KR102280870B1 - DLEC1 methylation marker for predicting prognosis of intrahepatic cholangiocarcinoma - Google Patents

Abstract

The present application discloses a methylation marker of the DLEC1 gene promoter for predicting the prognosis of intrahepatic cholangiocarcinoma. For personalized cancer treatment, a prerequisite is the discovery of prognostic markers that accurately predict the prognosis of the disease. In this respect, the DLCE1 methylation marker according to the present application is a prognostic marker for intrahepatic cholangiocarcinoma, and improvement of quality of life through selection of therapeutic agents including chemotherapy, radiation therapy, and immunotherapy, treatment method, differentiation of therapeutic activity, etc. In terms of prevention, etc., it can be usefully used in the development of personalized treatment methods according to prognostic characteristics.

Description

DLEC1 methylation marker for predicting prognosis of intrahepatic cholangiocarcinoma

The present application relates to a technology related to a prognostic predictor of intrahepatic bile duct cancer.

Biliary duct cancer is the second most common cancer occurring in the liver. Among cholangiocarcinomas, intrahepatic cholangiocarcinoma originates from various cells, unlike hierarchical cancer. Histologically, intrahepatic cholangiocarcinoma has three subtypes: LD (large bile duct) type, SD (small bile duct small bile duct) type, and BD (bile ductule, bile duct) type.

These three histological types of intrahepatic cholangiocarcinoma show differentiation in relation to various clinical findings including viral infection. For example, SD and BD are associated with absence of mucin, chronic hepatitis, and IDH1/2 mutations, whereas LD is strongly associated with presence of mucin and KRAS mutations.

Although intrahepatic cholangiocarcinoma is a liver cancer with a poor prognosis, it has not received much attention from academia because it is a rare carcinoma in the West, and a unique TNM staging for intrahepatic cholangiocarcinoma was developed for the first time in the 7th revision. However, it is known that TNM staging in the 7th revision does not properly predict the prognosis of intrahepatic cholangiocarcinoma, and although TNM staging in the 8th revision has been published, research results are still lacking as to whether it predicts the prognosis of intrahepatic cholangiocarcinoma properly. In addition, there are few research results on prognostic markers of intrahepatic cholangiocarcinoma, and few of the reproducible research results of prognostic markers of intrahepatic cholangiocarcinoma published to date have been published.

Furthermore, there is no chemotherapy method that can improve the patient's prognosis as an adjuvant chemotherapy method after surgery other than surgical treatment for intrahepatic cholangiocarcinoma. Intrahepatic cholangiocarcinoma is a heterogeneous carcinoma, the cells of origin are diverse, and the biological characteristics according to histological and gross types are heterogeneous.

Intrahepatic cholangiocarcinoma Despite these heterogeneous properties, the best treatment results through customized treatment have not been created due to the application of the same treatment method.

Recently, methods for diagnosing cancer itself by measuring DNA methylation have been proposed. DNA methylation mainly occurs in the cytosine of CpG island of the promoter region of a specific gene, thereby interfering with the binding of transcription factors and blocking the expression of a specific gene (gene silencing). It is the main mechanism by which the function of the gene is lost even without a mutation in the coding sequence. Abnormal methylation/demethylation in CpG islands has been reported in various cancer cells such as prostate cancer, colon cancer, uterine cancer, and breast cancer, and it is known that hypermethylation occurs in the promoter region of specific genes in the early stages of cancer development. Recently, attempts have been made to investigate promoter methylation of tumor-related genes and use them in various cancer treatments. However, there are no studies on prognostic predictors according to subtypes in specific cancers.

Korean Patent Registration No. 1504069 relates to a methylation marker and method for detecting or diagnosing cholangiocarcinoma, and discloses various gene methylation markers for detecting or diagnosing cholangiocarcinoma, but does not disclose markers related to prognosis after surgery for endothelial ductal adenocarcinoma. not.

US Patent Publication No. 2009-0053706 relates to a DNA methylation marker associated with the methylation aspect of CpG islands in human colorectal cancer, and provides a marker that can be used in the diagnosis of colorectal cancer.

Korean Patent Application Laid-Open No. 2012-0058163 relates to a methylation biomarker for cancer diagnosis and its use, and discloses a method for diagnosing cancer by confirming the methylation status of a TESC gene promoter.

Therefore, there is an urgent need to develop a marker that can be usefully used to predict the prognosis of intrahepatic cholangiocarcinoma through methylation analysis and develop a customized treatment method according to the prognostic characteristics.

The present application aims to provide a methylation marker that can be usefully used in the development of a customized treatment method by measuring the methylation level of intrahepatic cholangiocarcinoma by measuring DNA methylation of the promoter region that regulates the expression of the DLEC1 gene.

In one aspect, the present application provides a composition for predicting prognosis of intrahepatic cholangiocarcinoma, comprising a substance for detecting methylation of the CpG dinucleotide motif of the DLEC1 gene promoter.

In one embodiment, the composition or method according to the present disclosure may predict the prognosis of intrahepatic cholangiocarcinoma of the small bile duct type among histological types of intrahepatic cholangiocarcinoma.

In another embodiment, the prognostic prediction according to the composition or method according to the present application may be a prediction of intrahepatic cholangiocarcinoma-specific survival or cancer non-specific recurrence-free survival.

In another aspect, the present application provides information on the prognosis of intrahepatic bile duct cancer,

providing a biological sample derived from a subject in need of predicting the prognosis of intrahepatic bile duct cancer of the small bile duct type; detecting the presence or absence of methylation of the CpG dinucleotide motif of the DLEC1 promoter from the DNA extracted from the biological sample; and correlating the presence or absence of methylation of the motif in the biological sample with the prognosis of the intrahepatic cholangiocarcinoma as compared with the result of the control group.

In the associating step of the method according to the present application, when methylation is detected in the biological sample, the prognosis of intrahepatic cholangiocarcinoma of the patient from which the biological sample is derived may be predicted.

In another embodiment, the prognostic prediction is intrahepatic cholangiocarcinoma-specific survival or cancer non-specific recurrence-free survival, and when methylation is detected, cancer-specific survival or cancer non-specific recurrence-free survival is good.

In another embodiment, the biological sample used in the method according to the present disclosure may include an intrahepatic cholangiocarcinoma biopsy or excised tissue.

The method used for the detection of methylation in the method according to the present invention comprises contacting with a compound that selectively modifies non-methylated cytosine residues or selectively modifies methylated cytosine residues of genomic DNA derived from a biological sample, the contacting It may be by detection of a product produced by

In another embodiment, the detection of methylation is by a methylation-specific amplification method,

The amplification method is amplified using a primer set comprising at least one primer that binds to a sequence comprising a modified non-methylated CpG dinucleotide motif but does not bind to a sequence comprising an unmodified methylated CpG dinucleotide motif. Using a primer set comprising at least one primer that produces a product or binds to a sequence comprising an unmodified methylated CpG dinucleotide motif but does not bind to a sequence comprising a modified non-methylated CpG dinucleotide motif. to produce an amplification product.

In other embodiments, a primer set may be used in conjunction with a probe, wherein the probe binds to a sequence comprising an unmodified methylated CpG dinucleotide motif, but does not bind to a sequence comprising a modified unmethylated CpG dinucleotide motif, or It could be the other way around.

A prerequisite for personalized cancer treatment is the discovery of prognostic markers that accurately predict the prognosis of the disease. In the case of intrahepatic cholangiocarcinoma, there was no development as a prognostic marker, limiting the development of personalized treatment for each individual. The methylation marker of the DLEC1 gene promoter for predicting the prognosis of intrahepatic cholangiocarcinoma according to the present application can be usefully used for the development of personalized treatment as a prognostic predictor of intrahepatic cholangiocarcinoma. Differentiate between patients with good prognosis and those with poor prognosis, in terms of improving the quality of life and preventing unnecessary treatment through selection of therapeutic agents including chemotherapy, radiation therapy, and immunotherapy, and differentiation of treatment methods and aggressiveness of treatment It can be usefully used to develop customized treatment methods according to prognostic characteristics.

1 is a result showing the change in gene methylation level according to the histological type of intrahepatic cholangiocarcinoma, and the methylation of 12 gene promoters including DLEC1 showed a difference according to the histological type.
2 is a result of survival analysis according to the methylation level of the DLEC1 promoter. a, c, e, and g measure cancer-specific survival, and b, d, f, and h measure recurrence-free survival. Also, a and b are survival analysis in intrahepatic cholangiocarcinoma, c and d are survival analysis in MF type intrahepatic cholangiocarcinoma, e and f are survival analysis in SD type intrahepatic cholangiocarcinoma, and g and h are survival analysis in BD type intrahepatic cholangiocarcinoma. It is the result.
Figure 3 shows (a) a flow chart of the existing diagnosis before including DLEC1 promoter methylation, and (b) a flow chart of a new prognostic diagnosis including measurement of DLEC1 promoter methylation.
4 schematically shows a methylite analysis method capable of analyzing the degree of methylation of a methylation site according to the present disclosure in one embodiment.

The present application is based on the discovery of a DLEC1 methylation marker that can predict the prognosis of intrahepatic cholangiocarcinoma.

Accordingly, in one aspect, the present application relates to a methylation marker of the DLEC1 gene promoter and use for predicting the prognosis of intrahepatic cholangiocarcinoma.

According to the present application, methylation of the Deleted In Lung And Esophageal Cancer Protein 1 (DLEC1) gene in intrahepatic cholangiocarcinoma was found to be associated with the prognosis of the disease. The DLEC1 (Deleted In Lung And Esophageal Cancer Protein 1) methylation marker according to the present application is associated with prognosis according to the presence or absence of methylation in the CpG dinucleotide motif. The human DLEC1 gene information can be found in NCBI Gene ID: 9940. The promoter region of the gene is methylated within, for example, within about 1 kbp in the 5' direction from the transcription start site of the gene, in particular, the methylation status of the CpG island region to be described later It can be correlated with prognosis. there is.

In one embodiment the methylation of the DLEC1 gene promoter according to the present disclosure is detected on a CpG island comprising a CpG dinucleotide motif. CpG islands are typically about 1 to 2 kbp in length and, starting upstream of the promoter of the gene of interest, are also present in the 3' region, including downstream transcription sites, for example, enhancers, promoters and It is found in several sites, including introns. Whether or not the methylation marker gene of the present application is methylated includes detecting CpG of CpG islands present at these various sites.

Herein, a promoter is a minimal sequence necessary to direct transcription, and may be regulated by a cell type-specific, tissue-specific, or external signal or substance in a promoter-dependent gene. These promoters are located at the 5' or 3' region of the gene. Whether or not methylation of all or part of the promoter region is determined can be determined, and methylation of the target gene promoter proceeds from the outside to the inside around the initiation site.

In one embodiment the methylation site is within about 2 kbp, within about 1 kbp, in particular within 750 bp in the 5' direction from the promoter region, in particular the transcription start site. In particular, in one embodiment, the DLEC1 gene includes a promoter sequence based on RefSeq (GRCh38/hg38) chr3:38038205-38122737 (UCSC Genome Browser: https://genome.ucsc.edu/cgi-bin/hgGateway?hgsid=785944985_ATDn39izmajjoU7otLJN7fCinNHj) am.

Biliary duct cancer is the second most common cancer occurring in the liver. Among cholangiocarcinomas, intrahepatic cholangiocarcinoma originates from various cells, unlike hierarchical cancer. Histologically, intrahepatic cholangiocarcinoma has three subtypes: LD (large bile duct, bile duct) type, SD (small bile duct, small bile duct) type, and BD (bile ductule, bile duct) type.

This histological type of intrahepatic cholangiocarcinoma can be discriminated only by histopathological analysis of samples collected during surgery. However, it is not possible to predict the prognosis only by the histologic type after surgical treatment.

As used herein, prognosis means predicting in advance the future course or outcome of a cholangiocarcinoma patient. The prognosis is determined by the probability of being alive for a specific period, that is, the survival rate. In general, a good prognosis in a specific patient group, particularly in the patient group in which methylation of the DLEC1 promoter CpG island has occurred, means that the patient is compared, for example, methylation at the site. This means that the survival rate is significantly higher than that of the patient group that did not develop .

1 , it can be seen that DLEC1 methylation-positive patients have improved 5-year (60 months) cancer-specific survival rates by 10% and recurrence-free survival rates by 20% or more, compared to methylation-negative patients.

In one embodiment, the marker according to the present application is used for predicting the prognosis of the small bile duct type among the histological types of intrahepatic cholangiocarcinoma. In the case of increased methylation in the CpG island of the DLEC1 gene in small bile duct-type intrahepatic cholangiocarcinoma, it was found to have a superior prognosis compared to the case in which it was not. That is, the marker according to the present application can discriminate between carcinomas that will have a good prognosis after surgery in SD type and carcinomas that will not, and can serve as a marker that provides important information on survival in SD type intrahepatic cholangiocarcinoma depending on whether or not DLEC1 methylation is present. there is. It may be useful for the development of a customized treatment method according to the prognostic characteristics of intrahepatic cholangiocarcinoma, which shows a different prognostic course depending on the presence or absence of DLEC1 methylation.

For example, as schematically shown in FIG. 3 herein, when the histological type after surgery is determined to be SD and the prognosis is determined to be good according to methylation analysis, non-surgical anticancer including radiation therapy, chemotherapy, and immunotherapy By adjusting the intensity and/or frequency of treatment or selecting treatment in combination with other treatments, it is possible to develop customized treatments. For cancers with high incidence such as colorectal cancer and breast cancer, various molecular markers that enable personalized treatment have been developed, and treatment with a specific drug is determined according to the test results of these molecular markers, thereby maximizing the patient's therapeutic effect. and improvement of quality of life and increase of survival rate. However, in the case of intrahepatic cholangiocarcinoma, such a marker does not exist, and the marker according to the present application can be usefully used in the development of personalized treatment. For example, in the case of colorectal cancer, when it is determined that microsatellite instability (MSI-high) is present due to promoter hypermethylation of the hMLH1 gene in stage 3, it is reported that additional chemotherapy after surgery does not help survival, but intrahepatic cholangiocarcinoma does not have these markers.

In another embodiment, the marker according to the present disclosure is an independent prognostic factor even in multivariate prognostic analysis, and can predict intrahepatic cholangiocarcinoma-specific survival or cancer non-specific recurrence-free survival. This is based on outcomes that will follow patients up to 10 years.

Accordingly, in another embodiment, the present application relates to the use of a DLEC1 methylation marker for predicting the prognosis of intrahepatic cholangiocarcinoma.

In one embodiment, it relates to a composition for predicting the prognosis of intrahepatic cholangiocarcinoma, comprising a substance for detecting methylation of the CpG dinucleotide motif of the DLEC1 gene promoter.

The use of the markers according to the present application may refer to the foregoing.

The detection substance according to the present application includes substances used in various known methods capable of detecting a methylation state.

In one embodiment according to the present application, a restriction enzyme sensitive to methylation is used to detect CpG dinucleotide methylation status as a detection substance. These restriction enzymes selectively cut methylated restriction enzyme recognition sites or non-methylated restriction enzyme recognition sites. Examples of the former include AccIII, BanI, BstNI, MspI, or XmaI, and examples of the latter include, but are not limited to, AccII, AvaI, BssHII, BstUI, HpaII, or NotI. By analyzing the size of the product through electrophoresis after treatment with restriction enzymes, the methylation state can be determined depending on whether or not it is cleaved.

Also in another embodiment, a compound that selectively modifies a CpG dinucleotide site may be used, which may be detected directly or through an additional reaction. Electrophoresis, chromatography and mass spectroscopy can be used, for example, when nucleic acid amplification or changes in size and/or charge state are involved. Examples of compounds used in the further reaction include hydrazine and bisulfite ions. DNA modified with hydrazine is cleaved when treated with piperidine. DNA treated with bisulfite ions can be cleaved by treatment with alkali.

In another embodiment according to the present disclosure, various amplification methods may be used for detecting CpG dinucleotide methylation status. For example, PCR (Polymerase Chain Reaction), methylation specific PCR, real time methylation specific PCR (real timemethylation specific PCR), PCR using methylated DNA specific binding protein, DNA microarray, pyrosequencing and bisulfite sequence This can be done through analysis. Examples of amplification methods other than PCR include ligase chain reaction (LCR) (Barringer et al, 1990. Gene 89, 117-122), transcriptional amplification (WO1988/10315), and selective amplification of the target sequence (US). Pat. No. 6,410,276), PCR using conserved sequences (US Pat. No. 4,437,975), PCR using random primers (WO1990/06995), nucleic acid-based sequence amplification (NASBA) (US Pat. Nos. 5,409,818; 5,554,517; 6,063,603) ), and nick replacement amplification (WO2004/067726) methods, but are not limited thereto.

In one embodiment, the detection substance included in the composition according to the present application is a substance used in the methylation-specific amplification method of the CpG dinucleotide motif, and the substance increases the C of the CpG depending on whether the CpG dinucleotide motif is methylated. differentially modifying substances; and a primer set and probe comprising at least one primer that binds to a sequence comprising a non-methylated CpG dinucleotide motif modified by the agent but does not bind to a sequence comprising an unmodified methylated CpG dinucleotide motif; or a primer set and probe comprising at least one primer that binds to a sequence comprising a methylated CpG dinucleotide motif unmodified by the agent, but does not bind to a sequence comprising a modified non-methylated CpG dinucleotide motif; may include

In one embodiment, the forward and backward primers are represented by SEQ ID NOs: 1 and 2, respectively, and the probe is represented by the sequence of SEQ ID NO: 3. Both the primer and the probe act in a way that binds to the CpG dinucleotide when methylated. In the case of the probe, 5' is 6-FAM (6-Carboxyfluorescein) and 3' is 5-TAMRA (5-Carboxytetramethylrhodamine) It is labeled with a fluorescent substance called , and is used for TaqMan® analysis.

In one embodiment, the substance that differentially modifies C (cytosine) of CpG according to whether the CpG dinucleotide motif is methylated includes bisulfite. Bisulfite does not modify methylated cytosine and unmethylated cytosine is transformed into uracil.

PCR primers for detecting the methylation state of CpG dinucleotides may be prepared in various ways depending on the detection method. For example, in the case of bisulfite analysis, COBRA (Called Combined Bisulfite Restriction Analysis), or Ms-SNuPE (Methylation-sensitive single nucleotide primer extension) analysis, the primer itself does not cover or hybridize the DNA methylation site and possible site. It is designed so that it does not, and the sequence variation at the site where differential methylation occurs is located between a pair of primers. Alternatively, the primer may be constructed to specifically hybridize to a methylated or non-methylated site after compound treatment, and additional sequences, such as restriction enzyme sites, ligand binding sites, linkers, if binding complementarity is sufficient to not interfere with hybridization. Alternatively, it may be constructed to include a repeating sequence.

In one embodiment according to the present application, a probe capable of specifically binding to a specific product may also be used for detecting modified or unmodified DNA, and such a probe may be directly bound to the modified product or to an amplification product of the modified product. It can bind, and for detection, it can be labeled with a variety of known substances, for example, a fluorescent substance, a radioactive substance, a bioluminescent substance, a luminescent substance, a chemiluminescent substance, an enzyme, a receptor, or a ligand. The labeling method is a technique well known in the art, and can be performed through a conventional method.

In another aspect, the present application provides information on the prognosis of intrahepatic cholangiocarcinoma, comprising the steps of: providing a biological sample derived from a subject in need of prognosis of intrahepatic cholangiocarcinoma; detecting the degree of methylation of the CpG dinucleotide motif of the DLEC1 promoter from the DNA extracted from the biological sample; and correlating the degree of methylation of the motif of the biological sample with the prognosis of the intrahepatic cholangiocarcinoma.

In the associating step in the method according to the present application, when DLEC1 is methylated in the biological sample, the prognosis of intrahepatic cholangiocarcinoma of the patient from which the biological sample is derived may be predicted.

In one embodiment, the degree or presence of methylation in the method according to the present application can be determined as follows. In quantitative analysis using bisulfite and nucleic acid amplification method, when the percentage of methylated reference (PMR) value of DLEC1 is 4 or more, it is determined that DLEC1 methylation is present, and when it is less than 4, it is determined that there is no methylation. Compared to subjects without DLEC1 methylation, the prognosis of subjects with DLEC1 methylation is significantly better.

In one embodiment, in quantitative analysis using amplification of bisulfite-treated DNA, when the PMR (Percent of methylated reference) value is 4 or more, it is determined that hypermethylation is achieved. Methods for determining PMR are known, for example, in Ogino S, et al. Precision and performance characteristics of sodium bisulfite conversion and real-time PCR (MethyLight) for quantitative DNA methylation analysis. J Mol Diagn. 2006;8:209-217.

When a control group is used in the method according to the present disclosure, a sample determined to be free from DLEC1 methylation among intrahepatic cholangiocarcinoma cases may be used as the control group.

The biological sample that can be used in the method according to the present invention is an intrahepatic cholangiocarcinoma biopsy tissue or surgically excised tissue from a patient or suspected patient with intrahepatic cholangiocarcinoma, or chemically treated tissue, or an in vitro culture of the tissue, in the tissue derived organoids, or cell lines derived from intrahepatic cholangiocarcinoma.

In one embodiment, in the method of the present application, the biological sample capable of detecting the presence/degree of methylation is DNA or nucleic acid extracted from the above-described tissue, etc. CpG dinucleotide particularly methylated CpG dinucleotide In particular, the presence of a dinucleotide in the CpG island can be detected. Any nucleic acid can be used.

Furthermore, any nucleic acid in purified or unpurified form may be used in the present invention, and any nucleic acid containing or suspected of containing a nucleic acid sequence containing a target site (eg, CpG-containing nucleic acid) may be used. there is. A nucleic acid site that can be differentially methylated is a CpG island, which is a nucleic acid sequence having a high CpG density compared to other, for example, other sites. In the case of CpG islands, the average G*C ratio is about 60%, and the average G*C ratio of normal DNA is 40%.

In one embodiment, the nucleic acid used for detecting whether CpG is methylated is DNA, in particular, genomic DNA. Nucleic acids contained in the sample used for the detection of the methylation state of these CpG islands can be extracted by various methods described in Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY., latest edition).

As mentioned above, various substances and various methods using such substances for the detection of the methylation status of a marker according to the present disclosure can be used.

Other methods for analyzing DNA methylation status include MALDITOFF, MassARRAY, MethyLight, QAMA (Quantitative analysis of ethylated alleles), ERMA (enzymatic regional methylation assay), HeavyMethyl, QBSUPT, MS-SNuPE, MethylQuant, Quantitative PCR sequencing, oligo nucleotide-based microarrays, but are not limited thereto.

In one embodiment, detection of the methylation status of CpG dinucleotides uses real-time PCR. Real-time PCR can be performed by various methods, for example, the TaqMan system (Applied Biosystems), Molecular Beacon system, or Scorpion system can be used. A probe labeled with a fluorescence quencher is used, and in the latter case, a labeled probe having a hairpin structure linked to a primer is used.

Probes, primers, etc. used for detection of methylation status act through hybridization with a target nucleic acid. Hybridization conditions may be determined according to specific experimental purposes, characteristics of nucleic acids used in the reaction, and the like. For example, the length of the nucleic acid of the hybridization site, the degree of homology, the nucleotide sequence composition (eg, GC/AT composition ratio), and the nucleic acid type (eg, RNA, DNA) are considered in the selection of hybridization conditions. In general, high hybridization conditions are used to increase specificity. However, as described above, the optimal conditions vary depending on the externa hybridization reaction and can be determined through experiments.

Hereinafter, examples are presented to help the understanding of the present invention. However, the following examples are provided for easier understanding of the present invention, and the present invention is not limited thereto.

Example

Example 1. Intrahepatic cholangiocarcinoma prognostic methylation marker selection

(1) DLEC1 methylation marker selection

As a result of comparing the DNA methylation frequencies of 113 genes for gallbladder cystic duct tissue (n=10) and intrahepatic cholangiocarcinoma tissue (n=10), 30 genes highly methylated in intrahepatic cholangiocarcinoma were identified as cancer-specific DNA methylation markers. was selected.

In addition, using the intrahepatic cholangiocarcinoma paraffin block specimens (formalin fixed, paraffin-embedded tissue) derived from 172 intrahepatic cholangiocarcinoma patients who underwent surgical resection, MethyLight assay was performed on 30 cancer-specific DNA methylation markers to screen SD, DLEC1 was found to be the most significant marker for the difference in methylation frequency and prognostic importance in BD and LD (see FIG. 1 ).

DLEC1 had metallization frequencies of 45% in BD, 38% in SD, and 4.9% in SD.

(2) DLEC1 methylation and clinicopathological characteristics of intrahepatic cholangiocarcinoma

Analysis of DLEC1 methylation in 172 intrahepatic cholangiocarcinoma specimens that had undergone surgical resection to remove intrahepatic cholangiocarcinoma showed that the patient's gender, intrahepatic cholangiocarcinoma gross type, histological type, degree of differentiation, presence of mucus, and peripheral nerve invasion were determined. , associated with chronic liver disease and biliary duct epithelial dysplasia (see Table 1).

[Table 1] DLEC1 methylation and clinicopathological characteristics of intrahepatic cholangiocarcinoma

(3) DLEC1 methylation and survival analysis

In a single survival analysis of all intrahepatic cholangiocarcinomas, an increase in DLEC1 methylation was associated with a good prognosis in patients with intrahepatic cholangiocarcinoma, which was found to be common to both cancer-specific survival and recurrence-free survival (Fig. 2a and b). . In intrahepatic cholangiocarcinoma, DLEC1 methylation showed a close association with mass-forming gross type and BD and SD tissue types. In addition, the prognosis was analyzed for mass forming type gross-type intrahepatic cholangiocarcinoma (Fig. 2c, d), and prognostic analysis was conducted for only SD tissue type intrahepatic cholangiocarcinoma (Fig. 2e,f). As a result, DLEC1 methylation was good. While there was a significant relationship with the prognosis, it was found that the methylation level of DLEC1 did not show a significant relationship with the prognosis when survival analysis was performed on only the BD tissue type (Fig. 2 g, h).

DLEC1 methylation is mainly observed in intrahepatic cholangiocarcinoma BD type and SD type, and among these two tissue types, only SD type intrahepatic cholangiocarcinoma is closely related to a good prognosis, and it is also independent in multivariate prognostic analysis in both cancer-specific survival and recurrence-free survival. is a prognostic factor.

In multivariate survival analysis, intrahepatic cholangiocarcinoma was classified as N stage, T stage, M stage, pTNM stage, lymphatic emboli, nerve invasion, vascular invasion, number of origins, gross type, histological form, degree of differentiation, DLEC1 promoter methylation is an independent prognostic factor for cancer-specific survival, in which only death from primary cancer is censored, regardless of the presence or absence, and recurrence-free survival, which includes not only death from cancer, but also recurrence and occurrence of secondary cancer. worked (Table 2 and Table 3).

[Table 2] Relationship between cancer-specific survival and clinicopathological factors

[Table 3] Relationship between recurrence-free survival and clinicopathological factors

In the conventional diagnostic (FIG. 3a) method, there is insufficient method for predicting disease progression other than clinical and histological findings. However, DLEC1 methylation of the present application, which is an independent prognostic predictor, can increase the accuracy of prediction for the prognosis of intrahepatic cholangiocarcinoma.

Specifically, for personalized treatment, a prerequisite is the discovery of prognostic markers that accurately predict the prognosis of the disease. In this regard, the DLCE1 methylation marker according to the present application can be usefully used for the development of personalized treatment as a prognostic marker for intrahepatic cholangiocarcinoma. For example, using the same treatment method for a patient with a good prognosis and a patient with a poor prognosis may be disadvantageous to the patient in terms of therapeutic effect, improvement of quality of life, and prevention of unnecessary treatment. In one embodiment, DLEC1 methylation of the present application is a prognostic marker that can determine which carcinomas will and will not have a good prognosis after surgery in SD type among histological types of intrahepatic cholangiocarcinoma. That is, since SD-type intrahepatic cholangiocarcinoma has a markedly different prognostic course depending on the presence or absence of DLEC1 methylation, DLEC1 methylation is a marker that provides important information on survival in SD-type intrahepatic cholangiocarcinoma. Adhering to the same treatment method as other tissue types for SD-type intrahepatic cholangiocarcinoma, which has a markedly different prognosis depending on the presence or absence of DLEC1 methylation, violates the concept of customized treatment, and is useful for developing customized treatment methods according to prognostic characteristics. can be used

Experimental method

- Sample selection and DNA extraction

In intrahepatic cholangiocarcinoma slides generated from paraffin block, the most obvious site of cancer was marked through examination under a microscope, scraped with a razor blade, dissolved in tissue lysis buffer, incubated at 55°C for 2 days, and exposed at 95°C for 30 minutes. This improves the accuracy of DNA methylation measurement by facilitating bisulfite conversion by dropping cross-linking between DNA strands by formalin fixation or proteins attached to DNA.

-Bisulfite modification and MethyLight

Bisulfite modification was performed using the EZ DNA methylation kit (ZYMO RESEARCH) according to the manufacturer's method. Cytosine of unmethylated CpG island by bisulfite treatment is converted to uracil. For measurement of DLEC1 promoter methylation level, quantitative measurement of methylation level in CpG island was performed using MethyLight (Nucleic Acids Res. 2000 Apr 15; 28(8): e32.), a method of real time methylation-specific PCR. carried out. When the PMR (Percent of methylated reference) value was 4 or higher, it was determined that the promoter was hypermethylated. The primer and probe sequences used in the experiment are as follows. (In the sequence below, all directions are 5'->3'.

DLEC1 forward primer: TCGTTGCGTATTTAAGATATTTCGTATT

DLEC1 reverse primer : CGTAACGCTCATTCTCGCTACC

DLEC1 probe: 6FAM-TAATCAAACTTACGCTCACTTCGTCGCCG-TAMRA

PCR conditions: 95℃ 10 min-> 95℃ 20 sec -> 59℃ 40 sec -> Plate read: 50 cycles

A relatively better prognosis can be expected when intrahepatic cholangiocarcinoma with hypermethylated DLEC1 promoter region is confirmed as a result of the experiment, and since it is independent of other prognostic factors, it can be considered independent of clinical and pathological findings. Therefore, there is a clinical need to be performed separately from the existing pathological findings.

Although the exemplary embodiments of the present application have been described in detail above, the scope of the present application is not limited thereto, and various modifications and improvements by those skilled in the art using the basic concept of the present application as defined in the following claims are also included in the scope of the present application. will belong to

All technical terms used in the present invention, unless otherwise defined, have the meaning as commonly understood by one of ordinary skill in the art of the present invention. The contents of all publications herein incorporated by reference are incorporated herein by reference.

<110> Seoul National University R&DB Foundation <120> DLEC1 methylation marker for predicting prognosis of intrahepatic cholangiocarcinoma <130> DP201911001P <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for detecting DLEC1 CpG Motifs <400> 1 tcgttgcgta tttaagatat ttcgtatt 28 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> DLEC1 Reverse primer for detecting DLEC1 CpG Motifs <400> 2 cgtaacgctc attctcgcta cc 22 <210> 3 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> DLEC1 Probe for detecting DLEC1 CpG Motifs <400> 3 taatcaaact tacgctcact tcgtcgccg 29

Claims (13)

A composition for predicting prognosis of intrahepatic cholangiocarcinoma, comprising a substance for detecting methylation of the CpG dinucleotide motif of the DLEC1 gene promoter.
The method of claim 1,
The intrahepatic cholangiocarcinoma is a histological type of the small bile duct type, a composition for predicting the prognosis of intrahepatic bile duct cancer.
The method of claim 1,
The prognosis prediction is intrahepatic cholangiocarcinoma-specific survival or cancer non-specific recurrence-free survival, the composition for predicting the prognosis of intrahepatic cholangiocarcinoma.
3. The method according to claim 1 or 2,
The detection material is a material used in the methylation-specific amplification method of the CpG dinucleotide motif,
The substance may include a substance that differentially modifies C of the CpG according to whether the CpG dinucleotide motif is methylated; and
a primer set and probe comprising at least one primer that binds to a sequence comprising a non-methylated CpG dinucleotide motif modified by the agent but does not bind to a sequence comprising an unmodified methylated CpG dinucleotide motif; or
A primer set and probe comprising at least one primer that binds to a sequence comprising a methylated CpG dinucleotide motif unmodified by the agent but does not bind to a sequence comprising a modified non-methylated CpG dinucleotide motif The composition for predicting the prognosis of intrahepatic cholangiocarcinoma.
To provide information on the prognosis of intrahepatic bile duct cancer,
Providing a biological sample isolated from a subject in need of prediction of the prognosis of intrahepatic bile duct cancer, wherein the intrahepatic bile duct cancer is a small bile duct type;
detecting the presence or absence of methylation of the CpG dinucleotide motif of the DLEC1 promoter from the DNA extracted from the biological sample; and
Comparing the results of the control group to the presence or absence of methylation of the motif in the biological sample, comprising the step of correlating the prognosis of the intrahepatic cholangiocarcinoma methylation analysis method.
6. The method of claim 5,
In the associating step, when methylation is detected in the biological sample, it is predicted that the prognosis of the intrahepatic cholangiocarcinoma of the patient from which the biological sample is derived is good.
7. The method according to claim 5 or 6,
The intrahepatic bile duct cancer histological type is a small bile duct type, methylation analysis method of intrahepatic bile duct cancer.
7. The method according to claim 5 or 6,
The prognostic prediction is intrahepatic cholangiocarcinoma-specific survival or cancer non-specific recurrence-free survival, methylation analysis method of intrahepatic cholangiocarcinoma.
7. The method according to claim 5 or 6,
The biological sample is an intrahepatic cholangiocarcinoma biopsy or a tissue extracted, methylation analysis method of intrahepatic cholangiocarcinoma.
7. The method according to claim 5 or 6,
wherein the methylation selectively modifies non-methylated cytosine residues of genomic DNA derived from the biological sample, or contacting with a compound that selectively modifies methylated cytosine residues, and detecting a product produced by the contacting The method of methylation analysis of intrahepatic bile duct cancer.
7. The method according to claim 5 or 6,
The detection is by a methylation-specific amplification method,
The amplification method is amplified using a primer set comprising at least one primer that binds to a sequence comprising a modified non-methylated CpG dinucleotide motif but does not bind to a sequence comprising an unmodified methylated CpG dinucleotide motif. produce a product, or
An amplification product is generated using a primer set comprising at least one primer that binds to a sequence comprising an unmodified methylated CpG dinucleotide motif but does not bind to a sequence comprising a modified non-methylated CpG dinucleotide motif. The method for methylation analysis of intrahepatic cholangiocarcinoma.
12. The method of claim 11,
The amplification product comprises (a) a first probe that binds to a sequence comprising a modified non-methylated CpG dinucleotide motif but does not bind to a sequence comprising an unmodified methylated CpG dinucleotide motif; or
(b) binding to a sequence comprising an unmodified methylated CpG dinucleotide motif but not binding to a sequence comprising a modified non-methylated CpG dinucleotide motif, which is detected using a second probe Methylation analysis method.
in paragraph 12
The second probe and the primer sequence used therewith are as follows, a method for methylation analysis of intrahepatic cholangiocarcinoma:
DLEC1 forward primer: 5'TCGTTGCGTATTTAAGATATTTCGTATT3' (SEQ ID NO: 1)
DLEC1 back primer: 5'CGTAACGCTCATTCTCGCTACC3' (SEQ ID NO: 2)
DLEC1 probe: 5'TAATCAAACTTACGCTCACTTCGTCGCCG3' (SEQ ID NO: 3)

Images