KR102247432B1 - Biomarker composition for cancer diagnosis and use thereof - Google Patents

Abstract

The present invention relates to a biomarker composition for cancer diagnosis, and more particularly, to a biomarker composition for cancer diagnosis comprising PMAIP1 expressed in platelets. PMAIP1 according to the present invention significantly decreases the amount of expression in platelets of cancer patients compared to normal people, and cancer diagnosis using this can use a blood sample containing platelets, so it is possible to conveniently and accurately determine whether or not cancer is onset. . Accordingly, the present invention can be used in various ways in the field of cancer prevention, treatment, and diagnosis.

Description

Biomarker composition for cancer diagnosis and use thereof TECHNICAL FIELD

The present invention relates to a biomarker composition for cancer diagnosis, and more particularly, to a biomarker composition for cancer diagnosis comprising PMAIP1.

Cancer is a disease that threatens human health and life, with about 13% of all deaths due to cancer. In 2007, 7.6 million people worldwide died of cancer. In the United States, 1.4 million new cancers have been reported annually over the past few years, and cancer is the second leading cause of death. According to statistics from the SEER report, the mortality rate for all cancer types in the United States rose from 195.4 cases per 100,000 cases in 1950 to 204.4 cases by 1978, and then steadily declined to 184.0 cases in 2005. This decline seems to be due to early detection of cancer due to improved diagnostic techniques. Early detection and treatment of all cancer types plays an important role in the prognosis and survival of cancer.

On the other hand, PMAIP1 (Phorbol-12-myristate-13-acetate-induced protein 1) is also called Noxa, and is a pro-apoptotic member of the Bcl-2 protein group. The expression of PMAIP1 is regulated by the tumor suppressor p53 and is known to be involved in p53 mediated cell death.

KR Patent Publication No. 10-2009-0078365

Xu, Kun, et al. "A comparative analysis of gene-expression data of multiple cancer types." PloS one 5.10 (2010): e13696. Guo, Yongchen, et al. "Identification of key candidate genes and pathways in colorectal cancer by integrated bioinformatical analysis." International journal of molecular sciences 18.4 (2017): 722.

Accordingly, the present inventors completed the present invention by confirming that the expression of PMAIP1 in platelets derived from cancer patients was significantly lower than that in platelets derived from normal individuals while studying biomarkers for early cancer diagnosis.

Accordingly, an object of the present invention is to provide a biomarker composition for cancer diagnosis comprising PMAIP1 (Phorbol-12-myristate-13-acetate-induced protein 1).

Another object of the present invention is to provide a composition for diagnosis of cancer comprising an agent measuring the expression of PMAIP1 or a gene encoding the same.

Another object of the present invention is to provide a cancer diagnostic kit comprising the composition for cancer diagnosis.

Another object of the present invention is to provide a method for providing information on cancer diagnosis and a method for screening a cancer therapeutic agent.

In order to achieve the above object, the present invention provides a biomarker composition for cancer diagnosis comprising PMAIP1.

In addition, the present invention provides a composition for diagnosis of cancer comprising an agent measuring the expression of PMAIP1 or a gene encoding the same.

In addition, the present invention provides a cancer diagnostic kit comprising the composition for cancer diagnosis.

In addition, the present invention provides a method of providing information on cancer diagnosis, including measuring the expression of PMAIP1 or a gene encoding the same in a biological sample.

In addition, the present invention comprises the steps of: (a) treating a target material to be screened on a biological sample, which is an experimental group; (b) measuring and comparing the expression of PMAIP1 or a gene encoding the same in the experimental group of step (a) and the control group not treated with the target substance; And (c) selecting a target substance that increases the expression of PMAIP1 or a gene encoding the experimental group compared to the control group as a result of the comparison in step (b).

PMAIP1 according to the present invention significantly decreases the amount of expression in platelets of cancer patients compared to normal people, and cancer diagnosis using this can use a blood sample containing platelets, so it is possible to conveniently and accurately determine whether or not cancer is onset. . Accordingly, the present invention can be used in various ways in the field of cancer prevention, treatment, and diagnosis.

1 is a diagram showing the results of measuring the expression of CD69 in platelets, leukocytes, and exosomes through droplet digital PCR.
2 is a diagram showing the results of measuring the expression of PMAIP1 in platelets, leukocyte soft layers, and exosomes through droplet digital PCR.
3 is a diagram showing the results of analyzing the expression of CD69 in platelets of cancer patients with various carcinomas through RNA sequencing.
4 is a diagram showing the results of analyzing the expression of PMAIP1 in platelets of cancer patients with various carcinomas through RNA sequencing.

Hereinafter, the present invention will be described in detail.

According to an aspect of the present invention, the present invention provides a biomarker composition for cancer diagnosis comprising PMAIP1.

In the present invention, “PMAIP1 (Phorbol-12-myristate-13-acetate-induced protein 1)” is also referred to as Noxa (Latin word meaning'damage'), and is a pre-apoptotic component of the Bcl-2 protein group. (pro-apoptotic member). The expression of PMAIP1 is regulated by the tumor suppressor p53 and is known to be involved in p53 mediated cell death. Until now, the diagnosis of cancer using PMAIP1 has not been disclosed in detail, and prior studies have not sufficiently demonstrated the possibility of using it as a practical biomarker. However, the present inventors confirmed for the first time that the expression of PMAIP1 in platelets of cancer patients decreases compared to normal people, and this was used as a biomarker for cancer diagnosis.

In an embodiment of the present invention, it is preferable that the biomarker composition further comprises a cluster of differentiation 69 (CD69).

In the present invention, "CD69" is a human transmembrane C type lectin protein encoded by the CD69 gene, and means an activation marker expressed in hematopoietic stem cells, T cells, and cells of the immune system.

In the present invention, "diagnosis" means confirming the presence or characteristics of a pathological condition. The diagnosis is meant to include not only the onset or not, but also the prognosis, the course of the cancer, the stage, and the like.

In the present invention, the "biomarker" may also be used as a diagnostic marker or a diagnostic marker, and is a material that can be diagnosed by discriminating whether or not cancer occurs in a biological sample, and increases or decreases in a cancer patient sample compared to a normal sample And organic biomolecules such as visible polypeptides or nucleic acids (eg, mRNA), lipids, glycolipids, glycoproteins or sugars (monosaccharides, disaccharides, oligosaccharides, etc.).

In the present invention, "cancer" is an aggressive characteristic in which cells divide and grow while ignoring normal growth limits, invasive properties that penetrate into surrounding tissues, and metastatic properties that spread to other parts of the body. ) It is a generic term for diseases caused by cells with characteristics. In the present specification, the cancer is also used in the same meaning as malignant tumor or malignant ascites. The cancer is gastric cancer, breast cancer, lung cancer, liver cancer, blood cancer, bone cancer, pancreatic cancer, and skin cancer. ), head or neck cancer, cutaneous or intraocular melanoma, uterine sarcoma, ovarian cancer, rectal cancer, anal cancer , Colon cancer, fallopian tube carcinoma, endometrial carcinoma, cervical cancer, small intestine cancer, endocrine cancer, thyroid cancer ), parathyroid cancer, adrenal cancer, soft tissue tumor, urethral cancer, prostate cancer, bronchogenic cancer, common bile duct cancer), neuroendocrine tumor, and bone marrow tumor.

In one embodiment of the present invention, it has been confirmed that the expression of PMAIP1 in platelets of cancer patients is significantly reduced compared to that of a normal person, and the PMAIP1 can be used as a biomarker for cancer diagnosis. Additionally, since the expression of CD69 in platelets of cancer patients is significantly lower than that of normal people, it can be used together to increase the accuracy of cancer diagnosis using PMAIP1.

According to another aspect of the present invention, the present invention provides a composition for diagnosis of cancer comprising an agent measuring the expression of PMAIP1 or a gene encoding the same.

In an embodiment of the present invention, it is preferable that the composition further comprises an agent for measuring the expression of CD69 or a gene encoding it in order to increase the accuracy of cancer diagnosis.

In the present invention, "an agent measuring the expression of a protein or a gene encoding it" refers to a gene encoding PMAIP1, CD69, PMAIP1, and a gene encoding CD69, which are markers that increase expression in a biological sample of a cancer patient as described above. It refers to a molecule that can be used for detection of a marker by specifically binding to at least one selected from the group consisting of and checking its expression level.

The agent for measuring the expression of PMAIP1 or CD69 is an oligopeptide, monoclonal antibody, polyclonal antibody, chimeric antibody, ligand, PNA (Peptide nucleic acid) or It may be an aptamer.

In the present invention, "antibody" is a term known in the art and refers to a specific protein molecule directed against an antigenic site. For the purposes of the present invention, an antibody refers to an antibody that specifically binds to PMAIP1 or CD69, which are the markers of the present invention, and such an antibody is cloned into an expression vector according to a conventional method and The encoded protein can be obtained and prepared from the obtained protein by a conventional method. This includes partial peptides that can be made from the protein. The form of the antibody of the present invention is not particularly limited, and if a polyclonal antibody, a monoclonal antibody, or any one having antigen binding properties, a part thereof is also included in the antibody of the present invention, and all immunoglobulin antibodies are included. Furthermore, the antibody of the present invention also includes special antibodies such as humanized antibodies.

The antibody used for the detection of the biomarker for cancer diagnosis of the present invention includes not only a complete form having two full-length light chains and two full-length heavy chains, but also functional fragments of antibody molecules. A functional fragment of an antibody molecule refers to a fragment that has at least an antigen-binding function, and includes Fab, F(ab'), F(ab') 2 and Fv.

The agent measuring the expression of the gene encoding PMAIP1 or CD69 may be an antisense oligonucleotide, a primer pair, or a probe.

In the present invention, the "primer" is a nucleic acid sequence having a short free 3'hydroxyl group, which can form a complementary template and a base pair, and is a starting point for template strand copying. It refers to a short nucleic acid sequence that functions as. The primers can initiate DNA synthesis in the presence of a reagent for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at an appropriate buffer and temperature. Specifically, by performing PCR amplification using sense and antisense primers of PMAIP1 or CD69 polynucleotide, cancer can be diagnosed through whether a desired product is produced. PCR conditions, the length of sense and antisense primers can be modified based on those known in the art.

In the present invention, the term "probe" refers to a nucleic acid fragment such as RNA or DNA corresponding to a few bases or hundreds of bases that can achieve specific binding with the mRNA, and is labeled to confirm the presence or absence of a specific mRNA. I can. The probe may be manufactured in the form of an oligonucleotide probe, a single stranded DNA (DNA) probe, a double stranded DNA (DNA) probe, or an RNA probe. Selection of suitable probes and conditions for hybridization can be modified based on those known in the art.

The primers or probes of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well known methods. Such nucleic acid sequences can also be modified using a number of means known in the art. Non-limiting examples of such modifications include methylation, “encapsulation”, substitution of one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkers such as methyl phosphonate, phosphotriester, Phosphoroamidate, carbamate, etc.) or to a charged linker (eg phosphorothioate, phosphorodithioate, etc.).

In an embodiment of the present invention, it is preferable to measure the expression of PMAIP1 or a gene encoding the same in platelets for the diagnosis of cancer. In addition, it is desirable to measure the expression of CD69 in platelets together to improve the accuracy of cancer diagnosis.

According to another aspect of the present invention, the present invention provides a cancer diagnostic kit comprising the composition for diagnosis of cancer.

The kit may be an RT-PCR kit, a digital PCR kit, a DNA chip kit, a western blotting kit, or a protein chip kit, but is not limited thereto.

The kit may include not only an agent measuring the expression of PMAIP1 or a gene encoding it, but also tools and reagents generally used in the art used for immunological analysis.

In an embodiment of the present invention, the kit may further include an agent measuring the expression of CD69 or a gene encoding the CD69 in order to improve the accuracy of cancer diagnosis.

Examples of the tool or reagent include, but are not limited to, a suitable carrier, a labeling substance capable of generating a detectable signal, chromophores, solubilizers, detergents, buffers, stabilizers, and the like. When the labeling material is an enzyme, a substrate capable of measuring enzyme activity and a reaction terminator may be included. The carrier includes a soluble carrier, an insoluble carrier, and an example of a soluble carrier includes a physiologically acceptable buffer solution known in the art, for example, PBS, and an example of an insoluble carrier includes polystyrene, polyethylene, polypropylene, polyester, poly It may be acrylonitrile, fluororesin, crosslinked dextran, polysaccharide, polymers such as magnetic fine particles plated with metal on latex, other paper, glass, metal, agarose, and combinations thereof.

Since the kit of the present invention comprises the above-described biomarker composition and diagnostic composition, duplicates are omitted in order to avoid excessive complexity of the present specification.

According to another aspect of the present invention, the present invention provides a method of providing information on cancer diagnosis comprising measuring the expression of PMAIP1 or a gene encoding the same in a biological sample.

The information on the diagnosis is measurement information on the expression of PMAIP1 in cancer patients, and for the purposes of the present invention, when it is determined that the expression of PMAIP1 in platelets is decreased than in a normal sample, the cell growth and cell migration of cancer cells are increased. It suggests that cancer is caused, and based on this, the present invention provides information on whether or not a subject develops cancer.

In an embodiment of the present invention, in order to increase the accuracy of providing information on cancer diagnosis, the expression of CD69 or a gene encoding it in platelets may be additionally measured. It is suggested that cancer is caused when the expression of CD69 or the gene encoding it in platelets is measured to be reduced compared to that of a normal sample.

In the present invention, "measurement of protein expression" is a process of determining the presence and level of expression of a protein expressed in a marker gene in a biological sample in order to diagnose cancer. To check the amount of protein. Analysis methods for this include Western blotting, ELISA (enzyme linked immunosorbent assay), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immune diffusion, and rocket immunoelectricity. Electrophoresis, tissue immunostaining, immunoprecipitation assay (Immunoprecipitation Assay), complement fixation assay (Complement Fixation Assay), FACS and protein chip (protein chip), and the like, but are not limited thereto.

In the present invention, "measurement of the expression of a protein-encoding gene" is a process of confirming the presence and expression of mRNA of a cancer diagnostic marker gene in a biological sample in order to diagnose cancer, and can be determined by measuring the amount of mRNA. have. Analysis methods for this are RT-PCR, Competitive RT-PCR (Competitive RT-PCR), Real-time RT-PCR (Real-time RT-PCR), RNase protection assay (RPA), Northern blotting. blotting) or DNA chips, but are not limited thereto.

In an embodiment of the present invention, the biological sample may be blood, plasma, serum, urine, saliva, or tissue, preferably blood, more preferably platelets, but is not limited thereto.

According to another aspect of the present invention, the present invention comprises the steps of: (a) treating a biological sample, which is an experimental group, of a target material to be screened; (b) measuring and comparing the expression of PMAIP1 or a gene encoding the same in the experimental group of step (a) and the control group not treated with the target substance; And (c) selecting a target substance that increases the expression of PMAIP1 or a gene encoding the experimental group compared to the control group as a result of the comparison in step (b).

In an embodiment of the present invention, the method for screening a cancer therapeutic agent may further include measuring the expression of CD69 or a gene encoding it in platelets in order to increase screening accuracy, and comparing it with a control group.

In the step (c), when the target substance increases the expression of PMAIP1 of the experimental group or a gene encoding it, it may inhibit cell growth and migration of cancer cells, and thus may be selected as a cancer treatment.

Hereinafter, the present invention will be described in more detail through examples. These examples are for illustrative purposes only, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not construed as being limited by these examples.

Example 1. Sample preparation

As samples, platelets, leukocytes, and exosomes were separated from the blood of normal and cancer patients, respectively, and RNA was extracted from them. The cancer patients are gastric cancer, cervical cancer, colon cancer, lung cancer, breast cancer, pancreatic cancer, prostate cancer, bile duct cancer, neuroendocrine tumor, hepatocellular carcinoma, and ovarian cancer.

1-1. Platelet RNA extraction

After collecting 4 ml of blood, it was transferred to a K2/K3 EDTA tube. The transferred blood was centrifuged for 10 minutes at room temperature (20 to 25 °C) at a speed of 800 to 1000 rpm. Centrifuged multiplatelet plasma (Platelet-Rich Plasma, PRP) was transferred to a 1.5 ml tube and centrifuged at room temperature at 2500 rpm for 10 minutes to obtain platelet pellets. RNA was extracted from the platelet pellet using the RNeasy Mini Kit (Qiagen, Venlo, Netherlands).

1-2. leukocyte Seniority ( buffy coat) RNA extraction

After collecting 4 ml of blood, it was transferred to a K2/K3 EDTA tube. The transferred blood was centrifuged for 10 minutes at room temperature (20 to 25 °C) at a speed of 800 to 1000 rpm. The plasma and red blood cell layers on the upper layer of the tube were removed. In order to remove the red blood cells remaining in the tube, the red blood cell lysate was added to the tube, followed by centrifugation at 14000 rpm at 4° C. for 1 minute. The red blood cell removal process was repeated 5 times to remove red blood cells in the tube, thereby obtaining only a soft layer of white blood cells. RNA was extracted from the soft layer of leukocytes using the RNeasy Mini Kit.

1-3. Exosomes RNA extraction

ExoQuick solution (System Biosciences, Palo Alto, CA, USA) and 1 ml of serum were mixed and then reacted at 4° C. for 1 hour. After the reaction, the tube was centrifuged at 1500 g for 30 minutes to separate exosome pellets. Using the SeraMir Exosome RNA Purification column Kit (System Biosciences), exosome RNA was extracted from the exosome pellet.

Example 2. cDNA synthesis

After measuring the concentration, purity, yield, and size of the platelet RNA, leukocyte soft layer RNA, and exosome RNA extracted in Example 1, cDNA was synthesized based on this.

Specifically, the concentration and purity of platelet RNA and leukocyte soft layer RNA were determined using a NanoDrop 1000 spectrometer (Thermo Scientific, Waltham, MA, USA), a Qubit 2.0 fluorescence photometer (Life Technologies, Grand Island, NY, USA), and a Qubit RNA Hs assay kit. It was measured using. RNA yield and size were measured using an Agilent 2100 bioanalyzer (Agilent Technologies, Foster City, CA, USA) and an RNA 6000 Pico kit.

Using the SuperScript™ VILO™ cDNA synthesis kit (invitogen, Carlsbad, CA, USA), cDNA using the platelet RNA, leukocyte soft layer RNA, and exosome RNA as templates was synthesized. The cDNA synthesis was performed according to the manufacturer's manual.

Example 3. Droplet digital PCR (Droplet digital PCR) CD69 and PMAIP1 Expression analysis

A droplet digital PCR was performed using the platelet cDNA synthesized in Example 2, the leukocyte soft layer cDNA, and the exosome cDNA as templates. Specifically, prepared platelet cDNA was prepared by diluting 5 times. QX200 droplet digital PCR supermix for probe (No UTP, 2X) 10ul, forward PMAIP1 primer (10pmol) 1ul, reverse PMAIP1 primer (10pmol) 1ul, forward CD69 primer (10pmol) 1ul, reverse CD69 primer (10pmol) 1ul, PMAIP1 A final sample (20ul) was prepared by mixing 0.5ul of a specific probe (FAM dye, 10uM), 0.5uL of a CD69 specific probe (VIC dye, 10uM), 4uL of distilled water, and 1ul of diluted platelet cDNA.

The nucleotide sequences of the droplet digital PCR primers and probes used in this example are as follows.

-Forward PMAIP1 primer: CAAGAACGCTCAACCGAGC

-Reverse PMAIP1 primer: CTGCCGGAAGTTCAGTTTGTC

-PMAIP1 specific probe: AGCAGAGCTGGAAGTC

-Forward CD69 primer: GGAAGTGGTCAAATGGCAAAGA

-Reverse CD69 primer: TTCCATGCTGCTGACCTCTGT

-CD69 specific probe: ACAACTGGTTCAACGTT.

Droplets were generated in the QX200 droplet generator by adding 20ul of the prepared sample and 70ul of droplet generator oil to the DG8 Droplet Generator Cartridge. The prepared droplet was carefully transferred to a PCR plate and then sealed. PCR of the sealed PCR plate was performed. The PCR conditions are shown in Table 1.

step Temperature(℃) time Temperature change rate Number of cycles Enzyme activation
(Enzyme activation) 95 10 minutes 2℃/sec One denaturalization
(Denaturation) 94 30 seconds 40 Annealing/elongation
(Annealing/extension) 60 1 minute 40 Enzyme inactivation
(Enzyme deactivation) 98 10 minutes One maintain
(Hold) 4 - One

After completion of PCR, fluorescence of each droplet was measured using a QX200 Droplet Reader. The measured results were confirmed using QuantaSoft software. The measured results were expressed by converting the number of mRNA copies per ng of total RNA (copies/ng). In the same manner as described above, droplet digital PCR of leukocyte soft layer and exosome cDNA was performed. The droplet digital PCR results of platelet cDNA, leukocyte soft layer cDNA, and exosome cDNA are shown in Table 2, which are graphed and shown in FIGS. 1 and 2.

Platelets Exosomes leukocyte Seniority Label Sample
No. Diagnosis PMAIP1 CD69 PMAIP1 CD69 PMAIP1 CD69 copies/ng copies/ng copies/ng copies/ng copies/ng copies/ng One patient GAST 95 260 0 0 0 0 2 patient CECA 110 485 0 0 0 0 3 patient CORE 3.5 29.5 0 0 0 0 4 patient CORE 20 120 0 0 0 0 5 patient LUCA 3.5 0 0 0 0 0 6 patient BRCA 3.5 0 7 0 10 260 7 patient BRCA 3.5 14 0 7 43 190 8 patient HPCA 22.5 135 7 7 109 1180 9 patient CORE 51 125 7 0 119 300 10 patient OVCA 61 370 0 0 0 0 11 patient BRCA 10 80 13 47 7 90 12 patient GAST 3.5 50 6 13 44 320 13 patient GAST 0 45 0 7 50 560 14 Normal person HLTH 515 2250 6 26 7 7 15 Normal person HLTH 280 1605 7 0 0 34 16 Normal person HLTH 995 7750 7 0 55 710 17 Normal person HLTH 180 1450 0 0 80 300 18 Normal person HLTH 735 5200 7 0 0 0 19 Normal person HLTH 165 705 0 0 0 0 20 Normal person HLTH 180 760 0 0 0 0 21 Normal person HLTH 185 635 0 0 0 0 22 Normal person HLTH 365 1770 292 0 525.6 1430.8 23 Normal person HLTH 390 1635 546 819 0 1365 HLTH: Normal control
BRCA: breast cancer
CORE: colon cancer
GAST: stomach cancer
PANC: pancreatic cancer
PRCA: prostate cancer
BIDU: bile duct cancer
NRED: Neuroendocrine tumor
CECA: cervical cancer
LUCA: lung cancer
HPCA: liver cancer
OVCA: ovarian cancer

As shown in Table 2 and FIG. 1, it was confirmed that CD69 was expressed at about 635 to 2250 copies/ng in platelets of normal humans. However, in the platelets of cancer patients (breast cancer, colon cancer, gastric cancer, pancreatic cancer, prostate cancer, bile duct cancer, neuroendocrine tumor, cervical cancer, lung cancer, liver cancer and ovarian cancer), the expression of CD69 was significantly reduced from about 0 to 125 copies/ng. I did.

As shown in Table 2 and FIG. 2, it was confirmed that PMAIP1 was expressed at about 160 to 490 copies/ng in platelets of normal people. However, in the platelets of cancer patients (breast cancer, colon cancer, stomach cancer, pancreatic cancer, prostate cancer, bile duct cancer, neuroendocrine tumor, cervical cancer, lung cancer, liver cancer and ovarian cancer), the expression of PMAIP1 was significantly reduced to about 0 to 51 copies/ng. I did.

The above results indicate that the expression of CD69 and PMAIP1 in platelets of cancer patients is significantly reduced compared to that of a normal person, and thus it can be used for diagnosis of various cancers.

Example 4. Using RNA sequencing To carcinoma According to CD69 and Of PMAIP1 Expression analysis

After measuring the amount of platelet RNA extracted in Example 1 using a Cubit system, the amount of RNA injection for each sample was equalized to 10 ng. CDNA was synthesized using SuperScript™ VILO™ cDNA synthesis kit (Thermo Fisher). A transcriptome library was prepared using the Ion AmpliSeq transcript human gene expression kit (Thermo Fisher). At this time, when the amount of RNA injected was less than 10 ng, the PCR cycle was increased according to the manufacturer's manual. The prepared library was measured using High Sensitivity D1000 ScreenTape. The results of analyzing the expression of CD69 and PMAIP1 according to carcinoma through RNA sequencing are shown in FIGS. 3 and 4.

As shown in Figs. 3 and 4, it was confirmed that the expression of CD69 and PMAIP1 was significantly reduced in platelets of patients with breast cancer, colon cancer, gastric cancer, pancreatic cancer, prostate cancer, bile duct cancer, and neuroendocrine tumors compared to normal subjects.

Overall, the present inventors confirmed that the expression of CD69 and PMAIP1 in platelets significantly decreased depending on the onset of cancer. This means that CD69 and PMAIP1 can be used as biomarkers for cancer diagnosis, and thus can be used in various fields in the field of cancer prevention, treatment, and diagnosis.

Above, a specific part of the present invention has been described in detail, and for those of ordinary skill in the art, it is obvious that this specific technique is only a preferred embodiment, and the scope of the present invention is not limited thereby. something to do. Therefore, it will be said that the practical scope of the present invention is defined by the appended claims and their equivalents.

Claims (18)

Including Phorbol-12-myristate-13-acetate-induced protein 1 (PMAIP1),
Gastric cancer, cervical cancer, colon cancer, lung cancer, breast cancer, pancreatic cancer, prostate cancer, common bile duct cancer), neuroendocrine tumor, liver cancer, and ovarian cancer.
The composition is for diagnosis of cancer in a platelet sample, a composition.
The method of claim 1,
The composition further comprises a CD69 (Cluster of differentiation 69), a biomarker composition for cancer diagnosis.
delete The method of claim 1,
The PMAIP1 is a biomarker composition for cancer diagnosis that is suppressed in expression in an individual with cancer.
The method of claim 2,
The CD69 is that the expression is suppressed in an individual with cancer, a biomarker composition for cancer diagnosis.
delete Comprising an agent for measuring the expression of PMAIP1 or a gene encoding the same,
Gastric cancer, cervical cancer, colon cancer, lung cancer, breast cancer, pancreatic cancer, prostate cancer, common bile duct cancer), neuroendocrine tumor, liver cancer, and ovarian cancer.
The composition is for diagnosis of cancer in a platelet sample, a composition.
The method of claim 7,
The composition further comprises an agent for measuring the expression of CD69 or a gene encoding it, a composition for cancer diagnosis.
The method of claim 7,
The agent for measuring the expression is an oligopeptide, monoclonal antibody, polyclonal antibody, chimeric antibody, ligand, PNA (Peptide nucleic acid) or aptamer that specifically binds to PMAIP1, Composition for diagnosis of cancer.
The method of claim 7,
The agent for measuring the expression is an antisense oligonucleotide, a primer pair or a probe that specifically binds to a gene encoding PMAIP1, a composition for cancer diagnosis.
delete It relates to a cancer diagnostic kit comprising the composition of any one of claims 7 to 10,
The cancer includes gastric cancer, cervical cancer, colon cancer, lung cancer, breast cancer, pancreatic cancer, prostate cancer, and bile duct cancer. Common bile duct cancer), neuroendocrine tumor, liver cancer, and ovarian cancer,
The kit is to diagnose cancer in a platelet sample, kit.
The method of claim 12,
The cancer diagnostic kit is an RT-PCR kit, a digital PCR kit, a DNA chip kit, or a protein chip kit.
Gastric cancer, cervical cancer, colon cancer, lung cancer, breast cancer, including the step of measuring the expression of PMAIP1 or a gene encoding it in platelets Diagnosis of one or more cancers selected from the group consisting of pancreatic cancer, prostate cancer, common bile duct cancer, neuroendocrine tumor, liver cancer, and ovarian cancer How to provide information about.
The method of claim 14,
The method further comprises measuring the expression of CD69 or a gene encoding it.
delete delete delete

Images