates to a methylation marker of the DLEC1 gene promoter and use for predicting the prognosis of intrahepatic cholangiocarcinoma.
본원에 따르면 간내담관암종에서 DLEC1 (Deleted In Lung And Esophageal Cancer Protein 1) 유전자의 메틸화가 상기 질환의 예후와 연관된 것으로 나타났다. 본원에 따른 DLEC1 (Deleted In Lung And Esophageal Cancer Protein 1) 메틸화 마커는 CpG 다이뉴클레오타이드 모티브에서 메틸화 여부에 따라 예후와 연관된다. 인간 DLEC1 유전자는 NCBI Gene ID: 9940에서 그 정보를 찾을 수 있다. 상기 유전자의 프로모터 부위는 예를 들면 상기 유전자의 전사개시부위로부터 예를 들면 5' 방향으로 약 1 kbp 이내에서의 메틸화 여부, 특히 후술하는 CpG 아일랜드 부위의 메틸화 상태의 판별을 통해 예후와 연관시킬 수 있다. According to the present application, methylation of the Deleted In Lung And Esophageal Cancer Protein 1 (DLEC1) gene in intrahepatic cholangiocarcinoma was found to be associated with the prognosis of the disease. The DLEC1 (Deleted In Lung And Esophageal Cancer Protein 1) methylation marker according to the present application is associated with prognosis according to the presence or absence of methylation in the CpG dinucleotide motif. The human DLEC1 gene information can be found in NCBI Gene ID: 9940. The promoter region of the gene is methylated within, for example, within about 1 kbp in the 5' direction from the transcription start site of the gene, in particular, the methylation status of the CpG island region to be described later It can be correlated with prognosis. there is.
일 구현예에서 본원에 따른 DLEC1 유전자 프로모터의 메틸화는 CpG 다이뉴클레오타이드 모티브를 포함하는 CpG 아일랜드에서 검출된다. CpG 아일랜드는 전형적으로 약 1 내지 2 kbp 길이를 가지고, 해당 유전자의 프로모터의 업스트림 (upstream)에서 시작하여, 다운스트림의 전사 부위를 포함하여 3' 부위에도 존재하며, 예를 들면, 인핸서, 프로모터 및 인트론을 포함하는 여러 부위에서 발견된다. 본원의 메틸화 마커 유전자의 메틸화 여부는 이러한 다양한 부위에 존재하는 CpG 아일랜드의 CpG를 검출하는 것을 포함한다.In one embodiment the methylation of the DLEC1 gene promoter according to the present disclosure is detected on a CpG island comprising a CpG dinucleotide motif. CpG islands are typically about 1 to 2 kbp in length and, starting upstream of the promoter of the gene of interest, are also present in the 3' region, including downstream transcription sites, for example, enhancers, promoters and It is found in several sites, including introns. Whether or not the methylation marker gene of the present application is methylated includes detecting CpG of CpG islands present at these various sites.
본원에서 프로모터는 전사를 지시하는데 필요한 최소한의 서열이고, 프로모터-의존성 유전자에서 세포 타입 특이적, 조직 특이적 또는 외부 시그널이나 물질에 의해 조절될 수 있다. 이러한 프로모터는 유전자의 5' 또는 3' 부위에 위치한다. 프로모터 부위의 전체 또는 일부에서 메틸화 여부가 측정될 수 있으며, 표적 유전자 프로모터의 메틸화는 개시부위를 중심으로 바깥쪽에서부터 내부로 진행한다.Herein, a promoter is a minimal sequence necessary to direct transcription, and may be regulated by a cell type-specific, tissue-specific, or external signal or substance in a promoter-dependent gene. These promoters are located at the 5' or 3' region of the gene. Whether or not methylation of all or part of the promoter region is determined can be determined, and methylation of the target gene promoter proceeds from the outside to the inside around the initiation site.
일 구현예에서 메틸화 부위는 프로모터 부위, 특히 전사개시부 위로부터 5' 방향으로 약 2 kbp 이내, 약 1 kbp 이내, 특히 750 bp 이내이다. 특히 일 구현예에서 DLEC1 유전자는 프로모터 서열을 포함하여 RefSeq (GRCh38/hg38) 기준 chr3:38038205-38122737 (UCSC Genome Browser: https://genome.ucsc.edu/cgi-bin/hgGateway?hgsid=785944985_ATDn39izmajjoU7otLJN7fCinNHj) 이다.In one embodiment the methylation site is within about 2 kbp, within about 1 kbp, in particular within 750 bp in the 5' direction from the promoter region, in particular the transcription start site. In particular, in one embodiment, the DLEC1 gene includes a promoter sequence based on RefSeq (GRCh38/hg38) chr3:38038205-38122737 (UCSC Genome Browser: https://genome.ucsc.edu/cgi-bin/hgGateway?hgsid=785944985_ATDn39izmajjoU7otLJN7fCinNHj) am.
담관암은 간에서 발생하는 암 중 두 번째로 흔하고 담관암중 간내에서 발생하는 간내담관암은 간문부암과는 달리 다양한 세포에서 기원한다. 간내 담관암은 조직학적으로 LD (large bile duct, 대담관) 유형, SD (small bile duct 소담관) 유형, 및 BD (bile ductule, 담세관) 유형의 세가지 아형이 존재한다. Biliary duct cancer is the second most common cancer occurring in the liver. Among cholangiocarcinomas, intrahepatic cholangiocarcinoma originates from various cells, unlike hierarchical cancer. Histologically, intrahepatic cholangiocarcinoma has three subtypes: LD (large bile duct, bile duct) type, SD (small bile duct, small bile duct) type, and BD (bile ductule, bile duct) type.
이러한 간내담관암의 이러한 조직학적 유형은 수술과정에서 채취된 시료의 조직병리학적 분석에 의해서만 판별이 가능하다. 하지만 수술적 치료 후의 조직학적 유형만으로는 예후예측이 가능하지 않다.This histological type of intrahepatic cholangiocarcinoma can be discriminated only by histopathological analysis of samples collected during surgery. However, it is not possible to predict the prognosis only by the histologic type after surgical treatment.
본원에서 예후(prognosis)란, 담관암종 환자의 앞으로의 경과나 결과를 미리 예측하는 것을 의미한다. 예후는 특정기간동안 살아있을 확률, 즉 생존율로 따지는데, 일반적으로 특정 대상환자군, 특히 본원에서 DLEC1 프로모터 CpG 아일랜드의 메틸화가 발생한 환자군의 예후가 양호하다는 것은 비교대상 환자군, 예를 들면 상기 부위에서 메틸화가 발생하지 않은 환자군과 비교하여 생존율이 유의하게 높다는 것을 의미한다.As used herein, prognosis means predicting in advance the future course or outcome of a cholangiocarcinoma patient. The prognosis is determined by the probability of being alive for a specific period, that is, the survival rate. In general, a good prognosis in a specific patient group, particularly in the patient group in which methylation of the DLEC1 promoter CpG island has occurred, means that the patient is compared, for example, methylation at the site. This means that the survival rate is significantly higher than that of the patient group that did not develop .
도 1을 기준으로 DLEC1 메틸화 양성 환자는 메틸화 음성 환자에 비해 5년(60개월) 암특이생존율이 10%, 무재발 생존율은 20% 이상 향상되고 있는 것을 확인할 수 있다.1 , it can be seen that DLEC1 methylation-positive patients have improved 5-year (60 months) cancer-specific survival rates by 10% and recurrence-free survival rates by 20% or more, compared to methylation-negative patients.
일 구현예에서 본원에 따른 마커는 특히 간내담관암의 조직학적 유형중 소담관 유형의 예후 예측에 사용된다. 소담관 유형의 간내담관암의 DLEC1 유전자의 CpG 아일랜드에서 메틸화가 증가한 경우, 그렇지 않은 경우와 비교하여 우수한 예후를 갖는 것으로 나타났다. 즉 본원에 따른 마커는 SD유형에서 수술후 양호한 예후를 가질 암종과 그렇지 않을 암종을 판별할 수 있어, DLEC1 메틸화 여부 또는 정도에 따라 SD유형 간내담관암종에서 생존에 관한 중요한 정보를 제공하는 마커로서 작용할 수 있다. DLEC1 메틸화유무에 따라 다른 예후경과를 보이는 간내담관암예후적 특성에 따른 맞춤치료방법의 개발에 유용할 수 있다. In one embodiment, the marker according to the present application is used for predicting the prognosis of the small bile duct type among the histological types of intrahepatic cholangiocarcinoma. In the case of increased methylation in the CpG island of the DLEC1 gene in small bile duct-type intrahepatic cholangiocarcinoma, it was found to have a superior prognosis compared to the case in which it was not. That is, the marker according to the present application can discriminate between carcinomas that will have a good prognosis after surgery in SD type and carcinomas that will not, and can serve as a marker that provides important information on survival in SD type intrahepatic cholangiocarcinoma depending on whether or not DLEC1 methylation is present. there is. It may be useful for the development of a customized treatment method according to the prognostic characteristics of intrahepatic cholangiocarcinoma, which shows a different prognostic course depending on the presence or absence of DLEC1 methylation.
예를 들면 본원 도 3에 도식적으로 나타낸 바와 같이, 수술 후 조직학적 유형이 SD로 판단되고, 메틸화분석에 따라 예후가 양호한 것으로 판단된 경우, 방사선 치료, 화학적 치료, 면역치료를 포함하는 비수술적 항암 치료의 강도 및/또는 회수의 조정 또는 기타 다른 치료법과의 병행 치료 등의 선별을 통해, 맞춤형 치료의 개발이 가능하다. 대장암, 및 유방암 같이 발병율이 높은 암의 경우, 개인별 맞춤치료를 가능하게 하는 다양한 분자 마커가 개발되어 있고, 이러한 분자 마커의 검사 결과에 따라 특정 약물로의 치료 여부가 결정되어 환자의 치료효과 극대화 및 삶의 질의 향상, 생존률 증가에 많은 기여를 하고 있다. 하지만, 간내담관암의 경우 이러한 마커가 전무한 실정으로, 본원에 따른 마커는 개인별 맞춤형 치료 개발에 유용하게 사용될 수 있다. 일례로 대장암의 경우 3기에서 hMLH1 유전자의 프로모터 과메틸화등에 의해 현미부수체 불안정성(MSI-high)이 있다고 판정되면 수술 후 추가적인 항암화학치료가 생존에 도움이 되지 않는 것으로 보고되고 있으나, 간내담관암은 이러한 마커가 존재하지 않는다.For example, as schematically shown in FIG. 3 herein, when the histological type after surgery is determined to be SD and the prognosis is determined to be good according to methylation analysis, non-surgical anticancer including radiation therapy, chemotherapy, and immunotherapy By adjusting the intensity and/or frequency of treatment or selecting treatment in combination with other treatments, it is possible to develop customized treatments. For cancers with high incidence such as colorectal cancer and breast cancer, various molecular markers that enable personalized treatment have been developed, and treatment with a specific drug is determined according to the test results of these molecular markers, thereby maximizing the patient's therapeutic effect. and improvement of quality of life and increase of survival rate. However, in the case of intrahepatic cholangiocarcinoma, such a marker does not exist, and the marker according to the present application can be usefully used in the development of personalized treatment. For example, in the case of colorectal cancer, when it is determined that microsatellite instability (MSI-high) is present due to promoter hypermethylation of the hMLH1 gene in stage 3, it is reported that additional chemotherapy after surgery does not help survival, but intrahepatic cholangiocarcinoma does not have these markers.
또다른 구현예에서 본원에 따른 마커는 다변량 예후분석에서도 독립적인 예후인자로서, 간내담관암 특이적 생존 또는 암비특이적 무재발 생존을 예측을 할 수 있다. 이는 최고 10년까지 환자를 추적할 결과에 근거한 것이다. In another embodiment, the marker according to the present disclosure is an independent prognostic factor even in multivariate prognostic analysis, and can predict intrahepatic cholangiocarcinoma-specific survival or cancer non-specific recurrence-free survival. This is based on outcomes that will follow patients up to 10 years.
이에 다른 구현예에서 본원은 DLEC1 메틸화 마커의 간내담관암 예후 예측용도에 관한 것이다.Accordingly, in another embodiment, the present application relates to the use of a DLEC1 methylation marker for predicting the prognosis of intrahepatic cholangiocarcinoma.
일 구현예에서는 DLEC1 유전자 프로모터의 CpG 다이뉴클레오타이드 모티브의 메틸화 검출용 물질을 포함하는, 간내담관암 예후 예측용 조성물에 관한 것이다.In one embodiment, it relates to a composition for predicting the prognosis of intrahepatic cholangiocarcinoma, comprising a substance for detecting methylation of the CpG dinucleotide motif of the DLEC1 gene promoter.
본원에 따른 마커의 용도는 앞서 언급한 바를 참조할 수 있다. The use of the markers according to the present application may refer to the foregoing.
본원에 따른 검출용 물질은 메틸화 상태를 검출할 수 있는 공지된 다양한 방법에 이용되는 물질을 포함하는 것이다.The detection substance according to the present application includes substances used in various known methods capable of detecting a methylation state.
본원에 따른 일 구현에서는 검출용 물질로는 CpG 다이뉴클레오타이드 메틸화 상태 검출에, 메틸화에 감응적인 제한효소가 사용된다. 이러한 제한효소는 메틸화된 제한효소 인식 부위 또는 비-메틸화된 제한효소 인식부위를 선별적으로 절단한다. 전자의 예로는 AccIII, BanI, BstNI, MspI, 또는 XmaI을 포함하고, 후자의 예로는 AccII, AvaI, BssHII, BstUI, HpaII, 또는 NotI를 포함하나, 이로 제한하는 것은 아니다. 제한효소 처리 후 전기영동을 통해 산물의크기를 분석하여, 절단 여부에 따라 메틸화 상태를 판별할 수 있다.In one embodiment according to the present application, a restriction enzyme sensitive to methylation is used to detect CpG dinucleotide methylation status as a detection substance. These restriction enzymes selectively cut methylated restriction enzyme recognition sites or non-methylated restriction enzyme recognition sites. Examples of the former include AccIII, BanI, BstNI, MspI, or XmaI, and examples of the latter include, but are not limited to, AccII, AvaI, BssHII, BstUI, HpaII, or NotI. By analyzing the size of the product through electrophoresis after treatment with restriction enzymes, the methylation state can be determined depending on whether or not it is cleaved.
또한 다른 구현예에서 CpG 다이뉴클레오타이드 부위를 선별적으로 변형시키는 화합물이 사용될 수 있으며, 이는 직접 또는 추가의 반응을 거쳐 검출될 수 있다. 예를 들면 핵산 증폭 또는 크기 및/또는 하전 상태의 변화가 수반되는 경우, 전기영동, 크로마토그래피 및 질량분광기가 사용될 수 있다. 추가의 반응에 사용되는 화합물의 예로는 하이드라진 및 바이설파이트 이온을 들 수 있다. 하이드라진으로 변형된 DNA는 피페리딘으로 처리하는 경우 절단된다. 바이설파이트 이온으로 처리된 DNA는 알칼리로 처리하여 절단할 수 있다.Also in another embodiment, a compound that selectively modifies a CpG dinucleotide site may be used, which may be detected directly or through an additional reaction. Electrophoresis, chromatography and mass spectroscopy can be used, for example, when nucleic acid amplification or changes in size and/or charge state are involved. Examples of compounds used in the further reaction include hydrazine and bisulfite ions. DNA modified with hydrazine is cleaved when treated with piperidine. DNA treated with bisulfite ions can be cleaved by treatment with alkali.
본원에 따른 다른 구현에서는 CpG 다이뉴클레오타이드 메틸화 상태 검출에, 다양한 증폭 방법이 사용될 수 있다. 예를 들면 PCR(Polymerase Chain Reaction), 메틸화 특이적 PCR, 실시간 메틸화 특이적 PCR(real timemethylation specific PCR), 메틸화 DNA 특이적 결합 단백질을 이용한 PCR, DNA 마이크로어레이, 파이로서열분석 및 바이설파이트 서열분석을 통해서 수행될 수 있다. PCR 이외의 증폭방법으로는 라이게이즈 연쇄 반응(ligase chain reaction, LCR) (Barringer et al, 1990. Gene 89, 117-122), 전사 증폭(WO1988/10315), 표적서열의 선택적 증폭 방법(U.S. Pat. No. 6,410,276), 보존서열을 이용한 PCR(U.S. Pat. No. 4,437,975), 무작위 프라이머를 이용한 PCR(WO1990/06995), 핵산기재 서열 증폭(NASBA) (U.S. Pat. Nos. 5,409,818; 5,554,517; 6,063,603), 및 틈(nick) 교체 증폭(WO2004/067726) 방법을 들 수 있으나 이로 제한하는 것은 아니다.In another embodiment according to the present disclosure, various amplification methods may be used for detecting CpG dinucleotide methylation status. For example, PCR (Polymerase Chain Reaction), methylation specific PCR, real time methylation specific PCR (real timemethylation specific PCR), PCR using methylated DNA specific binding protein, DNA microarray, pyrosequencing and bisulfite sequence This can be done through analysis. Examples of amplification methods other than PCR include ligase chain reaction (LCR) (Barringer et al, 1990. Gene 89, 117-122), transcriptional amplification (WO1988/10315), and selective amplification of the target sequence (US). Pat. No. 6,410,276), PCR using conserved sequences (US Pat. No. 4,437,975), PCR using random primers (WO1990/06995), nucleic acid-based sequence amplification (NASBA) (US Pat. Nos. 5,409,818; 5,554,517; 6,063,603) ), and nick replacement amplification (WO2004/067726) methods, but are not limited thereto.
일 구현예에서 본원에 따른 조성물에 포함되는 검출용 물질은 상기 CpG 다이뉴클레오타이드 모티브의 메틸화 특이적 증폭 방법에 사용되는 물질로서, 상기 물질은 상기 CpG 다이뉴클레오타이드 모티브의 메틸화여부에 따라 상기 CpG의 C를 차별적으로 변형시키는 물질; 및 상기 물질에 의해 변형된 비-메틸화 CpG 다이뉴클레오타이드 모티브를 포함하는 서열에는 결합하나, 비변형된 메틸화 CpG 다이뉴클레오타이드 모티브를 포함하는 서열에는 결합하지 않는 적어도 하나의 프라이머를 포함하는 프라이머 세트 및 프로브; 또는 상기 물질에 의해 비변형된 메틸화 CpG 다이뉴클레오타이드 모티브를 포함하는 서열에는 결합하나, 변형된 비-메틸화 CpG 다이뉴클레오타이드 모티브를 포함하는 서열에는 결합하지 않는 적어도 하나의 프라이머를 포함하는 프라이머 세트 및 프로브를 포함할 수 있다.In one embodiment, the detection substance included in the composition according to the present application is a substance used in the methylation-specific amplification method of the CpG dinucleotide motif, and the substance increases the C of the CpG depending on whether the CpG dinucleotide motif is methylated. differentially modifying substances; and a primer set and probe comprising at least one primer that binds to a sequence comprising a non-methylated CpG dinucleotide motif modified by the agent but does not bind to a sequence comprising an unmodified methylated CpG dinucleotide motif; or a primer set and probe comprising at least one primer that binds to a sequence comprising a methylated CpG dinucleotide motif unmodified by the agent, but does not bind to a sequence comprising a modified non-methylated CpG dinucleotide motif; may include
일 구현예에서는 전방 및 후방 프라이머는 각각 서열번호 1 및 2로 표시되고, 프로브는 서열번호 3의 서열로 표시된다. 상기 프라이머 및 프로브는 모두 CpG 다이뉴클레오타이드에 메틸화가 된 경우에 결합을 하는 방식으로 작용하며, 프로브의 경우 5'은 6-FAM (6-Carboxyfluorescein) 그리고, 3'은 5-TAMRA (5-Carboxytetramethylrhodamine) 라는 형광물질로 표지되어 있어, TaqMan® 방식의 분석에 사용된다. In one embodiment, the forward and backward primers are represented by SEQ ID NOs: 1 and 2, respectively, and the probe is represented by the sequence of SEQ ID NO: 3. Both the primer and the probe act in a way that binds to the CpG dinucleotide when methylated. In the case of the probe, 5' is 6-FAM (6-Carboxyfluorescein) and 3' is 5-TAMRA (5-Carboxytetramethylrhodamine) It is labeled with a fluorescent substance called , and is used for TaqMan® analysis.
일 구현예에서 CpG 다이뉴클레오타이드 모티브의 메틸화여부에 따라 상기 CpG의 C (사이토신)를 차별적으로 변형시키는 물질은 바이설파이트를 포함한다. 바이설파이트는 메틸화된 사이토신은 변형시키지 않고, 비메틸화된 사이토신은 유라실로 변형된다. In one embodiment, the substance that differentially modifies C (cytosine) of CpG according to whether the CpG dinucleotide motif is methylated includes bisulfite. Bisulfite does not modify methylated cytosine and unmethylated cytosine is transformed into uracil.
CpG 다이뉴클레오타이드의 메틸화 상태의 검출을 위한 PCR 프라이머는 검출 방법에 따라 다양하게 제작될 수 있다. 예를 들면 바이설파이트 분석, COBRA (Called Combined Bisulfite Restriction Analysis), 또는 Ms-SNuPE (Methylation-sensitive single nucleotide primer extension) 분석의 경우, 프라이머 자체는 DNA 메틸화 부위 및 가능 부위는 커버하지 않거나, 교잡하지 않도록 디자인되며, 차별적으로 메틸화가 일어나는 부위에서의 서열변이는 한 쌍의 프라이머 사이에 위치하도록 한다. 또는 프라이머가 화합물 처리 후의 메틸화 또는 비-메틸화 부위에 특이적으로 교잡하도록 제작될 수 있으며, 결합 상보성이 충분하여 교잡을 방해하지 않는 경우, 추가의 서열 예를 들면 제한효소 부위, 리간드 결합부위, 링커 또는 반복서열을 포함하도록 제작될 수 있다.PCR primers for detecting the methylation state of CpG dinucleotides may be prepared in various ways depending on the detection method. For example, in the case of bisulfite analysis, COBRA (Called Combined Bisulfite Restriction Analysis), or Ms-SNuPE (Methylation-sensitive single nucleotide primer extension) analysis, the primer itself does not cover or hybridize the DNA methylation site and possible site. It is designed so that it does not, and the sequence variation at the site where differential methylation occurs is located between a pair of primers. Alternatively, the primer may be constructed to specifically hybridize to a methylated or non-methylated site after compound treatment, and additional sequences, such as restriction enzyme sites, ligand binding sites, linkers, if binding complementarity is sufficient to not interfere with hybridization. Alternatively, it may be constructed to include a repeating sequence.
본원에 따른 일 구현예에서는 또한 변형 또는 비변형 DNA 검출을 위해 특정 산물에 특이적으로 결합할 수 있는 프로브가 사용될 수 있으며, 이러한 프로브는 변형된 산물에 직접 결합하거나 또는 변형된 산물의 증폭 산물에 결합할 수 있으며, 검출을 위해 공지의 다양한 물질 예를 들면 형광물질, 방사선물질, 생물발광물질, 발광물질, 화학발광물질, 효소, 수용체 또는 리간드로 표지될 수 있다. 표지방법은 당해 분야에 널리 알려진 기술로, 통상적인 방법을 통하여 수행할 수 있다.In one embodiment according to the present application, a probe capable of specifically binding to a specific product may also be used for detecting modified or unmodified DNA, and such a probe may be directly bound to the modified product or to an amplification product of the modified product. It can bind, and for detection, it can be labeled with a variety of known substances, for example, a fluorescent substance, a radioactive substance, a bioluminescent substance, a luminescent substance, a chemiluminescent substance, an enzyme, a receptor, or a ligand. The labeling method is a technique well known in the art, and can be performed through a conventional method.
다른 양태에서 본원은 간내담관암 예후 예측에 대한 정보를 제공하기 위해, 상기 간내담관암의 예후 예측이 필요한 대상체 유래의 생물학적 시료를 제공하는 단계; 상기 생물학적 시료에서 추출된 DNA로부터 DLEC1 프로모터의 CpG 다이뉴클레오타이드 모티브의 메틸화 정도를 검출하는 단계; 및 상기 생물학적 시료의 상기 모티브의 매틸화 정도를 상기 간내담관암의 예후와 연관시키는 단계를 포함하는, 간내담관암의 메틸화 분석 방법에 관한 것이다. In another aspect, the present application provides information on the prognosis of intrahepatic cholangiocarcinoma, comprising the steps of: providing a biological sample derived from a subject in need of prognosis of intrahepatic cholangiocarcinoma; detecting the degree of methylation of the CpG dinucleotide motif of the DLEC1 promoter from the DNA extracted from the biological sample; and correlating the degree of methylation of the motif of the biological sample with the prognosis of the intrahepatic cholangiocarcinoma.
본원에 따른 방법에서 상기 연관시키는 단계에서, 상기 생물학적 시료에서 DLEC1 메틸화된 경우, 상기 생물학적 시료가 유래된 환자의 간내담관암의 예후가 양호한 것으로 예측할 수 있다.In the associating step in the method according to the present application, when DLEC1 is methylated in the biological sample, the prognosis of intrahepatic cholangiocarcinoma of the patient from which the biological sample is derived may be predicted.
일 구현예에서 본원에 따른 방법에서 메틸화 정도 또는 유무는 다음과 같이 판단할 수 있다. 바이설파이트 및 핵산 증폭방법을 이용한 정량분석에서, DLEC1의 PMR (Percent of methylated reference) 값이 4 이상일 때 DLEC1 메틸화가 있는 것으로 판단하고, 4 미만일 때 메틸화가 없는 것으로 판단한다. DLEC1 메틸화가 없는 대상체와 비교하여, DLEC1 메틸화가 있는 대상체의 예후가 유의하게 좋다.In one embodiment, the degree or presence of methylation in the method according to the present application can be determined as follows. In quantitative analysis using bisulfite and nucleic acid amplification method, when the percentage of methylated reference (PMR) value of DLEC1 is 4 or more, it is determined that DLEC1 methylation is present, and when it is less than 4, it is determined that there is no methylation. Compared to subjects without DLEC1 methylation, the prognosis of subjects with DLEC1 methylation is significantly better.
일 구현예에서는 바이설파이트 처리된 DNA의 증폭을 사용한 정량분석에서 PMR (Percent of methylated reference) 값이 4 이상일 때 과메틸화된 것으로 판단한다. PMR 결정 방법은 공지되 것으로 예를 들면 Ogino S, et al. Precision and performance characteristics of sodium bisulfite conversion and real-time PCR (MethyLight) for quantitative DNA methylation analysis. J Mol Diagn. 2006;8:209-217를 참조할 수 있다.In one embodiment, in quantitative analysis using amplification of bisulfite-treated DNA, when the PMR (Percent of methylated reference) value is 4 or more, it is determined that hypermethylation is achieved. Methods for determining PMR are known, for example, in Ogino S, et al. Precision and performance characteristics of sodium bisulfite conversion and real-time PCR (MethyLight) for quantitative DNA methylation analysis. J Mol Diagn. 2006;8:209-217.
본원에 따른 방법에서 대조군이 사용되는 경우, 대조군은 간내담관암종 증례들 중에서 DLEC1 메틸화가 없다고 판정된 시료가 사용될 수 있다.When a control group is used in the method according to the present disclosure, a sample determined to be free from DLEC1 methylation among intrahepatic cholangiocarcinoma cases may be used as the control group.
본원에 따른 방법에 사용될 수 있는 생물학적 시료는 간내담관암 환자 또는 의심되는 환자의 간내담관암 생검 조직 또는 외과적인 적출조직 또는 상기 조직이 화학적으로 처리된 것, 또는 상기 조직의 인비트로 배양물, 상기조직에서 유래된 오가노이드(organoid), 혹은 간내담관암에서 유래된 세포주를 포함한다.The biological sample that can be used in the method according to the present invention is an intrahepatic cholangiocarcinoma biopsy tissue or surgically excised tissue from a patient or suspected patient with intrahepatic cholangiocarcinoma, or chemically treated tissue, or an in vitro culture of the tissue, in the tissue derived organoids, or cell lines derived from intrahepatic cholangiocarcinoma.
일 구현예서 본원의 방법에서는 상기 메틸화 여부/정도를 검출할 수 있는 생물학적 시료는 상술한 조직 등에서 추출한 DNA 또는 핵산으로 특히 메틸화된 CpG 다이뉴클 레오타이드 특히 CpG 아일랜드에서의 다이뉴클레오타이드의 존재를 검출할 수 있는 핵산이라면 어떤 것이든 사용할 수 있다. In one embodiment, in the method of the present application, the biological sample capable of detecting the presence/degree of methylation is DNA or nucleic acid extracted from the above-described tissue, etc. CpG dinucleotide particularly methylated CpG dinucleotide In particular, the presence of a dinucleotide in the CpG island can be detected. Any nucleic acid can be used.
나아가 본 발명에서의 정제되거나 정제되지 않은 형태의 어떠한 핵산도 사용될 수 있으며, 타겟 부위(예를 들면, CpG-함유 핵산)를 함유하는 핵산 서열을 함유하고 있거나 함유할 것으로 의심되는 어떠한 핵산도 사용될수 있다. 차별적으로 메틸화될 수 있는 핵산 부위가 CpG 아일랜드이고, 이는 다른 예를 들면 다른 부위와 비교하여 높은 CpG 밀도를 가지는 핵산 서열이다. CpG 아일랜드의 경우 평균 G*C 비율이 약 60%로, 보통의 DNA의 G*C 비율은 평균 40%를 나타낸다. Furthermore, any nucleic acid in purified or unpurified form may be used in the present invention, and any nucleic acid containing or suspected of containing a nucleic acid sequence containing a target site (eg, CpG-containing nucleic acid) may be used. there is. A nucleic acid site that can be differentially methylated is a CpG island, which is a nucleic acid sequence having a high CpG density compared to other, for example, other sites. In the case of CpG islands, the average G*C ratio is about 60%, and the average G*C ratio of normal DNA is 40%.
일 구현예에서 CpG의 메틸화 여부 검출에 사용되는 핵산은 DNA, 특히 유전체 DNA이다. 이러한 CpG 아일랜드의 메틸화 상태의 검출에 사용되는 시료에 포함된 핵산은 Sambrook 등(Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY.,최신판)에 기재된 여러 가지 방법으로 추출될 수 있다.In one embodiment, the nucleic acid used for detecting whether CpG is methylated is DNA, in particular, genomic DNA. Nucleic acids contained in the sample used for the detection of the methylation state of these CpG islands can be extracted by various methods described in Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY., latest edition).
앞서 언급한 바와 같이 본원에 따른 마커의 메틸화 상태의 검출을 위한 다양한 물질 및 이러한 물질을 사용한 다양한 방법이 사용될 수 있다.As mentioned above, various substances and various methods using such substances for the detection of the methylation status of a marker according to the present disclosure can be used.
DNA 메틸화 상태를 분석할 수 있는 다른 방법으로는 MALDITOFF, MassARRAY, MethyLight, QAMA(Quantitative analysis of ethylated alleles), ERMA(enzymatic regional methylation assay), HeavyMethyl, QBSUPT, MS-SNuPE, MethylQuant, Quantitative PCR sequencing, 올리고뉴클레오타이드 기재의 마이크로어레이를 들 수 있으나 이로 제한하는 것은 아니다.Other methods for analyzing DNA methylation status include MALDITOFF, MassARRAY, MethyLight, QAMA (Quantitative analysis of ethylated alleles), ERMA (enzymatic regional methylation assay), HeavyMethyl, QBSUPT, MS-SNuPE, MethylQuant, Quantitative PCR sequencing, oligo nucleotide-based microarrays, but are not limited thereto.
일 구현예에서는 CpG 다이뉴클레오타이드의 메틸화 상태 검출은 실시간 PCR을 이용한다. 다양한 방법으로 실시간 PCR을 수행할 수 있으며, 예를 들면 TaqMan 시스템(Applied Biosystems)이나, Molecular Beacon 시스템, Scorpion 시스템을 사용할 수 있으며, 전자의 두 방법은 양 말단 중 하나가 각각 형광염료(fluorophore), 형광제거염료(fluorescence quencher)로 표지된 프로브가 사용되며, 후자는 프라이머에 연결된 헤어핀 구조가 형성된 표지된 프로브가 사용된다.In one embodiment, detection of the methylation status of CpG dinucleotides uses real-time PCR. Real-time PCR can be performed by various methods, for example, the TaqMan system (Applied Biosystems), Molecular Beacon system, or Scorpion system can be used. A probe labeled with a fluorescence quencher is used, and in the latter case, a labeled probe having a hairpin structure linked to a primer is used.
메틸화 상태의 검출을 위해 사용되는 프로브, 프라이머 등은 표적 핵산과 교잡을 통해 작용한다. 교잡 조건은 구체적 실험 목적, 반응에 사용되는 핵산의 특성 등에 따라 결정될 수 있다. 예를 들면 교잡부위의 핵산의 길이, 상동성정도, 뉴클레오티드 서열 조성(예를 들면, GC/AT 조성비) 및 핵산 타입(예를 들면, RNA, DNA) 등이 교잡조건의 선택에 고려된다. 일반적으로 특이성을 높이기 위해서는 고교잡 조건이 사용된다. 그러나 상술한 바와 같이 최적 조건은 구제척 교잡반응에 따라 다양하며, 실험을 통하여 결정할 수 있다.Probes, primers, etc. used for detection of methylation status act through hybridization with a target nucleic acid. Hybridization conditions may be determined according to specific experimental purposes, characteristics of nucleic acids used in the reaction, and the like. For example, the length of the nucleic acid of the hybridization site, the degree of homology, the nucleotide sequence composition (eg, GC/AT composition ratio), and the nucleic acid type (eg, RNA, DNA) are considered in the selection of hybridization conditions. In general, high hybridization conditions are used to increase specificity. However, as described above, the optimal conditions vary depending on the externa hybridization reaction and can be determined through experiments.
이하, 본 발명의 이해를 돕기 위해서 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐 본 발명이 하기의 실시예에 한정되는 것은 아니다.Hereinafter, examples are presented to help the understanding of the present invention. However, the following examples are provided for easier understanding of the present invention, and the present invention is not limited thereto.
실시예 Example
실시예 1. 간내담관암 예후예측 메틸화 마커 선별Example 1. Intrahepatic cholangiocarcinoma prognostic methylation marker selection
(1) DLEC1 메틸화 마커 선별(1) DLEC1 methylation marker selection
담낭 cystic duct tissue (n=10)와 간내담관암조직 (n=10)을 대비하여 113개 유전자의 DNA메틸화빈도를 비교한 결과, 간내담관암에서 높게 메틸화되는 유전자들 30개를 암특이 DNA메틸화마커로 선별하였다.As a result of comparing the DNA methylation frequencies of 113 genes for gallbladder cystic duct tissue (n=10) and intrahepatic cholangiocarcinoma tissue (n=10), 30 genes highly methylated in intrahepatic cholangiocarcinoma were identified as cancer-specific DNA methylation markers. was selected.
또한 외과적 절제술을 받은 172명의 간내담관암 환자로부터 유래한 간내담관암 파라핀 블록 검체(formalin fixed, paraffin-embedded tissue)를 사용하여 30개 암특이적 DNA메틸화마커에 대해 MethyLight assay를 시행하여 스크린하여 SD, BD, 그리고 LD에서 메틸화빈도 차이, 그리고 예후적 중요도에서 가장 의미 있는 마커는 DLEC1인 것으로 나타났다(도 1 참조). In addition, using the intrahepatic cholangiocarcinoma paraffin block specimens (formalin fixed, paraffin-embedded tissue) derived from 172 intrahepatic cholangiocarcinoma patients who underwent surgical resection, MethyLight assay was performed on 30 cancer-specific DNA methylation markers to screen SD, DLEC1 was found to be the most significant marker for the difference in methylation frequency and prognostic importance in BD and LD (see FIG. 1 ).
DLEC1은 BD에서 45%, SD에서 38%, 그리고 SD에서 4.9%의 메탈화 빈도를 보였다.DLEC1 had metallization frequencies of 45% in BD, 38% in SD, and 4.9% in SD.
(2) DLEC1 메틸화와 간내담관암의 임상병리학적 특성(2) DLEC1 methylation and clinicopathological characteristics of intrahepatic cholangiocarcinoma
간내담관암을 제거하기 위하여 외과적 절제술을 시행받은 172개의 간내담관암 검체에서, DLEC1 메틸화를 분석한 결과, 이는 환자의 성별, 간내담관암 육안유형, 조직학적 유형, 분화정도, 점액존재여부, 말초신경침범, 만성간질환 동반, 담관상피내이형성 등과 연관되어 있는 것으로 나타났다(표 1 참조).Analysis of DLEC1 methylation in 172 intrahepatic cholangiocarcinoma specimens that had undergone surgical resection to remove intrahepatic cholangiocarcinoma showed that the patient's gender, intrahepatic cholangiocarcinoma gross type, histological type, degree of differentiation, presence of mucus, and peripheral nerve invasion were determined. , associated with chronic liver disease and biliary duct epithelial dysplasia (see Table 1).
[표 1] DLEC1 메틸화와 간내담관암의 임상병리학적 특성[Table 1] DLEC1 methylation and clinicopathological characteristics of intrahepatic cholangiocarcinoma
(3) DLEC1 메틸화와 생존분석(3) DLEC1 methylation and survival analysis
전체 간내담관암을 대상으로 시행한 단일 생존분석에서, DLEC1 메틸화의 증가는 간내담관암 환자의 좋은 예후와 연관되어 있었으며 이는 암특이적인 생존과 무재발생존 양쪽에서 공통된 것으로 나타났다(도 2의 a 및 b). 간내담관암에서 DLEC1메틸화가 mass-forming 육안유형 및 BD와 SD 조직유형과 밀접한 연관성을 보이는 것으로 나타났다. 또한 mass forming type 육안유형 간내담관암을 대상으로 예후분석하였고(도 2의 c,d), SD조직유형 간내담관암만을 대상으로 예후분석하였으며(도 2의 e,f), 그 결과, DLEC1메틸화는 좋은 예후와 유의성 있는 관계를 지닌 반면, BD조직유형만을 대상으로 생존분석을 시행하였을 시(도 2의 g,h)에는 DLEC1의 메틸화 수준이 예후와 유의한 연관관계를 보이지 않는 것으로 나타났다. In a single survival analysis of all intrahepatic cholangiocarcinomas, an increase in DLEC1 methylation was associated with a good prognosis in patients with intrahepatic cholangiocarcinoma, which was found to be common to both cancer-specific survival and recurrence-free survival (Fig. 2a and b). . In intrahepatic cholangiocarcinoma, DLEC1 methylation showed a close association with mass-forming gross type and BD and SD tissue types. In addition, the prognosis was analyzed for mass forming type gross-type intrahepatic cholangiocarcinoma (Fig. 2c, d), and prognostic analysis was conducted for only SD tissue type intrahepatic cholangiocarcinoma (Fig. 2e,f). As a result, DLEC1 methylation was good. While there was a significant relationship with the prognosis, it was found that the methylation level of DLEC1 did not show a significant relationship with the prognosis when survival analysis was performed on only the BD tissue type (Fig. 2 g, h).
DLEC1메틸화는 간내담관암종 BD유형과 SD유형에서 주로 관찰되며, 이 두가지 조직유형중 SD유형의 간내담관암에서만 양호한 예후와 밀접한 연관성을 보이고, 또한 암특이적인 생존과 무재발생존 양쪽에서 다변량 예후분석에서도 독립적인 예후인자이다.DLEC1 methylation is mainly observed in intrahepatic cholangiocarcinoma BD type and SD type, and among these two tissue types, only SD type intrahepatic cholangiocarcinoma is closely related to a good prognosis, and it is also independent in multivariate prognostic analysis in both cancer-specific survival and recurrence-free survival. is a prognostic factor.
다변량 생존분석에서 간내담관암은 N stage, T stage, M stage, pTNM stage, lymphatic emboli, 신경침습, 혈관침습, 기원된 장소의 개수, 육안형, 조직학적 형태, 분화의 정도, 절제면에서 종양의 존재 여부와는 무관하게 DLEC1 프로모터 메틸화가 원발암에 의한 사망만 중도절단하는 암특이적인 생존과 암에 의한 사망외에 재발, 2차암 발생 등도 중도절단에 포함되는 무재발 생존에 대한 독립적인 예후인자 로써 작용했다(표 2 및 표 3).In multivariate survival analysis, intrahepatic cholangiocarcinoma was classified as N stage, T stage, M stage, pTNM stage, lymphatic emboli, nerve invasion, vascular invasion, number of origins, gross type, histological form, degree of differentiation, DLEC1 promoter methylation is an independent prognostic factor for cancer-specific survival, in which only death from primary cancer is censored, regardless of the presence or absence, and recurrence-free survival, which includes not only death from cancer, but also recurrence and occurrence of secondary cancer. worked (Table 2 and Table 3).
[표 2] 암특이적인 생존과 임상병리학적인 요소의 연관관계[Table 2] Relationship between cancer-specific survival and clinicopathological factors
[표 3] 무재발 생존과 임상병리학적인 요소의 연관관계[Table 3] Relationship between recurrence-free survival and clinicopathological factors
기존의 진단(도 3a) 방법으로는 임상적 소견과 조직학적 소견 외에 질병의 진행을 예측할 수 있는 방법이 미비했다. 하지만 독립적인 예후 예측 인자인 본원의 DLEC1 메틸화는 간내 담관암의 예후에 대한 예측의 정확도를 올릴 수 있게 되었다.In the conventional diagnostic (FIG. 3a) method, there is insufficient method for predicting disease progression other than clinical and histological findings. However, DLEC1 methylation of the present application, which is an independent prognostic predictor, can increase the accuracy of prediction for the prognosis of intrahepatic cholangiocarcinoma.
구체적으로 개인별 맞춤치료를 위해서는 선결과제가 질환의 예후를 정확하게 예측하는 예후 표지자의 발굴이다. 이런 측면에서 본원에 따른 DLCE1 메틸화 마커는 간내담관암의 예후예측 표지자로서 개인별 맞춤치료의 개발을 위해 유용하게 사용될 수 있다. 예를 들면 예후가 양호한 환자와 그렇지 않은 환자에게 동일한 치료방법을 사용한다는 것은 치료효과, 삶의 질의 향상, 불필요한 치료의 방지 등의 측면에서 환자에게 불리할 수 있다. 일 구현예에서 본원의 DLEC1 메틸화는 간내담관암종의 조직학적 유형 중 SD유형에서 수술후 양호한 예후를 가질 암종과 그렇지 않을 암종을 가늠할 수 있는 예후예측 표지자이다. 즉, SD유형 간내담관암은 DLEC1 메틸화 유무에 따라 극명하게 다른 예후 경과를 보이므로, DLEC1 메틸화는 SD 유형 간내담관암종에서 생존에 관한 중요한 정보를 제공하는 표지자이다. DLEC1 메틸화유무에 따라 극명하게 다른 예후경과를 보이는 SD 유형 간내담관암을 다른 조직 유형과 동일한 치료방법을 고수한다는 것은 맞춤치료의 개념을 위반하는 것이며, 예후적 특성에 따른 맞춤치료방법을 개발에 유용하게 사용될 수 있다.Specifically, for personalized treatment, a prerequisite is the discovery of prognostic markers that accurately predict the prognosis of the disease. In this regard, the DLCE1 methylation marker according to the present application can be usefully used for the development of personalized treatment as a prognostic marker for intrahepatic cholangiocarcinoma. For example, using the same treatment method for a patient with a good prognosis and a patient with a poor prognosis may be disadvantageous to the patient in terms of therapeutic effect, improvement of quality of life, and prevention of unnecessary treatment. In one embodiment, DLEC1 methylation of the present application is a prognostic marker that can determine which carcinomas will and will not have a good prognosis after surgery in SD type among histological types of intrahepatic cholangiocarcinoma. That is, since SD-type intrahepatic cholangiocarcinoma has a markedly different prognostic course depending on the presence or absence of DLEC1 methylation, DLEC1 methylation is a marker that provides important information on survival in SD-type intrahepatic cholangiocarcinoma. Adhering to the same treatment method as other tissue types for SD-type intrahepatic cholangiocarcinoma, which has a markedly different prognosis depending on the presence or absence of DLEC1 methylation, violates the concept of customized treatment, and is useful for developing customized treatment methods according to prognostic characteristics. can be used
실험방법Experimental method
- 검체의 선택 및 DNA 추출- Sample selection and DNA extraction
파라핀블록에서 생성된 간내담관암 슬라이드에서 현미경하의 검사를 통해 암이 가장 명백한 부위를 표기하고 이를 면도날로 긁어 tissue lysis buffer에 용해시키고 섭씨 55도에서 2일간 배양한 후 섭씨 95도에서 30분간 노출시켰다. 이는 포르말린 고정에 의한 DNA가닥간의 cross-linking이나 DNA에 부착된 단백질등을 떨어뜨려, bisulfite conversion이 용이하게 해줘 DNA메틸화 측정의 정확성을 향상시킨다.In intrahepatic cholangiocarcinoma slides generated from paraffin block, the most obvious site of cancer was marked through examination under a microscope, scraped with a razor blade, dissolved in tissue lysis buffer, incubated at 55°C for 2 days, and exposed at 95°C for 30 minutes. This improves the accuracy of DNA methylation measurement by facilitating bisulfite conversion by dropping cross-linking between DNA strands by formalin fixation or proteins attached to DNA.
-Bisulfite modification과 MethyLight-Bisulfite modification and MethyLight
EZ DNA methylation kit (ZYMO RESEARCH)을 제조자의 방법대로 사용하여 바이설파이트 변형을 수행하였다. 바이설파이트 처리에 의해 메틸화되지 않은 CpG Island의 사이토신은 유라실로 변하게 된다. DLEC1 프로모터 메틸화 수준에 대한 측정은 Real time methylation-specific PCR의 한 방법인 MethyLight (Nucleic Acids Res. 2000 Apr 15; 28(8): e32.) 기법을 이용하여 CpG island에서 메틸화 레벨에 대한 정량적 측정을 수행하였다. PMR (Percent of methylated reference) 값이 4 이상일 때 프로모터가 과메틸화 되었다고 판단하였다. 실험에 사용된 프라이머 및 프로브 서열은 다음과 같다. (아래 서열에서 방향은 모두 5‘->3’으로 기재된 것이다. Bisulfite modification was performed using the EZ DNA methylation kit (ZYMO RESEARCH) according to the manufacturer's method. Cytosine of unmethylated CpG island by bisulfite treatment is converted to uracil. For measurement of DLEC1 promoter methylation level, quantitative measurement of methylation level in CpG island was performed using MethyLight (Nucleic Acids Res. 2000 Apr 15; 28(8): e32.), a method of real time methylation-specific PCR. carried out. When the PMR (Percent of methylated reference) value was 4 or higher, it was determined that the promoter was hypermethylated. The primer and probe sequences used in the experiment are as follows. (In the sequence below, all directions are 5'->3'.
DLEC1 forward primer : TCGTTGCGTATTTAAGATATTTCGTATTDLEC1 forward primer: TCGTTGCGTATTTAAGATATTTCGTATT
DLEC1 reverse primer : CGTAACGCTCATTCTCGCTACCDLEC1 reverse primer : CGTAACGCTCATTCTCGCTACC
DLEC1 probe : 6FAM-TAATCAAACTTACGCTCACTTCGTCGCCG-TAMRADLEC1 probe: 6FAM-TAATCAAACTTACGCTCACTTCGTCGCCG-TAMRA
PCR 조건: 95℃ 10 min-> 95℃ 20 sec -> 59℃ 40 sec -> Plate read : 50 cyclesPCR conditions: 95℃ 10 min-> 95℃ 20 sec -> 59℃ 40 sec -> Plate read: 50 cycles
실험결과 과메틸화된 DLEC1 프로모터 부위를 지닌 간내담관암이 확인되었을 때 상대적으로 더 좋은 예후를 기대할 수 있으며 이는 예후와 연관된 다른 요소와 독립적이기에 임상적인 소견 및 병리학적 소견과 무관하게 생각할 수 있다. 따라서 기존의 병리학적 소견과는 별개로 시행해야할 임상적인 필요성이 있다.A relatively better prognosis can be expected when intrahepatic cholangiocarcinoma with hypermethylated DLEC1 promoter region is confirmed as a result of the experiment, and since it is independent of other prognostic factors, it can be considered independent of clinical and pathological findings. Therefore, there is a clinical need to be performed separately from the existing pathological findings.
이상에서 본원의 예시적인 실시예에 대하여 상세하게 설명하였지만 본원의 권리범위는 이에 한정되는 것은 아니고 다음의 청구범위에서 정의하고 있는 본원의 기본 개념을 이용한 당업자의 여러 변형 및 개량 형태 또한 본원의 권리범위에 속하는 것이다.Although the exemplary embodiments of the present application have been described in detail above, the scope of the present application is not limited thereto, and various modifications and improvements by those skilled in the art using the basic concept of the present application as defined in the following claims are also included in the scope of the present application. will belong to
본 발명에서 사용되는 모든 기술용어는, 달리 정의되지 않는 이상, 본 발명의 관련 분야에서 통상의 당업자가 일반적으로 이해하는 바와 같은 의미로 사용된다. 본 명세서에 참고문헌으로 기재되는 모든 간행물의 내용은 본 발명에 도입된다.All technical terms used in the present invention, unless otherwise defined, have the meaning as commonly understood by one of ordinary skill in the art of the present invention. The contents of all publications herein incorporated by reference are incorporated herein by reference.
<110> Seoul National University R&DB Foundation
<120> DLEC1 methylation marker for predicting prognosis of intrahepatic
cholangiocarcinoma
<130> DP201911001P
<160> 3
<170> KoPatentIn 3.0
<210> 1
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer for detecting DLEC1 CpG Motifs
<400> 1
tcgttgcgta tttaagatat ttcgtatt 28
<210> 2
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DLEC1 Reverse primer for detecting DLEC1 CpG Motifs
<400> 2
cgtaacgctc attctcgcta cc 22
<210> 3
<211> 29
<212> DNA
<213> Artificial Sequence
<220>
<223> DLEC1 Probe for detecting DLEC1 CpG Motifs
<400> 3
taatcaaact tacgctcact tcgtcgccg 29
<110> Seoul National University R&DB Foundation
<120> DLEC1 methylation marker for predicting prognosis of intrahepatic
cholangiocarcinoma
<130> DP201911001P
<160> 3
<170> KoPatentIn 3.0
<210> 1
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer for detecting DLEC1 CpG Motifs
<400> 1
tcgttgcgta tttaagatat ttcgtatt 28
<210> 2
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DLEC1 Reverse primer for detecting DLEC1 CpG Motifs
<400> 2
cgtaacgctc attctcgcta
Claims (13)
A composition for predicting prognosis of intrahepatic cholangiocarcinoma, comprising a substance for detecting methylation of the CpG dinucleotide motif of the DLEC1 gene promoter.
상기 간내담관암은 조직학적 유형이 소담관 유형인, 간내담관암 예후 예측용 조성물.
The method of claim 1,
The intrahepatic cholangiocarcinoma is a histological type of the small bile duct type, a composition for predicting the prognosis of intrahepatic bile duct cancer.
상기 예후 예측은 간내담관암 특이적 생존 또는 암비특이적 무재발 생존인, 간내담관암 예후 예측용 조성물.
The method of claim 1,
The prognosis prediction is intrahepatic cholangiocarcinoma-specific survival or cancer non-specific recurrence-free survival, the composition for predicting the prognosis of intrahepatic cholangiocarcinoma.
상기 검출용 물질은 상기 CpG 다이뉴클레오타이드 모티브의 메틸화 특이적 증폭 방법에 사용되는 물질로서,
상기 물질은 상기 CpG 다이뉴클레오타이드 모티브의 메틸화여부에 따라 상기 CpG의 C를 차별적으로 변형시키는 물질; 및
상기 물질에 의해 변형된 비-메틸화 CpG 다이뉴클레오타이드 모티브를 포함하는 서열에는 결합하나, 비변형된 메틸화 CpG 다이뉴클레오타이드 모티브를 포함하는 서열에는 결합하지 않는 적어도 하나의 프라이머를 포함하는 프라이머 세트 및 프로브; 또는
상기 물질에 의해 비변형된 메틸화 CpG 다이뉴클레오타이드 모티브를 포함하는 서열에는 결합하나, 변형된 비-메틸화 CpG 다이뉴클레오타이드 모티브를 포함하는 서열에는 결합하지 않는 적어도 하나의 프라이머를 포함하는 프라이머 세트 및 프로브를 포함하는 것인, 간내담관암 예후 예측용 조성물.
3. The method according to claim 1 or 2,
The detection material is a material used in the methylation-specific amplification method of the CpG dinucleotide motif,
The substance may include a substance that differentially modifies C of the CpG according to whether the CpG dinucleotide motif is methylated; and
a primer set and probe comprising at least one primer that binds to a sequence comprising a non-methylated CpG dinucleotide motif modified by the agent but does not bind to a sequence comprising an unmodified methylated CpG dinucleotide motif; or
A primer set and probe comprising at least one primer that binds to a sequence comprising a methylated CpG dinucleotide motif unmodified by the agent but does not bind to a sequence comprising a modified non-methylated CpG dinucleotide motif The composition for predicting the prognosis of intrahepatic cholangiocarcinoma.
간내담관암의 예후 예측이 필요한 대상체에서 분리된 생물학적 시료를 제공하는 단계로, 상기 간내담관암은 소담관 유형이고;
상기 생물학적 시료에서 추출된 DNA로부터 DLEC1 프로모터의 CpG 다이뉴클레오타이드 모티브의 메틸화 유무를 검출하는 단계; 및
대조군의 결과와 비교하여 상기 생물학적 시료의 상기 모티브의 매틸화 유무를 상기 간내담관암의 예후와 연관시키는 단계를 포함하는, 간내담관암의 메틸화 분석 방법.
To provide information on the prognosis of intrahepatic bile duct cancer,
Providing a biological sample isolated from a subject in need of prediction of the prognosis of intrahepatic bile duct cancer, wherein the intrahepatic bile duct cancer is a small bile duct type;
detecting the presence or absence of methylation of the CpG dinucleotide motif of the DLEC1 promoter from the DNA extracted from the biological sample; and
Comparing the results of the control group to the presence or absence of methylation of the motif in the biological sample, comprising the step of correlating the prognosis of the intrahepatic cholangiocarcinoma methylation analysis method.
상기 연관시키는 단계에서, 상기 생물학적 시료에서 메틸화 검출된 경우, 상기 생물학적 시료가 유래된 환자의 간내담관암의 예후가 양호한 것으로 예측하는 것인, 간내담관암의 메틸화 분석 방법.
6. The method of claim 5,
In the associating step, when methylation is detected in the biological sample, it is predicted that the prognosis of the intrahepatic cholangiocarcinoma of the patient from which the biological sample is derived is good.
상기 간내담관암은 조직학적 유형이 소담관 유형인, 간내담관암의 메틸화 분석 방법.
7. The method according to claim 5 or 6,
The intrahepatic bile duct cancer histological type is a small bile duct type, methylation analysis method of intrahepatic bile duct cancer.
상기 예후 예측은 간내담관암 특이적 생존 또는 암비특이적 무재발 생존인, 간내담관암의 메틸화 분석 방법.
7. The method according to claim 5 or 6,
The prognostic prediction is intrahepatic cholangiocarcinoma-specific survival or cancer non-specific recurrence-free survival, methylation analysis method of intrahepatic cholangiocarcinoma.
상기 생물학적 시료는 간내담관암 생검 또는 적출 조직인, 간내담관암의 메틸화 분석 방법.
7. The method according to claim 5 or 6,
The biological sample is an intrahepatic cholangiocarcinoma biopsy or a tissue extracted, methylation analysis method of intrahepatic cholangiocarcinoma.
상기 메틸화는 상기 생물학적 시료에서 유래된 유전체 DNA의 비-메틸화 사이토신 잔기를 선택적으로 변형시키거나, 또는 메틸화 사이토신 잔기를 선택적으로 변형시키는 화합물과 접촉하고, 상기 접촉에 의해 생성된 산물의 검출에 의한 것인, 간내담관암의 메틸화 분석 방법.
7. The method according to claim 5 or 6,
wherein the methylation selectively modifies non-methylated cytosine residues of genomic DNA derived from the biological sample, or contacting with a compound that selectively modifies methylated cytosine residues, and detecting a product produced by the contacting The method of methylation analysis of intrahepatic bile duct cancer.
상기 검출은 메틸화 특이적 증폭 방법에 의한 것으로,
상기 증폭방법은 변형된 비-메틸화 CpG 다이뉴클레오타이드 모티브를 포함하는 서열에는 결합하나, 비변형된 메틸화 CpG 다이뉴클레오타이드 모티브를 포함하는 서열에는 결합하지 않는 적어도 하나의 프라이머를 포함하는 프라이머 세트를 이용하여 증폭산물을 생성하거나, 또는
비변형된 메틸화 CpG 다이뉴클레오타이드 모티브를 포함하는 서열에는 결합하나, 변형된 비-메틸화 CpG 다이뉴클레오타이드 모티브를 포함하는 서열에는 결합하지 않는 적어도 하나의 프라이머를 포함하는 프라이머 세트를 이용하여 증폭산물을 생성하는 것인, 간내담관암의 메틸화 분석 방법.
7. The method according to claim 5 or 6,
The detection is by a methylation-specific amplification method,
The amplification method is amplified using a primer set comprising at least one primer that binds to a sequence comprising a modified non-methylated CpG dinucleotide motif but does not bind to a sequence comprising an unmodified methylated CpG dinucleotide motif. produce a product, or
An amplification product is generated using a primer set comprising at least one primer that binds to a sequence comprising an unmodified methylated CpG dinucleotide motif but does not bind to a sequence comprising a modified non-methylated CpG dinucleotide motif. The method for methylation analysis of intrahepatic cholangiocarcinoma.
상기 증폭산물은 (a) 변형된 비-메틸화 CpG 다이뉴클레오타이드 모티브를 포함하는 서열에는 결합하나, 비변형된 메틸화 CpG 다이뉴클레오타이드 모티브를 포함하는 서열에는 결합하지 않는 제1 프로브 또는
(b) 비변형된 메틸화 CpG 다이뉴클레오타이드 모티브를 포함하는 서열에는 결합하나, 변형된 비-메틸화 CpG 다이뉴클레오타이드 모티브를 포함하는 서열에는 결합하지 않는 제2 프로브를 이용하여 검출되는 것인, 간내담관암의 메틸화 분석 방법.
12. The method of claim 11,
The amplification product comprises (a) a first probe that binds to a sequence comprising a modified non-methylated CpG dinucleotide motif but does not bind to a sequence comprising an unmodified methylated CpG dinucleotide motif; or
(b) binding to a sequence comprising an unmodified methylated CpG dinucleotide motif but not binding to a sequence comprising a modified non-methylated CpG dinucleotide motif, which is detected using a second probe Methylation analysis method.
상기 제2 프로브 및 이와 함께 사용되는 프라이머 서열은 다음과 같은 것인, 간내담관암의 메틸화 분석 방법:
DLEC1 전방 프라이머 : 5‘TCGTTGCGTATTTAAGATATTTCGTATT3’ (서열번호 1)
DLEC1 후방 프라이머 : 5‘CGTAACGCTCATTCTCGCTACC3’ (서열번호 2)
DLEC1 프로브 : 5‘TAATCAAACTTACGCTCACTTCGTCGCCG3’ (서열번호 3)in paragraph 12
The second probe and the primer sequence used therewith are as follows, a method for methylation analysis of intrahepatic cholangiocarcinoma:
DLEC1 forward primer: 5'TCGTTGCGTATTTAAGATATTTCGTATT3' (SEQ ID NO: 1)
DLEC1 back primer: 5'CGTAACGCTCATTCTCGCTACC3' (SEQ ID NO: 2)
DLEC1 probe: 5'TAATCAAACTTACGCTCACTTCGTCGCCG3' (SEQ ID NO: 3)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020200000721A KR102280870B1 (en) | 2020-01-03 | 2020-01-03 | DLEC1 methylation marker for predicting prognosis of intrahepatic cholangiocarcinoma |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020200000721A KR102280870B1 (en) | 2020-01-03 | 2020-01-03 | DLEC1 methylation marker for predicting prognosis of intrahepatic cholangiocarcinoma |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20210087690A KR20210087690A (en) | 2021-07-13 |
KR102280870B1 true KR102280870B1 (en) | 2021-07-22 |
Family
ID=76858687
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020200000721A KR102280870B1 (en) | 2020-01-03 | 2020-01-03 | DLEC1 methylation marker for predicting prognosis of intrahepatic cholangiocarcinoma |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR102280870B1 (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113528664B (en) * | 2021-07-15 | 2023-08-29 | 四川大学华西医院 | Biomarker and application thereof in prognosis prediction of intrahepatic cholangiocellular carcinoma |
-
2020
- 2020-01-03 KR KR1020200000721A patent/KR102280870B1/en active IP Right Grant
Non-Patent Citations (1)
Title |
---|
Semin Cancer Biol. 51: 36-49 (2017.12.15.) |
Also Published As
Publication number | Publication date |
---|---|
KR20210087690A (en) | 2021-07-13 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US10113202B2 (en) | Method for determining the methylation status of the promoter region of the TWIST1 gene in genomic DNA from bladder cells | |
US11365451B2 (en) | Detecting colorectal neoplasm | |
US10808286B2 (en) | Methods for detecting epigenetic modifications | |
JP6397762B2 (en) | Method for determining prognosis of cancer subject and nucleic acid | |
DK2394170T3 (en) | Methods for detecting colorectal cancer | |
JP2013090629A (en) | Method and nucleic acid for analysis of cellular proliferative disorder | |
JP2012504397A (en) | Molecular markers in prostate cancer | |
JP2005204651A (en) | Prognostic marker for predicting therapeutic response and/or survival period of breast cell proliferative disorder patient | |
KR20220092561A (en) | Ovarian Cancer Detection | |
CN113811622B (en) | Detection of pancreatic ductal adenocarcinoma in plasma | |
CA3115945A1 (en) | Molecular markers in prostate cancer | |
KR102280870B1 (en) | DLEC1 methylation marker for predicting prognosis of intrahepatic cholangiocarcinoma | |
AU2012331104B2 (en) | Combinations of molecular markers in prostate cancer providing a diagnostic tool with improved sensitivity/specificity | |
CN111440863B (en) | Application of KAZN gene methylation detection reagent in preparation of colorectal cancer prognosis diagnosis reagent | |
KR101504069B1 (en) | Methods and Methylation Markers for detecting or diagnosing cholangiocarcinoma | |
EP2537941A1 (en) | Methods and nucleotide fragments of predicting the ability of tumor invasion and metastasis in vitro | |
KR20140077446A (en) | Methods and Methylation Markers for detecting or diagnosing cholangiocarcinoma | |
US20080213781A1 (en) | Methods of detecting methylation patterns within a CpG island | |
EP2773768B1 (en) | Combinations of molecular markers in prostate cancer providing a diagnostic tool with improved sensitivity/specificity | |
JP2005224238A (en) | Prognosis diagnosing marker for predicting treatment response and/or survival time of patient suffering from mammary cell growth disorder |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
GRNT | Written decision to grant |