KR102198708B1 - Composition for prevention, improvement or treatment of muscular disorder, or improvement of muscular functions comprising tart cherry extract - Google Patents

Abstract

The present invention relates to a composition for preventing, improving or treating muscle diseases, or for improving muscle function, containing a tart cherry extract.
Tat cherry extract of the present invention regulates genes involved in muscle protein synthesis (Akt1, PI3K, A1R and TRPV4) and muscle protein breakdown (Atrogin-1, MuRF1, myostatin and SIRT1) to increase muscle mass or inhibit muscle loss. , It can prevent, ameliorate, or treat muscle diseases or improve muscle function. Accordingly, the composition for preventing, improving or treating muscle diseases, or for improving muscle function, comprising the extract of the present invention as an active ingredient is very useful in the manufacture of competitive food compositions and pharmaceutical compositions.

Description

Composition for prevention, improvement or treatment of muscular disorder, or improvement of muscular functions comprising tart cherry extract}

The present invention relates to a composition for preventing, improving or treating muscle diseases, or for improving muscle function, containing a tart cherry extract.

Muscle (Muscle) is a tissue produced by the development of stem cells of the mesoderm and is composed of bundles of myofibers made up of a fusion of muscle cells (myoblasts). Muscles account for 40-50% of body weight, which supports and protects bones and internal organs, while allowing motility of tissues other than muscles such as the heartbeat (Journal of Nutritional Science and Vitaminology, 61: 188-194, 2015). . In addition to the protection of organs, muscles are closely related to the onset of metabolic diseases such as type 2 diabetes, obesity, and cardiovascular disease because muscles have a great influence on nutrient metabolism as well as physical activities including exercise.

Muscle atrophy is caused by a gradual decrease in muscle mass and refers to muscle weakness and degeneration (Cell, 119(7): 907-910, 2004). Muscle atrophy is promoted by inactivity, oxidative stress, and chronic inflammation and impairs muscle function and motor capacity (Clinical Nutrition, 26(5): 524-534, 2007). The most important factor in determining muscle function is muscle mass, which is maintained by a balance between protein synthesis and degradation. Muscular dystrophy occurs when protein degradation occurs more than synthetically (The International Journal of Biochemistry and Cell Biology, 37(10): 1985-1996, 2005).

Muscle size is regulated by intracellular signaling pathways that induce anabolic or catabolism occurring within the muscle, and when there are more signaling reactions that induce synthesis rather than degradation of muscle proteins. Muscle protein synthesis is increased, which is indicated by an increase in muscle size (hypertrophy) or an increase in the number of muscle fibers (hyperplasia) according to an increase in muscle protein (The Korea Journal of Sports Science, 20(3): 1551-1561, 2011).

Factors involved in muscle protein synthesis induce protein synthesis by phosphorylating downstream proteins from stimulation of the phosphatidylinositol-3 kinase (PI3K)/Akt pathway in muscle cells. The activity of the mammalian target of rapamycin (mTOR) by PI3K/Akt signaling is recognized as a central growth signaling factor that integrates various growth signals in cells. mTOR contributes to muscle mass increase by inducing muscle protein synthesis by activating two factors that initiate mRNA translation, 4E-binding protein (4E-BP1) and phosphorylated 70-kDa ribosomal S6 kinase (p70S6K) (The Korea Journal of Sports Science, 20(3): 1551-1561, 2011; The International Journal of Biochemistry and Cell Biology, 43(9): 1267-1276, 2011). Conversely, when the forhead box (FoxO), a transcription factor, moves from the cytoplasm to the nucleus, it increases the expression of the E3 ubiquitin ligase factors atrogin-1 and MuRF-1, which are involved in protein degradation (Disease Models and Mechanisms, 6: 25). -39, 2013). When their expression level is increased, protein breakdown in muscle is promoted and muscle mass is reduced. Therefore, promoting mTOR activity and inhibiting the expression of atrogin-1 and MuRF-1 increase the amount of muscle protein, thereby increasing muscle mass.

Tat cherry is a round or egg-shaped mature fruit of Prunus cerasus L. belonging to Prunus of the Rosaceae family. It is about 2.5 cm in diameter, ripens in red in June-July and has a strong sour taste. Cherries are widely used for food, and are also called sour cherries or pie cherries (Wang et al., 1999; Seeram et al., 2001; Bell et al., 2014a; Seymour et al., 2014; Keane et al. ., 2016a). Tat cherries contain a variety of flavonoids that exhibit potent antioxidant effects such as flavonoids isorhamnetin, kaempferol, quercetin, catechin, epicatechin, procyanidin and anthocyanin (Kim et al., 2005; Kirakosyan et al., 2009), and are now anti-inflammatory (Wang). et al., 1999), antioxidant (Howatson et al., 2010; Bell et al., 2014b), blood pressure reduction (Keane et al., 2016b), cognitive improvement (Matchynski et al., 2013), and cardioprotective effects ( Wang et al., 1999; Seeram et al., 2001), etc. Various pharmacological activities are known experimentally. However, the effect of preventing and treating muscle diseases or improving muscle function of the extract of tart cherry was not known.

Accordingly, the present inventors searched for a natural substance that can be safely applied while having excellent muscle function regulating activity, and as a result, tatice cherry extract significantly increased the expression of proteins related to muscle protein synthesis and muscle mass increase in muscle cells at the mRNA level. , Since it effectively inhibits the expression of enzymes involved in muscle protein degradation at the mRNA level, the tat cherry extract of the present invention can be used as an active ingredient in a composition for preventing, improving or treating muscle diseases, or a composition for improving muscle function. By confirming, the present invention was completed.

KR 10-2018-0134161 A KR 10-2006-0123663 A US 2008-0075797 A1

It is an object of the present invention to provide a pharmaceutical composition for the prevention or treatment of muscle diseases comprising the extract of tarts as an active ingredient.

In addition, another object of the present invention is to provide a pharmaceutical composition for increasing muscle or inhibiting muscle loss, comprising the extract of tart cherry as an active ingredient.

In addition, another object of the present invention is to provide a health functional food composition for preventing or improving muscle diseases, comprising the extract of tart cherry as an active ingredient.

In addition, another object of the present invention is to provide a health functional food composition for improving muscle function comprising a tart cherry extract as an active ingredient.

The pharmaceutical composition for the prevention or treatment of muscle diseases of the present invention for achieving the above object may include a tart cherry extract as an active ingredient.

The tart cherry extract may be an extract by one or more solvents selected from the group consisting of water, an organic solvent having 1 to 6 carbon atoms, a subcritical fluid, a supercritical fluid, and a mixture thereof.

In addition, the organic solvent having 1 to 6 carbon atoms is alcohol, acetone, ether, benzene, chloroform, ethyl acetate, methylene chloride, having 1 to 6 carbon atoms. It may be selected from the group consisting of (methylene chloride), hexane, and cyclohexane.

The muscle disease may be a muscle disease due to decreased muscle function, muscle wasting, or muscle degeneration.

The muscle disease caused by the decrease in muscle function, muscle wasting or muscle degeneration is in the group consisting of muscular atrophy, Sacopenia, atony, muscular dystrophy, muscle degeneration, myasthenia gravis and It may be one or more selected.

In addition, the muscle disease may be a muscle disease caused by side effects of glucocorticoids.

The glucocorticoid side effects may be caused by glucocorticoid treatment or an increase in the amount of glucocorticoid in a subject.

The glucocorticoids are cortisol, hydrocortin, cortisone, prednisolone, methylprednisolone, triamcinolone, triamcinolone acetonide, paramethasone, dexamethasone, betamethasone, hexestrol, methimazole, fluocinonide, fluocinolone acetonid, , Beclomethasone dipropionate, estriol, diflorasone diacetate, diflucortolone valerate, and difluprednate may be one or more selected from the group consisting of.

The muscle disease caused by the side effects of glucocorticoid may be muscular atrophy, myasthenia, muscular dystrophy, muscular stiffness, hypotonia, muscle weakness, muscular dystrophy, muscular dystrophy, amyotrophic lateral sclerosis, spinal progressive muscular atrophy or severe myasthenia or a combination thereof. .

The composition may be one to increase the expression of one or more types of mRNA selected from the group consisting of P13K, Akt1, A1R, and TRPV4.

The composition may be one that inhibits the expression of one or more types of mRNA selected from the group consisting of Atrogin-1, MuFR1, myostatin and SIRT1.

In addition, the pharmaceutical composition for increasing muscle or inhibiting muscle loss of the present invention for achieving the above-described other object may include a tart cherry extract as an active ingredient.

In addition, the health functional food composition for preventing or improving muscle disease of the present invention for achieving the another object described above may include a tart cherry extract as an active ingredient.

The formulation of the health functional food may be a powder, granule, tablet, capsule or beverage.

In addition, the health functional food composition for improving muscle function of the present invention for achieving the another object described above may include a tart cherry extract as an active ingredient.

Tat cherry extract of the present invention regulates genes involved in muscle protein synthesis (Akt1, PI3K, A1R and TRPV4) and muscle protein breakdown (Atrogin-1, MuRF1, myostatin and SIRT1) to increase muscle mass or inhibit muscle loss. , It can prevent, ameliorate, or treat muscle diseases or improve muscle function. Accordingly, the composition for preventing, improving or treating muscle diseases, or for improving muscle function, comprising the extract of the present invention as an active ingredient is very useful in the manufacture of competitive food compositions and pharmaceutical compositions.

1 is a schematic diagram for briefly showing an experimental method of an animal model according to an embodiment of the present invention.
Figure 2 is a graph showing the change in weight gain in glucocorticoid (dexamethasone)-induced muscular dystrophy mice according to the administration of the tart cherry extract according to an embodiment of the present invention.
3 is a graph showing changes in calf thickness of a glucocorticoid (dexamethasone)-induced muscular dystrophy mouse according to the administration of a tart cherry extract according to an embodiment of the present invention.
Figure 4 is a photograph showing the change in the calf muscle mass of a glucocorticoid (dexamethasone)-induced muscular dystrophy mouse according to the administration of the tart cherry extract according to an embodiment of the present invention.
Figure 5 is a graph showing the change in the thickness of the gastrocnemius in a glucocorticoid (dexamethasone)-induced muscular dystrophy mouse according to the administration of the tart cherry extract according to an embodiment of the present invention.
Figure 6 is a graph showing the change in the weight of the gastrocnemius of a glucocorticoid (dexamethasone)-induced muscular dystrophy mouse according to the administration of the tart cherry extract according to an embodiment of the present invention.
7 is a graph showing changes in calf muscle tension of glucocorticoid (dexamethasone)-induced muscular dystrophy mice according to the administration of the tart cherry extract according to an embodiment of the present invention.
Figure 8 is an image showing the histopathological changes of the gastrocnemius muscle of a glucocorticoid (dexamethasone)-induced muscular dystrophy mouse according to the administration of the tart cherry extract according to an embodiment of the present invention. In Figure 8, A is a normal medium control; B is the GLU control; C is Oxymetholone administration group; D is the TCcp 500 experimental group; E is TCcp 250 experimental group; And F means TCcp 125 experimental group;
FIG. 9 is an image showing changes in caspase-3 and PARP immunoreactive muscle fibers in the gastrocnemius muscle of a glucocorticoid (dexamethasone)-induced muscular dystrophy mouse according to an embodiment of the present invention according to the administration of a tart cherry extract. In Figure 9, A is a normal medium control; B is the GLU control; C is Oxymetholone administration group; D is the TCcp 500 experimental group; E is TCcp 250 experimental group; And F means TCcp 125 experimental group;
FIG. 10 is an image showing changes in nitrotyrosine and 4-HNE immunoreactive muscle fibers of the gastrocnemius muscle of a glucocorticoid (dexamethasone)-induced muscular atrophy mouse according to an embodiment of the present invention according to the administration of a tart cherry extract. In Figure 10, A is a normal medium control; B is the GLU control; C is Oxymetholone administration group; D is the TCcp 500 experimental group; E is TCcp 250 experimental group; And F means TCcp 125 experimental group;
FIG. 11 is an image showing changes in iNOS and Myostatin immunoreactive muscle fibers of the gastrocnemius muscle of a glucocorticoid (dexamethasone)-induced muscular dystrophy mouse according to an embodiment of the present invention according to the administration of a tart cherry extract. In Figure 11, A is a normal medium control; B is the GLU control; C is Oxymetholone administration group; D is the TCcp 500 experimental group; E is TCcp 250 experimental group; And F means TCcp 125 experimental group;

Hereinafter, the present invention will be described in detail.

The present invention is a pharmaceutical composition for the prevention or treatment of muscle diseases comprising the extract as an active ingredient; A pharmaceutical composition for increasing muscle or inhibiting muscle loss; Health functional food composition for preventing or improving muscle disease; It provides a health functional food composition for improving muscle function.

Tart cherry is a type of cherry originating from western Europe to Turkey. It has a strong sour taste and has been used for medicine and botanical purposes since about 100 years ago. Tart cherry has the effect of reducing chronic inflammation and is known to have anti-aging and anti-cancer effects because it is rich in anthocyanin, an antioxidant. It is also known to be effective in relieving insomnia due to its high content of melatonin, which regulates biological rhythm and induces sleep, and is known to help with cholesterol excretion, constipation, and prevention of hypertension and cardiovascular diseases due to its high content of dietary fiber. It is difficult to store and is used in the form of concentrate, juice, dried, frozen, or powder rather than fresh fruit.

In the present specification, "tart cherry extract" is obtained by extracting tart cherry using a suitable solvent, an extract, a dilution or concentrate of the extract, a dried product obtained by drying the extract, or a preparation or purified product thereof Includes all forms. Accordingly, the tart cherry extract of the present invention has a meaning in a broad sense to include a tart cherry processed product, for example, tart cherry powder, formulated to be administered to an animal.

The tart cherry extract may be obtained by extracting from tart cherry with one or more solvents selected from the group consisting of water, an organic solvent having 1 to 6 carbon atoms, and a subcritical or supercritical fluid, but is not limited thereto. The organic solvent having 1 to 6 carbon atoms is alcohol, acetone, ether, benzene, chloroform, ethyl acetate, methylene chloride, and 1 to 6 carbon atoms. chloride), hexane, or cyclohexane. Tartcherry extract extracted with 60 to 80% ethanol or methanol aqueous solution in the extraction solvent may preferably act in the prevention or treatment of muscle diseases.

The tart cherry extract of the present invention may be prepared using conventional extraction methods in the art such as heat extraction, cold needle extraction, ultrasonic extraction, filtration and reflux extraction, and for example, tart cherry is 100 MPa or more, preferably 100 It can also be obtained by extraction under ultra-high pressure conditions of MPa to 1000 MPa. If necessary, it can be prepared by additionally including filtration and concentration steps according to methods known in the art. Tart cherries can be purchased and used commercially, or those harvested or grown in nature can be used.

As an embodiment of the present invention, the tart cherry is mixed with an extraction solvent in a weight ratio of 1: 5 to 25, preferably 1: 8 to 15, and then mixed at 40 to 70°C, preferably at 50 to 60°C, and 10 to 20 After extraction for a period of time, preferably 15 to 18 hours, concentration under reduced pressure is performed to prepare an extract. When the weight ratio of the tart cherry and the extraction solvent is outside the above range, the active ingredient of the tart cherry may be extracted in a small amount in the extract.

On the other hand, in the present specification, the term "including as an active ingredient" means including an amount sufficient to achieve the efficacy or activity of the tart cherry extract. For example, the tart cherry extract is used in a concentration of 5 to 100 mg/ml, preferably 10 to 80 mg/ml, and more preferably 20 to 60 mg/ml. Since the tart cherry extract is a natural product and does not have side effects on the human body even if it is administered in an excessive amount, the upper limit of the quantity of the tart cherry extract contained in the composition of the present invention can be selected and carried out by a person skilled in the art within an appropriate range.

In the present specification, "muscle" refers to tendons, muscles, and tendons generically, and "muscle function" refers to the ability to exert power by contraction of the muscles, and the muscles can exert contractile force to the maximum in order to overcome resistance. It includes muscle strength, which is the ability to be capable, muscle endurance, which is the ability to repeat contractions and relaxations for a given weight, for how long or many times, and quickness, which is the ability to exert strong power in a short time. These muscle functions are controlled by the liver and are proportional to muscle mass. The term “improving muscle function” refers to improving muscle function for the better.

The composition for preventing, improving, or treating muscle diseases of the present invention or for improving muscle function may contain a tat cherry extract alone, or may contain one or more active ingredients exhibiting a function similar to that of tat cherry. If additional components are included, the effect of improving muscle function of the composition of the present invention may be further enhanced. When the above ingredients are added, skin safety, ease of formulation, and stability of active ingredients can be considered in combination with use.

When the composition for preventing or treating muscle diseases of the present invention is a pharmaceutical composition, it can be used for the prevention or treatment of muscle diseases due to muscle function decline, muscle wasting or degeneration, or muscle diseases due to side effects of steroids.

The decrease in muscle function, muscle wasting or muscle degeneration occurs due to genetic factors, acquired factors, aging, etc., and the decrease in muscle function or muscle wasting is a gradual loss of muscle mass, weakness of muscles, especially skeletal muscle or voluntary muscle and heart muscle, and Characterized by regression.

Specific examples of diseases related to muscle diseases caused by the decrease in muscle function, muscle wasting or degeneration include muscular atrophy, Sacopenia, atony, muscular dystrophy, muscle degeneration, and myasthenia. And the like, but are not limited thereto.

In addition, the muscle disease of the present invention may be due to a steroid side effect, and more specifically, it may be a muscle atrophy disease due to a steroid side effect. The steroid may be a glucocorticoid.

In the present specification, "glucocorticoid (GC)" may be a kind of steroid hormone that binds to a glucocorticoid receptor (GR or GCR) present in most vertebrate cells. The glucocorticoid receptor, also known as NR3C1 (nuclear receptor subfamily 3, group C, member 1), is a receptor to which cortisol and other glucocorticoids bind. The glucocorticoid receptor may have an amino acid sequence of NP_000167 (human) and NP_032199 (mouse). The glucocorticoid receptor may also be one encoded by the nucleotide sequence of NM_000176 (human) and NM_008173 (mouse).

The glucocorticoid is, for example, cortisol, hydrocortin, cortisone, prednisolone, methylprednisolone, triamcinolone, triamcinolone acetonide, paramethasone, dexamethasone, betamethasone, hexestrol, methimazole, fluocinonide, fluocinolone. , Fluorometholone, beclomethasone dipropionate, estriol, diflorasone diacetate, diflucortolone valerate, and difluprednate may be one or more selected from the group consisting of, preferably cortisol , Dexamethasone, betamethasone, prednisone, methylprednisolone or prednisolone.

The glucocorticoid side effects can be caused by glucocorticoid treatment, or by increasing the amount of glucocorticoid in the subject.

In addition, the glucocorticoid side effects may be caused by inhibition of P13K activity, inhibition of Akt1 activity, increase of Atrogin-1 activity, increase of MuRF-1 activity, or a combination thereof. In the present specification, "increased activity" may be caused by an increase in biosynthesis of a protein itself or an increase in specific activity of the protein itself. The pharmaceutical composition of the present invention is selected from the group consisting of P13K, Akt1, A1R and TRPV4 to increase the activity of one or more selected from the group consisting of Atrogin-1, MuFR1, myostatin and SIRT1 to decrease the activity of one or more selected from the group consisting of, or a combination thereof It may be something that causes. In addition, the composition may be one that reduces phosphorylation of a glucocorticoid receptor and/or decreases the intranuclear migration of a phosphorylated glucocorticoid receptor.

The composition may be for administration before, simultaneously, or after administration of the glucocorticoid drug. In the case of simultaneous administration, it may be for simultaneous administration as the same composition or as separate compositions.

The muscle disease caused by the glucocorticoid side effect may be a muscle atrophy disease. The muscular dystrophy disease may be muscular atrophy, myasthenia gravis, muscular dystrophy, muscular stiffness, hypotonia, muscular weakness, muscular dystrophy, muscular dystrophy, muscular atrophic lateral sclerosis, spinal progressive muscular atrophy or severe myasthenia or a combination thereof.

The composition of the present invention has the effect of increasing muscle mass and inhibiting muscle loss, and the type of muscle is not limited.

In a specific embodiment of the present invention, as a result of confirming the effect exhibited by administering the extract of tart cherry to an animal model of muscle atrophy induced by a glucocorticoid hormone preparation such as dexamethasone, glucocorticoid (hereinafter referred to as "GLU") to a control group In comparison, it was confirmed that the body weight and weight gain, calf thickness, gastrocnemius thickness and weight after muscle exposure, and calf muscle tension were significantly increased. In addition, as a blood biochemical change, the content of creatine and CK in the blood was significantly decreased, and the content of LDH was significantly increased compared to the GLU control group. In addition, as a change in the gastrocnemius antioxidant defense system, the contents of MDA and ROS in the gastrocnemius muscle were significantly decreased compared to the GLU control group, and the GSH content, SOD activity, and CAT activity were significantly increased. And, as a change in the mRNA expression in the gastrocnemius, the mRNA expression of Atrogin-1, MuRF1, myostatin, and SIRT1 was significantly decreased compared to the GLU control group, and the mRNA expression of PI3K, Akt1, A1R and TRPV4 was significantly increased. As for histopathological changes, the GLU-induced catabolic atrophy of the gastrocnemius muscle was significantly reduced, and the mean diameter of the gastrocnemius muscle fibers was significantly increased compared to the GLU control group, and the proportion of collagen fibers in the gastrocnemius muscle bundle was significantly decreased. I did. As a result of immunohistochemical changes, the number of immunoreactive muscle fibers of caspase-3, PARP, nitrotyrosine, 4-HNE, iNOS, and myostatin per unit area of the gastrocnemius muscle bundle was significantly reduced compared to the GLU control group.

Through the results as described above, since the extract of the tart cherry of the present invention exhibits an excellent effect in increasing muscle mass, a pharmaceutical composition for preventing or treating muscle diseases; A pharmaceutical composition for increasing muscle or inhibiting muscle loss; Health functional food composition for preventing or improving muscle disease; It can be usefully used as an active ingredient in a health functional food composition for improving muscle function.

On the other hand, the pharmaceutical composition of the present invention may contain a pharmaceutically acceptable salt of the extract of tart cherry. As used herein, the term "pharmaceutically acceptable" refers to physiologically acceptable and when administered to humans, usually does not cause an allergic reaction or a similar reaction, and the salt is a pharmaceutically acceptable free acid (free Acid addition salts formed by acid) are preferred.

The pharmaceutical composition of the present invention may be prepared using a pharmaceutically suitable and physiologically acceptable adjuvant in addition to the active ingredient, and the adjuvant includes excipients, disintegrants, sweeteners, binders, coating agents, expanding agents, lubricants, lubricants. Agents or flavoring agents can be used.

For administration, the pharmaceutical composition may include one or more pharmaceutically acceptable carriers in addition to the above-described active ingredients, and may be preferably formulated into a pharmaceutical composition.

The formulation form of the pharmaceutical composition may be granules, powders, tablets, coated tablets, capsules, suppositories, solutions, syrups, juices, suspensions, emulsions, drops, or injectable solutions. For example, for formulation in the form of tablets or capsules, the active ingredient may be combined with an oral, non-toxic pharmaceutically acceptable inert carrier such as ethanol, glycerol, water, and the like. In addition, if desired or necessary, suitable binders, lubricants, disintegrants and coloring agents may also be included in the mixture. Suitable binders are, but are not limited to, natural sugars such as starch, gelatin, glucose or beta-lactose, corn sweeteners, natural and synthetic gums such as acacia, lacquercanth or sodium oleate, sodium stearate, magnesium stearate, sodium Benzoate, sodium acetate, sodium chloride, and the like. Disintegrants include, but are not limited to, starch, methyl cellulose, agar, bentonite, xanthan gum, and the like.

As acceptable pharmaceutical carriers for compositions formulated as liquid solutions, sterilization and biocompatible, saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and One or more of these components may be mixed and used, and other conventional additives such as antioxidants, buffers, and bacteriostatic agents may be added as necessary. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to prepare injectable formulations such as aqueous solutions, suspensions, emulsions, etc., pills, capsules, granules, or tablets.

Furthermore, it can be preferably formulated according to each disease or ingredient using a method disclosed in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA as an appropriate method in the field.

The pharmaceutical composition of the present invention may be administered orally or parenterally, and in the case of parenteral administration, it may be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, transdermal administration, and the like, preferably oral administration.

A suitable dosage of the pharmaceutical composition of the present invention varies depending on factors such as formulation method, mode of administration, age, body weight, sex, pathological condition, food, administration time, route of administration, excretion rate and response sensitivity of the patient, and is usually As such, a skilled physician can easily determine and prescribe an effective dosage for the desired treatment or prophylaxis.

The pharmaceutical composition for preventing or treating muscle diseases of the present invention may provide a desirable muscle disease prevention or treatment effect when it contains an effective amount of the extract of tart cherry. In the present specification, the term "effective amount" refers to an amount that exhibits a higher response compared to the negative control group, and preferably refers to an amount sufficient to improve muscle function. The pharmaceutical composition of the present invention may contain 0.01 to 99.99% of the tart cherry extract, and the balance may be occupied by a pharmaceutically acceptable carrier. The effective amount of the tart cherry extract contained in the pharmaceutical composition of the present invention will vary depending on the form in which the composition is commercialized.

The total effective amount of the pharmaceutical composition of the present invention may be administered to a patient in a single dose, and may be administered by a fractionated treatment protocol that is administered for a long time in multiple doses. The pharmaceutical composition of the present invention may vary the content of the active ingredient depending on the severity of the disease. When parenterally administered, based on the tart cherry extract, to be administered in an amount of 50 to 3,000 mg, preferably 100 to 2,000 mg, more preferably 200 to 1,500 mg per 1 kg of body weight per day, and when administered orally, tart The cherry extract may be administered in an amount of 1 to 1,000 mg per 1 kg of body weight per day, preferably 50 to 800 mg, more preferably 200 to 600 mg per day. However, the dosage of the tart cherry extract is not only the administration route and the number of treatments of the pharmaceutical composition, but also the effective dosage for the patient considering various factors such as the patient's age, weight, health condition, sex, disease severity, diet and excretion rate. Because it is determined, considering this point, those of ordinary skill in the art will be able to determine an appropriate effective dosage of the tart cherry extract according to a specific use for preventing or treating muscle diseases. The pharmaceutical composition according to the present invention is not particularly limited in its formulation, route of administration, and method of administration as long as it exhibits the effects of the present invention.

The pharmaceutical composition of the present invention may be prepared in a unit dosage form by formulation using a pharmaceutically acceptable carrier and/or excipient, or may be prepared by placing it in a multi-dose container. At this time, the formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, granule, tablet or capsule, and may additionally include a dispersant or a stabilizer.

The pharmaceutical composition for preventing or treating muscle diseases of the present invention may be used alone or in combination with surgery, radiation therapy, hormone therapy, chemotherapy, or methods using a biological response modifier.

The pharmaceutical composition for preventing or treating muscle diseases of the present invention may also be provided in the form of a formulation for external use comprising the extract of tart cherry as an active ingredient.

When the pharmaceutical composition for preventing or treating muscle diseases of the present invention is used as an external preparation for skin, additionally fatty substances, organic solvents, solubilizing agents, thickening and gelling agents, emollients, antioxidants, suspending agents, stabilizers, foaming agents ), fragrance, surfactant, water, ionic emulsifier, nonionic emulsifier, filler, sequestering agent, chelating agent, preservative, vitamin, blocker, wetting agent, essential oil, dye, pigment, hydrophilic activator, lipophilic activator Or it may contain adjuvants commonly used in the field of dermatology such as any other ingredients commonly used in skin external preparations such as lipid vesicles. In addition, the above ingredients may be introduced in amounts generally used in the field of dermatology.

When the pharmaceutical composition for preventing or treating muscle diseases of the present invention is provided as an external preparation for skin, it may be a formulation such as an ointment, patch, gel, cream, or spray, but is not limited thereto.

In addition, the present invention provides a pharmaceutical composition for muscle augmentation or for inhibiting muscle loss, comprising the extract of tart cherry as an active ingredient.

The pharmaceutical composition for increasing muscle or inhibiting muscle loss is dedicated to the contents of "Tart Cherry Extract" and "Pharmaceutical Composition" of the aforementioned pharmaceutical composition for preventing or treating meat diseases.

It was confirmed through specific experimental examples that the composition increases the expression of one or more types of mRNA selected from the group consisting of P13K, Akt1, A1R and TRPV4. In addition, it was confirmed through specific experimental examples that the composition inhibited the expression of at least one mRNA selected from the group consisting of Atrogin-1, MuFR1, myostatin and SIRT1. Through these experimental results, it can be seen that the composition comprising the extract of the present invention as an active ingredient has an effect of increasing muscle or inhibiting muscle loss.

The composition for preventing or improving muscle disease of the present invention, or the composition for improving muscle function may be a food composition. The food composition of the present invention can be used to prevent or improve muscle diseases caused by muscle function decline, muscle wasting or degeneration. In particular, muscle wasting and degeneration occurs due to genetic factors, acquired factors, aging, etc., and muscle wasting is characterized by a gradual loss of muscle mass, weakness and degeneration of muscles, especially skeletal or voluntary muscles, and heart muscles. Examples of related diseases include muscular atrophy, Sacopenia, atony, muscular dystrophy, muscle degeneration, and myasthenia. The composition of the present invention has an effect of increasing muscle mass, and the type of muscle is not limited.

The food composition of the present invention includes all forms such as functional food, nutritional supplement, health food, food additives and feed, and contains humans or animals including livestock. It is targeted for eating. Food compositions of this type can be prepared in various forms according to conventional methods known in the art.

Food compositions of this type can be prepared in various forms according to conventional methods known in the art. General foods include, but are not limited to, beverages (including alcoholic beverages), fruits and processed foods thereof (e.g., canned fruit, canned food, jam, marmalade, etc.), fish, meat and processed foods thereof (e.g. ham, sausage) Corn beef), bread and noodles (e.g. udon, buckwheat noodles, ramen, spagate, macaroni, etc.), fruit juice, various drinks, cookies, sweets, dairy products (e.g. butter, cheese, etc.), edible vegetable oil, margarine , Vegetable protein, retort food, frozen food, various seasonings (eg, miso, soy sauce, sauce, etc.), etc., can be prepared by adding the tart cherry extract. In addition, as a nutritional supplement, it is not limited thereto, but may be prepared by adding tart cherry extract to capsules, tablets, pills, and the like. In addition, although not limited thereto as a health functional food, for example, the tart cherry extract itself is prepared in the form of tea, juice, and drinks, and liquefied, granulated, encapsulated, and powdered so that it can be consumed (healthy beverage). can do. In addition, in order to use the tart cherry extract in the form of a food additive, it may be prepared and used in the form of a powder or a concentrate. In addition, it may be prepared in the form of a composition by mixing the extract of tart cherry with a known active ingredient known to have an effect of preventing muscle disease or improving muscle function.

When the composition for preventing or improving muscle disease of the present invention, or the composition for improving muscle function, is used as a health drink composition, the health drink composition may contain various flavors or natural carbohydrates as an additional component, such as a conventional drink. I can. The natural carbohydrates described above include monosaccharides such as glucose and fructose; Disaccharides such as maltose and sucrose; Polysaccharides such as dextrin and cyclodextrin; It may be a sugar alcohol such as xylitol, sorbitol, and erythritol. Sweeteners include natural sweeteners such as taumatin and stevia extract; Synthetic sweeteners such as saccharin and aspartame can be used. The ratio of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 mL of the composition of the present invention.

The tart cherry extract may be contained as an active ingredient of a food composition for preventing or improving muscle disease, the amount of which is effective to achieve the effect of preventing or improving muscle disease, or improving muscle function, and is 0.01 based on the total weight of the composition. It is preferably to 100% by weight. The food composition of the present invention may be prepared by mixing with other active ingredients known to be effective in preventing muscle disease or improving muscle function with the extract of tart cherry.

In addition to the above, the food composition of the present invention may be a health functional food. Health functional foods are foods prepared by adding, encapsulating, powdering, or suspending tart cherry extract to various food materials, and when ingested, they are meant to bring specific health effects, but unlike general drugs, foods As a raw material, it has the advantage of not having side effects that may occur when taking the drug for a long time. The health functional food of the present invention obtained in this way is very useful because it can be consumed on a daily basis. The health functional foods include various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol Or it may contain a carbonation agent and the like. In addition, the health functional food of the present invention may contain flesh for the manufacture of natural fruit juice, fruit juice beverage or vegetable beverage.

In addition, the present invention provides a method for preventing, improving, or treating muscle diseases, comprising administering an effective amount of a tart cherry extract to a mammal.

The term "mammal" as used herein refers to a mammal that is the subject of treatment, observation or experimentation, and preferably refers to a human.

The term "effective amount" as used herein refers to the amount of an active ingredient or pharmaceutical composition that induces a biological or medical response in a tissue system, animal or human, which is considered by a researcher, veterinarian, doctor or other clinician, Includes an amount that induces relief of symptoms of the disease or disorder. The effective amount and the number of administrations for the active ingredient of the present invention may vary depending on the desired effect. Therefore, the optimal dosage to be administered can be easily determined by those skilled in the art, and the type of disease, the severity of the disease, the amount of active ingredients and other ingredients contained in the composition, the type of formulation, and the age, weight, and general health of the patient. It can be adjusted according to various factors including condition, sex and diet, time of administration, route of administration and secretion rate of the composition, duration of treatment, and drugs used simultaneously. In the prophylaxis, improvement or treatment method of the present invention, in the case of an adult, it is preferable to administer the tart cherry extract at a dose of 0.1 to 1,000 mg/kg when administered once to several times a day.

In the treatment method of the present invention, the composition comprising the extract of tart cherry as an active ingredient is a conventional method through oral, rectal, intravenous, intraarterial, intraperitoneal, intramuscular, intrasternal, transdermal, topical, intraocular or intradermal routes. Can be administered.

Hereinafter, examples and comparative examples will be described in detail with respect to a composition for preventing, improving, or treating muscle diseases comprising the extract of tart cherry according to the present invention as an active ingredient.

<Test method>

Abbreviation

TCcp: Tart Cherry Extract

Oxymetholone: Oxymetholone

GLU: Glucocorticoid

DEXA: Dexamethasone

Experimental animals

SPF/VAF Outbred CrljOri:CD1<ICR> male mice (OrientBio, Seungnam, Korea) were used after acclimatization for 10 days, and this animal experiment was conducted under the prior approval of the Animal Experiment Ethics Committee of Daegu Haany University.

Separation of experimental groups (total 6 groups; 8 animals per group)

(1) Normal medium control: Intact vehicle control

(2) GLU control: sterile distilled water and dexamethasone (hereinafter referred to as "dexamethasone" or "DEXA") administration muscle atrophy inducing control

(3) Oxymetholone: Oxymetholone 50 mg/kg and control drug group administered with DEXA

(4) TCcp 500: Tart Cherry Extract (hereinafter referred to as "Tat Cherry Extract" or "TCcp") 500 mg/kg and DEXA administered high-dose experimental group

(5) TCcp 250: Tart cherry extract (TCcp) 250 mg/kg and DEXA administered intermediate dose experimental group

(6) TCcp 125: tart cherry extract (TCcp) 125 mg/kg and low-dose experimental group administered with DEXA

150 healthy SPF/VAF CrljOri:CD1 [ICR] mice (OrientBio, Seungnam, Korea) were obtained, acclimated for 10 days, and then body weight (37.04ㅁ1.08 g, 34.80~39.40 g) and calf thickness (3.21ㅁ0.06 mm) were obtained. , 3.09~3.35 mm) were selected as 8 animals per group, and 6 groups were used for the experiment.

All experimental animals were fasted for about 18 hours each on the day of administration of the test substance and the day of the final necropsy (negative water was supplied freely during this period), and individuals were identified with picric acid (Fig. 1).

On the other hand, the dose of oxymetholone used in this experiment was determined in previous animal experiments [Pavlatos et al., 2001; Isaacs et al., 2011; Kim et al., 2015ab] was selected as a dose of 50 mg/kg, and TCcp was also based on the previous in vivo bioavailability evaluation [Kirakosyan et al., 2015] and drug efficacy experiments [Tall et al., 2004]. As a result, 500, 250, and 125 mg/kg were selected as high, medium and low dose administration groups, respectively.

Induction of muscular dystrophy

According to previous experimental methods (Gilson et al., 2007; Kim et al., 2015a), a water-soluble DEXA (Sigma-Aldrich, St. Louise, MO, USA) was used at a concentration of 1.5 mg/ml (DEXA itself was 0.1 mg/ml concentration) was dissolved in physiological saline, and a dose of 10 ml per kg body weight, that is, 15 mg/kg (1 mg/kg as DEXA itself) was injected subcutaneously once daily for 10 days, causing catabolic muscle atrophy. , In the normal medium control group, only the same dose of physiological saline was injected subcutaneously instead of DEXA.

Experimental substance (sample) and administration

TCcp (Anderson Global Group, Irvine, CA, USA) is a pink powder, Glucan Corp. (Pusan, Korea), and was used while refrigerated at 4°C, and off-white oxymetholone 50 mg Tablet (CelltrionPharm, JinCheon, Korea) was pulverized into a powder state, and stored in a refrigerator at 4°C. TCcp is dissolved in sterile distilled water at concentrations of 50, 25 and 12.5 mg/ml, and at a dose of 10 ml per kg of animal body weight (500, 250 and 125 mg/kg), from 2 weeks before the start of DEXA administration, once daily for 24 days. It was forcibly administered orally using a 1 ml syringe with zonde attached, and oxymetholone powder was also dissolved in sterile distilled water at a concentration of 15 mg/ml (oxymetholone itself, 5 mg/ml concentration), and 10 ml per kg of animal body weight. It was orally administered in the same manner as TCcp at a dose (150 mg/kg-50 mg/kg as oxymetholone). In the normal medium control group and the GLU control group, only the same volume of sterile distilled water was orally administered instead of TCcp or oxymetholone. The dose of oxymetholone used in this experiment was 50 mg/kg (Pavlatos et al., 2001; Isaacs et al., 2011; Kim et al., 2015ab) as the administered dose based on the results of previous animal experiments, and TCcp Also, based on the previous in vivo bioavailability evaluation (Kirakosyan et al., 2015) and drug efficacy experiments (Tall et al., 2004), 500, 250 and 125 mg/kg were selected as high-dose, medium-dose, and low-dose administration groups, respectively.

Measurement of calf muscle tension

According to the previous experimental methods (Kim et al., 2015ab), 1 hour after the last 24 doses of TCcp or oxymetholone (10 doses of DEXA), the tension of the left calf muscle of all experimental animals was measured using a computerized testing device (Computerized testing). machine for muscle strengths: SV-H1000, Japan Instrumentation System Co., Tokyo, Japan), was measured in Newton (N) units, respectively. That is, each mouse is fixed to the measuring device using a 1-0 silk suture knot performed on the chest area and the left posterior ankle area, and then recorded while the angle of the ankle reaches 0° (15-20 mm). The maximum tensile strength was recorded and considered as the calf muscle tension.

Other observation items

Body weight, calf thickness and tension, blood biochemistry, gastrointestinal muscle weight, thickness, tissue and immunohistochemical changes, and changes in the antioxidant defense system were observed to evaluate the effects and mechanisms of action of TCcp on catabolic muscle atrophy, and disruption of muscle proteins. And mRNA expression patterns known to be involved in the synthesis were also evaluated in the gastrocnemius.

Antioxidant defense system: reactive oxygen species (ROS) and glutathione (GSH) content in gastrocnemius muscle, superoxide dismutase (SOD) and catalase (CAT) activity, lipid peroxidation (malondialdehyde (MDA) content).

Blood biochemistry : creatine, CK and LDH content

MRNA expression involved in the disruption and synthesis of muscle proteins : Atrogin-1, muscle RING-finger protein-1 (MuRF1), phosphatidylinositol 3-kinase (PI3k) p85α, adenosine A1 receptor (A1R), transient receptor potential cation cannel subfamily V member 4 (TRPV4), myostatin and Sirtulin 1 (SIRT1) (Table 1). The oligonucleotides for Realtime RT-PCR used in this experiment are shown in Table 1 below.

Target 5’-3’ Sequence Size(bp) Gene ID Atrogin-1 Forward CAGCTTCGTGAGCGACCTC 244 67731 Reverse GGCAGTCGAGAAGTCCAGTC MuRF 1 Forward GACAGTCGCATTTCAAAGCA 194 433766 Reverse GCCTAGCACTGACCTGGAAG PI3K p85α Forward GCCAGTGGTCATTTGTGTTG 236 18708 Reverse ACACAACCAGGGAAGTCCAG Akt 1 Forward ATGAACGACGTAGCCATTGTG 116 11651 Reverse TTGTAGCCAATAAAGGTGCCAT Adenosine A1R Forward TGTTCCCAGGGCCTTTCAC 155 11539 Reverse TAATGGACTGAGACTAGCTTGACTGGTA TRPV4 Forward CAGGACCTCTGGAAGAGTGC 165 63873 Reverse AAGAGCTAGCCTGGACACCA Myostatin Forward CCTCCACTCCGGGAACTGA 185 17700 Reverse AAGAGCCATCACTGCTGTCATC SIRT1 Forward TTCACATTGCATGTGTGTGG 175 93759 Reverse TGAGGCCCAGTGCTCTAACT 18s Ribosomal RNA Forward AGCCTGAGAAACGGCTACC 252 19791 Reverse TCCCAAGATCCAACTACGAG

General histopathological observation : average muscle fiber diameter and ratio of collagen fibers

Immunohistochemical observations : apoptotic marks [caspase-3 and cleaved poly(ADP-ribose) polymerase (PARP)], oxidative stress [nitrotyrosine and inducible nitric oxide synthase (iNOS)], lipid peroxidation [4-hydroxynonenal (4-HNE) ] And muscle growth inhibitory factor [myostatin] (Table 2). Primary Antisera and Detection Kits were used for this experiment, and the specific configuration of the kit is shown in Table 2 below. All antisera (antiserum) in this experiment was diluted with 0.01M phosphate buffered saline and used.

Antisera or detection kits Code Source Dilution Primary antisera* Anti-cleaved caspase-3 (Asp175) polyclonal antibody 9661 Cell Signaling Technology Inc, Danvers, MA, USA 1:400 Anti-cleaved PARP (Asp214) specific antibody 9545 Cell Signaling Technology Inc, Danvers, MA, USA 1:100 Anti-4-Hydroxynonenal polyclonal antibody Ab46545 Abcam, Cambridge, UK 1:100 Anti-Nitrotyrosine polyclonal antibody 06-284 Millipore Corporation, Billerica, CA, USA 1:200 Anti-nitric oxide synthase2 (N-20) polyclonal antibody sc-651 Santa Cruz Biotechnology, Burlingame, CA, USA 1:100 Anti-GDF8/Myoststin antibody Ab71808 Abcam, Cambridge, UK 1:50 Detection kits Vectastain Elite ABC Kit PK-6200 Vector Lab. Inc., Burlingame, CA, USA 1:50 Peroxidae substrate kit SK-4100 Vector Lab. Inc., Burlingame, CA, USA 1:50

<Experiment result>

Experimental Example 1. Changes in body weight and weight gain

It was attempted to compare the effects of each sample administration by measuring the change in body weight and weight gain of mice during the sample administration period for a total of 24 days, including the sample pre-administration period for 14 days and the DEXA administration period for 10 days.

As a result of the experiment, from 5 days after the start of DEXA administration, significant (p<0.01) weight loss compared to the normal medium control group began to appear in the GLU control group. The weight gain during the period also showed a significant (p<0.01) decrease, respectively. In the Oxymetholone, TCcp 500 and 250 mg/kg administration groups, significant (p<0.01 or p<0.05) weight gain compared to the GLU control group began to appear 5 days after the start of DEXA administration, followed by a 10-day DEXA administration period and a 24-day experiment. The weight gain over the entire period also showed a significant (p<0.01) increase compared to the GLU control group.

That is, in the TCcp 500 and 250 mg/kg administration group, the dose-dependent weight loss inhibitory effect was confirmed (Table 3, Fig. 2). The change in the weight gain of the glucocorticoid (dexamethasone)-induced muscular dystrophy mice is shown in Table 3 and FIG. 2 below.

division Change in weight gain (g) Sample pre-administration period
(14 days) (With sample)
DEXA administration period
(10 days) Sample full-dose period
(Total 24 days) Control Intact 5.54±0.86 1.56±0.56 3.29±0.97 GLU 5.51±0.50 -5.61±0.85 -4.10±0.73 Comparative Example (Reference) Oxymetholone 5.31±0.57 -1.11±0.37 0.21±0.62 Example TCcp 500 mg/kg 5.58±0.72 -2.43±0.70 -0.70±1.19 TCcp 250 mg/kg 5.44±0.79 -3.04±0.92 -1.43±0.91 TCcp 125 mg/kg 5.70±0.60 -5.61±0.88 -3.60±0.83

Looking at Table 3, the weight gain during the 14-day pre-administration period was -0.45% in the GLU control group compared to the normal medium control group, and in the oxymetholone, TCcp 500, 250 and 125 mg/kg administration groups, respectively Compared to the GLU control group, -3.63%, 1.13%, -1.36% and 3.40% were changed.

During the 10-day DEXA administration period, the GLU control group showed a change of -459.20% compared to the normal medium control group, but in the oxymetholone, TCcp 500, 250, and 125 mg/kg groups, 81.18% and 57.79%, respectively, compared to the GLU control group. , 46.88% and 1.00%.

During the entire 24-day experiment, the GLU control group showed a change of -224.71% compared to the normal medium control group, but the oxymetholone, TCcp 500, 250, and 125 mg/kg administration groups showed 106.18% and 83.93%, respectively, compared to the GLU control group. , 66.24% and 13.20%.

<Consideration on Experimental Example 1>

The decrease in body weight and weight gain in the GLU control group in this experiment was a part of the wasting cachexia caused by the strong catabolic action of DEXA itself [Gupta and Chow, 2004; Cho et al., 2011], and a previous report that the dose-dependent increase in body weight and weight gain observed in the TCcp 500 and 250 mg/kg administration groups is generally accompanied by weight gain when oral administration of an immunoactive substance. [Duarte et al., 2000; Pinzone Fox et al., 2005], the well-known anti-inflammatory and antioxidant-related immunomodulatory effects of TCcp [Wang et al., 1999; Howatson et al., 2010; Bell et al., 2014b]. In addition, oxymetholone, as a representative anabolic steroid, inhibits catabolic action by GLU administration [Hengge et al., 1996, 2003ab], and is thought to cause a significant weight gain.

Experimental Example 2. Change in calf thickness

The effect of each sample administration was compared by measuring the change in the calf thickness of the mouse during the sample administration period for a total of 24 days including the sample pre-administration period for 14 days and the DEXA administration period for 10 days.

As a result of the experiment, from 19 days after the start of sample administration, that is, 5 days after the start of DEXA administration, a significant (p<0.01) reduction in calf thickness began to be recognized in the GLU control group compared to the normal control group, and was recognized throughout the experiment. The change in calf thickness during the 10 days DEXA administration period and the entire 24 days experiment also showed a significant (p<0.01) reduction compared to the normal medium control group. In the group administered with TCcp 500 and 250 mg/kg, a significant (p<0.01) increase in calf thickness compared to the GLU control group began to be recognized in a dose-dependent manner from 5 days after the start of DEXA administration, and the DEXA administration period for 10 days and a total of 24 days. The change in calf thickness during the entire period of the experiment also showed a significant (p<0.01) increase compared to the GLU control group.

In the Oxymetholone-administered group, a significant (p<0.01) increase in calf thickness compared to the normal medium control and GLU control was recognized from 5 days after the start of DEXA administration, and the calf thickness for the entire duration of the experiment for 10 days and 24 days The change also showed a significant (p<0.01) increase compared to the GLU control group.

As a result of this experiment, no significant change in calf thickness was observed in the TCcp 125 mg/kg administration group compared to the GLU control group, and the TCcp 500 mg/kg administration group suppressed the reduction in calf thickness, which was relatively low compared to the oxymetholone 50 mg/kg administration group. The effect was recognized (Table 4, FIGS. 3 and 4). Changes in calf thickness of glucocorticoid (dexamethasone)-induced muscular dystrophy mice are shown in Tables 4 and 3 below, and changes in calf muscle mass are shown in FIG. 4.

division Calf thickness change (mm) Sample pre-administration period
(14 days) (With sample)
DEXA administration period
(10 days) Sample full-dose period
(Total 24 days) Control Intact 0.24±0.04 0.08±0.05 0.31±0.06 GLU 0.24±0.05 -0.92±0.05 -0.69±0.05 Comparative Example (Reference) Oxymetholone 0.27±0.04 -0.36±0.04 -0.10±0.05 Example TCcp 500 mg/kg 0.25±0.03 -0.45±0.07 -0.20±0.08 TCcp 250 mg/kg 0.23±0.03 -0.51±0.08 -0.28±0.09 TCcp 125 mg/kg 0.22±0.04 -0.86±0.11 -0.64±0.11

Looking at Table 4, the amount of change in calf thickness during the 14-day sample pre-administration period was -1.05% in the GLU control group compared to the normal medium control group, and in the oxymetholone, TCcp 500, 250 and 125 mg/kg administration groups They showed changes of 12.77, 8.09, -2.13 and -6.91%, respectively, compared to the GLU control group.

The change in calf thickness during the 10-day DEXA administration period was -1306.56% in the GLU control group compared to the normal medium control group, but in the oxymetholone, TCcp 500, 250, and 125 mg/kg groups, 61.60 and 51.68, respectively, compared to the GLU control group. , 45.16 and 8.07%.

The change in calf thickness over the entire period of the experiment for 24 days was -318.33% in the GLU control group compared to the normal medium control group, but in the oxymetholone, TCcp 500, 250, and 125 mg/kg groups, 86.77%, compared to the GLU control group, respectively. It showed changes of 71.84%, 59.58% and 8.12%.

Experimental Example 3. Change in gastrocnemius thickness after muscle exposure

The effect of each sample administration was compared by measuring the change in the thickness of the gastrocnemius muscle after muscle exposure through removal of the skin of the mouse.

As a result of the experiment, a significant (p<0.01) reduction in gastrocnemius muscle thickness was observed in the GLU control group compared to the normal medium control group, but the oxymetholone 50 mg/kg, TCcp 500, and 250 mg/kg groups were significantly (p. <0.01) An increase in gastrocnemius thickness was recognized. As a result of this experiment, the dose-dependent gastrocnemius muscle thickness reduction inhibitory effect was confirmed in the TCcp 500 and 250 mg/kg administration groups (FIG. 5).

The GLU control group showed a change of -27.73% in gastrocnemius thickness after muscle exposure compared to the normal medium control group, but in the oxymetholone, TCcp 500, 250 and 125 mg/kg groups, 23.15%, 15.79%, 11.93% and respectively compared to the GLU control group. It showed a change of 4.06%.

Experimental Example 4. Changes in gastrocnemius weight

To compare the effect of each sample administration by measuring the change in the weight of the gastrocnemius of the mouse.

As a result of the experiment, in the GLU control group, significant (p<0.01) reductions in the absolute and relative weight of the gastrocnemius were recognized, respectively, but in the oxymetholone 50 mg/kg, TCcp 500, and 250 mg/kg administration groups, compared to the GLU control group. A significant (p<0.01) increase in gastrocnemius weight was recognized. As a result of this experiment, the dose-dependent gastrocnemius muscle weight reduction inhibitory effect was recognized in the TCcp and 250 mg/kg administration groups, but the TCcp 125 mg/kg administration group did not show any significant changes in gastrocnemius muscle weight compared to the GLU control group. Compared to the oxymetholone 50 mg/kg administration group in the 500 mg/kg administration group, a relatively low gastrocnemius weight reduction inhibitory effect was recognized (Fig. 6).

In the GLU control group, the absolute calf muscle weight showed a change of -41.57% compared to the normal medium control group, but in the oxymetholone, TCcp 500, 250 and 125 mg/kg groups, 45.53, 30.41, 21.46 and 4.17% changes compared to the GLU control group, respectively. Is shown.

In the case of the GLU control group, the relative weight of the calf muscle to body weight showed a change of -26.96% compared to the normal medium control group, but in the oxymetholone, TCcp 500, 250, and 125 mg/kg administration groups, 26.13%, 17.39%, and 17.39%, respectively, compared to the GLU control group. It showed changes of 11.93% and 2.88%.

Experimental Example 5. Change of calf muscle tension

It was attempted to compare the effect of each sample administration by measuring the change in the calf muscle tension of the mouse.

As a result of the experiment, in the GLU control group, a significant (p<0.01) decrease in calf muscle tension was recognized compared to the normal medium control group, but in the oxymetholone 50 mg/kg, TCcp 500 and 250 mg/kg group, it was significantly (p<0.01) compared to the GLU control group. <0.01) An increase in tension was recognized. As a result of this experiment, the dose-dependent calf muscle tension reduction inhibitory effect was recognized in the TCcp 500 and 250 mg/kg administration group, but no significant change in calf muscle tension was recognized in the TCcp 125 mg/kg administration group compared to the GLU control group. In addition, in the TCcp 500 mg/kg administration group, a comparatively low calf muscle tension reduction inhibitory effect was recognized as compared to the oxymetholone 50 mg/kg administration group (FIG. 7).

In the GLU control group, the calf muscle tension showed a change of -47.81% compared to the normal medium control group, but in the oxymetholone, TCcp 500, 250 and 125 mg/kg groups, 51.61%, 37.76%, 22.36% and 4.69%, respectively, compared to the GLU control group. Showed a change of.

<Consideration on Experimental Examples 2 to 5>

By administering a high dose of GLU, a decrease in the diameter of muscle fibers due to protein breakdown in muscle cells, ie, catabolic muscle atrophy, occurs [Gilson et al., 2007; Jones et al., 2010; Qin et al., 2013; Kim et al., 2015a]. In this experiment, as a result of catabolic muscle atrophy due to GLU, a decrease in calf thickness was recognized 5 days after the start of DEXA administration, and a remarkable decrease in the thickness and weight of the gastrocnemius muscle at the final autopsy resulted in a decrease in GLU-fuji calf muscle tension. . On the other hand, these reductions in calf muscle tension, gastrocnemius muscle thickness, and weight were suppressed in a dose-dependent manner by the administration of TCcp 500 and 250 mg/kg. These results indicate that TCcp is lower than 50 mg/kg of oxymetholone at doses of 500 and 250 mg/kg, but it is judged as one of the direct evidences showing a definite muscle protective effect.

Experimental Example 6. Blood biochemical changes

Biochemical changes such as changes in the content of indicator substances in mouse blood were measured to compare the effects of administration of each sample.

As a result of the experiment, the GLU control group showed a significant (p<0.01) increase in blood creatine and CK content compared to the normal medium control group along with a significant (p<0.01) decrease in blood LDH content. On the other hand, in the oxymetholone 50 mg/kg, TCcp 500, and 250 mg/kg administration groups, there was a significant (p<0.01 or p<0.05) reduction in blood creatine and CK content and a significant (p<0.01) blood LDH content compared to the GLU control group, respectively. Has been recognized.

That is, in the group administered with TCcp 500 and 250 mg/kg, it was confirmed that the dose-dependent increase in blood creatine and CK content and the inhibitory effect of decreasing the blood LDH content were confirmed (Table 5). The contents of Creatine, CK, and LDH in the blood of glucocorticoid (dexamethasone)-induced muscular dystrophy mice were measured and shown in Table 5 below.

division Serum levels Creatine(mg/dl) Creatine kinase (IU/I) LDH(IU/I) Control Intact 0.34±0.04 83.75±20.86 665.50±128.94 GLU 0.86±0.13 281.63±55.15 168.25±50.55 Comparative Example (Reference) Oxymetholone 0.44±0.06 148.00±17.78 318.50±79.79 Example TCcp 500 mg/kg 0.55±0.10 186.00±15.94 281.50±25.53 TCcp 250 mg/kg 0.64±0.09 208.88±20.95 241.13±38.72 TCcp 125 mg/kg 0.83±0.10 270.25±40.21 178.88±61.66

Looking at Table 5, in the GLU control group, the blood creatine content was changed by 152.77% compared to the normal medium control group, but in the oxymetholone, TCcp 500, 250, and 125 mg/kg administration groups, -48.32, -35.33, -, respectively, compared to the GLU control group. It showed a change of 25.11 and -3.36%.

In the GLU control group, the CK content in the blood showed a change of 236.27% compared to the normal medium control group, but in the oxymetholone, TCcp 500, 250 and 125 mg/kg groups, -47.45, -33.95, -25.83 and -4.04%, respectively, compared to the GLU control group. Showed a change of. The blood LDH content in the GLU control group showed a change of -74.72% compared to the normal medium control group, but in the oxymetholone, TCcp 500, 250, and 125 mg/kg groups, 89.30%, 67.31%, 43.31% and 6.32%, respectively, compared to the GLU control group. Showed a change of.

< Consideration on Experimental Example 6 >

Creatine is a kind of nitrogen-containing organic acid that mainly exists in the muscles of vertebrates and plays an important role in supplying energy to the cells.It is produced in the liver and kidneys and is stored in the plasma through the active transport system and stored as muscles in the muscle itself. It is known that there is no enzyme required for production [Wyss and Kaddurah-Daouk, 2000]. Currently 98% of the total creatine content in the body is found in muscles [Hunter, 1928], and it is known to always maintain a constant ratio [Balsom et al., 1994]. Creatine is constantly metabolized to creatinine, a nonionic cyclic derivative, 1.7% per day [Fitch et al., 1968], and the change from creatinine to creatine does not occur in vivo [Bloch and Schoenheimer, 1939]. In addition, the formed creatinine is also rapidly diffused from the muscle to the plasma and is lost, and reabsorption into the muscle does not occur [Wyss and Kaddurah-Daouk, 2000], so the content of creatine and creatinine in the body is always kept constant, and the activity and amount of skeletal muscle Maintains a constant equilibrium in [Heymsfield et al., 1983; Wyss and Kaddurah-Daouk, 2000]. Therefore, the content of creatine in the blood is used as an important blood biochemical indicator to measure the activity and amount of skeletal muscle, and an increase in creatine content means the destruction of skeletal muscle fibers [Sala et al., 2005; Stimpson et al., 2012; Kim et al., 2015a].

As a result of this experiment, previous studies [Kanda et al., 1999; Kim et al., 2015a], an increase in blood creatine content was caused by catabolic muscle atrophy caused by DEXA administration, but the increase in blood creatine content by this GLU was caused by TCcp 500 and 250 mg/kg administration. Was significantly suppressed in a dose-dependent manner. These results were lower than that of oxymetholone 50 mg/kg, but it was once again judged as one of the indirect evidences that TCcp showed muscle protective effects at the doses of 500 and 250 mg/kg.

LDH is an enzyme responsible for the decomposition of lactic acid. It is intensively present in red blood cells and heart muscle cells, and CK (Creatine kinase) is also an important enzyme responsible for supplying ATP through the decomposition of creatine in various cells, especially muscle cells. Therefore, since these cells are released into the blood when the cells are damaged, they can be used as indicators of cell damage such as muscle damage. In particular, simultaneous elevation of CK and LDH in blood has been used as a biochemical indicator of muscle damage [Zhang et al. ., 2012; Choi et al., 2013; Kim et al., 2015a], a remarkable increase in blood CK and LDH occurs even during muscle atrophy [Cohen et al., 1999], but in the case of catabolic muscle atrophy caused by DEXA, CK in blood due to muscle fiber damage due to protein breakdown. While an increase in the content is caused, a decrease in the content of LDH in the blood is accompanied by a decrease in muscle physiological activity [Orzechowski et al., 2002; Pellegrino et al., 2004; Kim et al., 2015a]. In the results of this experiment, a significant increase in blood CK content as an indicator of muscle damage caused by DEXA and a decrease in blood LDH content due to a decrease in muscle activity were caused. The reduction of was significantly suppressed in a dose-dependent manner by administration of TCcp 500 and 250 mg/kg. These results were also lower than oxymetholone 50 mg/kg, but TCcp was judged to be indirect evidence showing muscle protective effects at doses of 500 and 250 mg/kg.

Experimental Example 7. Changes in the gastrocnemius antioxidant defense system

Experimental Example 7-1. Change of gastrocnemius MDA

The change in the content of Malondialdehyde (hereinafter referred to as "MDA") in the gastrocnemius muscle of glucocorticoid (dexamethasone)-induced muscular dystrophy mice was measured to compare the effects of administration of each sample.

As a result of the experiment, a significant (p<0.01) increase in lipid peroxidation in the gastrocnemius muscle, i.e., an increase in MDA content, was recognized in the GLU control group compared to the normal medium control group, but in the oxymetholone, TCcp 500, and 250 mg/kg administration groups, compared to the GLU control group A significant (p<0.01) decrease in MDA content was recognized. As a result of this experiment, a dose-dependent gastrointestinal lipid peroxidation inhibitory effect was recognized in the TCcp 500 and 250 mg/kg administration group, but no significant change in gastrocnemius lipid peroxidation was observed in the TCcp 125 mg/kg administration group compared to the GLU control group. , Compared to the oxymetholone 50 mg/kg administration group in the TCcp 500 mg/kg administration group, a relatively low DEXA-induced gastrocnemius lipid peroxidation inhibitory effect was recognized (Table 6). Changes in the antioxidant defense system in the gastrocnemius muscle of glucocorticoid (dexamethasone)-induced muscular dystrophy mice were measured and shown in Table 6 below.

division Serum levels MDA
(nM/mg protein) ROS
(RFU/μg protein) GSH
(nM/mg protein) SOD
(nM/mim/mg protein) CAT
(U/mg protein) Control Intact 1.87±0.75 22.57±10.53 0.66±0.16 35.39±13.08 7.25±2.02 GLU 8.54±1.22 70.01±15.85 0.17±0.07 11.97±2.11 2.07±0.56 Comparative Example (Reference) Oxymetholone 4.53±0.93 32.57±11.84 0.41±0.12 22.79±4.32 3.88±0.63 Example TCcp 500 5.19±0.89 39.40±11.09 0.31±0.10 19.36±2.79 3.56±0.99 TCcp 250 6.17±1.25 46.36±13.36 0.28±0.06 17.39±2.19 3.21±0.92 TCcp 125 8.22±1.40 66.31±22.46 0.18±0.08 12.77±2.59 2.19±0.59

Looking at Table 6, in the GLU control group, the MDA content in the gastrocnemius muscle tissue on the final sacrifice day showed a change of 356.07% compared to the normal medium control group, but in the oxymetholone, TCcp 500, 250, and 125 mg/kg administration groups, respectively, compared to the GLU control group. Changes of -46.93%, -39.18%, -27.75% and -3.76% were shown.

Experimental Example 7-2. Changes in gastrocnemius ROS content

The change of ROS content in the gastrocnemius muscle of glucocorticoid (dexamethasone)-induced muscular dystrophy mice was measured to compare the effects of administration of each sample.

As a result of the experiment, a significant (p<0.01) increase in ROS in the gastrocnemius was observed in the GLU control group compared to the normal medium control group, but the oxymetholone, TCcp 500, and 250 mg/kg administration groups were significantly more significant than the GLU control group (p<0.01 or p<0.05) A decrease in ROS content was recognized. As a result of this experiment, in the group administered with TCcp 500 and 250 mg/kg, the dose-dependent effect of inhibiting the increase of ROS content in the gastrocnemius was recognized, but in the group administered with TCcp 125 mg/kg, the significant change in the ROS content in the gastrocnemius was observed compared to the GLU control group. It was not recognized, and the effect of inhibiting the increase of ROS content in the gastrocnemius muscle induced by DEXA relatively low was recognized in the TCcp 500 mg/kg administration group compared to the oxymetholone 50 mg/kg administration group (Table 6).

Looking at Table 6, in the GLU control group, the ROS content in the gastrocnemius muscle tissue on the final sacrificial day showed a change of 210.18% compared to the normal medium control, but in the oxymetholone, TCcp 500, 250, and 125 mg/kg administration groups, respectively, compared to the GLU control group- It showed changes of 53.48%, -43.73%, -33.78% and -5.28%.

Experimental Example 7-3. Changes in GSH content in gastrocnemius muscle

The change in the content of Glutathione (hereinafter referred to as "GSH") in the gastrocnemius muscle of glucocorticoid (dexamethasone)-induced muscular dystrophy mice was measured to compare the effect of administration of each sample.

As a result of the experiment, a significant (p<0.01) decrease in GSH content in the gastrocnemius muscle tissue was recognized in the GLU control group compared to the normal medium control group, but the oxymetholone, TCcp 500, and 250 mg/kg administration groups were significantly compared to the GLU control group. (p<0.01 or p<0.05) An increase in GSH content in muscle tissue was recognized. As a result of this experiment, in the group administered with TCcp 500 and 250 mg/kg, a dose-dependent inhibitory effect on the reduction of GSH content in the gastrocnemius was recognized, but in the group administered with TCcp 125 mg/kg, a significant change in the GSH content in the gastrocnemius was observed compared to the GLU control group. It was not recognized, and the inhibitory effect of reducing DEXA-induced GSH content in the gastrocnemius muscle was relatively low in the TCcp 500 mg/kg administration group compared to the oxymetholone 50 mg/kg administration group (Table 6).

Looking at Table 6, in the GLU control group, the GSH content in the gastrocnemius muscle tissue on the final sacrifice day showed a change of -74.10% compared to the normal medium control group, but in the oxymetholone, TCcp 500, 250, and 125 mg/kg administration groups, respectively, compared to the GLU control group. It showed changes of 139.71%, 82.35%, 66.18% and 8.09%.

Experimental Example 7-4. Changes in gastrocnemius SOD activity

The change in the activity of Superoxide dismutase (hereinafter referred to as "SOD") in the gastrocnemius muscle of glucocorticoid (dexamethasone)-induced muscular dystrophy mice was measured to compare the effect of administration of each sample.

As a result of the experiment, a significant (p<0.01) decrease in SOD activity, an endogenous antioxidant enzyme in gastrocnemius muscle tissue, was recognized in the GLU control group compared to the normal medium control group, but GLU in the oxymetholone 50 mg/kg, TCcp 500, and 250 mg/kg administration groups, respectively. Compared to the control group, a significant (p<0.01) increase in SOD activity in muscle tissue was recognized. As a result of this experiment, the dose-dependent inhibitory effect of reducing SO D activity in the gastrocnemius was recognized in the group administered with TCcp 500 and 250 mg/kg, but the change in SOD activity in the gastrocnemius was significant in the group administered with TCcp 125 mg/kg compared to the GLU control group. Was not recognized, and the inhibitory effect of reducing DEXA-induced SOD activity in the gastrocnemius muscle was relatively low in the TCcp 500 mg/kg administration group compared to the oxymetholone 50 mg/kg administration group (Table 6).

Looking at Table 6, in the GLU control group, the SOD activity in the gastrocnemius muscle tissue on the final sacrifice day showed a change of -66.18% compared to the normal medium control group, but in the oxymetholone, TCcp 500, 250, and 125 mg/kg administration groups, respectively, compared to the GLU control group. It showed changes of 90.43%, 61.79%, 45.28% and 6.73%.

Experimental Example 7-5. Changes in gastrocnemius CAT activity

The change in the activity of Catalase (hereinafter referred to as "CAT") in the gastrocnemius muscle of glucocorticoid (dexamethasone)-induced muscular dystrophy mice was measured to compare the effects of administration of each sample.

As a result of the experiment, a significant (p<0.01) decrease in CAT activity, an endogenous antioxidant enzyme in gastrocnemius muscle tissue, was recognized in the GLU control group compared to the normal medium control group, but the oxymetholone, TCcp 500, and 250 mg/kg administration groups were significantly compared to the GLU control group. An increase in CAT activity in muscle tissue was observed (p<0.01). As a result of this experiment, in the group administered with TCcp 500 and 250 mg/kg, a dose-dependent inhibitory effect of reducing intragastric CAT activity was recognized, but in the group administered with TCcp 125 mg/kg, the significant change in CAT activity in the gastrocnemius was observed compared to the GLU control group. It was not recognized, and the inhibitory effect of reducing DEXA-induced CAT activity in the gastrocnemius muscle was relatively low in the TCcp 500 mg/kg administration group compared to the oxymetholone 50 mg/kg administration group (Table 6).

Looking at Table 6, in the GLU control group, the CAT activity in the gastrocnemius muscle tissue on the final sacrifice day showed a change of -71.45% compared to the normal medium control group, but in the oxymetholone, TCcp 500, 250, and 125 mg/kg administration groups, respectively, compared to the GLU control group. It showed changes of 87.31%, 72.21%, 54.92% and 5.74%.

< Consideration on Experimental Example 7>

Various toxic substances formed by lipid peroxidation, especially ROS, are known to cause destruction of surrounding tissues [Comporti, 1985], and oxidative stress is also acting as a very important etiology for muscle atrophy [Powers et al., 2007] . GSH is a representative endogenous antioxidant, and is known to inhibit various tissue damage by reducing free radicals formed in cells, and thus acts as a representative antioxidant factor in tissues [Odabasoglu et al., 2006]. In addition, SOD is a representative antioxidant enzyme in the cell and plays a role in removing various oxidizing substances from cells. CAT is also an enzyme that converts H ₂ O ₂ , a strong active oxidizing substance, into H ₂ O [Cheeseman and Slater, 1993]. Therefore, lipid peroxidation, increase in ROS, decrease in GSH content, and inhibition of SOD and catalase activity occupy a very important position in inhibiting various tissue damage including muscle [Gore et al., 1998; Sㆌleyman et al., 2009; He et al., 2012]. Meanwhile, 4-HNE is an α, β-unsaturated hydroxyalkenal produced by lipid peroxidation of cells, and is attracting attention as a cause of various diseases, especially chronic inflammation, neuropathic diseases, adult respiratory distress syndrome, vascular disease, diabetes and tumors. It has been used as a marker for lipid peroxidation [Zarkovic, 2003; Dubinina and Dadali, 2010; Smathers et al., 2011]. In addition, nitrotyrosine is a product of tyrosine nitration mediated by reactive nitrogen species such as peroxynitrite anion and nitrogen dioxide, is involved in various oxidative stress disorders, and is used as a representative iNOS-related oxidative stress marker [Chen et al., 2004 ; Mohiuddin et al., 2006; Pacher et al., 2007].

As a result of this experiment, the number of nitrotyrosine, 4-HNE and iNOS-positive muscle fibers increased immunohistochemically with GLU-induced increase in lipid peroxidation in gastrocnemius muscle, increase in ROS content, decrease in GSH content, CAT and SOD activity. Admittedly, previous studies [Powers et al., 2007; Salvini et al., 2012; Kim et al., 2015a], it was observed that GLU-induced muscle atrophy is caused by damage to the antioxidant defense system. It was observed that TCcp 500 and 250 mg/kg significantly inhibited the inhibition of intramuscular lipid peroxidation and antioxidant defense system by DEXA in a dose-dependent manner, and at least in part under the conditions of this experiment, in the TCcp 500 and 250 mg/kg administration groups. It is judged that the recognized muscle atrophy inhibitory effect is caused by the activity of the antioxidant defense system.

Experimental Example 8. Changes in gastrocnemius mRNA expression by realtime RT-PCR

Experimental Example 8-1. Changes in gastrointestinal Atrogin-1 mRNA expression

The effect of administration of each sample was compared by measuring the change in Atrogin-1 mRNA expression in the gastrocnemius of glucocorticoid (dexamethasone)-induced muscular dystrophy mice.

As a result of the experiment, a significant (p<0.01) increase in gastrointestinal Atrogin-1 mRNA expression was observed in the GLU control group compared to the normal medium control group, but the oxymetholone, TCcp 500, and 250 mg/kg administration groups were significantly (p. <0.01) The decrease in Atrogin-1 mRNA expression was recognized.As a result of this experiment, a clear dose dependence was recognized in the TCcp 500 and 250 mg/kg administration groups, but the TCcp 125 mg/kg administration group had significant gastrointestinal muscle compared to the GLU control group. The change in Atrogin-1 mRNA expression was not recognized, and a relatively low DEXA-induced gastrointestinal Atrogin-1 mRNA expression inhibition effect was observed in the TCcp 500 mg/kg administration group compared to the oxymetholone 50 mg/kg administration group (Table 7). Changes in mRNA expression in gastrocnemius muscles of glucocorticoid (dexamethasone)-induced muscular dystrophy mice were measured using Realtime RT-PCR, and are shown in Table 7 below.

division Control Comparative example Example (mg/kg) Intact GLU oxymetholone TCcp 500 TCcp 250 TCcp 125 Atrogin-1 0.99±0.07 4.89±0.69 2.26±0.55 3.00±0.74 3.59±0.81 4.59±0.64 MuRF1 1.08±0.22 6.29±1.10 3.06±0.67 4.36±1.07 4.76±0.67 5.99±1.88 PI3K p85α 1.04±0.14 0.59±0.11 1.15±0.37 0.88±0.10 0.77±0.12 0.64±0.14 Akt1 1.02±0.05 0.54±0.06 0.87±0.11 0.74±0.06 0.67±0.07 0.57±0.12 A1R 1.05±0.14 0.51±0.13 0.87±0.07 0.77±0.08 0.70±0.10 0.54±0.17 TRPV4 1.11±0.10 0.37±0.09 0.66±0.10 0.61±0.13 0.55±0.10 0.40±0.10 Myostatin 1.03±0.10 7.02±0.99 3.23±0.78 4.72±1.01 5.12±0.79 6.51±1.24 SIRT1 1.03±0.17 10.73±3.03 3.73±1.11 4.57±1.19 6.27±1.35 10.02±1.57

Looking at Table 7, the GLU control group showed a change in gastrointestinal Atrogin-1 mRNA expression of 395.32% compared to the normal medium control group, but in the oxymetholone, TCcp 500, 250, and 125 mg/kg administration groups, -53.85%, compared to the GLU control group, respectively. It showed changes of -38.61%, -26.55% and -6.24%.

Experimental Example 8-2. Changes in gastrocnemius MuRF1 mRNA expression

The effect of administration of each sample was compared by measuring the change in expression of MuRF1 mRNA in the gastrocnemius of glucocorticoid (dexamethasone)-induced muscular dystrophy mice.

As a result of the experiment, a significant (p<0.01) increase in gastrocnemius MuRF1 mRNA expression was observed in the GLU control group compared to the normal medium control group, but the oxymetholone, TCcp 500, and 250 mg/kg administration groups were significantly (p<0.01) compared to the GLU control group. ) A decrease in MuRF1 mRNA expression was recognized. As a result of this experiment, the dose-dependent gastrocnemius MuRF1 mRNA expression inhibition effect was recognized in the TCcp 500 and 250 mg/kg administration groups, whereas the TCcp 125 mg/kg administration group showed significant changes in gastrocnemius MuRF1 mRNA expression compared to the GLU control group. It was not recognized, and the inhibitory effect of increasing DEXA-induced gastrocnemius MuRF1 mRNA expression was relatively low in the TCcp 500 mg/kg administration group compared to the oxymetholone 50 mg/kg administration group (Table 7).

Looking at Table 7, the GLU control group showed a change of 482.85% in gastrocnemius MuRF1 mRNA expression compared to the normal medium control group, but in the oxymetholone, TCcp 500, 250, and 125 mg/kg administration groups, -51.29% and -30.74%, respectively, compared to the GLU control group. %, -24.23% and -4.81%.

Experimental Example 8-3. Changes in gastrocnemius PI3K mRNA expression

The change of PI3K mRNA expression in the gastrocnemius muscle of glucocorticoid (dexamethasone)-induced muscular dystrophy mice was measured to compare the effects of administration of each sample.

As a result of the experiment, a significant (p<0.01) decrease in gastrocnemius PI3K mRNA expression was recognized in the GLU control group compared to the normal medium control group, but the oxymetholone 50 mg/kg, TCcp 500, and 250 mg/kg administration groups were significantly compared to the GLU control group. (p<0.01 or p<0.05) An increase in PI3K mRNA expression was recognized. As a result of this experiment, a dose-dependent gastrocnemius PI3K mRNA expression reduction inhibitory effect was recognized in the TCcp 500 and 250 mg/kg administration groups, whereas the TCcp 125 mg/kg administration group showed significant changes in gastrocnemius PI3K mRNA expression compared to the GLU control group. It was not recognized, and the inhibitory effect of reducing the expression of DEXA-induced gastrocnemius PI3K mRNA was relatively low in the TCcp 500 mg/kg administration group compared to the oxymetholone 50 mg/kg administration group (Table 7).

Looking at Table 7, the GLU control group showed a change in gastrocnemius PI3K mRNA expression -43.55% compared to the normal medium control group, but in the oxymetholone, TCcp 500, 250, and 125 mg/kg administration groups, respectively, 96.15% and 50.64% compared to the GLU control group. , 31.84% and 9.19%.

Experimental Example 8-4. Changes in gastrocnemius Akt1 mRNA expression

The change of Akt1 mRNA expression in the gastrocnemius muscle of glucocorticoid (dexamethasone)-induced muscular dystrophy mice was measured to compare the effects of administration of each sample.

As a result of the experiment, a significant (p<0.01) decrease in gastrocnemius Akt1 mRNA expression was observed in the GLU control group compared to the normal medium control group, but the oxymetholone, TCcp 500, and 250 mg/kg administration groups were significantly (p<0.01) compared to the GLU control group. ) An increase in Akt1 mRNA expression was recognized. As a result of this experiment, the dose-dependent gastrocnemius Akt1 mRNA expression reduction inhibitory effect was recognized in the TCcp 500 and 250 mg/kg administration groups, whereas the TCcp 125 mg/kg administration group showed significant changes in gastrocnemius Akt1 mRNA expression compared to the GLU control group. It was not recognized, and the inhibitory effect of reducing the expression of DEXA-induced gastrocnemius Akt1 mRNA was relatively low in the TCcp 500 mg/kg administration group compared to the oxymetholone 50 mg/kg administration group (Table 7).

Looking at Table 7, GLU control group showed a change of -47.55% in gastrocnemius Akt1 mRNA expression compared to the normal medium control group, but oxymetholone, TCcp 500, 250, and 125 mg/kg administration groups were 61.92% and 39.02% compared to the GLU control group, respectively. , 24.53% and 6.07%.

Experimental Example 8-5. Changes in gastrocnemius A1R mRNA expression

The effect of administration of each sample was compared by measuring the change in A1R mRNA expression in the gastrocnemius of glucocorticoid (dexamethasone)-induced muscular dystrophy mice.

As a result of the experiment, a significant (p<0.01) decrease in gastrocnemius A1R mRNA expression was observed in the GLU control group compared to the normal medium control group, but the oxymetholone, TCcp 500, and 250 mg/kg administration groups were significantly (p<0.01) compared to the GLU control group. ) An increase in A1R mRNA expression was recognized. As a result of this experiment, a dose-dependent gastrocnemius A1R mRNA expression reduction inhibitory effect was recognized in the TCcp 500 and 250 mg/kg administration group, but the significant change in gastrocnemius A1R mRNA expression in the TCcp 125 mg/kg administration group compared to the GLU control group. It was not recognized, and a relatively low inhibitory effect of reducing DEXA-induced gastrocnemius A1R mRNA expression was observed in the TCcp 500 mg/kg administration group compared to the oxymetholone 50 mg/kg administration group (Table 7).

Looking at Table 7, the GLU control group showed a change of -51.43% in gastrocnemius A1R mRNA expression compared to the normal medium control group, and in the oxymetholone, TCcp 500, 250, and 125 mg/kg administration groups, 70.59% and 50.98%, respectively, compared to the GLU control group. , 37.99% and 6.62%.

Experimental Example 8-6. Changes in gastrocnemius TRPV4 mRNA expression

The effect of administration of each sample was compared by measuring the change in expression of TRPV4 mRNA in the gastrocnemius muscle of glucocorticoid (dexamethasone)-induced muscular dystrophy mice.

As a result of the experiment, a significant (p<0.01) decrease in gastrocnemius TRPV4 mRNA expression was observed in the GLU control group compared to the normal medium control group, but the oxymetholone, TCcp 500, and 250 mg/kg administration groups were significantly (p<0.01) compared to the GLU control group. ) An increase in TRPV4 mRNA expression was recognized. As a result of this experiment, the dose-dependent gastrocnemius TRPV4 mRNA expression reduction inhibitory effect was recognized in the TCcp 500 and 250 mg/kg administration group, but the significant change in gastrocnemius TRPV4 mRNA expression in the TCcp 125 mg/kg administration group compared to the GLU control group. It was not recognized, and the inhibitory effect of reducing the expression of DEXA-induced gastrocnemius TRPV4 mRNA was relatively low in the TCcp 500 mg/kg administration group compared to the oxymetholone 50 mg/kg administration group (Table 7).

Looking at Table 7, the GLU control group showed a change in gastrocnemius TRPV4 mRNA expression -67.04% compared to the normal medium control group, but in the oxymetholone, TCcp 500, 250, and 125 mg/kg administration groups, 80.82% and 68.15%, respectively, compared to the GLU control group. , 49.66% and 8.22%.

Experimental Example 8-7. Changes in gastrocnemius myostatin mRNA expression

To compare the effects of administration of each sample by measuring the change in myostatin mRNA expression in the gastrocnemius muscle of glucocorticoid (dexamethasone)-induced muscular dystrophy mice.

As a result of the experiment, a significant (p<0.01) increase in gastrocnemius myostatin mRNA expression was observed in the GLU control group compared to the normal medium control group, but the oxymetholone, TCcp 500, and 250 mg/kg administration groups were significantly (p<0.01) compared to the GLU control group. ) A decrease in myostatin mRNA expression was observed. As a result of this experiment, a dose-dependent gastrocnemius myostatin mRNA expression inhibition effect was recognized in the TCcp 500 and 250 mg/kg administration groups, whereas the TCcp 125 mg/kg administration group showed significant changes in gastrocnemius myostatin mRNA expression compared to the GLU control group. It was not recognized, and the inhibitory effect of increasing DEXA-induced gastrocnemius myostatin mRNA expression was relatively low in the TCcp 500 mg/kg administration group compared to the oxymetholone 50 mg/kg administration group (Table 7).

Looking at Table 7, in the GLU control group, gastrocnemius myostatin mRNA expression was changed by 582.97% compared to the normal medium control group, but in the oxymetholone, TCcp 500, 250, and 125 mg/kg administration groups, -53.94% and -32.69, respectively, compared to the GLU control group. %, -27.08% and -7.29%.

Experimental Example 8-8. Changes in gastrocnemius SIRT1 mRNA expression

The change of SIRT1 mRNA expression in the gastrocnemius muscle of glucocorticoid (dexamethasone)-induced muscular dystrophy mice was measured to compare the effect of administration of each sample.

As a result of the experiment, a significant (p<0.01) increase in gastrointestinal SIRT1 mRNA expression was observed in the GLU control group compared to the normal medium control group, but the oxymetholone, TCcp 500, and 250 mg/kg administration groups were significantly (p<0.01) compared to the GLU control group. ) A decrease in SIRT1 mRNA expression was recognized. As a result of this experiment, the dose-dependent gastrointestinal SIRT1 mRNA expression inhibition effect was recognized in the TCcp 500 and 250 mg/kg administration group, but the significant change in gastrointestinal SIRT1 mRNA expression in the TCcp 125 mg/kg administration group compared to the GLU control group. It was not recognized, and the inhibitory effect of increasing DEXA-induced gastrointestinal SIRT1 mRNA expression was relatively low in the TCcp 500 mg/kg administration group compared to the oxymetholone 50 mg/kg administration group (Table 7).

Looking at Table 7, the GLU control group showed a change of 943.38% in gastrocnemius SIRT1 mRNA expression compared to the normal medium control group, but in the oxymetholone, TCcp 500, 250, and 125 mg/kg administration groups, -65.21% and -57.41%, respectively, compared to the GLU control group. %, -41.55% and -6.66%.

< Consideration on Experimental Example 8 >

Regardless of the cause of the onset, it is known that apoptosis by caspase activation is involved in the early stage of muscle atrophy [Arakawa et al., 2010; Lim and Han, 2010], caspase-3 and PARP are representative apoptosis markers [Nunez et al., 1998; Barrett et al., 2001], the increase in these caspase-3 and PARP in skeletal muscle fibers indicates damage to muscle cells by apoptosis [Dam et al., 2012; Yen et al., 2012], GLU is also known to induce apoptosis of muscle fibers [Dirks-Naylor and Griffiths, 2009; Kim et al., 2015a]. Therefore, the reduction of dose-dependent caspase-3 and PARP immunoreactive muscle fibers recognized in the TCcp 500 and 250 mg/kg dose groups, TCcp inhibited the induction of apoptosis at the doses of 500 and 250 mg/kg, thereby reducing muscle cell damage. It is judged as one of the direct evidence to suppress.

Muscle mass and structure can be measured by the balance of protein synthesis and destruction [Glass, 2003], and ATP-ubiquitin-dependent protein degradation is the most well-known protein destruction pathway [Onda et al., 2011], 3 here Kinds of enzymes, E1 (ubiquitin-activating), E2 (ubiquitin-conjugating), and E3 (ubiquitin ligase) are involved, and E3 ubiquitin ligases such as Atrogin-1 and MuRF1 are known to play an important role in muscle atrophy [ Glass et al. 2005]. Atrogin-1 contains the SCF complex (Skp, Cull and Roc1) [Gomes et al., 2001], and directly acts with calcineurin A and a-actinin-2 in the Z plate of skeletal muscle, causing muscle atrophy [Li et al., 2004]. In addition, MuRF1 is a ring finger-B-box-coiled-coil family [Centner et al., 2001] and induces destruction of skeletal muscle proteins by interacting with titin in the skeletal muscle M band [McElhinny et al., 2002]. The expression levels of Atrogin-1 and MuRF1 are significantly increased in atrophic muscles, whereas mice deficient in Atrogin-1 or MuRF1 are known to exhibit strong resistance to muscle atrophy [Bodine et al., 2001; Gomes et al., 2001; Cohen et al., 2009]. It is known that an increase in mRNA expression by Atrogin-1 and MuRF1 up-regulation is also involved in GLU-induced catabolic muscle atrophy [Gilson et al., 2007; Jones et al., 2010; Kim et al., 2015a].

In the results of this study, a remarkable increase in the expression of Atrogin-1 and MuRF1 mRNA was recognized in the gastrocnemius muscle, but the increase in the expression of Atrogin-1 and MuRF1 mRNA was significantly suppressed in a dose-dependent manner by the administration of TCcp 500 and 250 mg/kg. Therefore, it is lower than oxymetholone 50 mg/kg, but TCcp at the doses of 500 and 250 mg/kg, at least partially, blocks protein degradation of skeletal muscle through inhibition of Atrogin-1 and MuRF1 mRNA expression, and is judged to exhibit skeletal muscle fiber protective effect. do.

Insulin-like growth factor 1 (IFG-1)/phosphatidylinositol 3-kinase (PI3K)/Akt signaling pathway is a representative pathway that activates protein synthesis [Glass, 2005, 2010], and PI3K activated by insulin or IGF is serin. /It activates threonine kinase Akt and inhibits phosphorylates glycogen synthase kinase 3beta, causing muscle hypertrophy [Sandri et al., 2008].

Similar to the previous study [Kim et al., 2015a], the expression of Akt1 and PI3K in the gastrocnemius muscle was significantly reduced as well as in the previous study [Kim et al., 2015a]. However, oxymetholone expressed Akt1 and PI3K mRNA. Was significantly increased, and TCcp 500 and 250 mg/kg was also observed to increase the expression of Akt1 and PI3K mRNA in a dose-dependent manner, and was observed to promote skeletal muscle protein synthesis.

Adenosine can be found in the cardiovascular system [Berne et al. 1983, Segal and Kurjiaka 1995] and skeletal muscle [Hespel and Richter 1998], it acts as a very important physiological regulator and regulates blood flow of skeletal muscle [Dobson et al. 1971] and by promoting the absorption and utilization of glucose by skeletal muscle by stimulation of insulin [Vergauwen et al. 1994]. These physiological actions of adenosine are known to be regulated by adenosine receptors [Lynge and Hellsten, 2000], of which A1R exhibits skeletal muscle protection [Zheng et al., 2007]. TRPV4, a kind of TRP channel superfamily [Caterina et al., 1997; Guilak et al., 2010] is known as a Ca2+-permeable nonselective cation channel, and inhibits skeletal muscle atrophy or bone loss by acting mechanosensory or osmosensory in various musculoskeletal systems [Mizoguchi et al., 2008; Guilak et al., 2010].

Similar to the previous study [Kim et al., 2015a] in this experiment, a significant decrease in the mRNA expression of A1R and TRPV4 in the gastrocnemius was recognized by GLU, but TCcp 500 and 250 mg/kg were dose-dependently It was observed to significantly and significantly increase the expression of A1R and TRPV4, and was observed to exhibit a skeletal muscle protective effect.

Myostatin is a kind of growth differentiation factor belonging to the TGF-β protein family. It is secreted by skeletal muscle cells, binds to activin type II receptor, and inhibits muscle differentiation and growth [Carnac et al., 2006; Gonzalez-Cadavid et al., 2008], acting as a representative potent negative regulator to limit muscle growth [Gilson et al., 2007; Onda et al., 2011]. In addition, proteins belonging to the sirtuin family exhibit NAD+-dependent deacetylase and DP ribosyltransferase activities, and currently approximately 7 species (SIRT1-7) exhibiting physiological activity in mammalian cells have been identified [Michishita et al., 2007]. Of these, SIRT1 is the best known. It is known to exhibit a wide range of physiological activities such as cell proliferation, differentiation, apoptosis, and metabolism [Haigis and Guarente, 2006], but by regulating the transcription of peroxisome proliferator-activated receptor -γ co-activator 1α in muscle [Amat et al., 2009 ], inhibits muscle regeneration, and causes cachexia and atrophy of muscles [Toledo et al., 2011]. Significant increase in myostatin and SIRT1 mRNA expression has been recognized even during GLU-induced catabolic muscle atrophy [Amat et al., 2007; Gilson et al., 2007; Alamdari et al., 2012; Kim et al., 2015a].

In the results of this study, a significant increase in myostatin and SIRT1 mRNA expression in gastrocnemius muscle by GLU was recognized with an increase in the number of myostatin immunoreactive fibers, but these increased myostatin and SIRT1 mRNA expression and myostatin immunity by administering TCcp 500 and 250 mg/kg. The increase in the number of reactive fibers was significantly suppressed in a dose dependent manner.

Experimental Example 9. Histopathological change

The histopathological changes of the gastrocnemius muscle of glucocorticoid (dexamethasone)-induced muscular dystrophy mice were measured to compare the effects of administration of each sample.

As a result of the experiment, in the GLU control group, typical catabolic muscle atrophy findings such as reduction in the diameter of muscle fibers due to protein breakdown, microvacuolization, and fibrosis were recognized, which was significantly (p<0.01) compared to the normal medium control group. Along with the decrease, a significant (p<0.01) increase in the ratio of collagen fibers in the muscle bundle was recognized. On the other hand, in the group administered with oxymetholone, TCcp 500, and 250 mg/kg, catabolic atrophy of the GLU-induced gastrocnemius muscle was significantly reduced, compared with the GLU control group (p<0.01 or p<0.05). Each showed a decrease in the occupied ratio. As a result of this experiment, the dose-dependent reduction of the gastrocnemius muscle fiber diameter and the suppression of the increase in the ratio of collagen fibers were recognized in the TCcp 500 and 250 mg/kg administration groups, but the TCcp 125 mg/kg administration group was compared with the GLU control group. Significant changes in the gastrocnemius muscle fiber diameter and the ratio of collagen fibers were not recognized, and the DEXA-induced decrease in the gastrocnemius muscle fiber diameter and the collagen fiber occupied were relatively low in the TCcp 500 mg/kg group compared to the oxymetholone 50 mg/kg group. The inhibitory effect of increasing the ratio was recognized (Table 8, Fig. 8). The histopathological changes of the gastrocnemius muscles of the glucocorticoid (dexamethasone)-induced muscular dystrophy mice were measured and shown in Table 8 below.

division Control Comparative example Example (mg/kg) Intact GLU oxymetholone TCcp 500 TCcp 250 TCcp 125 General histomorphometry Fiber diameter (μm) 50.88±11.00 23.10±5.10 38.38±7.06 34.85±4.20 31.67±5.12 24.94±5.92 Collagen (%) 4.23±1.65 32.84±4.89 17.69±5.06 21.56±2.96 23.82±3.51 31.32±4.81 Immunohistomorphometry (fibers/mm ² ) Caspase-3 2.38±2.50 42.13±11.06 21.00±4.81 27.38±3.16 29.75±5.55 39.50±5.37 PARP 5.13±2.59 76.25±10.95 33.25±10.35 45.88±10.45 54.88±10.49 71.25±12.06 Nitrotyrosine 5.13±2.64 68.38±12.08 32.13±12.73 46.88±10.99 51.50±10.97 66.00±14.77 4-HNE 3.63±2.07 76.50±12.17 44.13±10.83 48.75±11.23 56.75±12.58 71.50±12.86 iNOS 8.00±3.16 52.88±12.19 21.75±6.48 34.00±6.48 38.25±8.71 51.00±15.51 Myostatin 1.38±1.06 52.75±10.63 22.13±4.76 29.00±8.73 36.13±11.24 50.50±11.38

Looking at Tables 8 and 8, in the GLU control group, the average diameter of the gastrocnemius fibers was -54.59% change compared to the normal medium control group, but in the oxymetholone, TCcp 500, 250 and 125 mg/kg administration groups, respectively, 66.15 compared to the GLU control group. , 50.84, 37.08 and 7.98% of changes.

In the GLU control group, the ratio of collagen fibers in the gastrocnemius muscle bundle showed a change of 676.62% compared to the normal medium control group, but in the oxymetholone, TCcp 500, 250, and 125 mg/kg groups, -46.14% and -34.36%, respectively, compared to the GLU control group. , -27.47% and -4.62%.

< Consideration on Experimental Example 9 >

Histopathologically, during catabolic muscle atrophy due to GLU, a decrease in the diameter of muscle fiber fibers, microvacuumization, and fibrosis are characteristically occurring due to protein breakdown [Kanda et al., 1999; Qin et al., 2013; Kim et al., 2015a], also in the results of this experiment, reduction in gastrocnemius fiber diameter, microvacuolization, and fibrosis in muscle bundles were recognized by DEXA administration. On the other hand, the fact that these GLU-induced catabolic muscle atrophy was decreased in a dose-dependent manner by the administration of TCcp 500 and 250 mg/kg. TCcp suppressed the catabolic muscle atrophy caused by GLU at the doses of 500 and 250 mg/kg. It is judged as direct evidence.

Experimental Example 10. Immunohistochemical Change

Experimental Example 10-1. Changes in gastrocnemius caspase-3 immunoreactive muscle fibers

The purpose of this study was to compare the effects of administration of each sample by measuring changes in caspase-3 immunoreactive muscle fibers in the gastrocnemius muscle of glucocorticoid (dexamethasone)-induced muscular atrophy mice.

As a result of the experiment, in the GLU control group, a significant (p<0.01) increase in the number of caspase-3 immune-reactive fibers per unit area of the gastrocnemius muscle bundle (mm ² ) was observed, but oxymetholone 50 mg/kg, TCcp 500 and 250 mg In the /kg administration group, a significant (p<0.01 or p<0.05) reduction in the number of caspase-3 immunoreactive muscle fibers was observed compared to the GLU control group. As a result of this experiment, the dose-dependent gastrocnemius caspase-3 immunoreactivity increase inhibitory effect was recognized in the TCcp 500 and 250 mg/kg administration group, but the gastrocnemius caspase-3 immunity was significant in the TCcp 125 mg/kg administration group compared to the GLU control group. The change in reactivity was not recognized, and a relatively low DEXA-induced gastrocnemius caspase-3 immune reactivity increase inhibition effect was recognized in the TCcp 500 mg/kg administration group compared to the oxymetholone 50 mg/kg administration group (Table 8, FIG. 9).

Looking at Tables 8 and 9, in the GLU control group, the number of caspase-3 immune-reactive fibers per unit area of the gastrocnemius muscle bundle showed a change of 1673.68% compared to the normal medium control group, but in the oxymetholone, TCcp 500, 250 and 125 mg/kg administration groups They showed changes of -50.15%, -35.01%, -29.38% and -6.23%, respectively, compared to the GLU control group.

Experimental Example 10-2. Changes in gastrocnemius PARP immunoreactive muscle fibers

To compare the effects of administration of each sample by measuring changes in PARP immunoreactive muscle fibers in the gastrocnemius muscle of glucocorticoid (dexamethasone)-induced muscular atrophy mice.

As a result of the experiment, in the GLU control group, a significant (p<0.01) increase in the number of PARP immunoreactive fibers per unit area of the gastrocnemius muscle bundle (mm ² ) was observed, but oxymetholone 50 mg/kg, TCcp 500 and 250 mg/kg. In the administration group, a significant (p<0.01) reduction was observed compared to the GLU control group, respectively. As a result of this experiment, in the group administered with TCcp 500 and 250 mg/kg, it was confirmed that the dose-dependent gastrocnemius PARP immunoreactivity increased inhibitory effect (Table 8, FIG. 9).

Looking at Tables 8 and 9, in the GLU control group, the number of PARP immune-reactive fibers per unit area of the gastrocnemius muscle bundle showed a change of 1387.80% compared to the normal medium control group, but GLU in the oxymetholone, TCcp 500, 250 and 125 mg/kg administration groups, respectively. Compared to the control group, -56.39%, -39.84%, -28.03%, and -6.56% were changed.

Experimental Example 10-3. Changes of nitrotyrosine immune-reactive muscle fibers in gastrocnemius muscle

To compare the effects of each sample administration by measuring the change of nitrotyrosine immunoreactive muscle fibers in the gastrocnemius muscle of glucocorticoid (dexamethasone)-induced muscular atrophy mice.

As a result of the experiment, in the GLU control group, an increase in the number of nitrotyrosine immune-reactive fibers per unit area (mm ² ) of the gastrocnemius muscle bundle was significantly (p<0.01) compared to the normal medium control group, but oxymetholone 50 mg/kg, TCcp 500 and 250 mg/kg In the administration group, a significant (p<0.01) reduction in the number of nitrotyrosine immunoreactive muscle fibers was observed compared to the GLU control group. As a result of this experiment, in the group administered with TCcp 500 and 250 mg/kg, it was confirmed that the dose-dependent gastrocnemius nitrotyrosine immunoreactivity increased inhibitory effect (Table 8, FIG. 10).

Looking at Tables 8 and 10, in the GLU control group, the number of nitrotyrosine immune-reactive fibers per unit area of the gastrocnemius muscle bundle showed a change of 1234.15% compared to the normal medium control, but in the oxymetholone, TCcp 500, 250, and 125 mg/kg administration groups, GLU respectively Compared to the control group, -53.02%, -31.44%, -24.68% and -3.47% were changed.

Experimental Example 10-4. Changes in gastrocnemius 4-HNE immunoreactive muscle fibers

To compare the effects of administration of each sample by measuring the change of 4-HNE immunoreactive muscle fibers in the gastrocnemius muscle of glucocorticoid (dexamethasone)-induced muscular atrophy mice.

As a result of the experiment, in the GLU control group, a significant (p<0.01) increase in the number of 4-HNE immune-reactive fibers per unit area of the gastrocnemius muscle bundle (mm ² ) was observed, but in the oxymetholone, TCcp 500 and 250 mg/kg administration groups. A significant (p<0.01) reduction in the number of 4-HNE immunoreactive muscle fibers was observed compared to each GLU control group. As a result of this experiment, the dose-dependent gastrocnemius 4-HNE immunoreactivity increased inhibitory effect was recognized in the TCcp 500 and 250 mg/kg administration group, but the gastrocnemius 4-HNE was significant in the TCcp 125 mg/kg administration group compared to the GLU control Changes in immune reactivity were not recognized, and a relatively low DEXA-induced gastrocnemius 4-HNE immune response increase inhibitory effect was recognized in the TCcp 500 mg/kg administration group compared to the oxymetholone 50 mg/kg administration group (Table 8, FIG. 10).

Looking at Tables 8 and 10, in the GLU control group, the number of 4-HNE immune-reactive fibers per unit area of the gastrocnemius muscle bundle showed a change of 2010.34% compared to the normal medium control group, but in the oxymetholone, TCcp 500, 250 and 125 mg/kg administration groups. They showed changes of -42.32%, -36.27%, -25.82% and -6.54%, respectively, compared to the GLU control group.

Experimental Example 10-5. Changes in iNOS immune-reactive muscle fibers in gastrocnemius muscle

The purpose of this study was to compare the effects of administration of each sample by measuring changes in iNOS immunoreactive muscle fibers in the gastrocnemius muscle of glucocorticoid (dexamethasone)-induced muscular atrophy mice.

As a result of the experiment, in the GLU control group, a significant (p<0.01) increase in the number of iNOS immune-reactive fibers per unit area (mm ² ) of the gastrocnemius muscle bundle was recognized, but in the oxymetholone, TCcp 500, and 250 mg/kg groups, GLU, respectively. Compared to the control group, a significant (p<0.01 or p<0.05) decrease in the number of iNOS immunoreactive muscle fibers was recognized. As a result of this experiment, the dose-dependent gastrocnemius iNOS immunoreactivity increased inhibitory effect was recognized in the group administered with TCcp 500 and 250 mg/kg, but the change in gastrocnemius iNOS immunoreactivity was significant in the group administered with TCcp 125 mg/kg compared to the GLU control group. Was not recognized, compared to the oxymetholone 50 mg/kg administration group in the TCcp 500 mg/kg administration group, a relatively low DEXA-induced gastrocnemius iNOS immune response increase inhibitory effect was recognized (Table 8, FIG. 11).

Looking at Tables 8 and 11, in the GLU control group, the number of iNOS immune-reactive fibers per unit area of the gastrocnemius muscle bundle showed a change of 560.94% compared to the normal medium control group, but in the oxymetholone, TCcp 500, 250 and 125 mg/kg administration groups, respectively GLU Compared to the control group, -58.87%, -35.70%, -27.66% and -3.55% were changed.

Experimental Example 10-6. Changes in immune-reactive muscle fibers of the gastrocnemius myostatin

The purpose of this study was to compare the effects of administration of each sample by measuring the changes in myostatin immunoreactive muscle fibers in the gastrocnemius muscle of glucocorticoid (dexamethasone)-induced muscular atrophy mice.

As a result of the experiment, in the GLU control group, a significant (p<0.01) increase in the number of myostatin immune-reactive fibers per unit area of the gastrocnemius muscle bundle (mm ² ) was observed, but in the oxymetholone, TCcp 500, and 250 mg/kg administration groups, GLU, respectively. Compared to the control group, a significant (p<0.01) reduction in the number of myostatin immunoreactive muscle fibers was observed. As a result of this experiment, the dose-dependent gastrocnemius myostatin immunoreactivity was found to be increased in the TCcp 500 and 250 mg/kg group, but the TCcp 125 mg/kg group showed a significant change in gastrocnemius myostatin immunoreactivity compared to the GLU control group. Was not recognized, compared to the oxymetholone 50 mg/kg administration group in the TCcp 500 mg/kg administration group, a relatively low DEXA-induced gastrocnemius myostatin immune response inhibition effect was recognized (Table 8, FIG. 11).

Looking at Tables 8 and 11, in the GLU control group, the number of myostatin immune-reactive fibers per unit area of the gastrocnemius muscle bundle showed a change of 3736.36% compared to the normal medium control group, respectively, in the oxymetholone, TCcp 500, 250, and 125 mg/kg administration groups, GLU Compared to the control group, -58.06%, -45.02%, -31.52% and -4.27% were changed.

<Consideration>

In this study, the effect of TCcp on muscle atrophy was evaluated in a mouse catabolic muscle atrophy model induced by DEXA [Gilson et al., 2007; Kim et al., 2015a], the oral administration of TCcp 500 and 250 mg/kg suppressed the reduction in calf thickness and tension, gastrocnemius thickness and weight by GLU, dose-dependently, and lipid peroxidation in the gastrocnemius muscle. And an increase in ROS, a decrease in GSH content, and a decrease in CAT and SOD activities were also inhibited in a dose-dependent manner.

In addition, TCcp significantly suppressed the decrease of LDH content, which is a blood biochemical indicator of muscle activity, and the increase of creatinine and CK content in blood, which are indicators of muscle damage, in a dose-dependent manner. Increased expression of myostatin, which is involved in muscle growth inhibition, and SIRT1 mRNA, which is known to inhibit muscle regeneration, was also dose-dependently suppressed, and expression of PI3K, Akt1, Adenosine A1R, and TRPV4 mRNA, which are involved in the synthesis of muscle protein and muscle growth. Was observed to increase dose dependently. TCcp 500 and 250 mg/kg also inhibited the reduction of gastrocnemius fiber diameter, microvasculosis, and fibrosis according to GLU-induced protein breakdown histologically, dose-dependently, immunohistochemically, caspase-3, PARP, The increase in the number of nitrotyrosine, iNOS, 4-HNE, and myostatin immunoreactive muscle fibers was also suppressed in a dose-dependent manner.

The composition comprising the extract of tart cherry of the present invention is a representative 17α-alkylated anabolic-androgenic steroid, which has a relatively low muscle protection effect compared to oxymetholone, which is currently used in the treatment of various muscle diseases, but is an extract derived from a natural product. It has the advantage of being able to use it safely without worrying about it. Therefore, the composition comprising the extract of the present invention has been confirmed to very effectively inhibit catabolic muscle atrophy caused by glucocorticoids through antioxidant and anti-inflammatory effects, and is expected to be applied to various muscle diseases in the future.

<Conclusion>

Through the above experiment, the composition containing the extract of the present invention is involved in the synthesis of muscle proteins (Akt1, PI3K, A1R and TRPV4) and disruption (Atrogin-1, MuRF1, myostatin and SIRT1) by antioxidant and anti-inflammatory effects. It was confirmed in detail that GLU-induced catabolic muscular dystrophy was inhibited through gene regulation.

Therefore, the composition comprising the extract of the tart cherry of the present invention is expected to be applicable to various muscle diseases including muscle atrophic diseases.

Hereinafter, examples of the preparation of the composition containing the extract of the tart cherry of the present invention are described, but the present invention is not intended to limit it, but is intended to be described in detail.

Formulation Example 1. Preparation of powder

5 g of tart cherry extract powder of the present invention

100 mg lactose

10 mg of talc

The above ingredients are mixed and filled in an airtight cloth to prepare a powder.

Formulation Example 2. Preparation of tablet

5 g of tart cherry extract powder of the present invention

100 mg corn starch

100 mg lactose

2 mg of magnesium stearate

After mixing the above ingredients, tablets are prepared by tableting according to a conventional tablet preparation method.

Formulation Example 3. Preparation of Capsule

5 g of tart cherry extract powder of the present invention

3 mg of crystalline cellulose

14.8 mg lactose

0.2 mg of magnesium stearate

According to a conventional capsule preparation method, the above ingredients are mixed and filled into gelatin capsules to prepare a capsule.

Formulation Example 4. Preparation of injection

10 g of tart cherry extract powder of the present invention

Mannitol 180 mg

2974 mg of sterile distilled water for injection

Na ₂ HPO ₄ ,12H ₂ O 26 mg

It is prepared with the above ingredients per ampoule according to a conventional injection preparation method.

Formulation Example 5. Preparation of liquid formulation

4 g of tart cherry extract powder of the present invention

10 g of isomerized sugar

5 g of mannitol

Purified water appropriate amount

According to the usual preparation method of liquid preparation, add each ingredient to purified water to dissolve it, add lemon zest, mix the above ingredients, add purified water and add purified water to adjust the total to 100g, then fill in a brown bottle for sterilization. To prepare a solution.

Formulation Example 6. Preparation of granules

10 g of tart cherry extract powder of the present invention

Vitamin mixture right amount

Vitamin A acetate 70 ㎍

1.0 mg of vitamin E

Vitamin B1 0.13 mg

Vitamin B2 0.15 mg

0.5 mg of vitamin B6

Vitamin B12 0.2 ㎍

Vitamin C 10 mg

Biotin 10 ㎍

1.7 mg of nicotinic acid amide

Folic acid 50 ㎍

0.5 mg of calcium pantothenate

Suitable amount of inorganic mixture

1.75 mg ferrous sulfate

Zinc oxide 0.82 mg

Magnesium carbonate 25.3 mg

Potassium monophosphate 15 mg

Dicalcium phosphate 55 mg

90 mg of potassium citrate

100 mg of calcium carbonate

Magnesium chloride 24.8 mg

The composition ratio of the vitamin and mineral mixture is relatively suitable for granules, but it is possible to arbitrarily modify the mixing ratio. After mixing the above ingredients according to a conventional granule preparation method, granules And can be used to prepare a health functional food composition according to a conventional method.

Formulation Example 7. Preparation of functional beverage

Tart cherry extract powder of the present invention 2 g

1,000 mg citric acid

100 g oligosaccharides

2 g of plum concentrate

1 g taurine

Total 900 mL with purified water

After mixing the above ingredients according to a normal health drink manufacturing method, stirring and heating the resulting solution at 85°C for about 1 hour, the resulting solution is filtered and obtained in a sterilized 2 L container, sealed and sterilized, and stored in a refrigerator. It is used to manufacture the functional beverage composition of the invention

The composition ratio is composed of ingredients suitable for a relatively preferred beverage in a preferred embodiment, but the mixing ratio may be arbitrarily modified according to regional and ethnic preferences, such as the demand class, the country of demand, and the purpose of use.

Although the present invention has been described as the above-mentioned preferred embodiment, it is possible to make various modifications or variations without departing from the gist and scope of the invention. In addition, the appended claims include such modifications or variations that fall within the gist of the present invention.

Claims (14)

As a pharmaceutical composition for the prophylaxis or treatment of muscle diseases, comprising a tart cherry extract as an active ingredient,
The muscle disease is a muscle disease caused by side effects of glucocorticoid,
The muscle diseases caused by the side effects of glucocorticoids are selected from the group consisting of muscular atrophy, myasthenia gravis, muscular dystrophy, muscular stiffness, hypotonia, muscular weakness, muscular dystrophy, muscular dystrophy, amyotrophic lateral sclerosis, spinal progressive muscular atrophy and severe myasthenia gravis. More than a species,
The composition is a pharmaceutical composition for preventing or treating muscle diseases, characterized in that it has an effect of increasing muscle mass or inhibiting muscle loss. The method of claim 1,
The tart cherry extract is a pharmaceutical composition for the prevention or treatment of muscle diseases, characterized in that it is an extract with one or more solvents selected from the group consisting of water, an organic solvent having 1 to 6 carbon atoms, a subcritical fluid, a supercritical fluid, and a mixture thereof . The method of claim 2,
The organic solvent having 1 to 6 carbon atoms is alcohol, acetone, ether, benzene, chloroform, ethyl acetate, methylene chloride, and 1 to 6 carbon atoms. chloride), hexane, or cyclohexane. A pharmaceutical composition for preventing or treating muscle diseases. delete delete delete The method of claim 1,
The glucocorticoid side effect is a pharmaceutical composition for preventing or treating muscle diseases, characterized in that caused by glucocorticoid treatment or an increase in the amount of glucocorticoid in an individual. The method of claim 1,
The glucocorticoids are cortisol, hydrocortin, cortisone, prednisolone, methylprednisolone, triamcinolone, triamcinolone acetonide, paramethasone, dexamethasone, betamethasone, hexestrol, methimazole, fluocinonide, fluocinolone acetonid, , Beclomethasone dipropionate, estriol, diflorasone diacetate, diflucortolone valerate, and prevention or treatment of muscle diseases, characterized in that at least one selected from the group consisting of difluprednate Pharmaceutical composition for use. delete The method of claim 1,
The composition is characterized in that it increases the expression of one or more kinds of mRNA selected from the group consisting of phosphatidylinositol 3-kinase (P13K), Akt1, A1R (adenosine A1 receptor) and TRPV4 (transient receptor potential cation cannel subfamily V member 4). Pharmaceutical composition for the prevention or treatment of muscle diseases. The method of claim 1,
The composition is a muscle characterized in that it inhibits the expression of at least one mRNA selected from the group consisting of Atrogin-1, MuFR1 (muscle RING-finger protein-1), myostatin (muscle growth inhibitory factor), and SIRT1 (Sirtulin 1). Pharmaceutical composition for the prevention or treatment of diseases. delete As a food composition for preventing or improving muscle diseases comprising a tart cherry extract as an active ingredient,
The muscle disease is a muscle disease caused by side effects of glucocorticoid,
The muscle diseases caused by the side effects of glucocorticoids are selected from the group consisting of muscular atrophy, myasthenia gravis, muscular dystrophy, muscular stiffness, hypotonia, muscular weakness, muscular dystrophy, muscular dystrophy, amyotrophic lateral sclerosis, spinal progressive muscular atrophy and severe myasthenia gravis. More than a species,
The composition is a food composition for preventing or improving muscle disease, characterized in that it has an effect of increasing muscle mass or inhibiting muscle loss. delete

Images