KR102204186B1 - Klebsiella pneumoniae strain, culture medium thereof and composition for improving skin comprising thereof - Google Patents

Abstract

The present invention relates to a Klebsiella pneumonia strain having a nitric oxide production inhibitory activity, which, unlike a conventional pathogenic microorganism Klebsiella species, does not contain a gene expressing a pathogenic factor, and which exhibits no cytotoxicity, and has excellent polysaccharide production ability having a skin-improving effect, and thus a food or cosmetic composition using a culture medium of the Klebsiella pneumonia strain as an active component can be utilized.

Description

Klebsiella pneumoniae strain, culture medium thereof, and a composition for improving skin comprising the same.

The present invention relates to a Klebsierra pneumoniae strain or a culture solution thereof, and more particularly, a food composition for skin improvement comprising a Klebsierra pneumoniae strain or a culture solution thereof as an active ingredient, in particular skin wrinkle improvement, skin barrier improvement, It relates to skin inflammation relief, skin regeneration or skin moisturizing health functional food, feed composition, skin regeneration or skin inflammation treatment pharmaceutical composition, or skin regeneration or skin inflammation treatment animal pharmaceutical composition.

The skin is a protective barrier that is always in contact with the external environment. It not only provides the environment for the human body to perform normal metabolic processes by suppressing the loss of moisture and electrolytes, but also protects the human body from external physical damage and chemical substances. , It also functions to prevent the invasion of viruses. Such skin consists of epidermis, dermis and subcutaneous tissue, and each tissue has a specific function and forms a mutual relationship with each other.

However, skin can easily lose its function due to excessive cleansing, lifestyle factors such as bathing, environmental factors such as dry air, pollutants, and endogenous diseases such as atopic skin or senile skin. In recent years, due to the increased number of factors, the number of people complaining of dry skin symptoms and various disorders caused by it is increasing. Therefore, a lot of research has been conducted to supply moisture from the outside or prevent moisture loss from the body in order to maintain proper skin moisture, and in fact, various types of moisturizers with moisture retention ability have been developed, mainly in cosmetics. It is widely used in the field.

A cosmetic composition (Patent Document 1) for improving skin moisturization and elasticity using fish skin protein hydrolyzate was developed, and a cosmetic composition (Patent Document 2) for enhancing skin moisturization using lactic acid extract of red crab skin was developed. Since the moisture content of the skin is improved by using only functional ingredients, there is a problem that the effect is temporary or insignificant.

Patent Document 1. Korean Patent Application Publication No. 10-2014-0073837 Patent Document 2. Korean Patent Publication No. 10-1351185

An object of the present invention is to provide a Klebsiella pneumoniae ( Klebsiella pneumoniae ) L5-2 strain or a culture solution thereof.

Another object of the present invention is to improve skin wrinkles, skin barrier improvement, skin inflammation alleviation, skin regeneration or skin comprising a culture medium of Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom as an active ingredient It is to provide a moisturizing cosmetic composition.

Another object of the present invention is to improve skin wrinkles, skin barrier improvement, skin inflammation alleviation, skin regeneration or skin comprising a culture medium of Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom as an active ingredient It is to provide an external composition for moisturizing.

Another object of the present invention is to improve skin wrinkles, skin barrier improvement, skin inflammation alleviation, skin regeneration or skin comprising a culture medium of Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom as an active ingredient It is to provide a food composition for moisturizing.

Another object of the present invention is to improve skin wrinkles, skin barrier improvement, skin inflammation alleviation, skin regeneration or skin comprising a culture medium of Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom as an active ingredient It is to provide a feed composition for moisturizing.

Another object of the present invention is to improve skin wrinkles, skin barrier improvement, skin inflammation alleviation, skin regeneration or skin comprising a culture medium of Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom as an active ingredient It is to provide a feed additive composition for moisturizing.

Another object of the present invention is to provide a pharmaceutical composition for the treatment or prevention of skin regeneration or skin inflammation comprising a culture medium of Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom.

Another object of the present invention is to provide a pharmaceutical composition for an animal for the treatment or prevention of skin regeneration or skin inflammation comprising a culture medium of Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom.

Another object of the present invention is to provide a method for treating skin regeneration or skin inflammation in which the composition is orally administered to humans or animals other than humans.

Another object of the present invention is to provide a new use of a culture medium of Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom for a drug for skin regeneration or skin inflammation treatment, or for manufacturing an animal drug. will be.

The present invention to achieve the above object, Klebsiella pneumoniae ( Klebsiella pneumoniae ) L5-2 strain (KCCM12490P) Alternatively, the culture solution is provided.

According to an embodiment of the present invention, the culture medium may contain dead cells or from which cells are removed.

According to an embodiment of the present invention, the strain may be derived from the intestine of an infant.

According to an embodiment of the present invention, the polysaccharide is a constituent monosaccharide, Rhamnose, Arabinose, Galactose, Glucose, Mannose, Xylose, and galactu It may be composed of galacturonic acid and glucuronic acid.

According to an embodiment of the present invention, the polysaccharide increases collagen expression and filaggrin production, inhibits NO (Nitric oxide) production, has excellent skin cell regeneration and wound recovery, and has an effect of inhibiting skin inflammation by ultraviolet rays. Can be.

The present invention, in order to achieve the above another object, Klebsiella pneumoniae ( Klebsiella pneumoniae ) L5-2 strain containing as an active ingredient a culture medium or a polysaccharide isolated therefrom, skin wrinkle improvement, skin barrier improvement, skin inflammation relief It provides a cosmetic composition for skin regeneration or skin moisturizing.

According to an embodiment of the present invention, the composition is a skin lotion, skin softener, skin toner, astringent, milk lotion, moisture lotion, nutrition lotion, massage cream, nutrition cream, moisture cream, hand cream, foundation, nutrition essence, pack , Soap, cleansing foam, cleansing lotion, cleansing cream, body lotion and body cleanser may be any one or more formulations selected from the group consisting of.

In order to achieve the another object, the present invention improves skin wrinkles, improves skin barriers, and relieves skin inflammation, including the culture medium of Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom as an active ingredient. It provides a composition for external application for skin regeneration or skin moisturization.

In order to achieve the another object, the present invention improves skin wrinkles, improves skin barriers, and relieves skin inflammation, including the culture medium of Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom as an active ingredient. It provides a food composition for skin regeneration or skin moisturizing.

According to an embodiment of the present invention, it may be a health functional food for skin wrinkle improvement, skin barrier improvement, skin inflammation relief, skin regeneration or skin moisturizing.

In order to achieve the another object, the present invention improves skin wrinkles, improves skin barriers, and relieves skin inflammation, including the culture medium of Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom as an active ingredient. It provides a feed composition for skin regeneration or skin moisturizing.

In order to achieve the another object, the present invention improves skin wrinkles, improves skin barriers, and relieves skin inflammation, including the culture medium of Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom as an active ingredient. It provides a feed additive composition for skin regeneration or skin moisturizing.

The present invention provides a pharmaceutical composition for the treatment or prevention of skin regeneration or skin inflammation comprising a culture medium of Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom in order to achieve the another object do.

In order to achieve the another object, the present invention includes a culture solution of Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom for skin regeneration, skin inflammation treatment or prevention of animals other than humans It provides a pharmaceutical composition for use.

In addition, the present invention provides a method for skin regeneration or skin inflammation by administering the composition to humans or non-human animals.

In addition, the present invention provides a new use of a culture medium of Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom for the manufacture of a drug for skin regeneration or skin inflammation, or an animal drug.

Klebsiella pneumoniae of the present invention ( Klebsiella pneumoniae ) L5-2 strain or its culture medium is a variety of effects such as nitric oxide (Nitric oxide) production inhibitory activity, collagen expression enhancement activity, filaggrin production enhancement activity and wound healing activity Has. In particular, the polysaccharide produced from the Klebsiella pneumoniae L5-2 strain according to the present invention and separated by the culture medium improves skin wrinkles, improves skin barriers, relieves skin inflammation, strengthens skin regeneration or skin moisturization, etc. It has excellent effects in improving skin.

In addition, the Klebsiella pneumoniae L5-2 strain of the present invention is one of the intestinal microorganisms derived from the feces of infants, and unlike the conventional pathogenic microorganisms, Klebsierra species, genes expressing pathogenic factors do not exist. In addition, since it does not show any cytotoxicity, skin wrinkle improvement, skin barrier improvement, skin inflammation relief, skin regeneration or skin moisturizing food composition, further health functional food, feed composition, skin regeneration or skin inflammation treatment pharmaceutical composition, animal pharmaceutical It can be used as a composition.

1A is a schematic diagram of a Klebsiella pneumoniae L5-2 strain based on a 16S rRNA sequence.
1B is a graph showing the analysis of the average nucleotide identity (ANI) value of the Klebsiella pneumoniae L5-2 strain.
2 is a complete circular genomic map of Klebsiella pneumoniae L5-2 strain. Figure 2A is a chromosome and Figure 2B is a plasmid.
Figure 3 is a graph showing the measurement of the growth curve of Klebsiella pneumoniae ( Klebsiella pneumoniae ) L5-2 strain and Klebsiella pneumoniae subsp. ozaenae ( Klebsiella pneumoniae subsp. ozaenae ) ATCC 11296 strain isolated from Example 1 .
Figure 4 is a microscope image of measuring the migration of HEKa cells treated with polysaccharides derived from Klebsiella pneumoniae L5-2 strain of Example 2 by concentration.

Hereinafter, the present invention will be described in detail.

As a result of trying to find a strain that does not show toxicity in vivo and is stable and capable of regenerating skin cells, improving skin wrinkles, improving skin barrier, moisturizing skin or improving, preventing or treating skin inflammation, a novel Kleb Sierra ( Klebsiella ) genus strain Klebsiella pneumoniae ( Klebsiella pneumoniae ) L5-2 strain was isolated and identified from the intestine or feces of infants and toddlers to complete the present invention.

One aspect of the present invention relates to a Klebsiella pneumoniae ( Klebsiella pneumoniae ) L5-2 strain (KCCM12490P) or a culture solution thereof.

Specifically, the Klebsiella pneumoniae L5-2 strain of the present invention may be derived from the intestine or feces of infants and toddlers, preferably younger than 7 years old.

As a result of 16S rDNA sequencing analysis for the identification and classification of the Klebsiella pneumoniae L5-2 strain, no bacteria with completely 100% homology were detected, and Klebsiella pneumoniae ( Klebsiella pneumoniae) subsp.ozaenae ) It was found to have 99.79% homology with ATCC 11296 strain.

In the present invention, the whole genome sequence analysis of Klebsiella pneumoniae L5-2 strain was performed, and it was deposited under the National Center for Biological Information (NCBI) access number CD_025683~025684. Specifically, the plasmid sequence of the Klebsiella pneumoniae L5-2 strain of the present invention is https://www.ncbi.nlm.nih.gov/nuccore/CP025683.1/ , and the chromosome sequence is https:/ Available at /www.ncbi.nlm.nih.gov/nuccore/CP025684.1/ .

As a result of comparing the information on the entire sequence, it was confirmed that the Klebsiella pneumoniae L5-2 strain had a clear difference from the Klebsiella pneumoniae subsp. ozaenae ATCC 11296 strain . .

Therefore, the microorganism of the present invention having the entire genome sequence of the US National Center for Biological Information (NCBI) access number CD_025683 ~ 025684 was named as Klebsiella pneumoniae L5-2 strain, and the Korea Microbial Conservation Center (KCCM) It was deposited on April 16, 2019, and was assigned the deposit number KCCM12490P.

Unlike the conventional Klebsiella pneumoniae , the strain was confirmed to have no genes encoding Aerobactin (VF0123), Tersiniabactin (VF0136) and Aerobactin (VF0229), which represent virulence factors. Through this, it can be seen that the Klebsiella pneumoniae L5-2 strain is harmless in the human body.

In the following examples, the Klebsiella pneumoniae L5-2 strain of the present invention has an activity to increase collagen expression, an activity to increase filaggrin production, and a wound repair activity, as well as an activity to inhibit nitric oxide production. . In addition, the Klebsiella pneumoniae L5-2 strain of the present invention has excellent polysaccharide production ability, and the polysaccharide derived from the Klebsiella pneumoniae L5-2 strain regenerates skin cells, and skin wrinkles and skin barriers It has the effect of improving skin moisturizing, inhibiting skin inflammation. Specifically, the polysaccharide derived from the Klebsiella pneumoniae L5-2 strain of the present invention increases collagen expression and filaggrin production, inhibits NO (Nitric oxide) production, and promotes skin cell regeneration or wound repair. It was confirmed that the effect of making it was exhibited.

Therefore, Klebsiella pneumoniae according to the present invention ( Klebsiella pneumoniae ) L5-2 strain, as well as a culture solution thereof, as a cosmetic or food composition for improving skin wrinkles, skin barrier improvement, skin inflammation relief, skin regeneration or skin It can be used in various ways for moisturizing.

The culture medium is a cell culture medium obtained by culturing a strain, and may include dead cells or from which cells are removed. The concentrate of the culture solution is the concentration of the culture solution, and the dried product of the culture solution means that the culture solution has been drained.

The cells may be any one or more selected from the group consisting of crushed cell wall fraction, live cells, dead cells and dried cells.

The polysaccharide can be isolated from the cell culture solution through cultivation of Klebsiella pneumoniae L5-2 strain, and the polysaccharide has an average molecular weight (MW) of 540 to 860 at 30 to 40°C, as a constituent monosaccharide. Includes Rhamnose, Arabinose, Galactose, Glucose, Mannose, Xylose, Galacturonic acid and Glucuronic acid. It may be composed of.

In addition, the polysaccharide derived from the Klebsiella pneumoniae L5-2 strain has the effect of inhibiting the production of NO, an inflammatory factor increased due to ultraviolet rays, and at least one of human fibroblasts or human keratinocytes. Selected skin regeneration, wound healing or skin inflammation alleviation effect.

The polysaccharide is a microbial polysaccharide that forms a capsular membrane around the cell wall as a part of the cell wall of the Klebsiella pneumoniae L5-2 strain, or accumulates in the form of a slime outside the cell wall during fermentation. It has already been reported that the polysaccharide is easy to recover from the culture medium and has a very good commercial potential because it requires low purification costs.In addition, it has been reported that polysaccharides produced by microorganisms have different types and ratios of monosaccharide components constituting polysaccharides depending on the species. Has been done.

In addition, polysaccharides derived from Klebsiella pneumoniae L5-2 strain increase filaggrin production, have the effect of improving the skin barrier, and enhance the expression of collagen in the skin, improving skin barrier and improving skin elasticity. , Skin wrinkle improvement or skin moisturizing effect.

Another aspect of the present invention relates to a polysaccharide having a skin-improving effect derived from Klebsiella pneumoniae L5-2 strain deposited with accession number KCCM12490P.

The polysaccharide can be isolated from the cell culture solution through cultivation of Klebsiella pneumoniae L5-2 strain, and the polysaccharide has an average molecular weight (MW) of 540 to 860 at 30 to 40°C, as a constituent monosaccharide. Includes Rhamnose, Arabinose, Galactose, Glucose, Mannose, Xylose, Galacturonic acid and Glucuronic acid. It may be, and preferably exhibits a skin improvement effect. The polysaccharide has the effect of regenerating skin cells, improving skin wrinkles and skin barrier, promoting skin moisturization, and inhibiting skin inflammation. Specifically, the polysaccharide derived from the Klebsiella pneumoniae L5-2 strain of the present invention increases collagen expression and filaggrin production, inhibits NO (Nitric oxide) production, and promotes skin cell regeneration or wound repair. It was confirmed that the effect of making it was exhibited.

Since the polysaccharide has non-toxic and non-antigenic properties, it can be safely used in the pharmaceutical field, food field, feed field, feed additive field, cosmetic field, and external preparation field.

Another aspect of the present invention relates to a method for producing the polysaccharide. Specifically, the a) Klebsiella pneumoniae ( Klebsiella pneumoniae ) L5-2 strain (KCCM12490P) is inoculated in a medium and cultured to obtain a culture solution, and b) separating a polysaccharide from the culture solution.

In the a) culturing step, the medium is not particularly limited as long as it is a general medium used in the art, but is preferably a selective LC medium, LC medium, TSB (tryptic soy broth) medium, MRS medium, or LB (Luria-Bertani) It may be selected from a medium or the like, and in consideration of the productivity of polysaccharides, it is preferably a selective LC medium or TSB (tryptic soy broth) medium. In addition, the culture temperature is preferably 25 ℃ to 40 ℃, in consideration of the productivity and economy of the polysaccharide, it is more preferably 35 to 40 ℃. In addition, the incubation time may be 1 to 72 hr, more preferably 40 to 55 hr. At this time, the pH is preferably pH 4.0 to 8.0, and more preferably 6.5 to 7.5.

The step of separating the polysaccharide from the b) culture solution includes: b-1) treating the culture solution with a protease, b-2) in the reaction solution recovered from b-1) by centrifugation, filtration or sedimentation. Removing the cells by; And b-3) preparing a precipitate by mixing a lower alcohol having 1 to 5 carbon atoms in the reaction solution from which the cells are removed.

The yield of polysaccharides may be increased through the step of b-1) treating the culture medium with a protease. Step b-1) may be performed under conditions of pH 5 to 10, preferably pH 7 to 8.

In addition, the step b-1) is preferably performed for 20 to 80°C, 1 to 60 minutes in consideration of the protease activity, and 55 to 75°C for 20 to 40 minutes, if considering the polysaccharide yield. desirable. If the condition is out of the above range, the reaction may not be sufficiently performed or excessively decomposed, resulting in a problem that the purification process for obtaining a polysaccharide is rather complicated.

Thereafter, cells or impurities are removed from the reaction solution recovered from b-1) by centrifugation, filtration, or sedimentation (step b-2).

The sedimentation is not particularly limited as long as it is a method for removing cells in general, but may be preferably performed by adding NaCl, and is not particularly limited as long as it is an amount capable of adding NaCl, but recovered from b-1). 0.1 to 10% by weight may be added based on the total volume of the reaction solution, and more preferably 2 to 4% by weight may be added.

Next, a precipitate is precipitated by mixing a lower alcohol having 1 to 5 carbon atoms in the reaction solution recovered from b-2) (step b-3), and polysaccharides can be separated therefrom. It is preferable that 1 to 2 parts by weight of the lower alcohol is included based on 1 part by weight of the reaction solution from which the cells are removed.

The step b) may be repeatedly performed as necessary, and it is preferable to repeat 2-3 times in consideration of the polysaccharide purification rate. If it is performed more than 3 times, a problem of increasing polysaccharide loss may occur.

After step b), as a conventional method in the art, after dissolving the precipitate in water, at least one solvent selected from the group consisting of n-hexane, methylene chloride, acetone, chloroform, ethyl acetate, and n-butanol was used. It can be further fractionated to prepare a fraction. In addition, according to the conventional method, extraction with organic solvents (alcohol, ether, acetone, hexane, methylene chloride, ethyl acetate, etc.), distribution of organic solvents such as hexane and butanol and water, and separation of components such as a method by column chromatography And a known method used for a method using activated carbon alone or in an appropriate combination.

In addition, the method by column chromatography is silica gel column chromatography, LH-20 column chromatography, ion exchange resin chromatography, and medium pressure. Selected from the group consisting of medium pressure liquid chromatography, thin layer chromatography (TLC), silica gel vacuum liquid chromatography, and high performance liquid chromatography. You can select and use any one of the following.

The manufacturing temperature in step b) may be 10 to 100°C, but is not limited thereto. The time is not particularly limited, but is preferably performed within 10 minutes to 2 days, and a conventional separator, ultrasonic grinder, or fractionator may be used as a separation device.

The polysaccharide obtained through the above process may be further concentrated or solidified. The concentration is not particularly limited as long as it is a concentration method generally used in the art, but may be preferably membrane filtration or dialysis.

The filtration process may use cotton, nylon, paper, or the like to filter out particles, or use ultrafiltration, cryofiltration, centrifugation, or the like, but is not limited thereto.

The solidification is not particularly limited as long as it is a method generally used in the art, but preferably includes hot air drying, vacuum drying, freeze drying, vacuum drying, spray drying, vacuum drying, foam drying, high frequency drying, infrared drying, etc. It is not limited thereto. In some cases, the final dried polysaccharide may be pulverized and powdered.

Another aspect of the present invention is a culture medium of Klebsiella pneumoniae L5-2 strain (KCCM12490P) or a polysaccharide isolated therefrom, improving skin wrinkles, improving skin barriers, reducing skin inflammation, skin regeneration, or moisturizing the skin. It relates to a cosmetic composition for.

In the present invention, the term "skin regeneration" may mean any action of supplementing a portion of the skin or promoting proliferation of skin cells when a portion of the skin is lost.

In the present invention, "improving skin wrinkles" may mean any action of increasing skin elasticity so that the skin is not folded and wrinkles are formed when the elasticity of the skin is lost and loosened.

In the present invention, "skin barrier improvement" may refer to any action in which the function of the skin barrier that is located on the outermost side of the skin and prevents moisture and nutrition loss is enhanced.

In the present invention, "skin moisturizing" may refer to any action of maintaining skin moisture or preventing moisture loss.

In the present invention, "relieving skin inflammation" may mean any action in which the immune response is alleviated and NO production is suppressed when the skin is activated by an external stimulus.

In the present invention, the term "improvement" may mean all actions of at least reducing the degree of a condition, for example, a parameter related to amelioration or treatment of a condition, and "prevention" is a parameter related to alleviation or treatment or delay of the condition, For example, it could mean any action that delays the onset of symptoms.

The cosmetic composition is skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisture lotion, nutrition lotion, massage cream, nutrition cream, moisture cream, hand cream, foundation, essence, nutrition essence, pack, soap, cleansing It may have any one or more formulations selected from the group consisting of foam, cleansing lotion, cleansing cream, body lotion and body cleanser.

Klebsiella pneumoniae of the present invention ( Klebsiella pneumoniae ) L5-2 strain (KCCM12490P) is not particularly limited as long as it is a general medium used in the art, preferably can be cultured in a selective LC medium, 25 ℃ to 40 ℃ , pH 4.0 to 8.0, can be cultured for 1 to 72 hours.

The cosmetic composition of the present invention may contain a culture solution of Klebsiella pneumoniae L5-2 strain (KCCM12490P) or a polysaccharide isolated therefrom.

The culture medium is a cell culture medium obtained by culturing a strain, and may include dead cells or from which cells are removed.

The cells may be any one or more selected from the group consisting of crushed cell wall fraction, live cells, dead cells and dried cells.

The cosmetic composition comprising the culture medium of the Klebsiella pneumoniae L5-2 strain (KCCM12490P) of the present invention or a polysaccharide isolated therefrom as an active ingredient is collagen expression, including nitric oxide production inhibitory activity It has an augmenting activity, a filaggrin production enhancing activity, a skin regeneration and wound healing activity.

The present invention provides a cosmetic composition comprising as an active ingredient a culture medium (KCCM12490P) of the Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom, wherein the composition includes Klebsiella pneumoniae ) L5-2 strain (KCCM12490P), a culture medium thereof may contain 0.1 to 20% by weight.

The formulation of the cosmetic composition is not particularly limited, but preferably, skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisture lotion, nutrition lotion, massage cream, nutrition cream, moisture cream, hand cream, foundation, It may be any one or more formulations selected from the group consisting of essence, nutritional essence, pack, soap, cleansing foam, cleansing lotion, cleansing cream, body lotion and body cleanser.

The cosmetic composition of the present invention may further include a component selected from the group consisting of water-soluble vitamins, oil-soluble vitamins, polymer peptides, polymer polysaccharides, sphingo lipids, and seaweed extract.

The water-soluble vitamin may be any one that can be blended in cosmetics, but preferably vitamin B1, vitamin B2, vitamin B6, pyridoxine, pyridoxine hydrochloride, vitamin B12, pantothenic acid, nicotinic acid, nicotinic acid amide, folic acid, vitamin C, vitamin H, etc. And their salts (thiamine hydrochloride, sodium ascorbate, etc.) and derivatives (ascorbic acid-2-phosphate sodium salt, ascorbic acid-2-magnesium salt, etc.) are also included in the water-soluble vitamins that can be used in the present invention. Included. Water-soluble vitamins can be obtained by conventional methods such as a microbial transformation method, a purification method from a culture of microorganisms, an enzyme method or a chemical synthesis method.

As the oil-soluble vitamin, any one may be used as long as it can be blended in cosmetics, but preferably vitamin A, carotene, vitamin D2, vitamin D3, vitamin E (d1-alpha tocopherol, d-alpha tocopherol, d-alpha tocopherol), etc. , Their derivatives (ascorbine palmitate, ascorbine stearate, ascorbine dipalmitate, dl-alpha tocopherol acetate, dl-alpha tocopherol nicotinate, vitamin E, DL-pantotenyl alcohol, D-pantotenyl alcohol, pantotenyl ethyl Ether, etc.) are also included in the oil-soluble vitamin used in the present invention. Oil-soluble vitamins can be obtained by conventional methods such as a microbial transformation method, a purification method from a microorganism culture, an enzyme or a chemical synthesis method.

The polymer peptide may be any one as long as it can be blended into a cosmetic, but preferably, collagen, hydrolyzed collagen, gelatin, elastin, hydrolyzed elastin, keratin, and the like can be mentioned. The polymeric peptide can be purified and obtained by a conventional method such as a purification method from a culture medium of a microorganism, an enzyme method, or a chemical synthesis method, or it can be used after being purified from natural products such as dermis of pigs and cattle, silk fibers of silkworms.

The polymer polysaccharide may be any one as long as it can be blended in the cosmetic composition, but preferably, hydroxyethyl cellulose, xanthan gum, sodium hyaluronate, chondroitin sulfuric acid or a salt thereof (sodium salt, etc.) may be mentioned. For example, chondroitin sulfate or a salt thereof can be used after being purified from mammals or fish.

The sphingo lipid may be any one as long as it can be blended into the cosmetic composition, and ceramide, phytosphingosine, sphingoglycolipid, and the like are preferably mentioned. Sphingo lipids are usually purified from mammals, fish, shellfish, yeast, plants, etc. by a conventional method, or can be obtained by chemical synthesis.

The seaweed extract may be anything as long as it can be blended into the cosmetic composition, but preferably brown algae extract, red algae extract, green algae extract, etc. are exemplified, and carrageenan, arginic acid, sodium arginate purified from these seaweed extracts And potassium arginate are also included in the seaweed extract used in the present invention. Seaweed extract can be obtained by purifying from seaweed by a conventional method.

In the cosmetic composition of the present invention, other ingredients to be blended in conventional cosmetics may also be blended. Other ingredients that may be added include fats and oils, moisturizers, emollients, surfactants, organic and inorganic pigments, organic powders, ultraviolet absorbers, preservatives, fungicides, antioxidants, plant extracts, pH adjusters, alcohols, pigments, fragrances, Blood circulation accelerators, cold sensation agents, restrictors, and purified water.

Examples of oil and fat components include ester oils and fats, hydrocarbon oils, silicone oils, fluorine oils, animal oils and vegetable oils.

Examples of ester oils include glyceryl tri2-ethylhexanoate, cetyl 2-ethylhexanoate, isopropyl myristate, butyl myristate, isopropyl palmitate, ethyl stearate, octyl palmitate, isocetyl isostearate, stearic acid. Butyl, ethyl linoleate, isopropyl linoleate, ethyl oleate, isocetyl myristate, isostearyl myristate, isostearyl palmitate, octyldodecyl myristate, isocetyl isostearate, diethyl sebacate, adipine Diisopropyl acid, isoalkyl neopentanoate, tri(capryl, capric acid) glyceryl, tri2-ethylhexanoate trimethylolpropane, triisostearate trimethylolpropane, tetra2-ethylhexanoate pentaelisitol , Cetyl caprylate, decyl laurate, hexyl laurate, decyl myristic acid, myristic myristic acid, cetyl myristate, stearyl stearate, decyl oleate, cetyl ricinooleate, isostea laurate Reel, isotridecyl myristate, isocetyl palmitate, octyl stearate, isocetyl stearate, isodecyl oleate, octyldodecyl oleate, octyldodecyl linoleate, isopropyl isostearate, 2-ethylhexanoate cetoste Aryl, 2-ethylhexanoate stearyl, isostearate hexyl, dioctanoate ethylene glycol, dioleate ethylene glycol, dicaprylic acid propylene glycol, dicaprylic acid propylene glycol, dicaprylic acid propylene glycol, dica Neopentyl glycol prinate, neopentyl glycol dioctanoate, glyceryl tricaprylate, glyceryl triundecylate, glyceryl triisopalmitate, glyceryl triisostearate, octyldodecyl neopentanoate, isostearyl octanoate , Octyl isononanoate, hexyldecyl neodecanoate, octyldodecyl neodecanoate, isocetyl isostearate, isostearyl isostearate, octyldecyl isostearate, polyglycerololeic acid ester, polyglycerin isostearate, Triisocetyl citrate, triisoalkyl citrate, triisooctyl citrate, lauryl lactate, myristyl lactate, cetyl lactate, octyldecyl lactate, triethyl citrate, acetyltriethyl citrate, acetyltributyl citrate, trioctyl citrate, di malic acid Isostearyl, 2-ethylhexyl hydroxystearate, di2-ethylhexyl succinate, diisobutyl adipate, diisopropyl sebacate, dioctyl sebacate, Cholesteryl stearate, cholesteryl isostearate, cholesteryl hydroxystearate, cholesteryl oleate, dihydrocholesteryl oleate, pitsteryl isostearate, pitsteryl oleate, 12-stealoyl And esters such as isocetyl hydroxystearate, stearyl 12-stealoylhydroxystearate, and isostearyl 12-stealoylhydroxystearate.

Hydrocarbon oils and fats, such as squalene, liquid paraffin, alpha-olefin oligomer, isoparaffin, ceresin, paraffin, liquid isoparaffin, polybuden, microcrystalline wax, and petrolatum, are mentioned.

Silicone-based fats and oils include polymethylsilicone, methylphenylsilicone, methylcyclopolysiloxane, octamethylpolysiloxane, decamethylpolysiloxane, dodecamethylcyclosiloxane, dimethylsiloxane/methylcetyloxysiloxane copolymer, dimethylsiloxane/methylsteaoxysiloxane copolymer, alkyl And modified silicone oil and amino-modified silicone oil.

As fluorine-based fats and oils, perfluoropolyether, etc. are mentioned.

Animal or vegetable oils include avocado oil, almond oil, olive oil, sesame oil, rice bran oil, new flower oil, soybean oil, corn oil, rapeseed oil, almond oil, palm kernel oil, palm oil, castor oil, sunflower oil, grape seed oil. , Cottonseed Oil, Palm Oil, Cucuine Nut Oil, Wheat Germ Oil, Rice Germ Oil, Shea Butter, Walnut Colostrum Oil, Marker Demi Anut Oil, Meadow Home Oil, Egg Yolk Oil, Tallow Oil, Horse Oil, Mink Oil, Orange Rape Oil, Jojoba Oil , Animal or plant fats such as canderry wax, carnauba wax, liquid lanolin, and hydrogenated castor oil.

Examples of the moisturizing agent include a water-soluble low-molecular moisturizer, a fat-soluble molecular moisturizer, a water-soluble polymer, and a fat-soluble polymer. Water-soluble low molecular weight moisturizers include serine, glutamine, sorbitol, mannitol, pyrrolidone-sodium carboxylate, glycerin, propylene glycol, 1,3-butylene glycol, ethylene glycol, polyethylene glycol B (polymerization degree n = 2 or more), polypropylene Glycol (polymerization degree n = 2 or more), polyglycerin B (polymerization degree n = 2 or more), lactic acid, lactate, and the like.

As a fat-soluble low molecular weight moisturizer, cholesterol, cholesterol ester, etc. are mentioned. Examples of the water-soluble polymer include carboxyvinyl polymer, polyaspartic acid salt, tragacanth, xanthan gum, methylcellulose, hydroxymethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, carboxymethylcellulose, water-soluble chitin, chitosan, dextrin, and the like. I can.

Examples of the oil-soluble polymer include polyvinylpyrrolidone/eicosene copolymer, polyvinylpyrrolidone/hexadecene copolymer, nitrocellulose, dextrin fatty acid ester, and polymer silicone.

Examples of the emollient agent include long-chain acyl glutamate cholesteryl ester, hydroxystearate cholesteryl, 12-hydroxystearic acid, stearic acid, rosin acid, and lanolin fatty acid cholesteryl ester.

As surfactant, nonionic surfactant, anionic surfactant, cationic surfactant, amphoteric surfactant, etc. are mentioned. Nonionic surfactants include self-emulsifying monostearate glycerin, propylene glycol fatty acid ester, glycerin fatty acid ester, polyglycerol fatty acid ester, sorbitan fatty acid ester, POE (polyoxyethylene) sorbitan fatty acid ester, POE sorbit fatty acid ester, POE Glycerin fatty acid ester, POE alkyl ether, POE fatty acid ester, POE hydrogenated castor oil, POE castor oil, POE·POP (polyoxyethylene·polyoxypropylene) copolymer, POE·POP alkyl ether, polyether-modified silicone, lauric acid Alkanolamides, alkylamine oxides, hydrogenated soybean phospholipids, and the like.

As anionic surfactants, fatty acid soap, alpha-acyl sulfonate, alkyl sulfonate, alkyl allyl sulfonate, alkyl naphthalene sulfonate, alkyl sulfate, POE alkyl ether sulfate, alkylamide sulfate, alkyl phosphate, POE alkyl phosphate, alkyl amide Phosphate, alkyloylalkyltaurine salt, N-acylamino acid salt, POE alkylether carboxylate, alkyl sulfosuccinate, sodium alkylsulfoacetate, acylated hydrolyzed collagen peptide salt, perfluoroalkyl phosphate, and the like. have. Cationic surfactants include alkyl trimethyl ammonium chloride, stearyl trimethyl ammonium chloride, stearyl trimethyl ammonium bromide, cetostearyl trimethyl ammonium chloride, distearyl dimethyl ammonium chloride, stearyldimethylbenzyl ammonium chloride, behenyl trimethyl ammonium bromide, and chloride. Benzalkonium, diethylaminoethyl amide stearate, dimethylaminopropyl amide stearate, lanolin derivative quaternary ammonium salt, and the like.

Examples of amphoteric surfactants include carboxybetaine type, amide betaine type, sulfobetaine type, hydroxysulfobetaine type, amide sulfobetaine type, phosphobetaine type, aminocarboxylate type, imidazoline derivative type, amideamine type, etc. And amphoteric surfactants.

Examples of organic and inorganic pigments include silicic acid, silicic anhydride, magnesium silicate, talc, sericite, mica, kaolin, bengala, clay, bentonite, titanium coated mica, bismuth oxychloride, zirconium oxide, magnesium oxide, zinc oxide, titanium oxide, aluminum oxide. , Inorganic pigments such as calcium sulfate, barium sulfate, magnesium sulfate, calcium carbonate, magnesium carbonate, iron oxide, ultramarine, chromium oxide, chromium hydroxide, calamine, and complexes thereof; Polyamide, polyester, polypropylene, polystyrene, polyurethane, vinyl resin, urea resin, phenol resin, fluorine resin, silicon resin, acrylic resin, melamine resin, epoxy resin, polycarbonate resin, divinylbenzene-styrene copolymer, Organic pigments, such as silk powder, cellulose, CI pigment yellow, and CI pigment orange, and complex pigments of these inorganic pigments and organic pigments, etc. are mentioned.

Examples of the organic powder include metal soaps such as calcium stearate; Alkyl phosphate metal salts, such as sodium zinc cetylate, a zinc laurylate, and calcium laurylate; Acylamino acid polyvalent metal salts such as N-lauroyl-beta-alanine calcium, N-lauroyl-beta-alanine zinc, and N-lauroyl glycine calcium; Amide sulfonic acid polyvalent metal salts such as N-lauroyl-taurine calcium and N-palmitoyl-taurine calcium; N, such as N-epsilon-lauroyl-L-lysine, N-epsilon-palmitoyl lizine, N-alpha-paritoylolnitine, N-alpha-lauroylarginine, N-alpha-hardened tallow fatty acid acylarginine, etc. -Acyl basic amino acid; N-acyl polypeptides such as N-lauroylglycylglycine; Alpha-amino fatty acids such as alpha-aminocaprylic acid and alpha-aminolauric acid; Polyethylene, polypropylene, nylon, polymethyl methacrylate, polystyrene, divinylbenzene/styrene copolymer, ethylene tetrafluoride, and the like.

UV absorbers include paraaminobenzoic acid, ethyl paraaminobenzoate, amyl paraaminobenzoate, octyl paraaminobenzoate, ethylene glycol salicylate, phenyl salicylate, octyl salicylate, benzyl salicate, butyl phenyl salicylate, homomentyl salicylate, benzyl cinnamate , Paramethoxycinnamic acid-2-ethoxyethyl, paramethoxycinnamic acid octyl, diparamethoxycinnamic acid mono-2-ethylhexane glyceryl, paramethoxycinnamic acid isopropyl, diisopropyl·diisopropyl cinnamic acid ester mixture, right Cannic acid, ethyl urocanate, hydroxymethoxybenzophenone, hydroxymethoxybenzophenonesulfonic acid and salts thereof, dihydroxymethoxybenzophenone, sodium dihydroxymethoxybenzophenone disulfonate, dihydroxybenzophenone , Tetrahydroxybenzophenone, 4-tert-butyl-4'-methoxydibenzoylmethane, 2,4,6-trianilino-p-(carbo-2'-ethylhexyl-1'-oxy)-1 ,3,5-triazine, 2-(2-hydroxy-5-methylphenyl)benzotriazole, etc. are mentioned.

As a disinfectant, hinokitiol, triclosan, trichlorohydroxydiphenyl ether, chlorhexidine gluconate, phenoxyethanol, resorcin, isopropylmethylphenol, azulene, salicylic acid, zinphylithione, benzalkonium chloride, photosensitization Sono No. 301, mononitroguarous sodium, undecylenic acid, and the like.

Examples of the antioxidant include butylhydroxyanisole, propyl gallic acid, and elisorbic acid. Examples of the pH adjuster include citric acid, sodium citrate, malic acid, sodium malate, pmalic acid, sodium pmarate, succinic acid, sodium succinate, sodium hydroxide, sodium monohydrogen phosphate, and the like. Examples of alcohol include higher alcohols such as cetyl alcohol.

In addition, the blending ingredients that may be added are not limited thereto, and any of the above ingredients can be blended within a range that does not impair the object and effect of the present invention, but preferably 0.01 to 5% by weight, more preferably, based on the total weight. May be blended in 0.01-3% by weight.

The cosmetic composition of the present invention may take the shape of a solution, an emulsion, a viscous mixture, or the like. Ingredients included in the cosmetic composition of the present invention may include ingredients commonly used in cosmetics in addition to the culture medium of the strain or polysaccharides isolated therefrom as an active ingredient. For example, stabilizers, solubilizers, vitamins, pigments And conventional adjuvants and carriers such as fragrances.

When the cosmetic composition formulation of the present invention is a paste, cream, or gel, animal fibers, plant fibers, wax, paraffin, starch, tracant, cellulose derivatives, polyethylene glycol, silicone, bentonite, silica, talc, or zinc oxide, etc. are used as carrier components. Can be used.

When the cosmetic composition formulation of the present invention is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, or polyamide powder may be used as a carrier component. In particular, in the case of a spray, additional chlorofluorohydrocarbons , Propane/butane or a propellant such as dimethyl ether.

When the cosmetic composition formulation of the present invention is a solution or emulsion, a solvent, solvating agent or emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol , 1,3-butylglycol oil, glycerol aliphatic ester, polyethylene glycol or fatty acid ester of sorbitan.

When the cosmetic composition formulation of the present invention is a suspension, as a carrier component, a liquid diluent such as water, ethanol or propylene glycol, an ethoxylated isostearyl alcohol, a suspending agent such as polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Crystalline cellulose, aluminum metahydroxide, bentonite, agar or tracant, and the like may be used.

When the cosmetic composition formulation of the present invention is a surfactant containing cleansing, as carrier components, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, Fatty acid amide ether sulfates, alkylamidobetaines, fatty alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, linoline derivatives, or ethoxylated glycerol fatty acid esters may be used.

Another aspect of the present invention is a skin wrinkle improvement, skin barrier improvement, skin inflammation alleviation, skin regeneration or skin comprising the culture medium of Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom as an active ingredient It relates to an external composition for moisturizing.

The culture medium of the Klebsiella pneumoniae L5-2 strain or the polysaccharide isolated therefrom is as described above.

The external preparation may be a cream, gel, ointment, skin emulsifier, skin suspension, transdermal delivery patch, drug-containing bandage, lotion, or a combination thereof. The external preparations are ingredients commonly used in external preparations for skin such as cosmetics and pharmaceuticals, such as aqueous ingredients, oily ingredients, powder ingredients, alcohols, moisturizers, thickeners, ultraviolet absorbers, whitening agents, preservatives, antioxidants, surfactants, fragrances, Colorants, various skin nutrients, or combinations thereof and may be appropriately formulated according to need. The external preparations include metal sequestering agents such as disodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate, and gluconic acid, caffeine, tannin, bellapamil, licorice extract, glavidine, fruit of calin Hot-water extract, various herbal medicines, tocopherol acetate, glytilithic acid, tranexamic acid and derivatives or salts thereof, vitamin C, ascorbic acid magnesium phosphate, ascorbic acid glucoside, arbutin, kojic acid, glucose, fructose, trehalose Sugars such as etc. can also be appropriately blended.

Another aspect of the present invention is a skin wrinkle improvement, skin barrier improvement, skin inflammation alleviation, skin containing a culture medium of Klebsiella pneumoniae L5-2 strain (KCCM12490P) or a polysaccharide isolated therefrom as an active ingredient It relates to a food composition for regeneration or skin moisturizing.

The culture medium of the Klebsiella pneumoniae L5-2 strain or the polysaccharide isolated therefrom is as described above.

The'food composition' is an active ingredient, in addition to the culture medium of Klebsiella pneumoniae L5-2 strain or polysaccharides isolated therefrom, the standards and specifications of foods commonly used in food manufacturing ('Food Code') Food raw materials that can be used as foods described in, and food additives described in the food additive code.

It does not need to be particularly limited, but includes, for example, proteins, carbohydrates, fats, nutrients, flavoring agents and flavoring agents. The carbohydrates include monosaccharides such as glucose and fructose; Disaccharides such as maltose, sugar, lactose, and the like; Oligosaccharides or polysaccharides such as dextrin, starch syrup, cyclodextrin, and the like; Sugar alcohols such as xylitol, sorbitol, erythritol, and the like can be used. The flavoring agent may be a natural flavoring agent [taumatin, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.]) and a synthetic flavoring agent (saccharin, aspartame, etc.).

When preparing a food composition using the culture medium of Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom as an active ingredient, the culture medium of Klebsiella pneumoniae L5-2 strain or isolated therefrom Polysaccharides do not need to be particularly limited as long as they are content exhibiting skin wrinkle improvement, skin barrier improvement, skin inflammation relief, skin regeneration or skin moisturizing effect, but, for example, 0.1 to 99% by weight, 0.5 to 95% by weight, 1 to 90% by weight , 2 to 80% by weight, 3 to 70% by weight, 4 to 60% by weight, may be included in 5 to 50% by weight.

In the food composition, the culture medium of Klebsiella pneumoniae L5-2 strain or the polysaccharide isolated therefrom varies depending on the condition of the ingestor, the weight, the presence or absence of disease, and the duration, but by a skilled person Can be appropriately selected. For example, it may be 1 to 5,000 mg, preferably 5 to 2,000 mg, more preferably 10 to 1,000 mg, even more preferably 20 to 800 mg, most preferably 50 to 500 mg based on the daily dosage. In addition, the number of administrations does not need to be particularly limited, but can be adjusted by a person skilled in the art within the range of 3 times a day to once a week. In the case of long-term intake for the purpose of health and hygiene or for the purpose of health control, it may be less than the above range.

The food composition is not particularly limited, but may be, for example, a powder, a granule, a tablet, a capsule, a pill, an extract, a jelly formulation, a tea bag formulation, or a beverage formulation.

In addition, in order to improve skin damage caused by ultraviolet rays or impart skin moisturizing functionality to general foods, the culture solution of the Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom can be added, and foods that can be added Silver does not need to be particularly limited, for example, confectionery, bread or rice cakes, processed cocoa products or chocolates, meat or egg products, fish meat as exemplified in the standards and standards of food pursuant to Article 7 of the Food Sanitation Act ('Food Code') It can be added to processed products, tofu or jelly, noodles, tea, coffee, beverages, special purpose foods, pastes, seasoned foods, dressings, kimchi, salted fish, pickles, stewed foods, alcoholic beverages, raisins, and other foods. In addition, it may be added to dairy products, processed meat products and packaged meats, and egg products exemplified in the processing standards and ingredient specifications of livestock products according to Article 4 of the Livestock Hygiene Management Act ('Livestock Products Code').

On the other hand, the food composition containing the culture medium of the Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom as an active ingredient alone is "improving skin wrinkles, improving skin barriers, reducing skin inflammation, skin regeneration or skin It can be used as a health functional food that helps for moisturizing.

The'health functional food' refers to a food manufactured (including processing) in accordance with legal standards using raw materials or ingredients having useful functions for the human body (Article 3, No. 1 of the Health Functional Food Act). The'health functional food' may differ in terms or ranges from country to country, but'Dietary Supplement' in the United States,'Food Supplemnet' in Europe,'Health Functional Food' in Japan or ' It may correspond to'Food for Special Health Use (FoSHU)' and'Health Food' in China.

The food composition or health functional food may additionally contain food additives, and the suitability as a food additive shall be determined according to the standards and standards for the relevant item in accordance with the general rules and general test methods of the'Food Additive Code' unless otherwise specified. Follows.

In addition, the health functional food includes the culture medium of the Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom, and "improves skin wrinkles, improves skin barriers, relieves skin inflammation, helps regenerate skin, or moisturizes the skin. Raw materials notified as'functional raw materials' or individually approved raw materials used in "health functional foods that give health benefits", such as honeybush extract, fermented powder, pine bark extract, etc., red ginseng, corn, corn, finger root extract powder, probiotics HY7714, Konjac Potato Extract (Powder), Rice Bran Extract, Jicho Extract Powder, AP Collagen Enzyme Degradation Peptide, Extraction Complexes such as Dandelion, Collactive Collagen Peptide., Low Molecular Collagen Peptide, Corn Embryo Extract, Soybean Barley Fermentation Complex, Wheat Oil Extract, Pomegranate concentrate NAG (Nage, N-acetylglucosamine, N-Acetylglucosamine), spirulina, plants containing chlorophyll, chlorella, phosphatidylserine, hyaluronic acid, aloe gel, and other health functional food materials related to skin health can be used in combination.

The present invention is a feed composition for skin wrinkle improvement, skin barrier improvement, skin inflammation alleviation, skin regeneration or skin moisturizing, comprising a culture medium of Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom as an active ingredient Or it relates to a feed additive composition.

The'feed composition' is a food that can be used as a food described in the standards and standards of food ('Food Code') in addition to the culture medium of Klebsiella pneumoniae L5-2 strain or polysaccharides isolated therefrom as an active ingredient. Ingredients, food additives Ingredients that fall within the scope of the sweetened feed in Attached Table 1 of'Standards and Specifications for Feed, etc.' Raw materials that fall within the range of can be used.

The'feed composition' may be an extractant among auxiliary feeds according to'standards and standards for feed, etc.', and may be a blended feed including the auxiliary feed.

When preparing a feed composition using the culture medium of the Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom as an active ingredient, the active ingredient is to improve skin wrinkles by ultraviolet rays, improve skin barrier, relieve skin inflammation, The content showing skin regeneration or skin moisturizing effect does not need to be particularly limited, but, for example, 0.1 to 99% by weight, 0.5 to 95% by weight, 1 to 90% by weight, 2 to 80% by weight, 3 to 70% by weight, It may be included in 4 to 60% by weight and 5 to 50% by weight.

The culture medium of the Klebsiella pneumoniae L5-2 strain, or the polysaccharide isolated therefrom, which is an active ingredient in the feed composition, varies depending on the condition, weight, and the presence or absence of disease, and the duration of the ingesting animal, but a person skilled in the art Can be appropriately selected by For example, it may be 1 to 5,000 mg, preferably 5 to 2,000 mg, more preferably 10 to 1,000 mg, even more preferably 20 to 800 mg, most preferably 50 to 500 mg based on the daily dosage. In addition, the number of administrations does not need to be particularly limited, but can be adjusted by a person skilled in the art within the range of 3 times a day to once a week. In the case of long-term intake for the purpose of health and hygiene or for the purpose of health control, it may be less than the above range.

Another aspect of the present invention relates to a pharmaceutical composition for skin regeneration, skin inflammation treatment or prevention, comprising a culture medium of Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom as an active ingredient.

In addition, the present invention relates to an oral animal pharmaceutical composition for skin regeneration, treatment or prevention of skin inflammation, comprising as an active ingredient a culture medium of Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom.

In addition, the present invention provides a method for treating skin regeneration and skin inflammation in which the composition is orally administered to humans or animals other than humans.

In addition, the present invention provides a novel use of a culture medium of Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom for the manufacture of a drug for skin regeneration, skin inflammation treatment, or an animal drug by ultraviolet rays. .

In addition to the culture medium of Klebsiella pneumoniae L5-2 strain or polysaccharides isolated therefrom, the'pharmaceutical composition','medicine','animal pharmaceutical composition'or'animalmedicine' is an active ingredient. It may further include suitable carriers, excipients, and diluents commonly used in the preparation of compositions and the like.

The'carrier' is a compound that facilitates the addition of the compound into cells or tissues. The'diluent' is a compound that is diluted in water to dissolve the compound as well as stabilize the biologically active form of the target compound.

The carrier, excipient, and diluent do not need to be particularly limited, but for example, lactose, glucose, sugar, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose , Methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.

The pharmaceutical composition, medicament, veterinary pharmaceutical composition or veterinary medicament may be individually administered as a prophylactic or therapeutic agent, or may be administered in combination with other therapeutic agents, and may be administered sequentially or simultaneously with a conventional therapeutic agent.

The pharmaceutical composition, medicine, veterinary pharmaceutical composition, or veterinary drug may be formulated and used in oral dosage forms such as powders, granules, tablets, capsules, troches, suspensions, emulsions, syrups, aerosols, etc., respectively, according to conventional methods. have. In the case of formulation, it can be prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.

The formulation of the pharmaceutical composition may be granules, powders, tablets, external preparations for skin, capsules, suppositories, solutions, syrups, juices, suspensions, emulsions, drops, or injectable solutions. For example, for formulation in the form of a tablet or capsule (oral preparation), the active ingredient may be combined with an oral, non-toxic pharmaceutically acceptable inert carrier such as ethanol, glycerol, water, and the like. In addition, if desired or necessary, suitable binders, lubricants, disintegrants and coloring agents may also be included in the mixture. Suitable binders are, but are not limited to, natural sugars such as starch, gelatin, glucose or beta-lactose, corn sweeteners, natural and synthetic gums such as acacia, lacquercanth or sodium oleate, sodium stearate, magnesium stearate, sodium Benzoate, sodium acetate, sodium chloride, and the like. Disintegrants include, but are not limited to, starch, methyl cellulose, agar, bentonite, xanthan gum, and the like.

As acceptable pharmaceutical carriers for compositions formulated as liquid solutions, sterilization and biocompatible, saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and One or more of these components may be mixed and used, and other conventional additives such as antioxidants, buffers, and bacteriostatic agents may be added as necessary. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to prepare injectable formulations such as aqueous solutions, suspensions, emulsions, etc., pills, capsules, granules, or tablets.

Furthermore, it can be preferably formulated according to each disease or ingredient using a method disclosed in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA as an appropriate method in the field.

The pharmaceutical composition or veterinary pharmaceutical composition of the present invention can be administered orally or parenterally, and in the case of parenteral administration, it can be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, transdermal administration, etc., preferably Is oral administration.

The amount of use of the pharmaceutical composition, medicament, veterinary pharmaceutical composition or veterinary medicament may vary depending on the age, sex, and weight of the patient or the animal to be treated, and above all, the condition of the subject to be treated, a specific category of the disease to be treated, or It will depend on the type, route of administration and the nature of the therapeutic agent used.

The pharmaceutical composition, medicament, veterinary pharmaceutical composition or veterinary medicament is appropriately selected according to the absorption of the active ingredient in the body, the excretion rate, the age and weight, sex and condition of the patient or the animal to be treated, and the severity of the disease to be treated. , In general, it is preferred to administer 0.1 to 1,000 mg/kg per day, preferably 1 to 500 mg/kg, more preferably 5 to 250 mg/kg, and most preferably 10 to 100 mg/kg. The unit dosage form formulation thus formulated may be administered several times at regular time intervals as needed.

The pharmaceutical composition or veterinary pharmaceutical composition of the present invention may be prepared in unit dosage form by formulation using a pharmaceutically acceptable carrier and/or excipient, or may be prepared by incorporating it into a multi-dose container. At this time, the formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, granule, tablet or capsule, and may additionally include a dispersant or a stabilizer.

In addition, the present invention is a method for improving, preventing or treating skin regeneration or skin inflammation comprising administering to a mammal an effective amount of a culture medium of Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom. Provides.

The term "mammal" as used herein refers to a mammal that is the subject of treatment, observation or experimentation, and preferably refers to a human.

The term "effective amount" as used herein refers to an amount of an active ingredient or pharmaceutical composition that induces a biological or medical response in a tissue system, animal or human, which is considered by a researcher, veterinarian, doctor or other clinician, which Contains an amount that induces relief of the. The effective amount and the number of administrations for the active ingredient of the present invention may vary depending on the desired effect. Therefore, the optimal dosage to be administered can be easily determined by those skilled in the art, and the skin condition, the degree of skin cell regeneration, the degree of inflammation, the degree of pilaggrin expression, the amount of collagen expressed in the skin or the degree of skin elasticity, the effective contained in the composition Depending on various factors, including the content of ingredients and other ingredients, the type of formulation, and the patient's age, weight, general health status, sex and diet, administration time, route of administration and secretion rate of the composition, treatment period, and drugs used simultaneously Can be adjusted. In the prevention, treatment, or improvement method of the present invention, in the case of an adult, when the composition is administered once to several times a day, it is preferable to administer the composition in a dose of 0.001 g/kg to 10 g/kg, and more preferably It may be administered in a dose of 0.1 g / kg to 10 g / kg.

In the treatment method of the present invention, the composition containing the active ingredient of the culture medium of the Klebsiella pneumoniae L5-2 strain or a polysaccharide isolated therefrom is oral, rectal, intravenous, intraarterial, intraperitoneal, muscle It can be administered in a conventional manner through an internal, intrasternal, transdermal, topical, intraocular or intradermal route, preferably oral or transdermal.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for describing the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

<Example 1> Klebsierra pneumoniae ( Klebsiella pneumoniae ) L5-2 strain isolation and culture

The present inventors selected and isolated the Klebsiella pneumoniae L5-2 strain from feces of infants under 7 years old (Korean nationality) in order to find a non-toxic strain showing a useful effect on the skin, and this It was deposited with the Microbial Conservation Center (KCCM) on April 16, 2019, and was given the deposit number KCCM12490P.

At this time, the medium was 10.0 g peptone, 4.0 g of meat extract, 3.0 g sodium acetate, 1.0 g KH ₂ PO ₄ , 1.0 g yeast extract, 1.9 g ammonium citrate, 1.0 g skim milk, 0.1 g MgSO ₄ , 0.05 g MnSO ₄ , 1.0 ml of Tween-80 (Sigma-Aldrich, St. Louis, MO, USA) and 1 L of selective LC medium containing 15 g agar (Junsei Chemical Co., Tokyo, Japan) were prepared and used [Ravula RR , Shah NP (1998) Selective enumeration of Lactobacillus casei from yogurts and fermented milk drinks. Biotechnol Tech 12:819-822]. The pH was adjusted to 7.0 ㅁ 0.2, and the bacteria were incubated under anaerobic conditions at 37°C for 48 hours.

The Klebsiella pneumoniae subsp.ozaenae ATCC 11296 strain was used as a comparative control for the Klebsiella pneumoniae L5-2 strain, and was distributed from Leibniz Institute DSMZ (Braunschweig, Germany). Used. Klebsiella pneumoniae ( Klebsiella pneumoniae ) L5-2 strain and ATCC 11296 strain were stored in 20% glycerol at -80 ℃.

<Example 2> Klebsierra pneumoniae ( Klebsiella pneumoniae ) Polysaccharide extraction from L5-2 strain

A culture solution of the Klebsiella pneumoniae L5-2 strain obtained from Example 1 was prepared. The culture solution was treated with 0.1% (w/v) proteolytic enzyme (preotease) and reacted for 30 minutes at pH 7.5 and 65° C., and then 3% (w/v) NaCl was added thereto and sufficiently dissolved while stirring, The supernatant was obtained by centrifugation. After adding 1.5 parts by weight of ethanol based on the total 1 part by weight of the obtained supernatant, it was stored at 4° C. for 4 hours, and a precipitate was obtained. The precipitate was re-dissolved to a concentration of 1% in distilled water, and 0.5% (w/v) of activated carbon was treated thereto, and then the activated carbon was removed with a filter paper, and then 3% (w/v) NaCl was added thereto and sufficiently stirred. Dissolved and centrifuged to obtain a supernatant. After adding 1.5 parts by weight of ethanol based on the total 1 part by weight of the supernatant, the mixture was stored at 4° C. for 4 hours, and a precipitate was obtained and dried under vacuum at 50° C. overnight to recover polysaccharides.

<Test Example 1> 16S rRNA of the strain and analysis of the phylogenetic tree using the same

1) 16S rRNA analysis

Sequence analysis of the 16S rRNA gene sequence of the Klebsiella pneumoniae L5-2 strain isolated from Example 1 [Kim OS, Cho YJ, Lee K, Yoon H, Kim M et al (2012) Introducing EzTaxon -e: a prokaryotic 16S rRNA gene sequence database with phylotypes that represent uncultured species. Int J Syst Evol Microbiol 62:716-721], was calculated using NCBI and ExBioCloud databases. Table 1 summarizes by calculating homology with the 16S rRNA sequence of Klebsiella pneumoniae L5-2 strain identified through the above method. At this time, the completeness is to create a complete 16S rRNA sequence database by separately collecting sequences containing all regions from the entire 16S rRNA sequence database to the Universal Primer (27F, 1492R) of the 16S rRNA sequence, and match and match the sequences. Completeness was calculated by calculating how many sequences were deleted in front/rear of the database sequence by alignment.

Strain EzBioCloud NCBI Similarity
(Similarity, %) completeness
(completeness, %) sameness
(Identity, %) Query coverage
(Query cover, %) Klebsierra pneumoniae subsp. ozaenae ATCC 11296 99.79 99.3 99 93 Klebsiella pneumoniae subsp.rhinoscleromatis ATCC 13884 99.59 100 99 92 Klebsierra pneumoniae ( K. pneumoniae) W14 98.09 93.8 - -

*-: not detected

As shown in Table 1, Klebsiella pneumoniae ( Klebsiella pneumoniae ) L5-2 strain in the EzBioCloud database was confirmed to exhibit the highest similarity to the Klebsiella pneumoniae subsp. ozaenae ( Klebsiella pneumoniae subsp. ozaenae ) ATCC 11296 strain in the EzBioCloud database. However, it did not have 100% homology (99.79%). Therefore, Klebsiella pneumoniae subsp. ozaenae ( Klebsiella pneumoniae subsp. ozaenae ) ATCC 11296 strain was selected as a comparative control for comparing the performance and effect of the present invention.

2) Schematic analysis

The phylogenetic tree was analyzed based on the 16S rRNA gene base sequence. Phylogenetic analysis of the Klebsiella pneumoniae L5-2 strain isolated from Example 1 was performed using MEGA 6, and a neighboring junction method using 1000 bootstraps (Tamura et al., 2013). (neighbor-joining method) was used to construct a phylogenetic tree.

The mean nucleotide identity (ANI) values were evaluated for evolutionary distance using the pyani version 0.2.7 program with the option "-m ANIb" (Pritchard et al. 2016). Using EzBioCloud, an online taxon search tool, the 16S rRNA gene sequence of the Klebsiella pneumoniae L5-2 strain and the Klebsiella pneumoniae subsp. ozaenae ATCC 11296 strain was confirmed.

Keulrep Sierra pneumoniae to Rioja INC (Klebsiella pneumoniae subsp. Ozaenae) ATCC 11296 strain, keulrep Sierra pneumoniae rinoseu Cle to Mathis (Klebsiella pneumoniae subsp. Rhinoscleromatis) ATCC 13884 strain, keulrep Sierra pneumoniae (Klebsiella pneumoniae subsp. Pneumoniae ) HS11286 strain, Klebsiella pneumoniae ( Klebsiella pneumoniae ) TH1 strain and Klebsiella pneumoniae ( Klebsiella pneumoniae ) W14 strain of the entire or draft genome sequence of the NCBI Genome Database http://www.ncbi.nlm.nih.gov /genom e /; accession; GCF_000163455 (ATCC 13884); GCF_000240185 (HS11286); GCF_001676825 (TH1); GCF_001646625(W14)].

Figure 1A is a schematic diagram of the Klebsiella pneumoniae L5-2 strain based on the 16S rRNA sequence, and Figure 1B is the average nucleotide identity (ANI) of the Klebsiella pneumoniae L5-2 strain This is a graph showing the value analysis.

1A and B, Klebsiella pneumoniae ( Klebsiella pneumoniae ) L5-2 strain and Klebsiella pneumoniae subsp. ozaenae ( Klebsiella pneumoniae subsp. ozaenae ) ATCC 11296 strain was confirmed evolutionary relationship. As a result, ANI values were found to vary from 98.8 to 99%.

<Test Example 2> Klebsierra pneumoniae ( Klebsiella pneumoniae ) Analysis of the whole genome sequence (Genome sequencing), genome assembly (Genome assembly) and genome information (Genome annotation) of L5-2 strain

Genomic DNA was extracted from the Klebsiella pneumoniae L5-2 strain using the QIAmp DNA Mini kit (Qiagen, Hilden, Germany), and the amount and quality of the DNA were measured with a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA). , USA) and a Qubit 2.0 fluorescence meter (Life Technologies, Carlsbad, CA, USA).

Whole genome sequencing was performed using the PacBio RS II platform. Specifically, a 10-kb DNA library was constructed and the entire genome sequence was analyzed by single-molecule real-time sequencing technology using P6-C4 chemistry (Pacific Biosciences, Menlo Park CA, USA). Sequence reading was performed using HGAP 4.0 (Pacific Biosciences) with a genome size option of 5.3Mb. Information on each gene function (annotation) was performed by PGAAP (Prokaryotic Genome Annotation Pipeline) of the National Center for Biotechnology Information (NCBI) [Tatusova T, Di Cuccio M, Badretdin A, Chetvernin V, Nawrocki EP et al (2016) NCBI prokaryotic genome annotation pipeline. Nucleic Acids Res 44:6614-6624].

Genes involved in acetate production were identified using the information described in PGAAP. In addition, the acetate metabolic pathway was analyzed by Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis [Kanehisa M, Furumichi M, Tanabe M, Sato Y, Morishima K (2017) KEGG: new perspectives on genomes, pathways, diseases and drugs. Nucleic Acids Res 45:D353-D361] was used for prediction. DNA plotter (Carver T, Thomson N, Bleasby A, Berriman M, Parkhill J (2009) DNA Plotter: circular and linear interactive genome visualization. Bioinformatics 25:119-120] was used to generate a genomic map, and genome topology was examined.

As a result, the complete genome sequence of the Klebsiella pneumoniae L5-2 strain was obtained with 170-fold coverage, and the total genome size was 5,376,334 bp and the GC content was confirmed to be 57.27%. Sierra pneumoniae ( Klebsiella pneumoniae ) L5-2 strain was named, and the entire sequence was deposited with the National Center for Biological Information (NCBI) access number CD_025683~025684 (https://www.ncbi.nlm.nih.gov/ nuccore/CP025683.1~CP025684.1/).

The results are shown in Table 2 and FIG. 2. Table 2 summarizes the genomes of the Klebsiella pneumoniae L5-2 strain and the Klebsiella pneumoniae subsp. ozaenae ATCC 11296 strain. In Table 2 below, CDS is a coding sequence, CRISPR is clustered regularly interspaced short palindromic repeats, ncRNA is non-coding RNA, rRNA is ribosomal RNA, and tRNA is transfer RNA.

2 is a complete circular genomic map of Klebsiella pneumoniae L5-2 strain. Figure 2A is a chromosome and Figure 2B is a plasmid. 'Track 1'indicated in light blue on the figure is the forward coding sequence (CDS),'Track 2'indicated in blue is the reverse CDS, and'Track 3'indicated in light purple is rRNA (5S, 16S and 23S), 'Track 4'in green is tRNA,'Track 5'in red is CRISPRs area, and'Track 6'in bright green and purple is the GC content area. Also,'Track 7', shown in bright green and purple, is the GC skew.

Characteristic Klebsiella pneumoniae L5-2 Klebsiella pneumoniae subsp.ozaenae ATCC 11296 genome Accessiion CP025683 GCA_000826585.2 Assembly level Complete Scaffold Sequence category 1 Chromosome, 1 plasmid 23 Scaffolds Total size 5,376,334 4,944,477 GC content 57.27 57.26 Annotation Genes 5341 5014 CDS 5217 4937 Coding genes 5062 4433 Pseudogenes 155 504 RNAs 124 77 rRNAs (5S, 16S, 23S) 25(9, 8, 8) 3(1, 1, 1) tRNAs 87 64 ncRNAs 12 10 Repeat region 0 2 CRISPRs 0 2 misc_feature 0 0

As shown in Table 2 and Figure 2, Klebsiella pneumoniae L5-2 strain has two contigs of a single circular chromosome (5,237,123 bp) and a single circular plasmid (139,211 bp), and a total There were 5341 genes, which were found to contain 5067 protein-coding genes, 155 pseudogenes, and 124 RNA genes (25 rRNA, 87 tRNA, 12 uncoated RNA). The assembly level of the Klebsiella pneumoniae subsp. ozaenae ATCC 11296 strain was in the form of the scaffold genome.

<Test Example 3> Klebsierra pneumoniae ( Klebsiella pneumoniae ) Classification of genome function of L5-2 strain

Genomic information of the Klebsiella pneumoniae L5-2 strain selected in Example 1 was functionally classified. Protein-coding genes were functionally classified according to the definition of a cluster of orthologous group (COG), and summarized in Table 3.

CODE COG functional description L5-2 ATCC 11296 J Translation, ribosomal structure, and biogenesis 272 272 A RNA processing and modification One One K Transcription 488 421 L Replication, recombination, and repair 150 175 B Chromatin structure and dynamics One One D Cell cycle control, cell division, and chromosome partitioning 51 52 Y Nuclear structure 0 0 V Defense mechanisms 122 110 T Signal transduction mechanisms 238 195 M Cell wall/membrane/envelope biogenesis 278 256 N Cell motility 78 50 Z Cytoskeleton One One W Extracellular structures 49 27 U Intracellular trafficking, secretion, and vesicular transport 77 63 O Posttranslational modification, protein turnover, and chaperones 196 165 X Mobilome: prophages and transposons 42 128 C Energy production and conversion 292 262 G Carbohydrate transport and metabolism 573 512 E Amino acid transport and metabolism 508 468 F Nucleotide transport and metabolism 100 96 H Coenzyme transport and metabolism 242 235 I Lipid transport and metabolism 160 127 P Inorganic ion transport and metabolism 354 326 Q Secondary metabolites biosynthesis, transport, and catabolism 136 111 R General function prediction only 431 388 S Function unknown 251 234 - NA 636 838

As shown in Table 3, based on the COG (Cluster of orthologous group), a search-oriented database that compares to find orthologous genes, the Klebsiella pneumoniae L5-2 strain isolated from Example 1 The function of each gene was confirmed on the full-length genome. And Klebsiella pneumoniae subsp. ozaenae ( Klebsiella pneumoniae subsp. ozaenae ) was compared with the ATCC 11296 strain.

As a result, Klebsiella pneumoniae ( Klebsiella pneumoniae ) L5-2 strain and Klebsiella pneumoniae subsp. ozaenae ( Klebsiella pneumoniae subsp. ozaenae ) ATCC 11296 strain isolated from Example 1 is "nuclear structure (Y)"(" It was confirmed that 25 out of 26 COG function codes excluding nuclear structure (Y)) were applicable.

Overall, Klebsiella pneumoniae ( Klebsiella pneumoniae ) L5-2 strain and Klebsiella pneumoniae subsp.ozaenae ( Klebsiella pneumoniae subsp.ozaenae ) in ATCC 11296 strain, respectively, 5091 and 4676 genes in the COG code, isolated from Example 1 It was classified, but it was confirmed that 636 and 838 genes, respectively, did not correspond.

"Signal transduction mechanisms (T)", "Extracellular structures (W)", "Intracellular trafficking, secretion and vesicle transport (U)" and "Secondary metabolite biosynthesis, transport and catabolism"("Signal transduction mechanisms ( T)", "Extracellular structures (W)", "Intracellular trafficking, secretion, and vesicular transport (U)", and "Secondary metabolites biosynthesis, transport, and catabolism (Q)") in 18 COG categories. It was confirmed that the Klebsiella pneumoniae ( Klebsiella pneumoniae ) L5-2 strain isolated from Example 1 had more genes than the Klebsiella pneumoniae subsp.ozaenae ( Klebsiella pneumoniae subsp.ozaenae ) ATCC 11296 strain.

Klebsiella pneumoniae subsp.ozaenae ATCC 11296 strain has been reported to have a total assembly gap length of 19,227 bp, 23 scaffolds and 128 contigs (contigs) (https: / /www.ncbi.nlm.nih.gov/assem bly/GCF_00082 6585.2).

Taken together, the Klebsiella pneumoniae ( Klebsiella pneumoniae ) L5-2 strain isolated from Example 1 on the full-length genome has a clear difference from the Klebsiella pneumoniae subsp. ozaenae ( Klebsiella pneumoniae subsp. ozaenae ) ATCC 11296 strain. And it was found.

<Test Example 4> Klebsierra pneumoniae ( Klebsiella pneumoniae ) Growth analysis of L5-2 strain

Klebsiella pneumoniae ( Klebsiella pneumoniae ) L5-2 strain and Klebsiella pneumoniae ( K. pneumoniae subsp. ozaenae ) ATCC 11296 strain TSA (tryptic soy agar) solid medium (17.0) containing 0.5% glucose (17.0) g/L pancreatic digest of casein, 3.0 g/L papaic digest of soybean, 2.5 g/L dextrose, 5.0 g/L sodium chloride, 2.5 g/L dipotassium phosphate (BD Biosciences, Franklin Lakes, NJ, USA), and 15 g/L bacteriological agar) was incubated in a shaking incubator at 37°C for 24 hours. The growth of the strain was analyzed by measuring OD _600nm in a 96-well plate using a SpectraMax i3 spectrophotometer (Molecular Devices, Sunnyvale, CA, USA). The experiment was repeated 3 times.

Figure 3 is a graph showing the measurement of the growth curve of Klebsiella pneumoniae ( Klebsiella pneumoniae ) L5-2 strain and Klebsiella pneumoniae subsp. ozaenae ( Klebsiella pneumoniae subsp. ozaenae ) ATCC 11296 strain isolated from Example 1 . Specifically, Figure 3 shows the Klebsiella pneumoniae ( Klebsiella pneumoniae ) L5-2 strain and the Klebsiella pneumoniae ( Klebsiella pneumoniae subsp. ozaenae ) ATCC 11296 strains isolated from Example 1, respectively, 2 hours from the start of cultivation. It is a growth curve measured in units.

As shown in Figure 3, the Klebsiella pneumoniae ( Klebsiella pneumoniae ) L5-2 strain isolated from Example 1 continued to grow better than the Klebsiella pneumoniae subsp. ozaenae ( Klebsiella pneumoniae subsp. ozaenae ) ATCC 11296 strain . Confirmed that.

<Test Example 5> Klebsierra pneumoniae ( Klebsiella pneumoniae ) Analysis of polysaccharide production ability derived from L5-2 strain

A polysaccharide derived from Klebsiella pneumoniae L5-2 strain prepared from Example 2 was isolated. Analysis of monosaccharide components of polysaccharides was performed by requesting Biocorp. Specifically, after performing acid hydrolysis, the filtered sample solution was lyophilized, and monosaccharide component analysis was performed using high performance anion exchange chromatography pulsed with amperometric detection (HPAEC-PAD). The results are shown in Table 4 below.

Polysaccharide (mg/g) L5-2 std.error Fucose N/D - Rhamnose 0.19 0.02 Arabinose 0.62 0.01 Galactose 119.43 0.21 Glucose 281.27 0.32 Mannose 180.27 0.49 Xylose 0.00 0.00 Galacturonic acid 1.36 0.05 Glucuronic acid 72.96 0.30

As shown in Table 4, a large amount of constituent monosaccharides were detected in the polysaccharide derived from Klebsiella pneumoniae L5-2 strain, through which the polysaccharide derived from Klebsiella pneumoniae L5-2 strain was constituent monosaccharide. Rhamnose, Arabinose, Galactose, Glucose, Mannose, Xylose, Galacturonic acid, and Glucuronic acid. It was confirmed to contain.

<Test Example 6> Functional classification and identification of genes encoding virulence factors.

Coding genes were sorted into a cluster of the Orthologous Groups (COG) database using BLASTP (E value cut-off: 1e-5), and classified according to the COG (Cluster of orthologous group) category [Galperin MY, Makarova KS, Wolf YI, Koonin EV (2015) Expanded microbial genome coverage and improved protein family annotation in the COG database. Nucleic Acids Res 43:D261-D269].

Among these, the database of pathogenic bacteria [Chen L, Yang J, Yu J, Yao Z, Sun Y et al (2005) VFDB: a reference database for bacterial virulence factors. Nucleic Acids Res 33:D325-D328 Chen L, Zheng D, Liu; Chen L, Zheng D, Liu B, Yang J, Jin Q (2016) VFDB 2016: hierarchical and refined dataset for big data analysis-10 years on. Nucleic Acids Res 44:D694-D697] was used to search for a gene encoding a virulence factor, and it was investigated based on the following criteria and shown in Table 5: Protein identity is at least 80%. , The coverage is at least 80%, and the alignment length is at least 50 bp.

In Table 5, L5-2 is a Klebsiella pneumoniae ( Klebsiella pneumoniae ) L5-2 strain isolated from Example 1, HS 11286 is a Klebsiella pneumoniae ( Klebsiella pneumoniae subsp. pneumoniae ) HS11286 strain, and TH1 is a Klebsiella pneumoniae strain. Sierra pneumoniae ( Klebsiella pneumoniae ) TH1 strain, W14 is Klebsiella pneumoniae ( Klebsiella pneumoniae ) W14 strain, ATCC 11296 is Klebsiella pneumoniae subsp. ozaenae ( Klebsiella pneumoniae subsp. ozaenae ) ATCC 11296 strain, ATCC 13884 is Klebsiella pneumoniae subsp. rhinoscleromatis ATCC 13884.

virulence gene ID L5-2 ATCC 11296 HS11286 ATCC 13884 TH1 W14 Type 1 fimbriae (VF0221) 5 0 5 4 5 5 LOS(CVF494) One One One One One One OmpA(VF0236) One One One One One One Enterobactin(VF0228) 8 8 8 0 8 8 Enterobactin (IA019) One One One 0 One One ECP(VF0404) 6 0 6 6 6 6 Aerobactin (VF0123) 0 2 0 2 0 0 Tersiniabactin (VF0136) 0 2 11 12 11 11 Aerobactin (VF0229) 0 3 0 3 0 0

In general, Klebsiella pneumoniae strain is a fungal bacteria present in the oral cavity, skin, and intestines. Klebsiella pneumoniae strain is an opportunistic infectious bacteria and is a major causative agent of acute pneumonia. In particular, the problem of infection in the hospital is rising seriously. According to Table 6, it was confirmed that the Klebsiella pneumoniae L5-2 strain had far fewer genes encoding pathogenic factors than the Klebsiella pneumoniae subsp. ozaenae ATCC 11296 strain. Specifically, aerobactin (VF0123), yersiniabactin (VF0136) and aerobactin (VF0229) were found only in Klebsiella pneumoniae subsp. ozaenae ATCC 11296 strain. In contrast, in the Klebsiella pneumoniae L5-2 strain isolated from Example 1, 5 genes encoding type 1 fimbriae (VF0221) and 6 genes encoding Escherichia coli common pilus (ECP; VF0404) Only was searched.

Klebsiella pneumoniae subsp.ozaenae ATCC 11296 strain is isolated from the soil, whereas Klebsiella pneumoniae ( Klebsiella pneumoniae ) L5-2 strain is isolated from the feces of infants. It is believed that genetic differences have appeared.

Prior keulrep Sierra pneumoniae (Klebsiella pneumoniae) L5-2 strain, as shown in Table 5, since there is no other keulrep Sierra pneumoniae (Klebsiella pneumoniae) virulence factors than the strain body is present, keulrep Sierra pneumoniae (Klebsiella pneumoniae) It can be seen that the L5-2 strain does not act as a pathogen in the human body.

Among the genes found in the Klebsiella pneumoniae L5-2 strain, Type 1 fimbriae is a gene that regulates and enhances the adhesion of bacterial cells to the host, and ECP is also an adhesion factor. Therefore, the genes found in the Klebsiella pneumoniae L5-2 strain correspond to evolutionarily adaptation to exist in the intestine, but do not exhibit toxicity factors.

Together, keulrep Sierra pneumoniae (Klebsiella pneumoniae) L5-2 strain to be isolated from the feces / under Chapter VII of the infant, it was confirmed that the acetate produced through fermentation, common keulrep Sierra pneumoniae (Klebsiella pneumoniae ), unlike the strain, did not have a toxic factor, so it was confirmed that it is a stable microorganism that does not act as a pathogenic microorganism.

<Test Example 7> Cytotoxicity analysis

1) Cell line culture

HDFa, a human dermal fibroblast, was used as the cell line used for cytotoxicity evaluation and wrinkle improvement. Media106 medium was used as the medium and culture conditions used, and culture was performed using an incubator under conditions of 37°C and 5% CO ₂ .

2) Cytotoxicity analysis (MTT)

In order to confirm the cytotoxicity to the polysaccharide obtained from Example 2, the polysaccharide of Example 2 was added to 1 ml Media106 medium, and the final concentration was 0, 0.1, 0.5, 1, 5, 10 and 20% (w/v ) To be a polysaccharide to prepare a mixed medium.

The HDFa cell lines were aliquoted into a 96-well plate at 1×10 ⁴ cells/ml, respectively, and then cultured for 18 hours at 37°C and 5% CO ₂ . After removing the medium and washing with PBS, mixed medium was added and cultured for 18 hours. In order to measure the viability of cells, MTT solution (5 mg/ml) was added, and fomazan formed for 4 hours was dissolved in DMSO, and the absorbance was measured.

sample Use concentration (%, w/v) Cell viability (%) Polysaccharide derived from the Klebsiella pneumoniae L5-2 strain of Example 2 0 100.00 0.1 110.62±2.09 0.5 109.03±2.52 One 103.48±2.82 5 109.74±0.32 10 106.51±4.86 20 109.32±7.34

As shown in Table 6, MTT analysis was performed to confirm the cytotoxicity of the sample, and as a result, polysaccharides derived from Klebsiella pneumoniae L5-2 strain prepared from Example 2 were all regardless of concentration. The survival rate of HDFa cells was confirmed to be 80% or more. Therefore, it can be seen that not only the Klebsiella pneumoniae L5-2 strain but also polysaccharides do not exhibit cytotoxicity against human dermal fibroblast HDFa cells.

<Test Example 8> Wrinkle improvement and skin barrier effect

1) Cell line culture

The cell line used to confirm the anti-wrinkle effect was HDFa, a human dermal fibroblast, and the cell line used to evaluate the effect of strengthening the skin barrier was HEKa, a human keratinocyte. As the medium and culture conditions used, the HDFa cell line was used as Media106, and the HEKa cell line was cultured using a DMEM media at 37° C. and 5% CO _{2 in} an incubator.

2) collagen expression rate

In order to confirm the wrinkle improvement and skin barrier efficacy for the polysaccharide obtained from Example 2, the polysaccharide of Example 2 was added to 1 ml Media106 medium, and the final concentration was 0, 0.1, 0.5, 1, 5, 10 and 20%. A mixed medium was prepared by making it a polysaccharide of (w/v).

The HDFa cell lines were aliquoted into a 96-well plate at 1×10 ⁴ cells/ml, respectively, and then cultured for 18 hours at 37°C and 5% CO ₂ . The medium was removed, washed with PBS, mixed medium was added, and cultured for 18 hours. As a positive control, 50 μM of Retinol palmitate was added as a new medium.

After removing the medium from each HDFa cell, total RNA was extracted using Trizol reagent (Invitrogen, USA). After quantifying each RNA amount using Nanodrop 2000 (Thermo, USA), cDNA was synthesized by reacting at 42°C for 55 minutes and 70°C for 15 minutes (Reverse Transcriptase Mix, ELPIS biotech, Korea). Changes in collagen expression using cDNA were confirmed using RT-PCR. PCR was performed on the Col1A1 gene in RT-PCR, and the primer information is as follows.

Forward primer of Col1A1 gene: AGGGCCAAGACGAAGACATC

Reverse primer of Col1A1 gene: AGATCACGTCATCGCACAACA

PCR reaction was carried out with 0.2 μM primers, 50 mM KCl, 20 mM Tris/HCl pH 8.4, 0.8 mM dNTP, 0.5U Extaq DNA polymerase, 3 mM MgCl2, 5X green Go Taq flexi buffer. After denaturation, the processes of denaturation, anealing, and polymeration were repeated 40 cycles under conditions of 94°C for 30 seconds, 58°C for 30 seconds, and 72°C for 30 seconds, respectively. The PCR product was subjected to electrophoresis on a 1.2% agarose gel and then analyzed and shown in Table 7.

sample Use concentration (%, w/v) Collagen expression rate
(% of control) Control 0 100.00 Polysaccharide derived from the Klebsiella pneumoniae L5-2 strain of Example 2 0.5 185.52±4.1 One 205.15±8.0 2 203.57±4.7 4 224.58±2.0 Retinol palmitate 50 μM 265.87±1.2

Among the components that make up the connective tissue of skin cells, collagen is an important constituent protein that accounts for about 90% and gives strength and tension to the skin by maintaining the skin's connective tissue. Collagen is widely used for enhancing skin elasticity and moisture. In the present invention, the anti-wrinkle effect was also verified, and it was attempted to confirm whether collagen was expressed in fibroblasts. As shown in Table 7, it was confirmed that the expression of the collagen gene was significantly increased by 1.8 to 2 times or more when the polysaccharide derived from the Klebsiella pneumoniae L5-2 strain of Example 2 was treated. That is, it was confirmed that it has the effect of enhancing collagen expression from the polysaccharide derived from the Klebsiella pneumoniae L5-2 strain of Example 2, and it can be seen that it can be used to improve, prevent, or treat wrinkles on the skin. .

3) Skin barrier strengthening effect

The skin barrier protein is an important component of the skin structure and plays an important role in blocking foreign antigens from entering the body. Skin barrier proteins include filaggrin, involucrin, and loricrin, and filaggrin (filament aggregating protein) aggregates keratin filaments in keratinocytes to prevent skin barriers. It is known to play an important role in

Therefore, in this experiment, in order to confirm the skin barrier strengthening effect of the polysaccharide derived from the Klebsiella pneumoniae L5-2 strain of Example 2, it was attempted to confirm the expression of filaggrin.

The HEKa cell lines were aliquoted into a 96-well plate at 1×10 ⁴ cells/ml, respectively, and cultured for 18 hours at 37°C and 5% CO ₂ . The medium was removed, washed with PBS, mixed medium was added, and cultured for 18 hours. The mixed medium was prepared by adding the polysaccharide of Example 2 to 1 ml Media106 medium in order to confirm the wrinkle improvement and skin barrier effect on the polysaccharide obtained from Example 2, and the final concentration was 0.5, 1, 2 and 4% (w/ It is prepared to become a polysaccharide of v).

As a positive control (CaCl ₂ ), 10 mM CaCl _{2 was} added instead of the L5-2 strain as a new medium. Nothing was treated as a negative control (con), and CaCl ₂ was treated with 10 mM CaCl ₂ as a positive control.

After removing the medium from each HEKa cell, total RNA was extracted using Trizol reagent (Invitrogen, USA). After quantifying each RNA amount using Nanodrop 2000 (Thermo, USA), cDNA was synthesized by reacting at 42°C for 55 minutes and 70°C for 15 minutes (Reverse Transcriptase Mix, ELPIS biotech, Korea). Changes in collagen expression using cDNA were confirmed using RT-PCR. In RT-PCR, PCR was performed on the Filaggrin gene, and the primer information is as follows.

Forward primer of Filaggrin gene: GGCACTGAAAGGCAAAAAGG

Reverse primer of Filaggrin gene: AAACCCGGATTCACCATAATCA

PCR reaction was carried out with 0.2 μM primers, 50 mM KCl, 20 mM Tris/HCl pH 8.4, 0.8 mM dNTP, 0.5U Extaq DNA polymerase, 3 mM MgCl2, 5X green Go Taq flexi buffer. After denaturation, the processes of denaturation, anealing, and polymeration were repeated 40 cycles under conditions of 94°C for 30 seconds, 58°C for 30 seconds, and 72°C for 30 seconds, respectively. The PCR product was subjected to electrophoresis on a 1.2% agarose gel, and then analyzed and shown in Table 8.

sample Use concentration (%, w/v) Filaggrin expression rate
(% of control) Control 0 100.00 Polysaccharide derived from the Klebsiella pneumoniae L5-2 strain of Example 2 0.5 124.48±7.3 One 126.43±7.3 2 153.55±5.5 4 160.17±9.6 CaCl ₂ 10mM 186.54±7.7

As shown in Table 8, it was confirmed that treatment with the polysaccharide derived from the Klebsiella pneumoniae L5-2 strain of Example 2 increased filaggrin expression 1.2 to 1.6 times compared to the negative control. . Therefore, it was found that the polysaccharide derived from the Klebsiella pneumoniae L5-2 strain of Example 2 had a very excellent skin barrier strengthening effect.

<Test Example 10> Inflammation alleviation effect

1) Cell line culture

The cell line used to relieve inflammation was HEKa, a human keratinocyte. DMEM medium was used as the used medium and culture conditions, and culture was performed using an incubator under conditions of 37°C and 5% CO ₂ .

2) Inflammation relief effect

The amount of Nitric oxide (NO) was measured to confirm the inflammation alleviation effect of each sample. The HEKa cell lines were aliquoted into a 96-well plate at 1×10 ⁴ cells/ml, respectively, and cultured for 18 hours at 37°C and 5% CO ₂ . The medium was removed, washed with PBS, and mixed medium was added. In order to confirm the cytotoxicity of the polysaccharide obtained from Example 2, the mixed medium was added with the polysaccharide of Example 2 to 1 ml Media106 medium, and the final concentration was 0.5, 1, 2, and 4% (w/v). What was prepared to become a polysaccharide was used. As a positive control (CaCl ₂ ), 10 mM CaCl _{2 was} added instead of the L5-2 strain as a new medium.

Then, in order to induce an inflammatory reaction, a TL 20W/12 RS fluorescent sun lamp (Philips, Netherlands) was used to irradiate a wavelength of 275 to 380 nm (up to 290 to 320 nm) with UVB (75 mJ/cm ² ) to produce NO. Induced occurrence. At this time, a TA 401/407 Kodacel filter (Kodak, USA) was attached and used to remove UVC.

After 30 minutes, the amount of NO generated from the cells was measured using the Griess Reagent System to measure the sodium nitrite concentration and shown in Table 9. Here, the NO concentration was calculated using the standard curve for each concentration of sodium nitrite. Here, the normal control (con-1) was not treated with anything, the negative control (con-2) was irradiated with UV to induce an inflammatory reaction, and Hydrocortisone was a positive control. It was treated with 10 μM.

sample Use concentration (%, w/v) UV Nitric oxide
production(μM) Control-1 0 - 10.26±0.43 Control-2 0 + 31.53±0.99 Polysaccharide derived from the Klebsiella pneumoniae L5-2 strain of Example 2 0.5 + 25.32±0.43 One + 20.26±0.65 2 + 19.57±0.33 4 + 19.69 Hydrocortisone 10 μM + 13.83

The inflammatory response is caused by the production of inflammatory factors such as inflammatory cytokines, nitric oxide (NO), and prostaglandinE2 (PGE2) by various stimuli or immune cells. Among them, NO has a high reactivity and accelerates the inflammatory response, so effectively suppressing it is considered the most important for improving, preventing and treating inflammation.

Thus, in order to confirm the inflammation alleviating effect of the polysaccharide derived from the Klebsiella pneumoniae L5-2 strain of Example 2, changes in NO production in HEKa cells, human keratinocytes, were confirmed. As shown in Table 9, it was confirmed that the treatment of the polysaccharide derived from the Klebsiella pneumoniae L5-2 strain of Example 2 increased NO production by 1.2 to 1.6 times compared to the negative control (con-2). . Therefore, it was found that the polysaccharide derived from the Klebsiella pneumoniae L5-2 strain of Example 2 was very excellent in reducing skin inflammation caused by ultraviolet rays.

<Test Example 11> Skin cell regeneration effect

1) Cell line culture

The cell line used to evaluate skin cell regeneration efficacy was HEKa, a human keratinocyte. DMEM medium was used as the used medium and culture conditions, and culture was performed using an incubator under conditions of 37°C and 5% CO ₂ .

2) Sample preparation

In order to confirm the cytotoxicity to the polysaccharide obtained from Example 2, the polysaccharide of Example 2 was added to 1 ml DMEM medium so that the final concentration was 0.5, 1, 2 and 4% (w/v) polysaccharide. A mixed medium was prepared.

3) Analysis of skin cell regeneration efficacy

A wound healing assay was performed to confirm the skin cell regeneration efficacy. After inoculating HEKa cells 4 × 10 ⁵ /well in a 6-well plate and culturing them, a pipette tip was used to scrape the bottom of the plate to make a portion where the cells were not attached. After that, each 1 ml of the sample was treated and cultured for 18 hours. After the test was repeated twice, the same location was photographed with a microscope at 0 and 18 hours after the wound was formed, and the area reduced for 18 hours was measured with ImageJ (National Institutes of Health, USA), and the average value was calculated in FIGS. 4 and 10 Shown in. Here, the normal control group (con) was not treated with anything, and the MD was treated with 0.1% by weight of Madecassoside as a positive control.

Figure 4 is a microscope image of measuring the migration of HEKa cells treated with polysaccharides derived from Klebsiella pneumoniae L5-2 strain of Example 2 by concentration.

sample Use concentration (%, w/v) Relative wound width
(% of control) Control 0 100.00 Polysaccharide derived from the Klebsiella pneumoniae L5-2 strain of Example 2 0.5 84.82±8.7 One 74.38±9.9 2 45.43±1.3 4 30.88±6.0 MD 0.1% by weight 38.72±7.4

When cells are damaged by chemical and physical stimuli, they secrete various chemokines and cytokines, and at the same time move to the site of skin damage and induce cell proliferation. Therefore, we tried to confirm the effect of inducing cell regeneration by the sample through a wound healing assay that tests the growth and migration of skin cells. As shown in FIG. 4 and Table 10, it was confirmed that the wound gap area was reduced by treatment with polysaccharides derived from the Klebsiella pneumoniae L5-2 strain of Example 2. Therefore, it was found that the polysaccharide derived from the Klebsiella pneumoniae L5-2 strain of Example 2 had a very excellent skin cell regeneration effect.

As the specific parts of the present invention have been described in detail above, it is obvious that these specific techniques are only preferred embodiments and are not limited to the scope of the present invention for those of ordinary skill in the art. Therefore, it will be said that the substantial scope of the present invention is defined by the appended claims and their equivalents.

<110> KOREA FOOD RESEARCH INSTITUTE <120> Klebsiella pneumoniae strain, culture medium thereof and composition for improving skin comprising thereof <130> HPC8553 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of Col1A1 gene <400> 1 agggccaaga cgaagacatc 20 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of Col1A1 gene <400> 2 agatcacgtc atcgcacaac a 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of Filaggrin gene <400> 3 ggcactgaaa ggcaaaaagg 20 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of Filaggrin gene <400> 4 aaacccggat tcaccataat ca 22

Claims (15)

Klebsiella pneumoniae L5-2 strain (KCCM12490P) The method of claim 1,
The strain is a strain characterized in that the gene encoding Aerobactin (VF0123), Tersiniabactin (VF0136) and Aerobactin (VF0229), which represent virulence factors unlike the conventional Klebsiella pneumoniae, does not exist. The method of claim 1,
The strain is characterized in that it has a polysaccharide production ability. The method of claim 3,
The polysaccharides are constituent monosaccharides: Rhamnose, Arabinose, Galactose, Glucose, Mannose, Xylose, Galacturonic acid, and Glucuronic acid. A strain comprising (Glucuronic acid). Klebsiella pneumoniae ( Klebsiella pneumoniae) L5-2 strain (KCCM12490P) or a cosmetic composition for improving skin wrinkles and skin barrier, comprising as an active ingredient a culture medium or a polysaccharide isolated therefrom. The method of claim 5,
The composition includes skin lotion, skin softener, skin toner, astringent, milk lotion, moisture lotion, nutrition lotion, massage cream, nutrition cream, moisture cream, hand cream, foundation, nutrition essence, pack, soap, cleansing foam, cleansing lotion, Cosmetic composition, characterized in that any one or more formulations selected from the group consisting of cleansing cream, body lotion and body cleanser. Klebsiella pneumoniae ( Klebsiella pneumoniae ) L5-2 strain (KCCM12490P) containing the culture medium or a polysaccharide isolated therefrom as an active ingredient for the improvement of skin inflammation by ultraviolet rays and an external composition for skin damage improvement. Klebsiella pneumoniae ( Klebsiella pneumoniae ) L5-2 strain (KCCM12490P) or a food composition for improving skin wrinkles and skin barrier, comprising as an active ingredient a culture solution or a polysaccharide isolated therefrom. delete Klebsiella pneumoniae (Klebsiella pneumoniae) L5-2 strain (KCCM12490P) containing a culture medium or a polysaccharide isolated therefrom as an active ingredient to improve skin inflammation by ultraviolet rays and a feed composition for improving skin damage caused by wounds. Klebsiella pneumoniae (Klebsiella pneumoniae) L5-2 strain (KCCM12490P) containing as an active ingredient a culture medium or a polysaccharide isolated therefrom, skin inflammation improvement by ultraviolet rays and a feed additive composition for improving skin damage caused by wounds. Klebsiella pneumoniae ( Klebsiella pneumoniae ) A pharmaceutical composition for the treatment or prevention of skin damage caused by ultraviolet rays and skin damage by ultraviolet rays comprising a culture medium of L5-2 strain (KCCM12490P) or a polysaccharide isolated therefrom as an active ingredient. Klebsiella pneumoniae ( Klebsiella pneumoniae ) L5-2 strain (KCCM12490P) or a polysaccharide isolated therefrom containing the culture medium as an active ingredient, except for humans for the treatment or prevention of skin damage caused by skin inflammation and wounds Pharmaceutical compositions for animals.
Klebsiella pneumoniae ( Klebsiella pneumoniae ) L5-2 strain (KCCM12490P) or a cosmetic composition for improving skin damage caused by wounds and skin inflammation by UV rays containing as an active ingredient a culture medium or a polysaccharide isolated therefrom. Klebsiella pneumoniae ( Klebsiella pneumoniae ) L5-2 strain (KCCM12490P) containing a culture medium or a polysaccharide isolated therefrom as an active ingredient to improve skin inflammation by ultraviolet rays and a food composition for improving skin damage caused by wounds.

Images