KR102226542B1 - Stem cell originated from equine fetal tissue and the cell therapy product for treating muscle and skeletal system - Google Patents

Abstract

The present invention relates to equine fetal tissue derived stem cells and a cell therapy for musculoskeletal regeneration containing the same, and more specifically, to equine amniotic fluid derived stem cells (Equine amniotic fluid). stem cells), analysis of the characteristics of amniotic stem cells prepared by the above method, stem cells derived from horse amniotic fluid containing the stem cells as an active ingredient, and a cell therapeutic agent for musculoskeletal regeneration containing the same.
The present invention provides stem cells derived from amniotic fluid in horses and animals.
In addition, the present invention is a process of collecting amniotic fluid of a pregnant horse (step 1),
The process of isolating mononuclear cells from the collected amniotic water (step 2),
It provides a method of producing mesenchymal stem cells derived from amniotic fluid from horses and animals, including the process of initially culturing the isolated amniotic fluid-derived mononuclear cells (step 3).
In addition, the present invention is a process of collecting amniotic fluid of a pregnant horse (step 1),
The process of isolating mononuclear cells from the collected amniotic water (step 2),
The process of initial culturing the isolated amniotic fluid-derived mononuclear cells (step 3),
Dulbecco Modified Eagle Medium (DMEM) containing 10-20% Fetal Bovine Serum (FBS), 0.5-1.5% Glutamax, and 0.5-1.5% penicillin/streptomycin cells between passages 3-5 initially cultured above. ) The process of culturing using a culture medium (4 process),
Horse and animal mesenchymal stems including the process of separating cells from the basal surface using 0.01 to 0.1% Typsin-EDTA after removing the medium in the culture dish and washing with PBS (Phosphate buffered saline, PH 7.2). It provides a method of making a cell.
In addition, the present invention provides a stem cell derived from amniotic fluid for horses and animals, characterized in that it has a musculoskeletal treatment function.
In addition, the present invention provides a cell therapeutic agent for regeneration of the musculoskeletal system comprising stem cells derived from horse and animal amniotic fluid.

Description

Stem cell originated from equine fetal tissue and the cell therapy product for treating muscle and skeletal system

The present invention relates to equine fetal tissue derived stem cells and a cell therapy for musculoskeletal regeneration containing the same, and more specifically, to equine amniotic fluid derived stem cells (Equine amniotic fluid). stem cells), analysis of the characteristics of amniotic stem cells prepared by the above method, stem cells derived from horse amniotic fluid containing the stem cells as an active ingredient, and a cell therapeutic agent for musculoskeletal regeneration containing the same.

The development of biotechnology has opened up the possibility of cell therapy and regenerative medicine, and the field of stem cell therapy for the treatment of human diseases is currently undergoing clinical trials and research at an alarming rate. Stem cells are cells that are capable of self-replicating themselves and have the ability to differentiate into cells of various tissues, and have the ability to regenerate damaged body tissues and cells. It is recognized and known as a next-generation technology with very high medical use for injuries that are difficult to treat.

Types of stem cells include embryonic stem cells using embryos at an early stage of development, adult stem cells using cells that make up tissues after development, and pluripotent induction stem cells using gene editing technology. There are (induced Pluripotent stem cells), and adult stem cells exist in each tissue of the body and provide an important role in maintaining the homeostasis of the body, and are classified into tissue stem cells derived from endoderm, mesoderm, and ectoderm depending on the origin of the tissue. .

Mesenchymal stem cells, a type of adult stem cells, have stable differentiation ability and are less likely to generate ethical issues and tumor cells. Entered. In addition, mesenchymal stem cells have the ability to regenerate damaged tissues and cells by moving directly to the area where the body was damaged. They can easily proliferate outside the body, and are multipotent cells capable of differentiating into various cell types. It is used as a useful target in cell therapy.

Currently, in the field of cell therapy, mesenchymal stem cells mainly include bone marrow, adipose tissue, and umbilical cord blood, and many studies have been conducted. Although it has the multipotential ability to differentiate into cells, studies are being conducted to find a source that has similar differentiation ability to embryonic stem cells among mesenchymal stem cell-derived tissues because it has a limited aspect compared to the differentiation ability of embryonic stem cells. .

Among fetal-derived tissues, stem cells derived from amniotic fluid are the most recently discovered and studied mesenchymal stem cell-derived tissues, and research results show that they have excellent proliferation ability and have many cell-specific markers characteristic of embryonic stem cells. Was announced. Amniotic fluid-derived stem cells can be obtained during pregnancy by fetal examination through amniotic fluid puncture or at birth through cesarean section, so they can be collected by a non-invasive method that does not harm the mother and fetus, and self-proliferates like other mesenchymal stem cells. The differentiation ability to differentiate into various types of cells was confirmed. The above results show the possibility of amniotic fluid-derived mesenchymal stem cells as cell therapeutics as the tissues that are produced with the fetus and can be collected quickly among adult stem cell-derived tissues.

Research on stem cell therapeutics in the treatment of human diseases has led to the development of animal stem cell therapeutics, and clinical trials and treatments are currently progressing at an alarming rate in horses and animals due to the development of the racehorse industry and companion animals, mainly dogs and cats. Has become. The development of stem cell therapy for the treatment of periostitis, a major injury factor for racehorses and roadsters, is expected to play a very effective role in shortening the recovery period of more than 6 months and improving health, through which the racehorse industry, which occupies a major portion of the horse industry. It is expected to be a very important study in the development of

Research results on several stem cell treatments including fetal stem cells are being marketed as treatments through clinical trials, but research on stem cell treatments has taken a step further from the research direction that has been focused on developing single cell treatments through various fusion technologies. Research is being conducted in pursuit of more reliable stability and effectiveness. Therefore, the establishment of stem cell therapeutics through fetal stem cells and musculoskeletal regeneration ability tests of homogeneous horses and animals will be helpful in the treatment of many diseases in the future.

As a related technology, Korean Patent Application Publication No. 10-2019-0037504 (a cell therapy for treating and preventing bone diseases in horses and animals, and a manufacturing method thereof using a three-dimensional environment) describes "Initially, mesenchymal stem cells of horses and animals were converted into bone cells. Invention related to the production of cells having cartilage and bone regeneration ability by inducing differentiation, and in particular, by creating a three-dimensional cell culture and differentiation environment using a hydrogel, and producing cells having cartilage and bone regeneration ability in a large amount quickly Has been presented.

The present invention is based on amniotic fluid-derived mesenchymal stem cells isolated from stem cells derived from fetal tissues of horses and animals, and embryonic stem cell-specific genes such as Oct4, c-Myc, and Klf4, and PAX6, ALCAM, Integrin β1, Endoglin, HCAM It simultaneously expresses a specific gene in mesenchymal stem cells such as, etc., has an excellent proliferation rate that is cultured for more than 50 passages, exhibits the ability to differentiate into mesoderm-derived cells, and exhibits multipotent stem cell characteristics, and is a marker related to equine leukocytes (ELAII). antigen), which shows a negative immunological characteristic for the musculoskeletal system, has been confirmed to be effective in treating the musculoskeletal system.

In particular, the present invention is easier to collect than the existing bone marrow, adipose, cord blood-derived treatment stem cells, has excellent proliferation and differentiation ability, and thus has utility as a new cell therapy agent for damage and diseases of the musculoskeletal system, and stem cells derived from horse amniotic fluid and musculoskeletal system containing the same. It is intended to provide a cell therapy for regeneration.

In addition, the present invention is to provide a horse amniotic fluid-derived stem cell having a fast and excellent growth rate (regeneration ability) compared to conventional mesenchymal stem cells and a regeneration ability through the treatment of the musculoskeletal system of the horse, and a cell therapy for the regeneration of the musculoskeletal system containing the same. .

The present invention in order to solve the above problems and needs,

It provides mesenchymal stem cells derived from amniotic fluid in horses and animals.

In addition, the present invention provides a mesenchymal stem cell derived from amniotic horse and animal characterized in that the horse and animal are selected from the group consisting of horses, donkeys, zebras, or hybrids born from hybrids thereof.

In addition, the present invention is a process of collecting amniotic fluid of a pregnant horse (step 1),

The process of isolating mononuclear cells from the collected amniotic water (step 2),

It provides a method for producing mesenchymal stem cells derived from amniotic fluid from horses and animals, including the process of initially culturing the isolated amniotic fluid-derived mononuclear cells (step 3).

In addition, the present invention is a process of collecting amniotic fluid of a pregnant horse (step 1),

The process of isolating mononuclear cells from the collected amniotic water (step 2),

The process of initial culturing the isolated amniotic fluid-derived mononuclear cells (step 3),

The horse amniotic fluid-derived cells initially cultured above were replaced with Dulbecco Modified Eagle Medium (DMEM) culture medium containing 10-20% FBS (Fetal Bovine Serum), 0.5-1.5% Glutamax, and 0.5-1.5% penicillin/streptomycin. Cultivation process (4 process),

Horse and animal mesenchymal stems including the process of separating cells from the basal surface using 0.01 to 0.1% Typsin-EDTA after removing the medium in the culture dish and washing with PBS (Phosphate buffered saline, PH 7.2). It provides a method of making a cell.

In addition, the process of collecting amniotic fluid from a pregnant horse (step 1),

Equine, characterized in that it is obtained with a 30-70 cc syringe equipped with 18-22 G and transferred to a 30-70 ml test tube, and then transported to the laboratory within an average of about 3-4 hours while maintaining at about 3-5°C. It provides a method for producing animal mesenchymal stem cells.

In addition, the present invention is the process of initial culturing the isolated amniotic fluid-derived mononuclear cells (step 3),

Horse and animal medium, characterized by cultivation in Roswell Park Memorial Institute (RPMI) 1640 medium culture medium containing 10-20% FBS (Fetal Bovine Serum), 0.5-1.5% Glutamax and 0.5-1.5% penicillin/streptomycin. It provides a method for producing mesenchymal stem cells.

In addition, the present invention provides a method of manufacturing horse and animal mesenchymal stem cells, characterized in that the cell adhesion is increased by using a culture dish coated with 0.05 to 0.15% gelatin in all culture processes.

In addition, the present invention is a method for producing horse and animal mesenchymal stem cells characterized in that when more than 80% of the cells are attached to the bottom of the culture medium in order to maintain the undifferentiated state of cells in all culture processes, passaged or frozen and stored. Provides.

In addition, the present invention provides a method for producing mesenchymal stem cells derived from amniotic fluid in horses and animals, which exhibit the following characteristics.

(a) It has the ability to self-proliferate over 50 passages while maintaining the characteristics of stem cells.

(b) It has the ability to differentiate into cells derived from mesoderm such as fat, cartilage, and bone cells.

(c) Both embryonic stem cell-specific genes Oct4, c-Myc, Klf4 and mesenchymal stem cell-related genes PAX6, ALCAM, Integrin α1, Endoglin, and HCAM were simultaneously positive for genetic expression.

(d) Cell surface markers CD44, CD90, and CD105 exhibit a positive immunological phenotype, and at the same time, CD14, CD45, CD79α, and ELA-DR exhibit a negative immunological phenotype.

In addition, the present invention provides a mesenchymal stem cell derived from amniotic fluid for horses and animals, characterized in that it has a musculoskeletal treatment function.

In addition, the present invention provides a cell therapy for treating and recovering musculoskeletal fractures, micro fractures, periostitis, tendon and ligament damage, muscle atrophy muscle atrophy, muscle fiber shunt, including mesenchymal stem cells derived from horse and animal amniotic fluid.

The present invention shows an action and effect capable of producing mesenchymal stem cells from amniotic fluid of horses and animals.

In addition, the stem cells derived from the amniotic fluid of horses and animals of the present invention have the function and effect of confirming the ability to self-proliferate when cultured for more than 50 passages while maintaining the characteristics of stem cells.

In addition, the function and effect of confirming that the stem cells derived from the amniotic fluid of horses and animals of the present invention become mesenchymal stem cells whose differentiation capabilities such as adipocyte differentiation, osteoblast differentiation, and chondrocyte differentiation are confirmed are exhibited.

In addition, it is confirmed that the stem cells derived from the amniotic fluid of horses and animals of the present invention exhibit pluripotent functions and effects as mesenchymal stem cells, including the characteristics of embryonic stem cells.

In addition, it is confirmed that the mesenchymal stem cells derived from amniotic fluid of horses and animals of the present invention are effective in treating the musculoskeletal system.

In addition, it is confirmed that the mesenchymal stem cells derived from amniotic fluid of horses and animals of the present invention are effective in treating musculoskeletal fractures, micro fractures, and periostitis.

In addition, mesenchymal stem cells derived from amniotic fluid of horses and animals according to the present invention have (a) self-proliferative ability that is cultured for more than 50 passages while maintaining the characteristics of stem cells, and (b) fat, cartilage, bone cells, etc. Has the ability to differentiate into mesoderm-derived cells of (c) embryonic stem cell-specific genes Oct4, c-Myc, Klf4 and mesenchymal stem cell-related genes PAX6, ALCAM, Integrin α1, Endoglin, and HCAM. Expression characteristics are shown, and (d) cell surface markers CD44, CD90, and CD105 have a positive immunological phenotype, and at the same time, CD14, CD45, CD79α, and ELA-DR have a negative immunological phenotype.

1 shows the initial culture of horse amniotic fluid-derived cells. (A) shows a pattern in which stem cells derived from amniotic fluid are attached to the surface of a culture dish and grow in the form of fibroblasts (X100). (B) is the result of staining with Diff-quick (X100).
2 shows the Doubling time when the number of passages of horse amniotic fluid-derived stem cells from the initial passage to passage 50 or more is increased.
3 shows an adipocyte differentiation experiment of horse amniotic fluid-derived stem cells. (A) represents a negative oil red O staining reaction of equine amniotic stem cells before differentiation induction (X100), (B) when staining with Oil Red O after culture in differentiation induction medium , Shows positive staining (X100). (C) is (X200).
4 shows an experiment for osteoblast differentiation of horse amniotic fluid-derived stem cells. (A) shows a negative reaction of Alizarin red S staining of horse amniotic stem cells before differentiation induction (X100), and (B) is stained with Alizarin red S after culture in differentiation induction medium. , Shows positive staining (X100). (C) is (X200).
5 shows a chondrocyte differentiation experiment of horse amniotic fluid-derived stem cells. (A) shows a negative Alcian blue staining reaction of equine amniotic stem cells before differentiation induction (X100), (B) is positive when stained with Alcian blue after culture in differentiation induction medium. It shows that it was stained with (X100). (C) is (X200).
6 shows the results of reverse transcription polymerase chain reaction (RT-PCR) of horse amniotic fluid-derived stem cells to confirm whether stem cell-specific genes are expressed. It can be seen that both embryonic stem cell genes (Oct4, c-MYC, klf4) and mesenchymal stem cell-related genes (PAX6, ALCAM, Integrin β1, Endoglin, HCAM) are expressed as a control marker, including beta-actin.
7 is a result of comparing the amount of gene expression through real-time quantitative analysis of the gene expression tested in FIG. 6.
Figure 8 shows the results of a flow cytometry (Flow Analysis Cytometry System) to confirm the characteristics of stem cells in amniotic fluid-derived cells. Through flow cytometry, cells derived from equine amniotic fluid showed positive immunological characteristics in the positive expression markers CD44, CD90, and C105 of mesenchymal stem cells, and negative immunity in the negative expression markers CD14, CD45, CD79α and the immune-related specific marker ELAⅡ. Showed the academic aspect.
9 is an X-ray result showing the recovery of damaged tissue after transplantation of the stem cells of the present invention to the damaged site of a horse with a musculoskeletal system injury using horse amniotic fluid-derived mesenchymal stem cells. (A, D) shows the left cartilage damage site, (B, E) the third humerus fracture and cartilage damage site, and (C, F) the radial fracture site before and after stem cell treatment.

Hereinafter, the present invention will be described in detail with reference to the drawings.

The present invention provides a method for producing stem cells derived from amniotic fluid from horses and animals, and stem cells derived from amniotic fluid from horses and animals according to the method.

Horses and animals of the present invention are meant to include animals composed of horses, donkeys, zebras, or hybrids born of a hybrid thereof.

In addition, the present invention provides a cell therapy for regeneration of the musculoskeletal system containing stem cells derived from horse and animal amniotic fluid.

The present invention is a technical feature of separating and culturing a stem cell line from amniotic fluid collected during the birth of a pregnant horse.

The present invention performs a process of collecting amniotic fluid from a pregnant horse. (Step 1)

Preferably, the present invention performs a process of collecting amniotic fluid in a non-invasive method during the birth process of a pregnant horse.

The present invention collects amniotic fluid in the process of giving birth of a pregnant horse, but such amniotic fluid is obtained with a 30-70 cc syringe equipped with 18-22 G before rupture of the amniotic sac during delivery of a mare whose pregnancy has been confirmed. After transferring to a ㎖ test tube, the preparation process is carried out by carrying it to the laboratory within an average of about 3 to 4 hours while maintaining about 3 to 5 ℃.

In the above 18-22 G, G means a lake, 18 means a diameter of 1.270 mm, and 22 means a size of 0.711 mm.

Preferably, the present invention collects amniotic fluid in the process of giving birth of a pregnant horse, but such amniotic fluid is obtained with a 50 cc syringe equipped with 18 G before rupture of the amniotic sac during delivery of a mare whose pregnancy has been confirmed, and is used in a 50 ml test tube. After the transfer, the preparation process is carried out by carrying it to the laboratory within an average of about 3 hours while maintaining at about 4°C.

The present invention performs the process of separating mononuclear cells from the collected amniotic fluid. (Step 2)

In the present invention, after filtering the amniotic water collected above using a cell strainer, it is mixed with PBS (Phosphate Buffered Saline) containing 3 to 7% penicillin/streptomycin in a ratio of 1:0.5 to 1.5, and then 2,000 to 4,000. Centrifuge at rpm for 8-12 minutes to recover the pellet.

Preferably, the amniotic water collected above is filtered using a 90-110 μM, preferably 100 μM cell strainer, and then mixed 1:1 with PBS (Phosphate Buffered Saline) containing 5% penicillin/streptomycin at 3,000 rpm. , Centrifugation for 10 minutes performs a process of recovering the pellet.

In addition, the recovered pellet is washed and centrifuged 1 to 3 times using PBS containing 3 to 7% penicillin/streptomycin to separate mononuclear cells.

Preferably, the recovered pellet is washed and centrifuged twice using PBS containing 5% penicillin/streptomycin to separate mononuclear cells.

The present invention performs the process of initial culturing the isolated amniotic fluid-derived mononuclear cells. (Step 3)

The present invention is the Roswell Park Memorial Institute containing 10-20% FBS (Fetal Bovine Serum), 0.5-1.5% Glutamax, and 0.5-1.5% penicillin/streptomycin for initial culture of the isolated amniotic fluid-derived mononuclear cells ( RPMI) 1640 medium culture medium is used.

It is preferable to use a Roswell Park Memorial Institute (RPMI) 1640 medium culture medium containing 15% FBS (Fetal Bovine Serum), 1% Glutamax, and 1% penicillin/streptomycin.

The present invention was dispensed into a 6-well culture dish coated with 0.05 to 0.15% gelatin to increase cell adhesion, and cultured in an incubator in an environment of ^{4.5 to 5.5% CO 2 at 38.5° C. at the same body temperature as horses and animals.}

Preferably, in order to increase cell adhesion, it was dispensed into a 6well culture dish coated with 0.1% gelatin, and it is recommended to put it in an incubator ^{in a 5% CO 2 environment at 38.5° C., the same as the body temperature of horses and animals, and cultivate it.}

The present invention performs a process of removing dead tissues and cells in the initial culture process.

In other words, in order to remove dead tissues and cells, the culture medium was replaced within 48h of the initial culture start, and the process of replacing the culture medium was performed even when it was observed that the cells were attached to the bottom of the culture dish.

In the present invention, when more than 80% of the cells are attached to the bottom of the culture medium, passage or freezing is performed to obtain and store stem cells derived from amniotic fluid.

As shown in FIG. 1, the growth shape of the cells in the amniotic fluid-derived stem cells cultured by the above-described process was observed as a spindle shape similar to that of fibroblast cells. This is similar to the shape that appears in other mesenchymal stem cells, and it is confirmed that they are mesenchymal stem cells derived from amniotic fluid through Diff-quick staining reagent for detailed observation of the cell morphology.

In the present invention, amniotic fluid-derived mesenchymal stem cells are prepared by the above process, and the amniotic fluid-derived mesenchymal stem cells thus prepared have excellent self-proliferation ability, It has a high differentiation ability, including differentiation into adipocytes, chondrocytes, and bone cells, and has the property of retaining the pluripotency of stem cells.

In addition, in the present invention, the mesenchymal stem cells derived from amniotic fluid prepared as described above have a function of treating the musculoskeletal system.

The production of horse and animal mesenchymal stem cells for musculoskeletal treatment of the present invention can be prepared by the following method.

The present invention contains 10-20% FBS (Fetal Bovine Serum), 0.5-1.5% Glutamax, and 0.5-1.5% Penicillin/Streptomycin for the cells derived from horse amniotic fluid between passages 3-5, initially cultured (manufactured) above. Perform the process of culturing using the Dulbecco Modified Eagle Medium (DMEM) culture medium (step 4).

Preferably, the cells derived from horse amniotic fluid between passages 3 to 5 prepared above were prepared in Dulbecco Modified Eagle Medium (DMEM) culture medium containing 15% FBS (Fetal Bovine Serum), 1% Glutamax, and 1% penicillin/streptomycin. To incubate.

In the present invention, after removing the medium in the culture dish and washing with PBS (Phosphate buffered saline, PH 7.2), the cell is separated from the basal surface using 0.01 to 0.1% Typsin-EDTA (step 5),

Perform the process of obtaining horse and animal mesenchymal stem cells.

Preferably, the medium in the culture dish is removed, washed with PBS (Phosphate buffered saline, PH 7.2), and then the cells are separated from the basal surface using 0.05% Typsin-EDTA, and then 5 x 10 ⁶ ~ 1 x 10 ^{7 depending on the injection site.} Veterinary cells are obtained.

The present invention performs the process of manufacturing horse and animal mesenchymal stem cells for musculoskeletal therapy for injection by diluting the cells prepared with PBS containing 0.1 to 1.0% FBS and injecting them into a syringe. (Step 6)

In the present invention, after diluting the cells prepared with PBS containing 0.1 to 1.0% FBS, and maintaining a temperature of 2 to 8°C while blocking sunlight in a syringe, horse and animal mesenchymal stem cells for musculoskeletal therapy contained in a syringe are prepared. Perform the manufacturing process.

Preferably, the present invention prepares horse and animal mesenchymal stem cells for musculoskeletal treatment at a temperature of 4° C. in a state in which sunlight is blocked in a 3 ml syringe after diluting the cells prepared with PBS containing 0.5% FBS.

The present invention provides a cell therapy for musculoskeletal regeneration containing mesenchymal stem cells derived from amniotic fluid prepared as described above.

The present invention prepares horse and animal amniotic mesenchymal stem cells derived from amniotic fluid in the following examples, and the amniotic fluid-derived mesenchymal stem cells have excellent self-proliferation ability, and adipocytes, cartilage cells, and bone cells It has a high differentiation ability, such as Rho differentiation, and has the characteristics of retaining the pluripotency of stem cells, and it is confirmed by a test that the function of musculoskeletal therapy appears.

< Example >

1. Method for producing mesenchymal stem cells derived from horse and animal amniotic fluid, and mesenchymal stem cells derived from horse and animal amniotic fluid according thereto

(1) horses and animals Mesenchyme Isolation and culture of stem cells

Amniotic fluid samples were obtained with a 50 cc syringe equipped with 18 G and transferred to a 50 ml test tube before rupture of the amniotic sac at the time of delivery of a mare whose pregnancy was confirmed, and then transferred to the laboratory within an average of about 3 hours while maintaining at about 4°C. .

The collected amniotic water was filtered using a 100 μM cell strainer, mixed 1:1 with PBS (Phosphate Buffered Saline) containing 5% penicillin/streptomycin, and centrifuged at 3,000 rpm for 10 minutes to collect a pellet. , The recovered pellet was washed twice with PBS containing 5% penicillin/streptomycin and centrifuged to separate mononuclear cells.

For the initial culture of amniotic fluid-derived mononuclear cells that have undergone the above separation process, a Roswell Park Memorial Institute (RPMI) 1640 medium culture medium containing 15% FBS (Fetal Bovine Serum), 1% Glutamax, and 1% penicillin/streptomycin was used. I did. In order to increase cell adhesion, the cells were dispensed into a 6-well culture dish coated with 0.1% gelatin, and cultured in an incubator ^{in a 5% CO 2 environment at 38.5° C. equal to the body temperature of a horse animal.}

In order to remove dead tissues and cells, the culture medium was replaced within 48h of the initial culture start, and the culture medium was replaced even when cells were observed to adhere to the bottom of the culture dish.To maintain the undifferentiated characteristics of stem cells, the culture medium was replaced. When more than 80% of the cells were attached, passaged or frozen and stored. Amniotic fluid-derived cells could be observed in an attached form after an average of about 5 days,

As shown in Fig. 1, the growth shape of the cells was observed as a spindle shape similar to that of fibroblasts. This is similar to the shape seen in other mesenchymal stem cells, and was confirmed with Diff-quick staining reagent for detailed observation of the cell morphology.

(2) Horses and animals for musculoskeletal therapy Mesenchyme Stem cell production

Horse amniotic fluid-derived cells between passages 3 to 5 were replaced with Dulbecco Modified Eagle Medium (DMEM) culture medium containing 15% Fetal Bovine Serum (FBS), 1% Glutamax, and 1% penicillin/streptomycin, and cultured.

Remove the medium in the culture dish, wash with PBS (Phosphate buffered saline, PH 7.2), and separate the cells from the basal surface using 0.05% Typsin-EDTA, and then 5 x 10 ⁶ ~ 1 x 10 ⁷ cells depending on the injection site. Prepared and prepared.

After diluting the cells prepared with PBS containing 0.5% FBS, horse and animal mesenchymal stem cells for musculoskeletal therapy were prepared at 4° C. in a state where sunlight was blocked in a 3 ml syringe.

2. Experiment

(1) The horse and animal mesenchymal stem cells prepared in the above examples were subjected to the following experiment.

(2) Mesenchyme Stem cell self-proliferation ability verification experiment

In order to analyze the excellent self-replication and proliferation ability of mesenchymal stem cells, the growth and proliferation efficiency of the amniotic stem cells obtained by the above-described method was confirmed through passage time analysis.

Doubling time analysis is expressed as an index representing the proliferation rate of cells through time analysis in which cells are doubled from the initial number, and is expressed as follows.

Doubling time(hr)={(T-T0)log2}/(logN-logN0)

T-T0: Cell culture time (hr)

N0: number of initially dispensed cells, N: number of final cultured cells

For this experiment, equine amniotic mesenchymal stem cells were dispensed in a six-well dish at a density of 200,000 cells/well, and then cultured in an incubator ^{in a 5% CO 2 environment at 38.5 °C in a manner that no new medium was added.} The culture time and the total number of active cells were observed.

Cells were counted only by viable cells using trypan blue staining.

That is, the medium in the six-well culture dish was removed, washed with PBS (Phosphate buffered saline, PH 7.2), and then the cells were separated from the basal surface using 0.05% Typsin-EDTA. Thereafter, the action of Trypsin was stopped with a new culture medium containing 5% FBS, and the cells isolated from the cell culture dish were used for counting the number of cells.

As a result, as shown in Fig. 2, the Doubling time curve shows that amniotic stem cells are growing up to passage 50 or more. This suggests excellent self-renewal ability of the horse amniotic fluid-derived mesenchymal stem cells obtained in the present invention as compared with the 14th generation of the existing horse amniotic fluid-derived mesenchymal stem cells.

(3) Differentiation ability confirmation experiment

In order to confirm the differentiation ability of the mesenchymal stem cells isolated from the equine amniotic fluid of the present invention, the differentiation was induced into adipocytes, cartilage cells, and bone cells in a medium suitable for each lineage using the StemPro Differentiation Kit of Gibco.

1) Adipogenic differentiation

In order to verify the possibility of differentiation into adipocytes, using Gibco's StemPro Adipogenesis Differentiation Kit was placed in a six-well dish at a density of 200,000 cells/well and cultured in an incubator ^{in 5% CO 2 environment at 38.5°C.}

The medium was changed every 2 days, and after about 1 week, it was confirmed that the shape of the cells gradually changed from the fibroblast shape to the round shape during the differentiation induction process of both amniotic fluid-derived mesenchymal stem cells.

As a result of staining with Oil Red O after about 7 days, staining due to lipid droplet formation could be observed (FIG. 3).

2) Osteogenic differentiation

In order to verify the possibility of differentiation into osteoblasts, the StemPro Osteogenesis Differentiation Kit of Gibco was used in a six-well dish at a density of 200,000 cells/well and cultured in an incubator in a 5% CO2 environment at 38.5°C.

The medium was changed every 2 days, and after about 1 week, it was confirmed that both amniotic fluid-derived mesenchymal stem cells gradually changed from fibroblasts to cubic cells during the differentiation induction process.

After the induction of differentiation for about 21 days, whether calcium precipitation occurred in the extracellular matrix was confirmed by Alizarin red S staining, and as a result, it was found that the staining was positive (FIG. 4 ).

3) Chondrogenic differentiation

To verify the possibility of differentiation into chondrocytes, using Gibco's StemPro Chondrogenesis Differentiation Kit at a concentration of 1,000 cells/microliter so that the cells grow in a spherical shape by the hanging drop method, one of the 3D culture methods. Incubated in an incubator in a 5% CO2 environment at 38.5°C.

The medium was added or exchanged once every 3 days, and as a result of staining with Alcian blue after about 14 days, staining due to chondrocyte differentiation could be observed (FIG. 5).

(4) stem cells Versatility Confirm

In general, mesenchymal stem cells have specific expression patterns that are distinguished by specific cell surface markers, and are positively expressed in horse and animal mesenchymal stem cells suggested by the International Stem Cell Committee (ISCT). Analysis of CD44, CD90, CD105 showing negative expression, CD14, CD45, CD79α showing negative expression, and ELA-II immune-related markers were performed through flow cytometry analysis and reverse transcription polymerase chain reaction (RT-PCR). .

1, Endoglin, HCAM 에 대하여 mRNA 레벨에서의 발현 양상을 실시간 정량 (Real time PCR)을 통해 분석하였다.In addition, embryonic stem cell-specific genes Oct4, c-Myc, Klf4, and mesenchymal stem cell-related genes PAX6, ALCAM, Integrin, which are known for the characteristics of amniotic stem cells derived from amniotic fluid.

1, Endoglin, HCAM was analyzed through real-time quantification (Real time PCR) for the expression pattern at the mRNA level.

1) Reverse transcription polymerase chain reaction (RT-PCR)

Total RNA was prepared using an RNA extraction kit according to the manufacturer's instructions (Qiagen, Cat. No. 74104). The RNA sample (1 µl of Total RNA) was synthesized using iScript reverse transcriptase (BIO-RAD) with oligo dT primers and random primers. Primers are shown in Table 1 below.

Gene name primer order size Accession No. beta-Actin F GGATGCAGAAGGAGATCACAG 125 NM_001081838.1 R CTGGAAGGTGGACAATGAGG OCT4 F TCTCCCATGCACTCAAACTG 197 XM_001490108 R AACTTCACCTTCCCTCCAAC c- Myc F GCCCATAAAATTGCCAAGAGG 132 XM_023655154 R AGCCCTGACCTTTGAATGAC Klf4 F ACCTCGCCTTACACATGAAG 218 XM_023629843.1 R TGGTTTCCTCATTGTCTCCTG PAX6 F TGTTTGCCCGAGAAAGACTAG 224 XM_023646553.1 R AGAGGTGAAGGATGAAACAGG ALCAM F AGAAGGCAGGAAGTTTGTCG 147 XM_001503380.6 R GGAAAGTTGAGGATTGTGCG Integrin -β1 F CTTATTGGCCTTGCATTGCT 169 XM_005606848.3 R TTCCCTCGTACTTCGGATTG HCAM F ATCCTCACGTCCAACACCTC 165 XM_005598012 R CTCGCCTTTCTTGGTGTAGC Endoglin F AAGAGCTCATCTCGAGTCTG 162 XM_003364144 R TGACGACCACCTCATTACTG

[Primers used in PCR]

The synthesized cDNA was reacted a total of 34 times at 95°C for 4 minutes, 95°C for 30 seconds, 56°C for 30 seconds, and 72°C for 30 seconds, and finally PCR was performed at 73°C for 5 minutes.

According to the base sequence of each primer, PCR was performed at an appropriate annealing temperature, and the PCR product was confirmed for gene expression through agarose gel electrophoresis that can compare the amplification size (FIG. 2).

As a result of RT-PCR, the expression of the embryonic stem cell-specific Oct4, c-Myc, and Klf4 genes indicating pluripotency of stem cells showed that each gene was expressed. PAX6, ALCAM, which are specific to mesenchymal stem cells. , Integrin β1, Endoglin, it was confirmed that the HCAM genes are expressed (Fig. 6).

2) Real time PCR

The cDNA used for real-time quantification was synthesized in the same manner as the cDNA synthesis method used for RT-PCR. Realtime PCR was performed 39 times under the conditions of 95°C for 10 minutes, 94°C for 15 seconds, 58°C for 30 seconds, and 72°C for 30 seconds.

As a control, a gene from horse skin-derived fibroblasts was used, and the expression amount of stem cell-specific markers was compared in horse amniotic fluid-derived mesenchymal stem cells by comparing the relative expression level with the beta-actin gene.

As a result, it was confirmed that the pluripotent genes Oct4, c-Myc, Klf4 and the genes specific to stem cells, PAX6, ALCAM, Integrin β1, Endoglin, and HCAM, all appeared significantly higher in the cells derived from horse amniotic fluid ( Fig. 7).

3) Flow cytometry analysis

Equine amniotic fluid-derived cells are flow cells that detect markers of fluidly flowing cells based on a laser after attaching various combinations of antibodies that combine each cell surface-specific antibody and fluorescent IgG such as FITC (fluorescein isothiocyanate) or PE (phycoerythrin). Cellular marker expression and expression levels were analyzed through analysis.

The antibodies used were as follows: CD14, CD44-FITC, CD45, CD79α-FITC, CD90-PE, CD105-FITC, ELA-DR-FITC and IgG-FITC. ^{About 5-8x10 5} cells per sample were used to analyze one antibody and flow cytometry (FACScan, BD Biosciences, USA) was performed using Cellquest software.

Stem cell-specific markers CD14, CD44, CD45, CD90, CD105, and ELA-DR were identified. As a result, CD44, CD90, and CD105 were positive immunological phenotypes, and CD14, CD45, CD79α, and ELA-DR were negative. The immunological phenotype of is shown. Therefore, it was confirmed that the amniotic fluid-derived cells have the characteristics of mesenchymal stem cells (Fig. 8).

5. Horses and Animals Mesenchyme Verification of the effects of stem cells in musculoskeletal therapy

(1) In the present invention, the effect of treating the musculoskeletal system of the horse and animal mesenchymal stem cells prepared in the above (2) Preparation Example of Horse and Animal Mesenchymal Stem Cells for Musculoskeletal Treatment was tested as follows.

(2) Cell injection and confirmation

Stem cell therapy for musculoskeletal treatment was performed by preparing cells within 3 hours. After finding the exact damage that needs treatment using ultrasound, the cells diluted with PBS were sterilized using a syringe with an 18222 gauge needle, and after being injected into the wound, the progress was monitored using ultrasound at intervals of 2 months. When it was confirmed that the recovery rate of the wound was remarkably fast (Fig. 9).

9 is an X-ray result showing the recovery of damaged tissue after transplantation to a treatment site of a horse with a musculoskeletal injury disease using horse amniotic fluid-derived mesenchymal stem cells. (A, D) shows the left cartilage damage site, (B, E) the third humerus fracture and cartilage damage site, and (C, F) shows the condition before and after stem cell treatment at the radial fracture site.

As described above, it can be seen that the horse and animal amniotic fluid-derived mesenchymal stem cells prepared according to the present invention are very effective in musculoskeletal injury.

The present invention is useful in the production, manufacturing, sales, distribution, and research industries related to the production of stem cells of horses and animals and cell therapy for regeneration of the musculoskeletal system using the same.

In particular, the present invention is useful in the production, manufacturing, sales, distribution, and research industries related to the production of mesenchymal stem cells extracted from amniotic fluid of horses and animals and cell therapy for musculoskeletal regeneration using the same.

Claims (4)

Perform the process of collecting amniotic fluid from pregnant horses and animals (Step 1),
Perform the process (step 2) of isolating mononuclear cells from the collected amniotic water,
After filtering the collected amniotic water using a cell strainer, it is mixed with PBS (Phosphate Buffered Saline) containing penicillin/streptomycin at a ratio of 1:0.5 to 1.5, and then centrifuged to recover the pellet. To do,
The recovered pellet is further washed and centrifuged using PBS containing penicillin/streptomycin to perform a process of separating mononuclear cells,
Performing the process of initial culturing the isolated amniotic fluid-derived mononuclear cells (step 3),
The medium for initial culturing the isolated amniotic fluid-derived mononuclear cells is a culture medium containing FBS (Fetal Bovine Serum), Glutamax, and penicillin/streptomycin,
The culture dish uses a gelatin-coated culture dish to increase cell adhesion.
The process of culturing by replacing the initially cultured horse amniotic fluid-derived cells with a culture medium containing FBS (Fetal Bovine Serum), Glutamax, and penicillin/streptomycin (step 4),
The process of removing the medium in the culture dish, washing with PBS (Phosphate buffered saline), and separating the cells from the basal surface using Typsin-EDTA (step 5),
Method for producing mesenchymal stem cells derived from horse and animal amniotic fluid having a musculoskeletal treatment function comprising a.
The method of claim 1,
A method for producing mesenchymal stem cells derived from amniotic fluid of horses and animals having a musculoskeletal treatment function, characterized in that the horses and animals are selected from the group consisting of horses, donkeys, zebras, or hybrids born of their hybrids.
The method of claim 1,
A method for producing mesenchymal stem cells derived from amniotic fluid of horses and animals with the function of treating the musculoskeletal system with the following characteristics.
(a) It has the ability to self-proliferate over 50 passages while maintaining the characteristics of stem cells.
(b) It has the ability to differentiate into cells derived from mesoderm such as fat, cartilage, and bone cells.
(c) Both embryonic stem cell-specific genes Oct4, c-Myc, Klf4 and mesenchymal stem cell-related genes PAX6, ALCAM, Integrin α1, Endoglin, and HCAM were simultaneously positive for genetic expression.
(d) Cell surface markers CD44, CD90, and CD105 exhibit a positive immunological phenotype, and at the same time, CD14, CD45, CD79α, and ELA-DR exhibit a negative immunological phenotype.
Musculoskeletal fractures, micro fractures, periostitis, tendon and ligament damage, muscle damage, muscle, including mesenchymal stem cells derived from horse and animal amniotic fluid with a musculoskeletal treatment function prepared according to any one of claims 1 to 3 Cell therapy for the treatment or recovery of atrophy, muscle fiber shunt.

Images