KR102187144B1 - Composition for preventing or treating inflammatory lung disease for nasal administration using complex for drug/gene delivery - Google Patents

Composition for preventing or treating inflammatory lung disease for nasal administration using complex for drug/gene delivery Download PDF

Info

Publication number
KR102187144B1
KR102187144B1 KR1020180123068A KR20180123068A KR102187144B1 KR 102187144 B1 KR102187144 B1 KR 102187144B1 KR 1020180123068 A KR1020180123068 A KR 1020180123068A KR 20180123068 A KR20180123068 A KR 20180123068A KR 102187144 B1 KR102187144 B1 KR 102187144B1
Authority
KR
South Korea
Prior art keywords
gene
chol
pam
cationic polymer
drug
Prior art date
Application number
KR1020180123068A
Other languages
Korean (ko)
Other versions
KR20190051792A (en
Inventor
이민형
김경윤
Original Assignee
한양대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한양대학교 산학협력단 filed Critical 한양대학교 산학협력단
Publication of KR20190051792A publication Critical patent/KR20190051792A/en
Application granted granted Critical
Publication of KR102187144B1 publication Critical patent/KR102187144B1/en

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0043Nose
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/045Hydroxy compounds, e.g. alcohols; Salts thereof, e.g. alcoholates
    • A61K31/05Phenols
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/12Ketones
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6905Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion
    • A61K47/6907Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion the form being a microemulsion, nanoemulsion or micelle
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2121/00Preparations for use in therapy

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Otolaryngology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Dispersion Chemistry (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Nanotechnology (AREA)
  • Rheumatology (AREA)
  • Pulmonology (AREA)
  • Pain & Pain Management (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

본 발명은 레스베라트롤 또는 커큐민이 포함된 콜레스테롤이 접합된 양이온성 고분자 마이셀 표면에 유전자가 결합된 약물/유전자 전달용 복합체 및 이를 포함하는 비강 투여용 염증성 폐질환 예방 또는 치료용 조성물에 관한 것이다.The present invention relates to a drug/gene delivery complex in which a gene is bound to the surface of cationic polymer micelles to which cholesterol containing resveratrol or curcumin is conjugated, and a composition for preventing or treating inflammatory lung disease for nasal administration comprising the same.

Description

약물/유전자 전달 복합체를 이용한 비강 투여용 염증성 폐질환 예방 또는 치료용 조성물{Composition for preventing or treating inflammatory lung disease for nasal administration using complex for drug/gene delivery}Composition for preventing or treating inflammatory lung disease for nasal administration using complex for drug/gene delivery}

본 발명은 약물/유전자 전달 복합체를 이용한 비강 투여용 염증성 폐질환 예방 또는 치료용 조성물에 관한 것이다. The present invention relates to a composition for preventing or treating inflammatory lung disease for nasal administration using a drug/gene delivery complex.

약물전달 시스템, 치료 부위에 약물을 전달하는 방법은 경구 투여, 경피 투여, 정맥 주사, 기관 내 흡입 등의 방법 등이 있다. 약물전달시스템은 이러한 전달에 있어 부작용을 최소화하고 효율을 극대화하기 위한 기술을 말한다. 약물전달시스템을 적절히 이용하면 약물의 방출 속도를 조절하거나 약물제제의 시간을 연장할 수 있고, 의약품의 안정성 개선, 부작용 최소화 등이 가능하다. 또한 흡수율이 낮은 약물을 효과적으로 전달하거나 원하는 부위에만 의약품이 전달 되도록 할 수 있다. 이러한 효과들을 위해 약물전달시스템에서는 천연 또는 합성고분자, 펩타이드, 금 나노 입자, 하이드로젤 등을 이용한 연구가 활발히 진행되고 있다.Drug delivery systems and methods of delivering drugs to the treatment site include oral administration, transdermal administration, intravenous injection, and intratracheal inhalation. The drug delivery system is a technology to minimize side effects and maximize efficiency in such delivery. If the drug delivery system is properly used, it is possible to control the release rate of drugs or extend the time of the drug formulation, improve the stability of drugs, and minimize side effects. In addition, drugs with a low absorption rate can be effectively delivered or drugs can be delivered only to a desired site. For these effects, studies using natural or synthetic polymers, peptides, gold nanoparticles, and hydrogels in drug delivery systems are being actively conducted.

유전자 치료란 유전자 전달체를 이용해 DNA 또는 RNA등의 핵산을 세포 내부로 전달하여 전달한 유전자의 발현을 통해 질병을 치료하는 방법을 말한다. 성공적인 유전자 치료를 위해서는 유전자를 효과적으로 전달 할 수 있는 전달체를 사용하는 것이 중요하다. 효과적인 유전자 전달체는 전달효율성이 높고 세포에 미치는 독성이 적어야 한다. 유전자 전달체로써는 크게 바이러스성 전달체와 비바이러스성 전달체로 구분할 수 있다. 일반적으로 바이러스성 전달체가 더 높은 효율을 보이나, 전달한 유전물질이 숙주 염색체에 통합될 수 있기 때문에 돌연변이를 유발하여 암으로 발전할 수 있고, 면역반응을 일으키는 등 여러 부작용을 유발할 수 있다. 반면, 비바이러스성 전달체는 상대적으로 안정적이며 세포독성이 낮고 면역반응을 유발할 수 있는 가능성도 낮다는 장점이 있다. 그러나 전달 효율성이 바이러스성 전달체에 비해 낮기 때문에 이를 개선할 필요성이 있다.Gene therapy refers to a method of treating diseases through the expression of the transferred genes by delivering nucleic acids such as DNA or RNA into cells using a gene delivery system. For successful gene therapy, it is important to use a carrier that can effectively deliver the gene. An effective gene delivery system should have high delivery efficiency and low toxicity to cells. As a gene delivery system, it can be largely divided into a viral delivery system and a non-viral delivery system. In general, viral carriers show higher efficiency, but since the transferred genetic material can be integrated into the host chromosome, it can cause mutations to develop cancer and cause various side effects, such as causing an immune response. On the other hand, the non-viral delivery system is relatively stable, has low cytotoxicity, and has the advantage of low possibility of inducing an immune response. However, since the delivery efficiency is lower than that of the viral delivery system, there is a need to improve this.

친수성 고분자인 PEG에 소수성 물질인 PLGA나 DSPE와 같은 물질을 결합시켜 양친성 블록고분자를 만들면 수용액 내부에서 마이셀을 형성할 수 있다. 소수성 약물을 세포에 전달하기 위한 방법으로 이런 마이셀 내부에 약물을 봉입하여 전달하는 방법이 주로 사용되고 있다.When the hydrophilic polymer PEG is combined with a hydrophobic material such as PLGA or DSPE to form an amphiphilic block polymer, micelles can be formed in the aqueous solution. As a method for delivering a hydrophobic drug to cells, a method of encapsulating and delivering the drug inside such micelles is mainly used.

일반적으로 유전자 전달의 경우 lipofectamine과 PEI 등 양이온성을 띄는 고분자가 사용된다. 유전자의 경우 음이온성을 띄기 때문에 이러한 양이온성 고분자와 자발적으로 복합체를 형성할 수 있다. 전체적으로 양이온성을 띄게 된 복합체는 음이온성을 띄는 세포막 내부로 유전자를 전달할 수 있다. In general, for gene delivery, polymers with cationic properties such as lipofectamine and PEI are used. Since genes are anionic, they can spontaneously form complexes with these cationic polymers. The complex that has become cationic as a whole can transfer genes into the anionic cell membrane.

시중에 판매되고 있는 레스베라트롤이나 커큐민 등의 소수성 약물은 알약의 형태로 판매되어 섭취하도록 되어 있다. 그러나 이러한 물질들은 물에 녹지 않아 체내 흡수율이 매우 낮기 때문에 단순 섭취 시 효율성이 매우 떨어진다. 또한 신약개발 관련 연구에 있어서 소수성 약물의 경우 세포 내부로 잘 전달되지 않기 때문에 효과를 증명하기 위해선 투여 용량을 높이거나 오랜 기간 동안 약물을 투여해야 한다.Commercially available hydrophobic drugs such as resveratrol and curcumin are sold in the form of pills to be consumed. However, since these substances are not soluble in water and have a very low absorption rate in the body, their efficiency is very low when consumed simply. In addition, in research related to the development of new drugs, hydrophobic drugs are not well delivered to the inside of cells, so to prove the effect, the dose must be increased or the drug must be administered for a long period of time.

유전자 전달을 위해 현재 가장 널리 사용되는 전달체인 lipofectamine, PEI 등의 경우 수용액 상에서 마이셀을 형성하지 않기에 유전자 외의 다른 약물은 전달하지 못한다[비특허문헌 1]. 마이셀을 형성할 수 있는 고분자 중 소수성 약물전달체로 사용하는 물질들은 대부분 PEG 계열로, 이러한 경우 유전자는 전달하지 못한다. 이전의 연구 중 다양한 크기의 PAMAM 덴드리머에 콜레스테롤을 결합하여 DNA를 전달하려는 시도가 있었다[비특허문헌 2]. 그러나 치료유전자 전달체로서 생체 내에 적용은 시도하지 않았으며 소수성 약물을 봉입하는 기술을 도입하지 못하였다. 소수성 약물과 유전자를 복합 전달할 수 있는 전달체로서 충분한 전달 효율과 낮은 세포독성이 검증되어 상용화된 물질은 아직 없는 상황이다.In the case of lipofectamine, PEI, etc., which are currently the most widely used delivery systems for gene delivery, drugs other than genes cannot be delivered because they do not form micelles in an aqueous solution [Non-Patent Document 1]. Among the polymers capable of forming micelles, most of the substances used as hydrophobic drug delivery systems are PEG-based, and in this case, genes cannot be delivered. Among the previous studies, there has been an attempt to deliver DNA by binding cholesterol to PAMAM dendrimers of various sizes [Non-Patent Document 2]. However, it has not been attempted to be applied in vivo as a therapeutic gene delivery vehicle, and a technology for encapsulating a hydrophobic drug has not been introduced. As a carrier capable of complex delivery of hydrophobic drugs and genes, sufficient delivery efficiency and low cytotoxicity have been verified, so there is no commercialized substance yet.

Husseini G. A; Pitt W.G, Micelles and nanoparticles for ultrasonic drug and gene delivery, Advanced Drug Delivery Reviews 60 (2008) 1137-1152Husseini G. A; Pitt W.G, Micelles and nanoparticles for ultrasonic drug and gene delivery, Advanced Drug Delivery Reviews 60 (2008) 1137-1152 Nasim Golkar; et al, Cholesterol-conjugated supramolecular assemblies of low generations polyamidoamine dendrimers for enhanced EGFP plasmid DNA transfection, J Nanopart Res (2016) 18:107Nasim Golkar; et al, Cholesterol-conjugated supramolecular assemblies of low generations polyamidoamine dendrimers for enhanced EGFP plasmid DNA transfection, J Nanopart Res (2016) 18:107

이에, 본 발명자들은 기존 경구 투여가 가능한 소수성 약물을 비강 투여로 염증성 폐질환 치료가 가능하도록 약물/유전자 전달 복합체를 개발하기 위하여 연구 노력한 결과, 양이온성 고분자로 PAMAM 덴드리머에 콜레스테롤을 결합시켜 양친매성을 가진 콜레스테롤이 접합된 양이온성 고분자 복합체(이하 PAM-chol)를 합성, 즉, 수용액 상에서 PAM-chol의 콜레스테롤 부위가 안쪽을 향하고 양이온성을 띠는 PAMAM 덴드리머 부위는 바깥쪽을 향하는 마이셀 형태로 형성되어 마이셀 내부에 소수성 약물을 마이셀 외부에 유전자를 결합시켜 약물과 유전자 모두 전달할 수 있는 비강 투여용 복합체를 개발함으로써 본 발명을 완성하게 되었다.Accordingly, the present inventors have made efforts to develop a drug/gene delivery complex to treat inflammatory lung diseases by nasal administration of a hydrophobic drug that can be administered orally, as a result of which, as a result, by binding cholesterol to PAMAM dendrimer with a cationic polymer, it has amphiphilic properties. Synthesis of a cationic polymer complex (hereinafter referred to as PAM-chol) with conjugated cholesterol, that is, in an aqueous solution, the cholesterol portion of PAM-chol faces inward, and the cationic PAMAM dendrimer portion is formed in the form of micelles facing outward. The present invention was completed by developing a complex for nasal administration that can deliver both drugs and genes by binding a hydrophobic drug inside the micelle with a gene outside the micelle.

따라서, 본 발명은 소수성 약물인 레스베라트롤 또는 커큐민이 포함된 콜레스테롤이 접합된 양이온성 고분자 마이셀 표면에 유전자가 결합된 비강 투여용 약물/유전자 전달 복합체 및 상기 복합체를 이용한 비강 투여용 염증성 폐질환 예방 또는 치료용 조성물을 제공하는데 목적이 있다. Therefore, the present invention is a drug/gene delivery complex for nasal administration in which a gene is bound to the surface of cationic polymer micelles conjugated with cholesterol containing hydrophobic drugs resveratrol or curcumin, and nasal inflammatory lung disease prevention or treatment using the complex It is an object to provide a composition for use.

본 발명은 소수성 약물이 포함된 콜레스테롤이 접합된 양이온성 고분자 마이셀 표면에 유전자가 결합된 비강 투여용 약물/유전자 전달 복합체에 관한 것이다.The present invention relates to a drug/gene delivery complex for nasal administration in which a gene is bound to the surface of a cationic polymer micelle to which cholesterol containing a hydrophobic drug is conjugated.

상기 소수성 약물은 구체적으로 레스베라트롤 및 커큐민으로 이루어진 군에서 선택된 하나 이상일 수 있다.The hydrophobic drug may specifically be at least one selected from the group consisting of resveratrol and curcumin.

상기 양이온성 고분자는 폴리(아미도아민) 계열 덴드리머(PAMAM 덴드리머), 키토산, 폴리(알릴아민)(poly(arylamine)), 폴리(비닐아민)(poly(vinylamine)), 폴리디알린메틸암모니움 클로라이드, 폴리에틸렌이민(polyethylenimine), N-하이드록시석신이미드(N-hydroxysuccinimide), 아텔로콜라겐(atelocollagen), 디에틸아미노에틸 셀룰로스(deithylaminoethyl cellulose), 폴리(L-라이신)(poly(L-lysine), β-시클로덱스트린(β-cyclodextrin), 폴리(N-에틸-4-비닐피리디늄브로마이드)(poly(Nethyl-4-vinylpyridiniumbromide), 폴리(디메틸아미노에틸메타크릴레이트)(poly(dimetylaminoethylmethylacrylate), 풀루란(pullulan), 헤파린, 시조필란(schizophyllan) 및 알부민으로 이루어진 군에서 선택된 하나 이상일 수 있다.The cationic polymer is a poly(amidoamine)-based dendrimer (PAMAM dendrimer), chitosan, poly(allylamine) (poly(arylamine)), poly(vinylamine) (poly(vinylamine)), polydialline methylammonium Chloride, polyethylenimine, N-hydroxysuccinimide, atelocollagen, diethylaminoethyl cellulose, poly(L-lysine) ), β-cyclodextrin, poly(N-ethyl-4-vinylpyridinium bromide)(poly(Nethyl-4-vinylpyridiniumbromide), poly(dimethylaminoethylmethacrylate)(poly(dimetylaminoethylmethylacrylate), It may be one or more selected from the group consisting of pullulan, heparin, schizophyllan, and albumin.

본 발명의 일 구현예에 따르면, 상기 약물/유전자 전달 복합체는 콜레스테롤이 접합된 양이온성 고분자 마이셀 내부에 소수성 약물이 봉입되고, 양이온성 고분자 표면에 유전자가 결합된 것을 의미한다. 즉, 수용액 상에서 콜레스테롤 부위가 안쪽을 향하고 양이온성 고분자 부위는 바깥쪽을 향하는 마이셀 형태로 형성되어 마이셀 내부에 소수성 약물을 마이셀 외부에 유전자를 결합시켜(양이온성 고분자 및 유전자가 쉘에 위치하고 콜레스테롤과 약물이 코어에 위치함) 약물과 유전자 모두 전달할 수 있는 복합체이다.According to one embodiment of the present invention, the drug/gene delivery complex means that a hydrophobic drug is enclosed in a cationic polymer micelle to which cholesterol is conjugated, and a gene is bound to the surface of the cationic polymer. In other words, in the aqueous solution, the cholesterol part faces inward and the cationic polymer part faces outward in the form of micelles, so that a hydrophobic drug inside the micelles is bound to the gene outside the micelles (cationic polymers and genes are located in the shell and cholesterol and drugs It is a complex that can deliver both drugs and genes.

일 구현예에서, 상기 콜레스테롤이 접합된 양이온성 고분자와 소수성 약물이 1 : 0.4 ~ 1.0 또는 1 : 0.45 ~ 0.9의 중량비로 혼합된 것을 포함한다.In one embodiment, the cholesterol-conjugated cationic polymer and a hydrophobic drug are mixed in a weight ratio of 1: 0.4 to 1.0 or 1: 0.45 to 0.9.

일 구현예에서, 유전자와 상기 마이셀(약물이 봉입된 콜레스테롤이 접합된 양이온성 고분자 마이셀)이 1 : 12 ~ 25 또는 13 ~ 20의 중량비로 혼합된 것을 포함한다.In one embodiment, a gene and the micelle (a cationic polymer micelle conjugated with a drug-encapsulated cholesterol) are mixed in a weight ratio of 1: 12 to 25 or 13 to 20.

특히, 상기 양이온성 고분자는 자체적으로 매우 낮은 독성을 가지고 있으며, 콜레스테롤 또한 생체를 구성하는 물질이기 때문에 본 발명의 약물/유전자 전달용 복합체는 낮은 세포독성과 면역원성을 갖는다.In particular, since the cationic polymer itself has very low toxicity and cholesterol is also a material constituting a living body, the drug/gene delivery complex of the present invention has low cytotoxicity and immunogenicity.

본 발명의 일 구현예에 따르면, 상기 약물/유전자 전달 복합체는 50 ~ 300 nm(바람직하게는 80 ~ 200 nm)의 평균 입자 크기를 갖는다. 하나의 특정예에서 상기 복합체는 100 ~ 250 nm(바람직하게는 100 ~ 200 nm)의 평균 입자 크기를 갖는다.According to one embodiment of the present invention, the drug/gene delivery complex has an average particle size of 50 to 300 nm (preferably 80 to 200 nm). In one specific example, the composite has an average particle size of 100 to 250 nm (preferably 100 to 200 nm).

본 발명의 일 구현예에 따르면, 상기 약물/유전자 전달 복합체는 1 내지 50 mV 범위의 제타 전위를 나타낸다. 이와 같이 본 발명의 복합체는 양성 제타 전위를 나타내기 때문에 효율적으로 세포 내로 엔도사이토시스될 수 있으며, 이에 따라 양이온성 고분자에 결합되어 있는 유전자 역시 목적 부위에 효율적으로 전달될 수 있다.According to an embodiment of the present invention, the drug/gene delivery complex exhibits a zeta potential in the range of 1 to 50 mV. As described above, since the complex of the present invention exhibits a positive zeta potential, it can be efficiently endocytosed into cells, and thus genes bound to the cationic polymer can also be efficiently delivered to the target site.

본 발명에서 상기 유전자는 플라스미드 유전자, 안티센스 올리고뉴클레오티드, siRNA, shRNA, miRNA, rRNA, RNA, DNA, cDNA, mRNA 및 tRNA로 이루어진 군으로 이루어진 군에서 선택된 하나 이상일 수 있다.In the present invention, the gene may be one or more selected from the group consisting of a plasmid gene, an antisense oligonucleotide, siRNA, shRNA, miRNA, rRNA, RNA, DNA, cDNA, mRNA, and tRNA.

본 명세서에서 용어, " 플라스미드 유전자"는 고리형태의 이중가닥 DNA로서 균류의 세포 내에 복제되어 독자적으로 증식할 수 있는 DNA이다. 다른 종의 세포 내에 전달될 수 있어 유전자재조합 기술을 통해 특정 유전형질을 발현하도록 하여 유전자 치료에 사용한다.As used herein, the term "plasmid gene" is a double-stranded DNA in the form of a ring, which is a DNA that can be replicated and proliferated independently in the cells of a fungus. Since it can be transferred into cells of different species, it is used for gene therapy by expressing a specific genotype through gene recombination technology.

본 명세서에서 용어, "siRNA"는 RNA 방해 또는 유전자 사일런싱을 매개할 수 있는 핵산 분자를 의미한다(참조: WO 00/44895, WO 01/36646, WO 99/32619, WO 01/29058, WO 99/07409 및 WO 00/44914). siRNA는 표적 유전자의 발현을 억제할 수 있기 때문에 효율적인 유전자 넉다운 방법으로서 또는 유전자 치료 방법으로 제공된다.As used herein, the term "siRNA" refers to a nucleic acid molecule capable of mediating RNA interference or gene silencing (see WO 00/44895, WO 01/36646, WO 99/32619, WO 01/29058, WO 99 /07409 and WO 00/44914). Since siRNA can inhibit the expression of a target gene, it is provided as an efficient gene knockdown method or as a gene therapy method.

하나의 특정예에서 본 발명의 siRNA 분자는, 센스 가닥과 안티센스 가닥이 서로 반대쪽에 위치하여 이중쇄를 이루는 구조를 가질 수 있다. 다른 특정예에 따르면, 본 발명의 siRNA 분자는 자기-상보성(self-complementary) 센스 및 안티센스 가닥을 가지는 단일쇄 구조를 가질 수 있다. siRNA는 RNA끼리 짝을 이루는 이중사슬 RNA 부분이 완전히 쌍을 이루는 것에 한정되지 않고 미스매치(대응하는 염기가 상보적이지 않음), 벌지(일방의 사슬에 대응하는 염기가 없음) 등에 의하여 쌍을 이루지 않는 부분이 포함될 수 있다. 전체 길이는 10 내지 100 염기, 바람직하게는 15 내지 80 염기, 더욱 바람직하게는 20 내지 70 염기이다.In one specific example, the siRNA molecule of the present invention may have a structure in which a sense strand and an antisense strand are located opposite to each other to form a double chain. According to another specific example, the siRNA molecule of the present invention may have a single-chain structure having a self-complementary sense and antisense strand. siRNA is not limited to a complete pair of double-stranded RNA portions that pair with each other, and is not paired by mismatch (the corresponding base is not complementary), bulge (there is no base corresponding to one chain), etc. May contain parts that do not. The total length is 10 to 100 bases, preferably 15 to 80 bases, more preferably 20 to 70 bases.

본 명세서에서 용어, "shRNA(short hairpin RNA)" 는 45 내지 70 뉴클레오티드의 길이를 가지는 단일가닥의 RNA로서 타겟 유전자 siRNA 염기서열의 센스와 상보적인 nonsense 사이에 3-10개의 염기 링커를 연결하는 올리고 DNA를 합성한 후 플라스미드 벡터에 클로닝하거나 또는 shRNA를 레트로바이러스인 렌티바이러스(lentivirus) 및 아데노 바이러스(adenovirus)에 삽입하여 발현시키면 loop가 있는 헤어핀 구조의 shRNA가 만들어지고 세포 내의 dicer에 의해 siRNA로 전환되어 RNAi 효과를 나타낸다.As used herein, the term "shRNA (short hairpin RNA)" is a single-stranded RNA having a length of 45 to 70 nucleotides, and an oligo linking 3-10 bases between the sense of the target gene siRNA sequence and the complementary nonsense When DNA is synthesized and then cloned into a plasmid vector or shRNA is inserted into retroviruses lentivirus and adenovirus and expressed, a hairpin-like shRNA with loop is created and converted into siRNA by dicer in cells. To show RNAi effect.

본 명세서의 사용된 용어, "miRNA(microRNA)"는 21-25 뉴클레오타이드의 단일 가닥 RNA 분자로서, 타겟 mRNA의 파쇄 또는 해독단계에서의 억제를 통하여 진핵생물의 유전자 발현을 제어하는 조절물질이다. 이러한 miRNA는 두 단계의 프로세싱으로 이루어진다. 최초의 miRNA 전사체(primary miRNA)가 핵 안에서 Drosha라는 RNaseⅢ type 효소에 의해 70-90 염기 정도의 스템-루프 구조, 즉 pre-miRNA로 만들어지고, 이후 세포질로 이동하여 다이서(Dicer)라는 효소에 의해 절단되어 21-25 염기의 성숙한 miRNA로 만들어진다. 이렇게 생성된 miRNA는 표적 mRNA에 상보적으로 결합하여 전사 후 유전자 억압자(post-transcriptional gene suppressor)로써 작용하며, 번역 억제와 mRNA 불안정화를 유도한다. miRNAs는 다양한 생리학적 현상 및 질환에 관여한다.As used herein, the term "miRNA (microRNA)" is a single-stranded RNA molecule of 21-25 nucleotides, and is a modulator that controls gene expression in eukaryotes through inhibition in the disruption or translation step of target mRNA. These miRNAs are processed in two steps. The first miRNA transcript (primary miRNA) is made into a stem-loop structure of about 70-90 bases, that is, pre-miRNA in the nucleus by an RNaseIII type enzyme called Drosha, and then moves to the cytoplasm, an enzyme called Dicer. To produce a mature miRNA of 21-25 bases. The resulting miRNA complementarily binds to the target mRNA, acts as a post-transcriptional gene suppressor, and induces translational inhibition and mRNA destabilization. miRNAs are involved in a variety of physiological phenomena and diseases.

본 명세서에서 사용된 용어, "안티센스 올리고뉴클레오티드"란 특정 mRNA의 서열에 상보적인 핵산 서열을 함유하고 있는 DNA 또는 RNA 또는 이들의 유도체를 의미하고, mRNA 내의 상보적인 서열에 결합하여 mRNA의 단백질로의 번역을 저해하는 작용을 한다. 안티센스 올리고뉴클레오티드의 길이는 6내지 100 염기이고, 바람직하게는 8 내지 60 염기이고, 보다 바람직하게는 10 내 40 염기이다.As used herein, the term "antisense oligonucleotide" refers to a DNA or RNA containing a nucleic acid sequence complementary to a specific mRNA sequence, or a derivative thereof, and binds to a complementary sequence in the mRNA to convert the mRNA into a protein. It acts to inhibit translation. The length of the antisense oligonucleotide is 6 to 100 bases, preferably 8 to 60 bases, and more preferably 10 to 40 bases.

본 발명의 일 구현예에 따르면, 본 발명은 상기 약물/유전자 전달 복합체를 포함하는 비강 투여용 염증성 폐질환 예방 또는 치료용 약제학적 조성물을 제공한다.According to one embodiment of the present invention, the present invention provides a pharmaceutical composition for preventing or treating inflammatory lung disease for nasal administration comprising the drug/gene delivery complex.

본 발명자들은 기존의 경구 투여로 염증성 폐질환을 치료할 경우 체내 약물 흡수율이 낮아 이를 흡입 가능하도록 비강 투여로 염증성 폐질환을 치료하기 위해 약물 및 유전자를 함께 전달할 수 있는 복합체를 개발하기 위하여 연구 노력하였다. 그 결과, 기존 경구 투여에 의한 염증성 폐질환 치료제 보다 비강 투여로 치료 가능한 본 발명에 따른 복합체가 매우 우수한 염증성 폐질환 치료 효과를 가짐을 확인할 수 있었다(도 16 참조). The present inventors have tried to develop a complex capable of delivering drugs and genes together in order to treat inflammatory lung diseases by nasal administration so that drug absorption in the body is low when treating inflammatory lung diseases by conventional oral administration. As a result, it was confirmed that the complex according to the present invention, which can be treated by nasal administration, has a very superior inflammatory lung disease treatment effect than the conventional oral treatment for inflammatory lung disease (see FIG. 16).

본 발명의 일 구현예에 따르면, 상기 염증성 호흡기 질환은 천식, 만성 폐쇄성 폐질환(COPD), 급성 폐손상(acute lung injury), 농흉, 폐농양, 폐렴, 폐결핵 및 기관지염으로 구성된 군으로부터 선택된다.According to one embodiment of the present invention, the inflammatory respiratory disease is selected from the group consisting of asthma, chronic obstructive pulmonary disease (COPD), acute lung injury, empyema, lung abscess, pneumonia, pulmonary tuberculosis and bronchitis.

상기 천식의 예로는, 기관지 천식, 아토피성 천식, 아토피성 기관지 IgE 매개 천식, 비아토피성 천식, 알레르기성 천식 및 비알레르기성 천식 등이 있으며, 상기 기관지염의 예로는, 급성 기관지염, 만성 기관지염, 세기관지염 및 카타르성 기관지염 등이 있다.Examples of the asthma include bronchial asthma, atopic asthma, atopic bronchial IgE mediated asthma, non-topic asthma, allergic asthma and non-allergic asthma, and examples of the bronchitis include acute bronchitis, chronic bronchitis, bronchiolitis And catarrhal bronchitis.

본 발명의 일 구현예에 따르면, 본 발명의 약제학적 조성물은 흡입 가능한 비강 내 주입으로 비강 투여할 수 있다. According to one embodiment of the present invention, the pharmaceutical composition of the present invention may be administered nasally by inhalable intranasal injection.

본 발명의 약제학적 조성물은 유효성분 이외에 약제학적으로 허용되는 담체를 포함한다. 본 발명의 약제학적 조성물에 포함되는 약제학적으로 허용되는 담체는 제제 시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences (19th ed.,1995)에 상세히 기재되어 있다.The pharmaceutical composition of the present invention includes a pharmaceutically acceptable carrier in addition to the active ingredient. Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are commonly used in formulation, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, Calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, etc. It does not become. The pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, and the like in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

본 발명의 약제학적 조성물은 비강 투여에 의해 폐 조직으로 전달될 수 있다.The pharmaceutical composition of the present invention can be delivered to lung tissue by nasal administration.

본 발명의 약학적 조성물의 유효 투여량은 환자의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설율 및 질환의 중증도 등에 따라 그 범위가 다양하며, 당해 기술 분야의 통상의 전문가에 의해 용이하게 결정될 수 있다.The effective dosage of the pharmaceutical composition of the present invention varies depending on the patient's weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and severity of disease. It can be easily determined by an expert.

본 발명의 약학적 조성물의 바람직한 투여량은 환자의 상태 및 체중, 질병의 정도, 약물 형태, 투여경로, 및 기간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다. 그러나 바람직하게는, 1일 당 0.001 내지 1000 mg/체중kg으로, 보다 바람직하게는 1일 당 0.01 내지 300 mg/체중kg으로 투여한다. 투여는 하루에 한 번 투여할 수도 있고, 여러 번 나누어 투여할 수도 있다. 본 발명의 유전자 전달체 복합체는 전체 조성물 총 중량에 대하여 0.0001 내지 10 중량%, 바람직하게는 0.001 내지 1 중량%의 양으로 존재할 수 있다.The preferred dosage of the pharmaceutical composition of the present invention varies depending on the condition and weight of the patient, the severity of the disease, the form of the drug, the route of administration, and the duration, but may be appropriately selected by those skilled in the art. However, preferably, it is administered at 0.001 to 1000 mg/kg body weight per day, and more preferably at 0.01 to 300 mg/kg body weight per day. Administration may be administered once a day, or may be administered in several divided doses. The gene delivery system complex of the present invention may be present in an amount of 0.0001 to 10% by weight, preferably 0.001 to 1% by weight, based on the total weight of the composition.

본 발명의 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.The pharmaceutical composition of the present invention is prepared in unit dosage form by formulating using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily carried out by a person having ordinary knowledge in the art. Or it can be made by incorporating it into a multi-dose container. At this time, the formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, granule, tablet or capsule, and may additionally include a dispersant or a stabilizer.

본 명세서에서 용어 "약제학적 유효량"은 상술한 약물/유전자 전달 복합체의 효능 또는 활성을 달성하는 데 충분한 양을 의미한다. The term "pharmaceutically effective amount" as used herein means an amount sufficient to achieve the efficacy or activity of the drug/gene delivery complex described above.

본 발명의 다른 양태에 따르면, 본 발명은 According to another aspect of the present invention, the present invention

양이온성 고분자에 콜레스테롤을 접합시켜 콜레스테롤이 접합된 양이온성 고분자를 제조하는 단계;Preparing a cationic polymer to which cholesterol is conjugated by conjugating cholesterol to a cationic polymer;

소수성 약물을 봉입시키는 단계; 및Encapsulating a hydrophobic drug; And

양이온성 고분자 표면에 유전자를 결합시키는 단계Binding the gene to the surface of the cationic polymer

를 포함하는 상술한 약물/유전자 전달 복합체의 제조방법을 포함할 수 있다.It may include a method for preparing the drug/gene delivery complex described above, including.

상기에서 약물/유전자 전달 복합체와 관련하여 기술한 모든 내용이 약물/유전자 전달 복합체의 제조방법에 그대로 적용 또는 준용될 수 있다.All the contents described above with respect to the drug/gene delivery complex may be applied or applied mutatis mutandis to the method of manufacturing the drug/gene delivery complex.

상기 콜레스테롤이 접합된 양이온성 고분자는 양이온성 고분자에 콜레스테롤을 접합시키는 단계는 하나 이상의 유기 용매 상에서 결합되는 것을 특징으로 한다. 이때, 상기 유기 용매는 디메틸설폭사이드(Dimethyl sulfoxide), 아세톤(acetone), 에탄올(ethanol), 메탄올(methanol), 1-프로판올(1-propanol), N,N-디메틸포름아마이드(N,N-dimethylformamide), N-메틸피롤리돈(N-methyl pyrrolidone), 다이옥산(dioxane), 테트라하이드로퓨란(tetrahydrofuran), 에틸아세테이트(ethyl acetate), 메틸에틸케톤(methylethylketone), 클로로포름(chloroform) 및 아세토니트릴(acetonitrile)로 이루어진 군에서 하나 이상 선택될 수 있다. 보다 바람직하기로는 양이온성 고분자로 PAMAM 덴드리머를 사용하는 경우에는 클로로포름과 메탄올의 혼합물이 적합하다. 이때, 콜레스테롤이 양이온성 고분자에 접합되도록 하기 위한 콜레스테릴 유도체를 사용할 수 있다. 상기 콜레스테릴 유도체는 콜레스테릴 에스터(cholesteryl ester), 콜레스테릴 클로로포르메이트(cholesteryl chloroformate) 및 콜레스테릴 벤조에이트(cholesteryl benzoate)로 이루어지는 군으로부터 선택된 하나 이상일 수 있으며, 콜레스테릴 클로로포르메이트가 보다 바람직하다.The step of conjugating cholesterol to the cationic polymer in the cholesterol-conjugated cationic polymer is characterized in that it is combined in one or more organic solvents. At this time, the organic solvent is dimethyl sulfoxide, acetone, ethanol, methanol, 1-propanol, N,N-dimethylformamide (N,N- dimethylformamide), N-methyl pyrrolidone, dioxane, tetrahydrofuran, ethyl acetate, methylethylketone, chloroform, and acetonitrile ( acetonitrile) may be selected from the group consisting of one or more. More preferably, a mixture of chloroform and methanol is suitable when using PAMAM dendrimer as a cationic polymer. At this time, a cholesterol derivative for conjugating cholesterol to a cationic polymer may be used. The cholesteryl derivative may be at least one selected from the group consisting of cholesteryl ester, cholesteryl chloroformate, and cholesteryl benzoate, and cholesteryl chloroformate Mates are more preferred.

양이온성 고분자를 유기용매에 녹인 양이온성 고분자 용액과 콜레스테릴 유도체를 유기용매에 녹인 콜레스테롤 용액을 0.5ml/10분 내지 10ml/10분의 속도로 30~40℃에서 40 ~60시간 동안 서서히 교반 후, 증류수를 첨가하고 원심분리, 여과, 투석 및 동결건조 과정을 거쳐 콜레스테롤이 접합된 양이온성 고분자를 제조한다. A cationic polymer solution in which a cationic polymer is dissolved in an organic solvent and a cholesterol solution in which a cholesteryl derivative is dissolved in an organic solvent are slowly stirred at 30 to 40°C for 40 to 60 hours at a rate of 0.5 ml/10 min to 10 ml/10 min. Thereafter, distilled water is added, followed by centrifugation, filtration, dialysis, and freeze-drying to prepare a cationic polymer conjugated with cholesterol.

이때, 제조된 콜레스테롤이 접합된 양이온성 고분자는 도 2에 나타낸 바와 같이 마이셀 형태를 가지며, 소수성의 콜레스테롤 부위는 마이셀 내부를 향해 위치하며, 양이온성 고분자는 마이셀 외부를 향해 위치한다.At this time, the prepared cationic polymer to which cholesterol is conjugated has a micelle shape as shown in FIG. 2, the hydrophobic cholesterol portion is located toward the inside of the micelle, and the cationic polymer is located toward the outside of the micelle.

그런 다음, 마이셀 형태의 콜레스테롤이 접합된 양이온성 고분자 내부에 소수성 약물, 즉 레스베라트롤 또는 커큐민이 봉입되도록 충전하는 단계이다.Then, a hydrophobic drug, that is, resveratrol or curcumin, is filled in the inside of the cationic polymer to which the micelle-type cholesterol is conjugated.

상기 마이셀 100 중량부를 물 300 중량부 내지 700 중량부에 용해시키고, 소수성 약물 20 중량부 내지 100 중량부를 에탄올 300 중량부 내지 700 중량부에 용해시킨다. 상기 두 용액을 혼합하고 물을 첨가 후, 초음파 분쇄, 용매 증발 및 동결건조 과정을 거쳐 약물을 충전시킨다.100 parts by weight of the micelles are dissolved in 300 parts by weight to 700 parts by weight of water, and 20 parts by weight to 100 parts by weight of a hydrophobic drug are dissolved in 300 parts by weight to 700 parts by weight of ethanol. The two solutions are mixed and water is added, followed by ultrasonic pulverization, solvent evaporation, and lyophilization to fill the drug.

그런 다음, 약물이 봉입된 마이셀 표면(즉, 양이온성 고분자 표면)에 유전자를 결합시켜 비강 투여용 약물/유전자 전달 복합체를 제조한다.Then, a drug/gene delivery complex for nasal administration is prepared by binding a gene to the drug-encapsulated micelle surface (ie, a cationic polymer surface).

상기 약물이 봉입된 마이셀과 유전자를 결합시켜 복합체를 형성하기 위하여, 마이셀을 물에 녹이고 유전자와 혼합한다. 이때 20~30℃에서 10~60분간 안정화 단계를 거친다.To form a complex by combining the drug-encapsulated micelles with the gene, the micelles are dissolved in water and mixed with the gene. At this time, it goes through a stabilization step at 20~30℃ for 10~60 minutes.

본 발명에 따른 비강 투여용 약물/유전자 전달 복합체는 체내에 흡수되기 힘든 소수성 약물을 효율적으로 전달할 수 있으며 소수성 약물과 유전자를 동시에 전달할 수 있다. 또한, 효과는 뛰어나나 부작용을 가진 소수성 약물과 부작용을 완화시켜 줄 수 있는 유전물질을 복합 전달하여 효율을 극대화시킬 수 있다. 특히, 상기 복합체는 흡입 가능한 비강 투여 방식으로 약물 흡수율이 낮은 기존 경구 투여용 염증성 폐질환 치료용 조성물에 비해 현저히 개선된 치료 효과를 가지므로, 1회 투여만으로도 약물의 효과를 확인할 수 있다.The drug/gene delivery complex for nasal administration according to the present invention can efficiently deliver a hydrophobic drug that is difficult to be absorbed into the body, and simultaneously deliver a hydrophobic drug and a gene. In addition, the efficiency can be maximized by delivering a combination of a hydrophobic drug having a side effect and a genetic material that can alleviate the side effect, although it is effective. In particular, the complex has a significantly improved therapeutic effect compared to the conventional oral inflammatory pulmonary disease treatment composition, which has a low drug absorption rate in an inhalable nasal administration method, so that the effect of the drug can be confirmed with only one administration.

도 1는 PAMAM-cholesterol(PAM-chol)의 반응식과 합성 개요도이다.
도 2는 PAM-chol을 이용하여 소수성 약물을 내부에 포함한 마이셀과 치료 유전자의 나노 복합체 형성과 복합체의 내포작용 후 약물 방출을 통한 치료 효과를 나타낸 개요도이다.
도 3은 PAMAM g2와 콜레스테롤의 결합을 통한 PAM-chol의 형성을 1H NMR으로 확인한 결과이다.
도 4는 레스베라트롤을 내부에 포함한 PAM-chol 나노마이셀의 SEM 영상(A) 및 레스베라트롤을 내부에 포함한 PAM-chol 나노마이셀과 pDNA 복합체의 SEM 영상(B)을 나타낸 것이다.
도 5는 PAM-chol/res 나노마이셀과 PAM-chol/res/pDNA 복합체의 크기를 나타낸 것이고(A), PAM-chol/res 나노마이셀과 PAM-chol/res/pDNA 복합체의 표면전하를 동적광산란법(Dynamic Light Scattering) 입자분석을 통하여 측정하여 비교한 결과이다(B).
도 6은 L2 세포주에서 레스베라트롤이 포함된 비율에 따른 PAM-chol/res 나노마이셀의 유전자 전달 효율을 비교한 결과이다.
도 7은 L2 세포주에서 커큐민이 포함된 비율에 따른 PAM-chol/cur 나노마이셀의 유전자 전달 효율을 비교한 결과이다.
도 8은 급성 폐손상 마우스 모델에서 HO-1 발현 정도를 면역조직화학법 염색을 통해 확인한 결과이다.
도 9는 급성 폐손상 마우스 모델에서 HO-1 발현 정도를 면역조직화학법 염색을 통해 확인한 결과이다.
도 10은 레스베라트롤의 NF-kB 활성 억제 효과를 형광면역분석법을 통해 공초점현미경으로 관찰한 결과이다.
도 11은 커큐민의 NF-kB 활성 억제 효과를 형광면역분석법을 통해 공초점현미경으로 관찰한 결과이다.
도 12는 급성 폐손상 마우스 모델에서 체취한 폐 세척액(A~C)과 폐 조직(D~F)에서 PAM-chol을 이용한 레스베라트롤과 HO-1 유전자의 전달에 따른 항염증 효과를 확인한 결과이다.
도 13은 급성 폐손상 마우스 모델 폐 조직슬라이드의 헤마톡실린-에오신 염색(hematoxylin-eosin stain, H&E stain)을 통한 염증 치료 효과를 확인한 결과이다.
도 14는 급성 폐손상 마우스 모델에서 체취한 폐 세척액(A~C)에서 PAM-chol을 이용한 커큐민과 HO-1 유전자의 전달에 따른 항염증 효과를 확인한 결과이다.
도 15는 급성 폐손상 마우스 모델 폐 조직슬라이드의 헤마톡실린-에오신 염색(hematoxylin-eosin stain, H&E stain)을 통한 염증 치료 효과를 확인한 결과이다.
도 16은 기존 경구 투여 약물과 본 발명에 따른 비강 투여용 복합체의 항염증 효과를 비교한 것이다.
1 is a schematic diagram of the reaction scheme and synthesis of PAMAM-cholesterol (PAM-chol).
2 is a schematic diagram showing the therapeutic effect through drug release after the formation of nanocomplexes of micelles and therapeutic genes containing a hydrophobic drug therein using PAM-chol, and the inclusion of the complex.
3 is a result of confirming the formation of PAM-chol through the binding of PAMAM g2 and cholesterol by 1H NMR.
FIG. 4 shows SEM images (A) of PAM-chol nanomicelles containing resveratrol inside and SEM images (B) of PAM-chol nanomicels and pDNA complexes containing resveratrol inside.
5 shows the size of the PAM-chol/res nanomicelle and the PAM-chol/res/pDNA complex (A), and dynamic light scattering of the surface charge of the PAM-chol/res nanomicelle and the PAM-chol/res/pDNA complex This is the result of comparison by measuring through particle analysis (Dynamic Light Scattering) (B).
6 is a result of comparing the gene transfer efficiency of PAM-chol/res nanomicelles according to the proportion of resveratrol in the L2 cell line.
7 is a result of comparing the gene transfer efficiency of PAM-chol/cur nanomicelles according to the ratio of curcumin contained in the L2 cell line.
8 is a result of confirming the level of HO-1 expression in a mouse model of acute lung injury through immunohistochemistry staining.
9 is a result of confirming the level of HO-1 expression in a mouse model of acute lung injury through immunohistochemistry staining.
10 is a result of observing the effect of resveratrol inhibiting NF-kB activity with a confocal microscope through fluorescence immunoassay.
11 is a result of observing the effect of curcumin inhibiting NF-kB activity with a confocal microscope through fluorescence immunoassay.
12 is a result of confirming the anti-inflammatory effect of resveratrol and HO-1 gene transfer using PAM-chol in lung lavage fluid (A-C) and lung tissue (D-F) taken in a mouse model of acute lung injury.
13 is a result of confirming the effect of treating inflammation through hematoxylin-eosin stain (H&E stain) of a mouse model lung tissue slide with acute lung injury.
14 is a result of confirming the anti-inflammatory effect of the delivery of curcumin and HO-1 genes using PAM-chol in lung lavage fluids (A to C) taken in an acute lung injury mouse model.
15 is a result of confirming the effect of treating inflammation through hematoxylin-eosin stain (H&E stain) of a mouse model lung tissue slide with acute lung injury.
16 is a comparison of the anti-inflammatory effect of the conventional oral administration drug and the nasal administration complex according to the present invention.

이하, 본 발명의 실시예를 통해 상세히 설명한다. 하기 실시예는 본 발명을 예시하는 것일 뿐 본 발명의 범위가 하기 실시예에 한정되는 것은 아니다. 본 실시예들은 본 발명의 개시가 완전하도록 하고, 본 발명이 속하는 기술 분야에서 통상의 지식이 가진 자에게 발명의 범주를 완전하게 알려주기 위해 제공되는 것이며, 본 발명은 청구항의 범주에 의해 정의될 뿐이다.Hereinafter, it will be described in detail through an embodiment of the present invention. The following examples are merely illustrative of the present invention, and the scope of the present invention is not limited to the following examples. These embodiments are provided to complete the disclosure of the present invention, and to fully inform the scope of the invention to those skilled in the art to which the present invention belongs, and the present invention is defined by the scope of the claims. Only.

실시예 1: PAM-chol의 제조Example 1: Preparation of PAM-chol

합성을 위한 용매로 클로로포름과 메탄올을 1:1 부피 비율로 혼합하여 사용하였다. PAMAM G2(Aldrich, St. Louis, MO) 0.1 mmol을 용매 20 ml에 녹여두고 용매 30 ml에 cholesteryl chloroformate 0.2 mmol을 녹인 용액을 PAMAM G2를 녹인 용액에 10분에 3ml의 속도로 한 방울씩 넣어준 후 교반기로 37℃에서 48시간동안 반응시켰다(혼합물 제조). 상기 혼합물에 증류수 40ml을 넣고 섞어주면 합성에 성공한 PAM-chol은 물에 녹으나 반응하지 않고 남아있는 콜레스테롤은 침전되었다. 증류수를 섞은 상기 혼합물을 2000rpm에 5분동안 원심분리한 후 상층액을 실린지 필터 0.22um로 filtration하였다. 걸러낸 용액은 투석막(MWCO 2kDa)을 사용하여 4℃에서 48시간 동안 투석시킨 후 동결건조하여 PAM-chol을 제조하였다(도 1).As a solvent for synthesis, chloroform and methanol were mixed in a volume ratio of 1:1. 0.1 mmol of PAMAM G2 (Aldrich, St. Louis, MO) was dissolved in 20 ml of solvent, and a solution of 0.2 mmol of cholesteryl chloroformate in 30 ml of solvent was added dropwise to the solution of PAMAM G2 at a rate of 3 ml every 10 minutes. Then, it was reacted at 37° C. for 48 hours with a stirrer (preparation of a mixture). When 40 ml of distilled water was added to the mixture and mixed, PAM-chol, which was successfully synthesized, was dissolved in water, but the cholesterol remaining without reaction was precipitated. The mixture mixed with distilled water was centrifuged at 2000 rpm for 5 minutes, and then the supernatant was filtered through a 0.22 μm syringe filter. The filtered solution was dialyzed at 4° C. for 48 hours using a dialysis membrane (MWCO 2kDa) and then lyophilized to prepare PAM-chol (FIG. 1).

합성한 PAM-chol은 1H NMR을 이용하여 확인하였다. NMR 확인 결과 PAMAM g2의 -CH2-의 228개의 H는 δ2.2~3.3사이의 피크로 나타났으며, 콜레스테롤의 -CH3의 15개의 H와 사이클로헥사인 고리의 접하는 부위의 3개의 H는 δ0.6~0.8 사이에서 피크를 나타냈다. 이를 통해 PAMAM g2에 콜레스테롤이 약 1:1.5의 몰비율로 결합되어 있음을 확인할 수 있었다 (도 3).The synthesized PAM-chol was confirmed using 1H NMR. As a result of NMR confirmation, 228 H of -CH 2 -of PAMAM g2 appeared as a peak between δ 2.2 and 3.3, and 15 H of -CH 3 of cholesterol and 3 H of the contact site of the cyclohexaine ring were A peak was shown between δ0.6 and 0.8. Through this, it was confirmed that cholesterol was bound to PAMAM g2 in a molar ratio of about 1:1.5 (FIG. 3).

실시예Example 2: 소수성 약물을 포함한 2: containing hydrophobic drugs 마이셀Micelle 제조 및 Manufacturing and 마이셀에To micelle 유전자를 결합시킨 복합체 형성 Formation of complexes that combine genes

1) One) 레스베라트롤을Resveratrol 포함한 inclusive 마이셀Micelle 제조 및 Manufacturing and 마이셀에To micelle 유전자를 결합시킨 복합체 형성 Formation of complexes that combine genes

500μg의 물에 PAM-chol 100μg을 녹여두고 80μg의 레스베라트롤을 500μg의 에탄올에 녹였다. 두 용액을 섞은 후 주사기를 이용해 9ml의 물에 천천히 넣어주며 초음파분쇄를 시켰다. 초음파분쇄는 3mm 마이크로팁을 이용하여 0.5초의 pulse on/off 간격으로 30초간 실시하였으며 이를 5회 반복하였다. 초음파 분쇄를 시킨 후 회전 증발기를 이용해 에탄올을 증발시키면 PAM-chol 마이셀 내부에 적재되지 않은 레스베라트롤은 침전되었다. 침전되지 않은 상층액만을 새로운 튜브에 넣고 동결건조시켜 사용하였다.100 μg of PAM-chol was dissolved in 500 μg of water, and 80 μg of resveratrol was dissolved in 500 μg of ethanol. After mixing the two solutions, they were slowly poured into 9 ml of water using a syringe and ultrasonically pulverized. Ultrasonic grinding was performed for 30 seconds at a pulse on/off interval of 0.5 seconds using a 3mm microtip, and this was repeated 5 times. When ethanol was evaporated using a rotary evaporator after ultrasonic pulverization, resveratrol that was not loaded in the PAM-chol micelle was precipitated. Only the supernatant that was not precipitated was put into a new tube and lyophilized for use.

마이셀과 유전자 복합체 형성을 위해 마이셀(PAM-chol/res)과 유전자는 15:1의 중량비로 혼합하였다. 동결건조한 마이셀을 물에 녹여 CMV promotor만을 포함하며 발현효과가 없는 pCI-empty 플라스미드 DNA(pDNA)[Promega. Cat# E1731] (서열번호 1)와 혼합한 후 상온에서 30분간 안정화시켰다. To form a micelle and gene complex, micelles (PAM-chol/res) and genes were mixed at a weight ratio of 15:1. Freeze-dried micelles are dissolved in water to contain only CMV promotor and have no expression effect pCI-empty plasmid DNA (pDNA) [Promega. Cat# E1731] (SEQ ID NO: 1) and then stabilized at room temperature for 30 minutes.

상기 pDNA의 서열은 다음 서열번호 1과 같다.The sequence of the pDNA is shown in SEQ ID NO: 1.

[서열번호 1][SEQ ID NO: 1]

TCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAATATTGGCTATTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCCAATATGACCGCCATGTTGGCATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACACCAATGGGCGTGGATAGCGGT TTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTTCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAATATTGGCTATTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCCAATATGACCGCCATGTTGGCATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACACCAATGGGCGTGGATAGCGGT TTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGT

레스베라트롤이 적재된 PAM-chol 마이셀(PAM-chol/res)과 마이셀에 유전자를 결합시킨 복합체(PAM-chol/res/pDNA)의 나노입자 형태는 주사전자현미경(SEM) 사진을 통해 확인하였다(도 4).The nanoparticle shape of the resveratrol-loaded PAM-chol micelles (PAM-chol/res) and the complex (PAM-chol/res/pDNA) that binds the genes to the micelles was confirmed through a scanning electron microscope (SEM) photograph (Fig. 4).

PAM-chol/res와 PAM-chol/res/pDNA의 크기와 표면전하는 Zetasizer Nano ZS(Malvern Instruments, Worcestershire, UK)를 이용하여 확인하였다. PAM-chol/res는 약 160 nm의 크기를 가지며 약 46 mV의 표면전하를 가지는 나노입자를 형성하며, PAM-chol/res/pDNA는 약 120 nm의 크기를 가지며 약 40 mV의 표면전하를 가지는 나노입자를 형성함을 확인하였다 (도 5).The size and surface charge of PAM-chol/res and PAM-chol/res/pDNA were confirmed using Zetasizer Nano ZS (Malvern Instruments, Worcestershire, UK). PAM-chol/res has a size of about 160 nm and forms nanoparticles with a surface charge of about 46 mV, and PAM-chol/res/pDNA has a size of about 120 nm and has a surface charge of about 40 mV. It was confirmed that nanoparticles were formed (FIG. 5).

2) 2) 커큐민을Curcumin 포함한 inclusive 마이셀Micelle 제조 및 Manufacturing and 마이셀에To micelle 유전자를 결합시킨 복합체 형성 Formation of complexes that combine genes

500μg의 물에 PAM-chol 100μg을 녹여두고 50μg의 커큐민을 500μg의 에탄올에 녹였다. 두 용액을 섞은 후 주사기를 이용해 9ml의 물에 천천히 넣어주며 초음파분쇄를 시켰다. 초음파 분쇄는 3mm 마이크로팁을 이용하여 0.5초의 pulse on/off 간격으로 30초간 실시하였으며 이를 5회 반복하였다. 초음파 분쇄를 시킨 후 회전 증발기를 이용해 에탄올을 증발시키면 PAM-chol 마이셀 내부에 적재되지 않은 커큐민은 침전되었다. 침전되지 않은 상층액만을 새로운 튜브에 넣고 동결건조시켜 사용하였다.100 μg of PAM-chol was dissolved in 500 μg of water, and 50 μg of curcumin was dissolved in 500 μg of ethanol. After mixing the two solutions, they were slowly poured into 9 ml of water using a syringe and ultrasonically pulverized. Ultrasonic grinding was performed for 30 seconds at a pulse on/off interval of 0.5 seconds using a 3mm microtip, and this was repeated 5 times. When ethanol was evaporated using a rotary evaporator after ultrasonic pulverization, curcumin not loaded in the PAM-chol micelle was precipitated. Only the supernatant that was not precipitated was put into a new tube and lyophilized for use.

마이셀과 유전자 복합체 형성을 위해 마이셀(PAM-chol/cur)과 유전자를 15:1의 중량비로 혼합하였다. 동결건조한 마이셀을 물에 녹여 CMV promotor만을 포함하며 발현효과가 없는 pCI-empty 플라스미드 DNA(pDNA)[Promega. Cat# E1731](서열번호 1)와 혼합한 후 상온에서 30분간 안정화시켰다. To form a micelle and gene complex, micelles (PAM-chol/cur) and genes were mixed at a weight ratio of 15:1. Freeze-dried micelles are dissolved in water to contain only CMV promotor and have no expression effect pCI-empty plasmid DNA (pDNA) [Promega. Cat# E1731] (SEQ ID NO: 1) and then stabilized at room temperature for 30 minutes.

커큐민이 적재된 PAM-chol 마이셀(PAM-chol/cur)과 마이셀에 유전자를 결합시킨 복합체(PAM-chol/cur/pDNA)의 크기와 표면전하는 Zetasizer Nano ZS(Malvern Instruments, Worcestershire, UK)를 이용하여 확인하였다. PAM-chol/cur는 약 140 nm의 크기를 가지며 약 50 mV의 표면전하를 가지는 나노입자를 형성하며, PAM-chol/cur/pDNA는 약 120 nm의 크기를 가지며 약 45 mV의 표면전하를 가지는 나노입자를 형성함을 확인하였다 (도 5).The size and surface charge of the PAM-chol micelles loaded with curcumin (PAM-chol/cur) and the complex (PAM-chol/cur/pDNA) that binds the gene to the micelles are using Zetasizer Nano ZS (Malvern Instruments, Worcestershire, UK) And confirmed. PAM-chol/cur has a size of about 140 nm and forms nanoparticles with a surface charge of about 50 mV, and PAM-chol/cur/pDNA has a size of about 120 nm and has a surface charge of about 45 mV. It was confirmed that nanoparticles were formed (FIG. 5).

실시예Example 3: 유전자 전달 효율 확인 3: Confirmation of gene transfer efficiency

1) 세포주에서 1) in the cell line PAMPAM -- cholchol // 레스베라트롤Resveratrol /유전자 복합체의 유전자 전달 효율 측정/Measurement of gene transfer efficiency of gene complex

랫트 폐 상피 세포주 (Rat lung epithelial cell; L2 cell)[한국세포주은행(Korean Cell line Bank)에서 구입]을 10%의 FBS (fetal bovine serum)를 포함한 RPMI1640 배지를 사용하여 37℃, 5% CO2에서 배양하였다. L2 cell은 transfection 24시간 전에 12웰 플레이트에 5x104 cell/well의 밀도로 37℃, 5% CO2에서 배양하였고 각 웰에 들어갈 pDNA양은 0.4μg, complex의 양은 60μl로 고정하였다.Rat lung epithelial cell (L2 cell) (purchased from Korean Cell line Bank) was used in RPMI1640 medium containing 10% FBS (fetal bovine serum) at 37°C, 5% CO 2 Cultured in. L2 cells were cultured in a 12-well plate at a density of 5x10 4 cells/well 24 hours before transfection at 37°C and 5% CO 2 , and the amount of pDNA to enter each well was fixed at 0.4 μg and the amount of complex at 60 μl.

본 실험(luciferase assay)에서는 pDNA로 pluc 유전자[서열번호 2]를 사용하였다.In this experiment (luciferase assay), the pluc gene [SEQ ID NO: 2] was used as pDNA.

[서열번호 2][SEQ ID NO: 2]

gtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgttgccttcgccccgtgccccgctccgcgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggcccttctcctccgggctgtaattagcgcttggtttaatgacggctcgtttcttttctgtggctgcgtgaaagccttaaagggctccgggagggccctttgtgcgggggggagcggctcggggggtgcgtgcgtgtgtgtgtgcgtggggagcgccgcgtgcggcccgcgctgcccggcggctgtgagcgctgcgggcgcggcgcggggctttgtgcgctccgcgtgtgcgcgaggggagcgcggccgggggcggtgccccgcggtgcgggggggctgcgaggggaacaaaggctgcgtgcggggtgtgtgcgtgggggggtgagcagggggtgtgggcgcggcggtcgggctgtaacccccccctgcacccccctccccgagttgctgagcacggcccggcttcgggtgcggggctccgtgcggggcgtggcgcggggctcgccgtgccgggcggggggtggcggcaggtgggggtgccgggcggggcggggccgcctcgggccggggagggctcgggggaggggcgcggcggccccggagcgccggcggctgtcgaggcgcggcgagccgcagccattgccttttatggtaatcgtgcgagagggcgcagggacttcctttgtcccaaatctggcggagccgaaatctgggaggcgccgccgcaccccctctagcgggcgcgggcgaagcggtgcggcgccggcaggaaggaaatgggcggggagggccttcgtgcgtcgccgcgccgccgtccccttctccatctccagcctcggggctgccgcagggggacggctgccttcgggggggacggggcagggcggggttcggcttctggcgtgtgaccggcggggtttatatcttcccttctctgttcctccgcagcccccaagcttggtaccatggaagacgccaaaaacataaagaaaggcccggcgccattctatccgctggaagatggaaccgctggagagcaactgcataaggctatgaagagatacgccctggttcctggaacaattgcttttacagatgcacatatcgaggtggacatcacttacgctgagtacttcgaaatgtccgttcggttggcagaagctatgaaacgatatgggctgaatacaaatcacagaatcgtcgtatgcagtgaaaactctcttcaattctttatgccggtgttgggcgcgttatttatcggagttgcagttgcgcccgcgaacgacatttataatgaacgtgaattgctcaacagtatgggcatttcgcagcctaccgtggtgttcgtttccaaaaaggggttgcaaaaaattttgaacgtgcaaaaaaagctcccaatcatccaaaaaattattatcatggattctaaaacggattaccagggatttcagtcgatgtacacgttcgtcacatctcatctacctcccggttttaatgaatacgattttgtgccagagtccttcgatagggacaagacaattgcactgatcatgaactcctctggatctactggtctgcctaaaggtgtcgctctgcctcatagaactgcctgcgtgagattctcgcatgccagagatcctatttttggcaatcaaatcattccggatactgcgattttaagtgttgttccattccatcacggttttggaatgtttactacactcggatatttgatatgtggatttcgagtcgtcttaatgtatagatttgaagaagagctgtttctgaggagccttcaggattacaagattcaaagtgcgctgctggtgccaaccctattctccttcttcgccaaaagcactctgattgacaaatacgatttatctaatttacacgaaattgcttctggtggcgctcccctctctaaggaagtcggggaagcggttgccaagaggttccatctgccaggtatcaggcaaggatatgggctcactgagactacatcagctattctgattacacccgagggggatgataaaccgggcgcggtcggtaaagttgttccattttttgaagcgaaggttgtggatctggataccgggaaaacgctgggcgttaatcaaagaggcgaactgtgtgtgagaggtcctatgattatgtccggttatgtaaacaatccggaagcgaccaacgccttgattgacaaggatggatggctacattctggagacatagcttactgggacgaagacgaacacttcttcatcgttgaccgcctgaagtctctgattaagtacaaaggctatcaggtggctcccgctgaattggaatccatcttgctccaacaccccaacatcttcgacgcaggtgtcgcaggtcttcccgacgatgacgccggtgaacttcccgccgccgttgttgttttggagcacggaaagacgatgacggaaaaagagatcgtggattacgtcgccagtcaagtaacaaccgcgaaaaagttgcgcggaggagttgtgtttgtggacgaagtaccgaaaggtcttaccggaaaactcgacgcaagaaaaatcagagagatcctcataaaggccaagaagggcggaaagatcgccgtgtaatctagagtcgacccgggcggccgcttcgagcagacatgataagatacattgatgagtttggacaaaccacaactagaatgcagtgaaaaaaatgctttatttgtgaaatttgtgatgctattgctttatttgtaaccattataagctgcaataaacaagttaacaacaacaattgcattcattttatgtttcaggttcagggggagatgtgggaggttttttaaagcaagtaaaacctctacaaatgtggtaaaatcgataaggatccgggctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgcttacaatttcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatggctcgacagatctgtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgttgccttcgccccgtgccccgctccgcgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggcccttctcctccgggctgtaattagcgcttggtttaatgacggctcgtttcttttctgtggctgcgtgaaagccttaaagggctccgggagggccctttgtgcgggggggagcggctcggggggtgcgtgcgtgtgtgtgtgcgtggggagcgccgcgtgcggcccgcgctgcccggcggctgtgagcgctgcgggcgcggcgcggggctttgtgcgctccgcgtgtgcgcgaggggagcgcggccgggggcggtgccccgcggtgcgggggggctgcgaggggaacaaaggctgcgtgcggggtgtgtgcgtgggggggtgagcagggggtgtgggcgcggcggtcgggctgtaacccccccctgcacccccctccccgagttgctgagcacggcccggcttcgggtgcggggctccgtgcggggcgtggcgcggggctcgccgtgccgggcggggggtggcggcaggtgggggtgccgggcggggcggggccgcctcgggccggggagggctcgggggaggggcgcggcggccccggagcgccggcggctgtcgaggcgcggcgagccgcagccattgccttttatggtaatcgtgcgagagggcgcagggact tcctttgtcccaaatctggcggagccgaaatctgggaggcgccgccgcaccccctctagcgggcgcgggcgaagcggtgcggcgccggcaggaaggaaatgggcggggagggccttcgtgcgtcgccgcgccgccgtccccttctccatctccagcctcggggctgccgcagggggacggctgccttcgggggggacggggcagggcggggttcggcttctggcgtgtgaccggcggggtttatatcttcccttctctgttcctccgcagcccccaagcttggtaccatggaagacgccaaaaacataaagaaaggcccggcgccattctatccgctggaagatggaaccgctggagagcaactgcataaggctatgaagagatacgccctggttcctggaacaattgcttttacagatgcacatatcgaggtggacatcacttacgctgagtacttcgaaatgtccgttcggttggcagaagctatgaaacgatatgggctgaatacaaatcacagaatcgtcgtatgcagtgaaaactctcttcaattctttatgccggtgttgggcgcgttatttatcggagttgcagttgcgcccgcgaacgacatttataatgaacgtgaattgctcaacagtatgggcatttcgcagcctaccgtggtgttcgtttccaaaaaggggttgcaaaaaattttgaacgtgcaaaaaaagctcccaatcatccaaaaaattattatcatggattctaaaacggattaccagggatttcagtcgatgtacacgttcgtcacatctcatctacctcccggttttaatgaatacgattttgtgccagagtccttcgatagggacaagacaattgcactgatcatgaactcctctggatctactggtctgcctaaaggtgtcgctctgcctcatagaactgcctgcgtgagattctcgcatgccagagatcctatttttggcaatcaaatcattccggatactgcgatttt aagtgttgttccattccatcacggttttggaatgtttactacactcggatatttgatatgtggatttcgagtcgtcttaatgtatagatttgaagaagagctgtttctgaggagccttcaggattacaagattcaaagtgcgctgctggtgccaaccctattctccttcttcgccaaaagcactctgattgacaaatacgatttatctaatttacacgaaattgcttctggtggcgctcccctctctaaggaagtcggggaagcggttgccaagaggttccatctgccaggtatcaggcaaggatatgggctcactgagactacatcagctattctgattacacccgagggggatgataaaccgggcgcggtcggtaaagttgttccattttttgaagcgaaggttgtggatctggataccgggaaaacgctgggcgttaatcaaagaggcgaactgtgtgtgagaggtcctatgattatgtccggttatgtaaacaatccggaagcgaccaacgccttgattgacaaggatggatggctacattctggagacatagcttactgggacgaagacgaacacttcttcatcgttgaccgcctgaagtctctgattaagtacaaaggctatcaggtggctcccgctgaattggaatccatcttgctccaacaccccaacatcttcgacgcaggtgtcgcaggtcttcccgacgatgacgccggtgaacttcccgccgccgttgttgttttggagcacggaaagacgatgacggaaaaagagatcgtggattacgtcgccagtcaagtaacaaccgcgaaaaagttgcgcggaggagttgtgtttgtggacgaagtaccgaaaggtcttaccggaaaactcgacgcaagaaaaatcagagagatcctcataaaggccaagaagggcggaaagatcgccgtgtaatctagagtcgacccgggcggccgcttcgagcagacatgataagatacattgatgagtttg gacaaaccacaactagaatgcagtgaaaaaaatgctttatttgtgaaatttgtgatgctattgctttatttgtaaccattataagctgcaataaacaagttaacaacaacaattgcattcattttatgtttcaggttcagggggagatgtgggaggttttttaaagcaagtaaaacctctacaaatgtggtaaaatcgataaggatccgggctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgcttacaatttcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctat ttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgc tgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatggctcgacagatct

PAM-chol당 레스베라트롤의 중량비가 0.2, 0.4, 0.6, 0.8, 1.0이 되도록 각각 레스베라트롤을 적재시킨 후 pDNA당 PAM-chol/res 마이셀 양을 3, 5, 10, 15, 20의 중량비로 혼합한 후 30분간 안정화시켜 PAM-chol/res/pDNA 복합체를 형성하였다. 비교를 위해 레스베라트롤이 포함되지 않은 PAM-chol과 pDNA를 10:1의 중량비로 혼합하여 PAM-chol/pDNA 복합체를 형성하여 각 실험의 기준으로 사용하였다. FBS를 포함하지 않는 배지로 교환 후 transfection 하였으며 4시간 후 다시 10%의 FBS를 포함하는 배지로 교환하였다. 48시간 후 96-well plates luminometer(Berthold Detection System GmbH, Pforzheim, Germany)를 이용하여 루시퍼라아제(luciferase)의 발현을 측정하였고, BCA protein assay kit를 사용하여 단백질 농도를 측정하였다. 유전자 전달 효율은 세포 단백질의 총량 mg당 빛의 세기를 계산하여 나타내었다. PAM-chol당 레스베라트롤이 0.8의 중량비로 적재된 경우가 가장 높은 transfection 효율을 나타냈으며, 이때 pDNA당 PAM-chol/res의 비율은 PAM-chol/res:pDNA=15:1에서 최적비율을 보였다 (도 6).After loading resveratrol so that the weight ratio of resveratrol per PAM-chol is 0.2, 0.4, 0.6, 0.8, and 1.0, the amount of PAM-chol/res micelles per pDNA is mixed at a weight ratio of 3, 5, 10, 15, 20. Stabilized for 30 minutes to form a PAM-chol/res/pDNA complex. For comparison, PAM-chol without resveratrol and pDNA were mixed at a weight ratio of 10:1 to form a PAM-chol/pDNA complex, which was used as a standard for each experiment. The medium was replaced with a medium containing no FBS, followed by transfection, and after 4 hours, the medium was replaced with a medium containing 10% FBS. After 48 hours, the expression of luciferase was measured using a 96-well plates luminometer (Berthold Detection System GmbH, Pforzheim, Germany), and the protein concentration was measured using a BCA protein assay kit. Gene transfer efficiency was expressed by calculating the light intensity per mg of the total amount of cellular protein. The highest transfection efficiency was obtained when resveratrol per PAM-chol was loaded at a weight ratio of 0.8, and the ratio of PAM-chol/res per pDNA was PAM-chol/res:pDNA=15:1 ( Fig. 6).

2) 세포주에서 2) in the cell line PAMPAM -- cholchol // 커큐민Curcumin /유전자 복합체의 유전자 전달 효율 측정/Measurement of gene transfer efficiency of gene complex

PAM-chol당 커큐민의 중량비가 0.2, 0.3, 0.4, 0.5, 0.6이 되도록 각각 커큐민을 적재시킨 후 pDNA당 PAM-chol/cur 마이셀 양을 3, 5, 10, 15, 20의 중량비로 혼합한 후 30분간 안정화시켜 PAM-chol/cur/pDNA 복합체를 형성하였다. 비교를 위해 커큐민이 포함되지 않은 PAM-chol과 pDNA를 10:1의 중량비로 혼합하여 PAM-chol/pDNA 복합체를 형성하여 각 실험의 기준으로 사용하였다. FBS를 포함하지 않는 배지로 교환 후 transfection 하였으며 4시간 후 다시 10%의 FBS를 포함하는 배지로 교환하였다. 48시간 후 96-well plates luminometer(Berthold Detection System GmbH, Pforzheim, Germany)를 이용하여 루시퍼라아제(luciferase)의 발현을 측정하였고, BCA protein assay kit를 사용하여 단백질 농도를 측정하였다. 유전자 전달 효율은 세포 단백질의 총량 mg당 빛의 세기를 계산하여 나타내었다. PAM-chol당 커큐민이 0.5의 중량비로 적재된 경우가 가장 높은 transfection 효율을 나타냈으며, 이때 pDNA당 PAM-chol/cur 의 비율은 PAM-chol/cur:pDNA=15:1 에서 최적 비율을 보였다 (도 7).After loading curcumin so that the weight ratio of curcumin per PAM-chol is 0.2, 0.3, 0.4, 0.5, 0.6, the amount of PAM-chol/cur micelle per pDNA is mixed in a weight ratio of 3, 5, 10, 15, 20. Stabilized for 30 minutes to form a PAM-chol/cur/pDNA complex. For comparison, PAM-chol without curcumin and pDNA were mixed in a weight ratio of 10:1 to form a PAM-chol/pDNA complex, which was used as a standard for each experiment. The medium was replaced with a medium containing no FBS, followed by transfection, and after 4 hours, the medium was replaced with a medium containing 10% FBS. After 48 hours, the expression of luciferase was measured using a 96-well plates luminometer (Berthold Detection System GmbH, Pforzheim, Germany), and the protein concentration was measured using a BCA protein assay kit. Gene transfer efficiency was expressed by calculating the light intensity per mg of the total amount of cellular protein. The highest transfection efficiency was obtained when curcumin per PAM-chol was loaded at a weight ratio of 0.5, and the ratio of PAM-chol/cur per pDNA was PAM-chol/cur:pDNA=15:1 ( Fig. 7).

실시예Example 4: 유전자 복합체의 치료 효과 확인을 위한 동물 모델 제작 4: Creation of an animal model to confirm the therapeutic effect of the gene complex

1) One) PAMPAM -- cholchol // 레스베라트롤Resveratrol // HOHO -1 유전자 복합체의 치료 효과 확인을 위한 동물 모델 제작-1 Creation of an animal model to confirm the therapeutic effect of the gene complex

생체 내에서 항염증 효과를 확인하기 위해 마우스 급성 폐 손상 모델을 사용하였다. 무병원체 환경에서 6주간 기른 수컷 Balb/c 마우스를 사용하였다. 전달에 사용한 HO-1 유전자[H. Kim, H. A. Kim, Y. M. Bae, J. S. Choi, M. Lee, J. Gene Dexamethasone-conjugated polyethylenimine as an efficient gene carrier with an anti-apoptotic effect to cardiomyocytes, Med.2009, 11, 515. ; M. Lee, S. Oh, C. H. Ahn, S. W. Kim, B. D. Rhee, K. S. Ko, An efficient GLP-1 expression system using two-step transcription amplification, J. Control. Release 2006, 115, 316.]는 β-actin enhancer와 promoter를 포함하며 하위 서열에 HO-1 cDNA를 포함하는 플라스미드 DNA를 사용하였다. To confirm the anti-inflammatory effect in vivo, a mouse acute lung injury model was used. Male Balb/c mice raised for 6 weeks in a pathogen-free environment were used. HO-1 gene used for delivery [H. Kim, H. A. Kim, Y. M. Bae, J. S. Choi, M. Lee, J. Gene Dexamethasone-conjugated polyethylenimine as an efficient gene carrier with an anti-apoptotic effect to cardiomyocytes, Med. 2009, 11, 515.; M. Lee, S. Oh, C. H. Ahn, S. W. Kim, B. D. Rhee, K. S. Ko, An efficient GLP-1 expression system using two-step transcription amplification, J. Control. Release 2006, 115, 316.] used plasmid DNA containing β-actin enhancer and promoter, and containing HO-1 cDNA in the lower sequence.

상기 HO-1 cDNA를 포함하는 플라스미드 DNA 서열(서열번호 3)은 다음과 같다.The plasmid DNA sequence (SEQ ID NO: 3) containing the HO-1 cDNA is as follows.

[서열번호 3][SEQ ID NO: 3]

HO-1 부분은 소문자로 표시함. HO-1 part is shown in lower case.

GGTACCGAGCTCTTACGCGTGCTAGCCCGGGCTCGAGATCTGCGATCTGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATCGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAaagcttatggagcgtccgcaacccgacagcatgccccaggatttgtcagaggccctgaaggaggccaccaaggaggtgcacacccaggcagagaatgctgagttcatgaggaactttcagaagggccaggtgacccgagacggcttcaagctggtgatggcctccctgtaccacatctatgtggccctggaggaggagattgagcgcaacaaggagagcccagtcttcgcccctgtctacttcccagaagagctgcaccgcaaggctgccctggagcaggacctggccttctggtacgggccccgctggcaggaggtcatcccctacacaccagccatgcagcgctatgtgaagcggctccacgaggtggggcgcacagagcccgagctgctggtggcccacgcctacacccgctacctgggtgacctgtctgggggccaggtgctcaaaaagattgcccagaaagccctggacctgcccagctctggcgagggcctggccttcttcaccttccccaacattgccagtgccaccaagttcaagcagctctaccgctcccgcatgaactccctggagatgactcccgcagtcaggcagagggtgatagaagaggccaagactgcgttcctgctcaacatccagctctttgaggagttgcaggagctgctgacccatgacaccaaggaccagagcccctcacgggcaccagggcttcgccagcgggccagcaacaaagtgcaagattctgcccccgtggagactcccagagggaagcccccactcaacacccgctcccaggctccgcttctccgatgggtccttacactcagctttctggtggcgacagttgctgtagggctttatgccatgtgaatgctctagaGTCGGGGCGGCCGGCCGCTTCGAGCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTAAAATCGATAAGGATCCGTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCCGGCAGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCCCAAGCTACCATGATAAGTAAGTAATATTAAGGTACGGGAGGTACTTGGAGCGGCCGCAATAAAATATCTTTATTTTCATTACATCTGTGTGTTGGTTTTTTGTGTGAATCGATAGTACTAACATACGCTCTCCATCAAAACAAAACGAAACAAAACAAACTAGCAAAATAGGCTGTCCCCAGTGCAAGTGCAGGTGCCAGAACATTTCTCTATCGATAGGTACCGAGCTCTTACGCGTGCTAGCCCGGGCTCGAGATCTGCGATCTGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATCGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAaagcttatggagcgtccgcaacccgacagcatgccccaggatttgtcagaggccctgaaggaggccaccaaggaggtgcacacccaggcagagaatgctgagttcatgaggaactttcagaagggccaggtgacccgagacggcttcaagctggtgatggcctccctgtaccacatctatgtggccctggaggaggagattgagcgcaacaaggagagcccagtcttcgcccctgtctacttcccagaagagctgcaccgcaaggctgccctggagcaggacctggccttctggtacgggccccgctggcaggaggtcatcccctacacaccagccatgcagcgctatgtgaagcggctccacgaggtggggcgcacagagcccgagctgctggtggcccacgcctacacccgctacctgggtgacctgtctgggggccaggtgctcaaaaagattgcccagaaagccctggacctgcccagctctggcgagggcctggccttcttcaccttccccaacattgccagtgccaccaagttcaagcagctctaccgctcccgcatgaactccctggagatgactcccgcagtcaggcagagggtgatagaagaggccaagactgcgttcctgctcaacatccagctctttgaggagttgcaggagctgctgacccatgacaccaaggaccagagcccctcacgggcaccagggcttcgccagcgggccagcaacaaagtgcaagattctgcccccgtg gagactcccagagggaagcccccactcaacacccgctcccaggctccgcttctccgatgggtccttacactcagctttctggtggcgacagttgctgtagggctttatgccatgtgaatgctctagaGTCGGGGCGGCCGGCCGCTTCGAGCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTAAAATCGATAAGGATCCGTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCCGGCAGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAA CTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCT GTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCCCAAGCTACCATGATAAGTAA GTAATATTAAGGTACGGGAGGTACTTGGAGCGGCCGCAATAAAATATCTTTATTTTCATTACATCTGTGTGTTGGTTTTTTGTGTGAATCGATAGTACTAACATACGCTCTCCATCAAAACAAAACGAAACAAAACAAACTAGCAAAATAGGCTGTCCCCAGTGCAAGTGCAGGTGCCAGAACATTTCTCTATCGATA

먼저, 염증반응 유도를 위해 마취시킨 마우스 기도에 카텍터를 삽입하여 20μg의 LPS를 처리하였다. 2시간 후 PAM-chol/res 나노마이셀과 최적 비율의 PAM-chol/HO-1, PAM-chol/res/HO-1 유전자 복합체를 만들어 기도에 카텍터를 사용하여 주입하였다. 실험에 사용한 PAM-chol/res 마이셀과 PAM-chol/res/HO-1 유전자 복합체는 실시예 3의 1)에서 언급한 최적 비율을 사용하였으며 마우스 1g당 약 0.25μg의 투여량을 식염수에 녹여 주입하였다. 주입 24시간 후 마우스의 폐 세척액(BAL fluid)와 폐 조직을 취하여 사용하였다.First, 20 μg of LPS was treated by inserting a catheter into an anesthetized mouse airway to induce an inflammatory response. After 2 hours, PAM-chol/res nanomicelles and PAM-chol/HO-1 and PAM-chol/res/HO-1 gene complexes in optimal ratio were made and injected into the airway using a catheter. The PAM-chol/res micelle and PAM-chol/res/HO-1 gene complex used in the experiment used the optimum ratio mentioned in 1) of Example 3, and a dose of about 0.25 μg per 1 g of mouse was dissolved in saline and injected. I did. 24 hours after injection, the mouse lung lavage (BAL fluid) and lung tissue were taken and used.

폐 세척액은 EDTA를 처리한 후 고속원심분리하여 상층액만을 취하였다. 마우스 폐 조직은 파라핀 블록을 만들어 5μm 두께로 잘라서 조직슬라이드를 만들거나, 잘게 분쇄하여 용해시킨 후 고속원심분리하여 상층액을 취하여 사용하였다.The waste washing liquid was treated with EDTA and then centrifuged at high speed to take only the supernatant. The mouse lung tissue was cut into a 5 μm thick paraffin block to make a tissue slide, or finely crushed and dissolved, followed by high-speed centrifugation to take the supernatant.

2) 2) PAMPAM -- cholchol // 커큐민Curcumin // HOHO -1 유전자 복합체의 치료 효과 확인을 위한 동물 모델 제작-1 Creation of an animal model to confirm the therapeutic effect of the gene complex

생체 내에서 항염증 효과를 확인하기 위해 마우스 급성 폐 손상 모델을 사용하였다. 무병원체 환경에서 6주간 기른 수컷 Balb/c 마우스[㈜오리엔트바이오 에서 구입, 동물실험윤리위원회(IACUC)의 규정에 따라 사육, 실험함, 승인번호(2016-0176A)]를 사용하였다. 전달에 사용한 HO-1 유전자는 β-actin enhancer와 promoter를 포함하며 하위 서열에 HO-1 cDNA를 포함하는 플라스미드 DNA(서열번호 2)를 사용하였다.To confirm the anti-inflammatory effect in vivo, a mouse acute lung injury model was used. Male Balb/c mice raised for 6 weeks in a pathogen-free environment [purchased from Orient Bio, reared and tested according to the regulations of the Animal Experimental Ethics Committee (IACUC), approval number (2016-0176A)] were used. The HO-1 gene used for delivery was a plasmid DNA (SEQ ID NO: 2) containing a β-actin enhancer and a promoter, and containing HO-1 cDNA in a lower sequence.

먼저, 염증반응 유도를 위해 마취시킨 마우스 기도에 카텍터를 삽입하여 20μg의 LPS를 처리하였다. 2시간 후 PAM-chol/cur 나노마이셀과 최적 비율의 PAM-chol/HO-1, PAM-chol/cur/HO-1 유전자 복합체를 만들어 기도에 카텍터를 사용하여 주입하였다. 실험에 사용한 PAM-chol/cur 마이셀과 PAM-chol/cur/HO-1 유전자 복합체는 실시예 3의 2)에서 언급한 최적 비율을 사용하였으며 마우스 1g당 약 0.25μg의 투여량을 식염수에 녹여 주입하였다. 주입 24시간 후 마우스의 폐 세척액(BAL fluid)와 폐 조직을 취하여 사용하였다.First, 20 μg of LPS was treated by inserting a catheter into an anesthetized mouse airway to induce an inflammatory response. After 2 hours, PAM-chol/cur nanomicelles and PAM-chol/HO-1 and PAM-chol/cur/HO-1 gene complexes in the optimal ratio were made and injected into the airways using a catheter. The PAM-chol/cur micelle and PAM-chol/cur/HO-1 gene complex used in the experiment used the optimal ratio mentioned in 2) of Example 3, and a dose of about 0.25 μg per 1 g of mouse was dissolved in saline and injected. I did. 24 hours after injection, the mouse lung lavage (BAL fluid) and lung tissue were taken and used.

폐 세척액은 EDTA를 처리한 후 고속원심분리하여 상층액만을 취하였다. 마우스 폐 조직은 파라핀 블록을 만들어 5μm 두께로 잘라서 조직슬라이드를 만들거나, 잘게 분쇄하여 용해시킨 후 고속원심분리하여 상층액을 취하여 사용하였다.The waste washing liquid was treated with EDTA and then centrifuged at high speed to take only the supernatant. The mouse lung tissue was cut into a 5 μm thick paraffin block to make a tissue slide, or finely crushed and dissolved, followed by high-speed centrifugation to take the supernatant.

3) 동물 모델에서 3) in animal models PAMPAM -- cholchol // 레스베라트롤Resveratrol // HOHO -1 유전자 복합체의 -1 of the gene complex HOHO -1 유전자 전달 효과 확인-1 Confirmation of gene transfer effect

동물 모델에서 HO-1 유전자 발현을 확인하기 위해 마우스 폐 조직슬라이드를 면역조직화학(Immunohistochemistry)을 통해서 염색하였다. 면역조직화학 키트(Bethyl Laboratories, Montgomery, TX)와 토끼 항HO-1 항체를 사용하여 염색한 후 광학현미경을 통해 관찰하였다. In order to confirm the expression of the HO-1 gene in the animal model, the mouse lung tissue slide was stained through Immunohistochemistry. After staining using an immunohistochemistry kit (Bethyl Laboratories, Montgomery, TX) and a rabbit anti-HO-1 antibody, it was observed through an optical microscope.

Control 그룹에 비해 LPS 그룹과 레스베라트롤만 전달시킨 그룹에서도 HO-1 발현이 조금 증가한 형태를 보였다. 그러나 다른 그룹에 비해 HO-1 유전자를 포함시킨 PAM-chol/HO-1 그룹과 PAM-chol/res/HO-1 그룹에서는 HO-1 발현이 월등히 증가한 것을 확인할 수 있었다 (도 8).Compared to the control group, the LPS group and the group that delivered only resveratrol showed a slight increase in HO-1 expression. However, compared to other groups, it was confirmed that HO-1 expression was significantly increased in the PAM-chol/HO-1 group and the PAM-chol/res/HO-1 group containing the HO-1 gene (FIG. 8).

4) 동물 모델에서 4) in animal models PAMPAM -- cholchol // 커큐민Curcumin // HOHO -1 유전자 복합체의 -1 of the gene complex HOHO -1 유전자 전달 효과 확인-1 Confirmation of gene transfer effect

동물 모델에서 HO-1 유전자 발현을 확인하기 위해 마우스 폐 조직슬라이드를 면역조직화학(Immunohistochemistry)을 통해서 염색하였다. 면역조직화학 키트(Bethyl Laboratories, Montgomery, TX)와 토끼 항HO-1 항체를 사용하여 염색한 후 광학현미경을 통해 관찰하였다. In order to confirm the expression of the HO-1 gene in the animal model, the mouse lung tissue slide was stained through Immunohistochemistry. After staining using an immunohistochemistry kit (Bethyl Laboratories, Montgomery, TX) and a rabbit anti-HO-1 antibody, it was observed through an optical microscope.

Control 그룹에 비해 LPS그룹도 HO-1 발현이 조금 증가한 형태를 보였다. 그러나 커큐민만을 전달시킨 그룹에서는 HO-1이 거의 검출되지 않았으며, PAM-chol/HO-1 그룹과 PAM-chol/cur/HO-1 그룹에서만 HO-1 발현이 월등히 증가한 것을 확인할 수 있었다 (도 9).Compared to the control group, the LPS group also showed a slight increase in HO-1 expression. However, in the group to which only curcumin was delivered, HO-1 was hardly detected, and it was confirmed that HO-1 expression was significantly increased only in the PAM-chol/HO-1 group and the PAM-chol/cur/HO-1 group (Fig. 9).

실시예 5: 동물 모델에서 NF-kB 활성 억제 효과 확인Example 5: Confirmation of the effect of inhibiting NF-kB activity in an animal model

1) 동물 모델에서 레스베라트롤의 NF-kB 활성 억제 효과 확인1) Confirmation of the inhibitory effect of resveratrol on NF-kB activity in an animal model

마우스 폐 조직슬라이드는 상기 실시예 4의 1)에서 기술한 방법으로 제작하였다. 레스베라트롤이 세포로 전달되어 NF-kB의 활성을 억제하는 효과를 확인하기 위해 형광면역분석법(immuno fluorescence technic)을 사용하여 관찰하였다. 조직슬라이드의 파라핀을 제거한 후 재수화(rehydration)하였다. Tween을 포함한 tris-buffered saline을 이용하여 항원을 복구한 후 rabbit anti p65 항체[Bethyl Laboratories, Montgomery, TX Cat# A303-662A]를 처리해 세포 내의 NF-kB[NFkB의 일부분이 p65이기 때문에 anti p65항체를 이용해 세포내의 NFkB를 확인함]와 결합시켰다. 한 시간 후에 Alexa 488형광을 가진 이차항체[Molecular Probes, Eugene, Oregon Cat# A21311]를 이용하여 염색하였고, 세포핵을 DAPI 형광을 이용하여 염색한 후 공초점현미경을 통하여 관찰하였다. NF-kB는 활성화 되면 세포질에서 세포핵으로 이동하는 특징을 가진다. Control 그룹은 세포핵 주변에만 NF-kb가 관찰되는 반면 LPS를 처리한 그룹은 NF-kB가 세포핵 내부로 들어간 것을 확인할 수 있었다. 레스베라트롤을 포함시키지 않고 HO-1만 전달시킨 PAM-chol/HO-1 그룹 또한 세포핵 내부에 NF-kB가 관찰되었으나, 레스베라트롤을 포함시킨 PAM-chol/res, PAM-chol/res/HO-1 그룹에서는 세포핵 내부에 NF-kB가 많이 줄어든 것을 확인할 수 있었다 (도 10).The mouse lung tissue slide was prepared by the method described in 1) of Example 4 above. In order to confirm the effect of resveratrol being delivered to cells and inhibiting the activity of NF-kB, it was observed using an immunofluorescence technique. After removing the paraffin from the tissue slide, it was rehydrated. After recovering the antigen using tris-buffered saline including Tween, it was treated with rabbit anti p65 antibody [Bethyl Laboratories, Montgomery, TX Cat# A303-662A] to treat NF-kB [NFkB in the cell as part of p65]. Was used to confirm the intracellular NFkB]. After an hour, the cells were stained with a secondary antibody having Alexa 488 fluorescence [Molecular Probes, Eugene, Oregon Cat# A21311], and the cell nuclei were stained using DAPI fluorescence and observed through a confocal microscope. When NF-kB is activated, it moves from the cytoplasm to the cell nucleus. In the control group, NF-kb was observed only around the cell nucleus, whereas the LPS-treated group showed that NF-kB entered the cell nucleus. The PAM-chol/HO-1 group, which delivered only HO-1 without resveratrol, also showed NF-kB inside the cell nucleus, but the PAM-chol/res, PAM-chol/res/HO-1 group containing resveratrol In the inside of the cell nucleus, it was confirmed that NF-kB was significantly reduced (FIG. 10).

실시예Example 6: 세포주에서 6: in the cell line NFNF -- kBkB 활성 억제 효과 확인 Check the inhibitory effect

1) 세포주에서 1) in the cell line 커큐민의Curcumin NFNF -- kBkB 활성 억제 효과 확인 Check the inhibitory effect

커큐민이 세포로 전달되어 NF-kB의 활성을 억제하는 효과를 확인하기 위해 형광면역분석법(immuno fluorescence technic)을 사용하여 관찰하였다. In order to confirm the effect of curcumin being delivered to cells and inhibiting the activity of NF-kB, it was observed using an immunofluorescence technique.

랫트 폐 상피 세포주 (Rat lung epithelial cell; L2 cell)을 실시예 3의 1)에서와 같은 방법으로 배양하여 transfection 24시간 전에 LPS 100ng을 처리하여 NF-kB의 활성화를 유도하였다. 실시예 3의 2)에서 언급한 최적 비율을 사용하여 PAM-chol/cur 와 PAM-chol/cur/pDNA 복합체를 형성하였다. FBS를 포함하지 않는 배지로 교환 후 transfection 하였으며 4시간 후 다시 10%의 FBS를 포함하는 배지로 교환하였다.A rat lung epithelial cell (L2 cell) was cultured in the same manner as in Example 3 1), and then 100 ng of LPS was treated 24 hours before transfection to induce the activation of NF-kB. PAM-chol/cur and PAM-chol/cur/pDNA complex were formed using the optimum ratio mentioned in 2) of Example 3. The medium was replaced with a medium containing no FBS, followed by transfection, and after 4 hours, the medium was replaced with a medium containing 10% FBS.

24시간 후 NF-kB 검출을 위해 4% PFA(paraformaldehyde)를 이용하여 세포를 고정시켰다. rabbit anti p65 항체[Bethyl Laboratories, Montgomery, TX Cat# A303-662A]를 처리해 세포 내의 NF-kB[NFkB의 일부분이 p65이기 때문에 anti p65항체를 이용해 세포내의 NFkB를 확인함]와 결합시켰다. 한 시간 후에 Alexa 488형광을 가진 이차항체[Molecular Probes, Eugene, Oregon Cat# A21311]를 이용하여 염색하였고, 세포핵을 DAPI 형광을 이용하여 염색한 후 공초점현미경을 통하여 관찰하였다. NF-kB는 활성화되면 세포질에서 세포핵으로 이동하는 특징을 가진다. Control 그룹은 세포핵 주변에만 NF-kb가 관찰되는 반면 LPS를 처리한 그룹은 NF-kB가 세포핵 내부로 들어간 것을 확인할 수 있었다. 커큐민을 포함시키지 않고 HO-1만 전달시킨 PAM-chol/HO-1 그룹 또한 세포핵 내부에 NF-kB가 관찰되었으나, 커큐민을 포함시킨 PAM-chol/cur, PAM-chol/cur/HO-1 그룹에서는 세포핵 내부에 NF-kB가 많이 줄어든 것을 확인할 수 있었다(도 11).After 24 hours, cells were fixed using 4% paraformaldehyde (PFA) for NF-kB detection. Rabbit anti p65 antibody [Bethyl Laboratories, Montgomery, TX Cat# A303-662A] was treated to bind with intracellular NF-kB [because a part of NFkB is p65, the intracellular NFkB was identified using an anti p65 antibody]. After an hour, the cells were stained with a secondary antibody having Alexa 488 fluorescence [Molecular Probes, Eugene, Oregon Cat# A21311], and the cell nuclei were stained using DAPI fluorescence and observed through a confocal microscope. When NF-kB is activated, it moves from the cytoplasm to the cell nucleus. In the control group, NF-kb was observed only around the cell nucleus, whereas in the LPS-treated group, it was confirmed that NF-kB entered the cell nucleus. The PAM-chol/HO-1 group, which delivered only HO-1 without containing curcumin, also showed NF-kB inside the cell nucleus, but the PAM-chol/cur, PAM-chol/cur/HO-1 group containing curcumin In the inside of the cell nucleus, it was confirmed that NF-kB was significantly reduced (FIG. 11).

실시예Example 7: 급성 7: acute 폐손상Lung damage 치료 효과 확인 Checking the effect of treatment

1) 동물 모델에서 1) in animal models PAMPAM -- cholchol // 레스베라트롤Resveratrol // HOHO -- 1유전자1 gene 복합체의 항염증 효과 확인 Confirming the anti-inflammatory effect of the complex

마우스 폐 세척액과 폐 조직 용해액은 상기 실시예 4의 1)에서 기술한 방법으로 사용하였다. 폐 세척액과 폐 조직에서 각각 세 종류의 염증 전 사이토카인(TNF-α, IL-1β, IL-6)을 효소면역분석법(ELISA)를 이용하여 측정하였다. 측정에는 ELISA kit(eBioscience, San Diego, USA)를 사용하였다. BCS assay를 통해 각 폐 세척액과 폐 조직액 샘플의 단백질 총량을 측정하여 총 단백질 양 당 사이토카인의 양(pg/mg)로 그래프화하였다. TNF-α의 경우는 HO-1의 효과가 크게 작용하는 것으로 나타났으며 IL-6의 경우 레스베라트롤의 효과가 크게 작용하는 것으로 보여졌다. IL-1β의 경우는 HO-1과 레스베라트롤이 비슷하나 HO-1의 작용이 조금 더 크게 작용하는 것으로 보였다. 그러나 모든 경우에서 HO-1과 레스베라트롤을 복합 전달하는 경우가 둘 중 하나만 전달하는 것 보다 염증성 사이토카인이 떨어지는 것을 확인할 수 있었다 (도 12).The mouse lung washing solution and lung tissue lysate were used in the method described in 1) of Example 4 above. Three types of pre-inflammatory cytokines (TNF-α, IL-1β, and IL-6) were measured in lung lavage fluid and lung tissue, respectively, using an enzyme immunoassay (ELISA). ELISA kit (eBioscience, San Diego, USA) was used for measurement. Through the BCS assay, the total amount of protein in each lung lavage fluid and lung tissue fluid sample was measured and graphed as the amount of cytokines per total protein amount (pg/mg). In the case of TNF-α, the effect of HO-1 was found to have a large effect, and in the case of IL-6, the effect of resveratrol was shown to be largely acting. In the case of IL-1β, HO-1 and resveratrol were similar, but the action of HO-1 appeared to be a little larger. However, in all cases, it was confirmed that the case of delivering HO-1 and resveratrol in combination was less inflammatory cytokines than delivering only one of the two (FIG. 12).

항염증 효과를 시각화하여 관찰하기 위해 상기 실시예 4의 1)의 방법으로 제작한 조직슬라이드를 H&E 염색을 통해 관찰하였다. LPS를 처리한 그룹은 control 그룹에 비해 출혈, 부종 등이 심각한 상태를 보였으며 면역세포의 침투와 세포의 섬유화도 관찰되었다. 그에 비해 HO-1 또는 레스베라트롤을 전달시킨 그룹은 부종의 크기와 출혈이 확연히 줄어든 것을 확인하였다. 한편 HO-1과 레스베라트롤을 복합 전달한 그룹의 경우 혈액이 아직 남아있는 부위임에도 불구하고 부종이 매우 줄어들었으며 면역세포와 섬유화도 관찰되지 않았다. 이를 통해 PAM-chol을 이용하여 HO-1과 레스베라트롤을 세포에 전달시킴으로써 급성 폐손상을 완화시킬 수 있으며 복합 전달시키는 경우 둘 중 하나만 전달시키는 것 보다 뛰어난 치료 효과가 있음을 확인할 수 있었다 (도 13, PAM-chol/res 보다 PAM-chol/res/HO-1의 경우 부종의 크기와 폐포 손상, 출혈 면에서 더 나아진 양상을 보임).In order to visualize and observe the anti-inflammatory effect, the tissue slide prepared by the method 1) of Example 4 was observed through H&E staining. The group treated with LPS showed severe bleeding and swelling compared to the control group, and the infiltration of immune cells and fibrosis of cells were also observed. On the other hand, it was confirmed that the size of edema and bleeding were significantly reduced in the group that delivered HO-1 or resveratrol. On the other hand, in the case of the combined delivery of HO-1 and resveratrol, swelling was greatly reduced even though the blood was still remaining, and immune cells and fibrosis were not observed. Through this, it was possible to alleviate acute lung injury by delivering HO-1 and resveratrol to cells using PAM-chol, and it was confirmed that the combined delivery has an excellent therapeutic effect than delivery of only one of the two (Fig. 13, PAM-chol/res/HO-1 showed better swelling size, alveolar damage, and bleeding than PAM-chol/res).

2) 동물 모델에서 2) in animal models PAMPAM -- cholchol // 커큐민Curcumin // HOHO -- 1유전자1 gene 복합체의 항염증 효과 확인 Confirming the anti-inflammatory effect of the complex

상기 실시예 4의 1)에서 기술한 방법으로 얻은 폐 세척액과 폐 조직에서 세 종류의 염증 전 사이토카인(TNF-α, IL-1β, IL-6)을 효소면역분석법(ELISA)를 이용하여 측정하였다. 측정에는 ELISA kit(eBioscience, San Diego, USA)를 사용하였다. BCS assay를 통해 각 폐 세척액과 폐 조직액 샘플의 단백질 총량을 측정하여 총 단백질 양 당 사이토카인의 양(pg/mg)로 그래프화하였다. IL-1β의 경우는 커큐민 또는 HO-1 둘 중 하나만 전달한 경우도 사이토카인 농도가 음성대조군 수준으로 감소함을 확인하였다. TNF-α의 경우는 HO-1의 효과가 크게 작용하는 것으로 보이나 복합 전달하는 경우가 둘 중 하나만 전달하는 것 보다 효과가 높은 것을 확인하였다. IL-6의 경우 커큐민의 전달이 HO-1 유전자 전달보다 조금 효과가 높은 것을 확인할 수 있었다 (도 14).Measurement of three types of pre-inflammatory cytokines (TNF-α, IL-1β, IL-6) in lung lavage fluid and lung tissue obtained by the method described in Example 4-1) using an enzyme immunoassay (ELISA) I did. ELISA kit (eBioscience, San Diego, USA) was used for measurement. Through the BCS assay, the total amount of protein in each lung lavage fluid and lung tissue fluid sample was measured and graphed as the amount of cytokines per total protein amount (pg/mg). In the case of IL-1β, it was confirmed that even when only one of curcumin or HO-1 was delivered, the cytokine concentration decreased to the level of the negative control group. In the case of TNF-α, it was found that the effect of HO-1 was large, but it was confirmed that the complex delivery was more effective than the delivery of only one of the two. In the case of IL-6, it was confirmed that the delivery of curcumin was slightly higher than that of the HO-1 gene (FIG. 14).

항염증 효과를 시각화하여 관찰하기 위해 상기 실시예 4의 1)의 방법으로 제작한 조직슬라이드를 H&E 염색을 통해 관찰하였다. LPS를 처리한 그룹은 control 그룹에 비해 출혈, 부종 등이 심각한 상태를 보였으며 면역세포의 침투와 세포의 섬유화도 관찰되었다. 그에 비해 HO-1 또는 커큐민을 전달시킨 그룹은 부종의 크기와 출혈이 확연히 줄어든 것을 확인하였다. 한편 HO-1과 커큐민을 복합 전달한 그룹의 경우 혈액이 아직 남아있는 부위임에도 불구하고 부종이 매우 줄어들었으며 면역세포와 섬유화도 관찰되지 않았다. 이를 통해 PAM-chol을 이용하여 HO-1과 커큐민을 세포에 전달시킴으로써 급성 폐손상을 완화시킬 수 있으며 복합 전달시키는 경우 둘 중 하나만 전달시키는 것 보다 뛰어난 치료 효과가 있음을 확인할 수 있었다(도 15, PAM-chol/cur/HO-1의 경우 부종의 크기와 폐포 손상, 출혈 면에서 더 나아진 양상을 보임).In order to visualize and observe the anti-inflammatory effect, the tissue slide prepared by the method 1) of Example 4 was observed through H&E staining. The group treated with LPS showed severe bleeding and swelling compared to the control group, and the infiltration of immune cells and fibrosis of cells were also observed. On the other hand, it was confirmed that the size of edema and bleeding were significantly reduced in the group that delivered HO-1 or curcumin. On the other hand, in the case of the combined delivery of HO-1 and curcumin, the swelling was greatly reduced even though the blood remained in the area, and immune cells and fibrosis were not observed. Through this, it was possible to alleviate acute lung injury by delivering HO-1 and curcumin to cells using PAM-chol, and it was confirmed that the combined delivery has an excellent therapeutic effect than delivery of only one of the two (Fig. 15, In the case of PAM-chol/cur/HO-1, the size of edema, alveolar damage, and bleeding were better.)

실험예Experimental example 1: 기존 경구투여 약물 흡수율과 본원 비강 투여용 복합체의 항염증 효과 비교 1: Comparison of the absorption rate of conventional oral drugs and the anti-inflammatory effect of the complex for nasal administration

레스베라트롤만을 경구 투여한 경우와 복합체를 사용하여 비강투여한 경우의 항염증 효과를 비교를 위해 마우스 급성 폐 손상 모델을 사용하였다. 무병원체 환경에서 6주간 기른 수컷 Balb/c 마우스를 사용하였다. 최적 비율인 PAM-chol:res=1:0.8 (중량)로 레스베라트롤을 적재한 PAM-chol/res 마이셀을 마우스 마리당 75μg 준비하고 적재에 사용한 양과 같도록 33.3μg의 레스베라트롤을 식염수에 넣어 준비하였다.A mouse acute lung injury model was used to compare the anti-inflammatory effect when resveratrol was administered orally and when administered intranasally using a complex. Male Balb/c mice raised for 6 weeks in a pathogen-free environment were used. PAM-chol/res micelles loaded with resveratrol at an optimal ratio of PAM-chol:res=1:0.8 (weight) were prepared by 75 μg per mouse, and 33.3 μg of resveratrol was added to saline so that the amount used for loading was the same.

염증반응 유도를 위해 마취시킨 마우스 기도에 카텍터를 삽입하여 20μg의 LPS를 처리하였다. 2시간 후 한 그룹은 PAM-chol/res 마이셀을 기도를 통해 주입하고 다른 그룹은 레스베라트롤을 넣은 식염수를 구강으로 주입하였다. 주입 24시간 후 마우스의 폐 세척액(BAL fluid)을 취하였다. 폐 세척액은 EDTA를 처리한 후 고속원심분리하여 상층액만을 사용하여 염증 전 사이토카인(TNF-α, IL-1β, IL-6)을 측정하였다. 측정에는 ELISA kit(eBioscience, San Diego, USA)를 사용하였다. BCS assay를 통해 각 샘플의 단백질 총량을 측정하여 총 단백질 양 당 사이토카인의 양(pg/mg)로 그래프화하였다.In order to induce the inflammatory response, a catheter was inserted into the anesthetized mouse airway and treated with 20 μg of LPS. Two hours later, one group was injected with PAM-chol/res micelles through the airway, and the other group was orally injected with saline containing resveratrol. Lung lavage (BAL fluid) from mice was taken 24 hours after injection. The lung lavage solution was treated with EDTA and then subjected to high-speed centrifugation, and pre-inflammatory cytokines (TNF-α, IL-1β, IL-6) were measured using only the supernatant. ELISA kit (eBioscience, San Diego, USA) was used for measurement. The total amount of protein in each sample was measured through the BCS assay and graphed as the amount of cytokine per total protein amount (pg/mg).

IL-1β의 경우 경구 투여는 전혀 효과가 없는 것을 확인하였다. TNF-α와 IL-6 경우는 경구 투여 또한 사이토카인 농도를 어느 정도 낮추는 경향성을 보였으나 복합체를 이용한 비강 투여가 훨씬 효과적임을 확인하였다 (도 16).In the case of IL-1β, it was confirmed that oral administration had no effect. In the case of TNF-α and IL-6, oral administration also showed a tendency to lower the cytokine concentration to some extent, but it was confirmed that nasal administration using the complex was much more effective (FIG. 16).

<110> Industry-University Cooperation Foundation Hanyang University <120> Composition for preventing or treating inflammatory lung disease for nasal administration using complex for drug/gene delivery <130> P18U10C1157 <150> KR 10-2017-0146712 <151> 2017-11-06 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 600 <212> DNA <213> Artificial Sequence <220> <223> plasmid DNA <400> 1 tcaatattgg ccattagcca tattattcat tggttatata gcataaatca atattggcta 60 ttggccattg catacgttgt atctatatca taatatgtac atttatattg gctcatgtcc 120 aatatgaccg ccatgttggc attgattatt gactagttat taatagtaat caattacggg 180 gtcattagtt catagcccat atatggagtt ccgcgttaca taacttacgg taaatggccc 240 gcctggctga ccgcccaacg acccccgccc attgacgtca ataatgacgt atgttcccat 300 agtaacgcca atagggactt tccattgacg tcaatgggtg gagtatttac ggtaaactgc 360 ccacttggca gtacatcaag tgtatcatat gccaagtccg ccccctattg acgtcaatga 420 cggtaaatgg cccgcctggc attatgccca gtacatgacc ttacgggact ttcctacttg 480 gcagtacatc tacgtattag tcatcgctat taccatggtg atgcggtttt ggcagtacac 540 caatgggcgt ggatagcggt ttgactcacg gggatttcca agtctccacc ccattgacgt 600 600 <210> 2 <211> 5866 <212> DNA <213> Artificial Sequence <220> <223> pluc gene <400> 2 gtcgaggtga gccccacgtt ctgcttcact ctccccatct cccccccctc cccaccccca 60 attttgtatt tatttatttt ttaattattt tgtgcagcga tgggggcggg gggggggggg 120 gcgcgcgcca ggcggggcgg ggcggggcga ggggcggggc ggggcgaggc ggagaggtgc 180 ggcggcagcc aatcagagcg gcgcgctccg aaagtttcct tttatggcga ggcggcggcg 240 gcggcggccc tataaaaagc gaagcgcgcg gcgggcggga gtcgctgcgt tgccttcgcc 300 ccgtgccccg ctccgcgccg cctcgcgccg cccgccccgg ctctgactga ccgcgttact 360 cccacaggtg agcgggcggg acggcccttc tcctccgggc tgtaattagc gcttggttta 420 atgacggctc gtttcttttc tgtggctgcg tgaaagcctt aaagggctcc gggagggccc 480 tttgtgcggg ggggagcggc tcggggggtg cgtgcgtgtg tgtgtgcgtg gggagcgccg 540 cgtgcggccc gcgctgcccg gcggctgtga gcgctgcggg cgcggcgcgg ggctttgtgc 600 gctccgcgtg tgcgcgaggg gagcgcggcc gggggcggtg ccccgcggtg cgggggggct 660 gcgaggggaa caaaggctgc gtgcggggtg tgtgcgtggg ggggtgagca gggggtgtgg 720 gcgcggcggt cgggctgtaa cccccccctg cacccccctc cccgagttgc tgagcacggc 780 ccggcttcgg gtgcggggct ccgtgcgggg cgtggcgcgg ggctcgccgt gccgggcggg 840 gggtggcggc aggtgggggt gccgggcggg gcggggccgc ctcgggccgg ggagggctcg 900 ggggaggggc gcggcggccc cggagcgccg gcggctgtcg aggcgcggcg agccgcagcc 960 attgcctttt atggtaatcg tgcgagaggg cgcagggact tcctttgtcc caaatctggc 1020 ggagccgaaa tctgggaggc gccgccgcac cccctctagc gggcgcgggc gaagcggtgc 1080 ggcgccggca ggaaggaaat gggcggggag ggccttcgtg cgtcgccgcg ccgccgtccc 1140 cttctccatc tccagcctcg gggctgccgc agggggacgg ctgccttcgg gggggacggg 1200 gcagggcggg gttcggcttc tggcgtgtga ccggcggggt ttatatcttc ccttctctgt 1260 tcctccgcag cccccaagct tggtaccatg gaagacgcca aaaacataaa gaaaggcccg 1320 gcgccattct atccgctgga agatggaacc gctggagagc aactgcataa ggctatgaag 1380 agatacgccc tggttcctgg aacaattgct tttacagatg cacatatcga ggtggacatc 1440 acttacgctg agtacttcga aatgtccgtt cggttggcag aagctatgaa acgatatggg 1500 ctgaatacaa atcacagaat cgtcgtatgc agtgaaaact ctcttcaatt ctttatgccg 1560 gtgttgggcg cgttatttat cggagttgca gttgcgcccg cgaacgacat ttataatgaa 1620 cgtgaattgc tcaacagtat gggcatttcg cagcctaccg tggtgttcgt ttccaaaaag 1680 gggttgcaaa aaattttgaa cgtgcaaaaa aagctcccaa tcatccaaaa aattattatc 1740 atggattcta aaacggatta ccagggattt cagtcgatgt acacgttcgt cacatctcat 1800 ctacctcccg gttttaatga atacgatttt gtgccagagt ccttcgatag ggacaagaca 1860 attgcactga tcatgaactc ctctggatct actggtctgc ctaaaggtgt cgctctgcct 1920 catagaactg cctgcgtgag attctcgcat gccagagatc ctatttttgg caatcaaatc 1980 attccggata ctgcgatttt aagtgttgtt ccattccatc acggttttgg aatgtttact 2040 acactcggat atttgatatg tggatttcga gtcgtcttaa tgtatagatt tgaagaagag 2100 ctgtttctga ggagccttca ggattacaag attcaaagtg cgctgctggt gccaacccta 2160 ttctccttct tcgccaaaag cactctgatt gacaaatacg atttatctaa tttacacgaa 2220 attgcttctg gtggcgctcc cctctctaag gaagtcgggg aagcggttgc caagaggttc 2280 catctgccag gtatcaggca aggatatggg ctcactgaga ctacatcagc tattctgatt 2340 acacccgagg gggatgataa accgggcgcg gtcggtaaag ttgttccatt ttttgaagcg 2400 aaggttgtgg atctggatac cgggaaaacg ctgggcgtta atcaaagagg cgaactgtgt 2460 gtgagaggtc ctatgattat gtccggttat gtaaacaatc cggaagcgac caacgccttg 2520 attgacaagg atggatggct acattctgga gacatagctt actgggacga agacgaacac 2580 ttcttcatcg ttgaccgcct gaagtctctg attaagtaca aaggctatca ggtggctccc 2640 gctgaattgg aatccatctt gctccaacac cccaacatct tcgacgcagg tgtcgcaggt 2700 cttcccgacg atgacgccgg tgaacttccc gccgccgttg ttgttttgga gcacggaaag 2760 acgatgacgg aaaaagagat cgtggattac gtcgccagtc aagtaacaac cgcgaaaaag 2820 ttgcgcggag gagttgtgtt tgtggacgaa gtaccgaaag gtcttaccgg aaaactcgac 2880 gcaagaaaaa tcagagagat cctcataaag gccaagaagg gcggaaagat cgccgtgtaa 2940 tctagagtcg acccgggcgg ccgcttcgag cagacatgat aagatacatt gatgagtttg 3000 gacaaaccac aactagaatg cagtgaaaaa aatgctttat ttgtgaaatt tgtgatgcta 3060 ttgctttatt tgtaaccatt ataagctgca ataaacaagt taacaacaac aattgcattc 3120 attttatgtt tcaggttcag ggggagatgt gggaggtttt ttaaagcaag taaaacctct 3180 acaaatgtgg taaaatcgat aaggatccgg gctggcgtaa tagcgaagag gcccgcaccg 3240 atcgcccttc ccaacagttg cgcagcctga atggcgaatg gacgcgccct gtagcggcgc 3300 attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc gctacacttg ccagcgccct 3360 agcgcccgct cctttcgctt tcttcccttc ctttctcgcc acgttcgccg gctttccccg 3420 tcaagctcta aatcgggggc tccctttagg gttccgattt agtgctttac ggcacctcga 3480 ccccaaaaaa cttgattagg gtgatggttc acgtagtggg ccatcgccct gatagacggt 3540 ttttcgccct ttgacgttgg agtccacgtt ctttaatagt ggactcttgt tccaaactgg 3600 aacaacactc aaccctatct cggtctattc ttttgattta taagggattt tgccgatttc 3660 ggcctattgg ttaaaaaatg agctgattta acaaaaattt aacgcgaatt ttaacaaaat 3720 attaacgctt acaatttcct gatgcggtat tttctcctta cgcatctgtg cggtatttca 3780 caccgcatat ggtgcactct cagtacaatc tgctctgatg ccgcatagtt aagccagccc 3840 cgacacccgc caacacccgc tgacgcgccc tgacgggctt gtctgctccc ggcatccgct 3900 tacagacaag ctgtgaccgt ctccgggagc tgcatgtgtc agaggttttc accgtcatca 3960 ccgaaacgcg cgagacgaaa gggcctcgtg atacgcctat ttttataggt taatgtcatg 4020 ataataatgg tttcttagac gtcaggtggc acttttcggg gaaatgtgcg cggaacccct 4080 atttgtttat ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga 4140 taaatgcttc aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc 4200 cttattccct tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg 4260 aaagtaaaag atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc 4320 aacagcggta agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact 4380 tttaaagttc tgctatgtgg cgcggtatta tcccgtattg acgccgggca agagcaactc 4440 ggtcgccgca tacactattc tcagaatgac ttggttgagt actcaccagt cacagaaaag 4500 catcttacgg atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat 4560 aacactgcgg ccaacttact tctgacaacg atcggaggac cgaaggagct aaccgctttt 4620 ttgcacaaca tgggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa 4680 gccataccaa acgacgagcg tgacaccacg atgcctgtag caatggcaac aacgttgcgc 4740 aaactattaa ctggcgaact acttactcta gcttcccggc aacaattaat agactggatg 4800 gaggcggata aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttatt 4860 gctgataaat ctggagccgg tgagcgtggg tctcgcggta tcattgcagc actggggcca 4920 gatggtaagc cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat 4980 gaacgaaata gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca 5040 gaccaagttt actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg 5100 atctaggtga agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg 5160 ttccactgag cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt 5220 ctgcgcgtaa tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg 5280 ccggatcaag agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata 5340 ccaaatactg ttcttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca 5400 ccgcctacat acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag 5460 tcgtgtctta ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc 5520 tgaacggggg gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga 5580 tacctacagc gtgagctatg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg 5640 tatccggtaa gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac 5700 gcctggtatc tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg 5760 tgatgctcgt caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg 5820 ttcctggcct tttgctggcc ttttgctcac atggctcgac agatct 5866 <210> 3 <211> 4198 <212> DNA <213> Artificial Sequence <220> <223> plasmid DNA comprising HO-1 cDNA <400> 3 ggtaccgagc tcttacgcgt gctagcccgg gctcgagatc tgcgatctgc atctcaatta 60 gtcagcaacc atagtcccgc ccctaactcc gcccatcccg cccctaactc cgcccagttc 120 cgcccattct ccgccccatc gctgactaat tttttttatt tatgcagagg ccgaggccgc 180 ctcggcctct gagctattcc agaagtagtg aggaggcttt tttggaggcc taggcttttg 240 caaaaagctt atggagcgtc cgcaacccga cagcatgccc caggatttgt cagaggccct 300 gaaggaggcc accaaggagg tgcacaccca ggcagagaat gctgagttca tgaggaactt 360 tcagaagggc caggtgaccc gagacggctt caagctggtg atggcctccc tgtaccacat 420 ctatgtggcc ctggaggagg agattgagcg caacaaggag agcccagtct tcgcccctgt 480 ctacttccca gaagagctgc accgcaaggc tgccctggag caggacctgg ccttctggta 540 cgggccccgc tggcaggagg tcatccccta cacaccagcc atgcagcgct atgtgaagcg 600 gctccacgag gtggggcgca cagagcccga gctgctggtg gcccacgcct acacccgcta 660 cctgggtgac ctgtctgggg gccaggtgct caaaaagatt gcccagaaag ccctggacct 720 gcccagctct ggcgagggcc tggccttctt caccttcccc aacattgcca gtgccaccaa 780 gttcaagcag ctctaccgct cccgcatgaa ctccctggag atgactcccg cagtcaggca 840 gagggtgata gaagaggcca agactgcgtt cctgctcaac atccagctct ttgaggagtt 900 gcaggagctg ctgacccatg acaccaagga ccagagcccc tcacgggcac cagggcttcg 960 ccagcgggcc agcaacaaag tgcaagattc tgcccccgtg gagactccca gagggaagcc 1020 cccactcaac acccgctccc aggctccgct tctccgatgg gtccttacac tcagctttct 1080 ggtggcgaca gttgctgtag ggctttatgc catgtgaatg ctctagagtc ggggcggccg 1140 gccgcttcga gcagacatga taagatacat tgatgagttt ggacaaacca caactagaat 1200 gcagtgaaaa aaatgcttta tttgtgaaat ttgtgatgct attgctttat ttgtaaccat 1260 tataagctgc aataaacaag ttaacaacaa caattgcatt cattttatgt ttcaggttca 1320 gggggaggtg tgggaggttt tttaaagcaa gtaaaacctc tacaaatgtg gtaaaatcga 1380 taaggatccg tcgaccgatg cccttgagag ccttcaaccc agtcagctcc ttccggtggg 1440 cgcggggcat gactatcgtc gccgcactta tgactgtctt ctttatcatg caactcgtag 1500 gacaggtgcc ggcagcgctc ttccgcttcc tcgctcactg actcgctgcg ctcggtcgtt 1560 cggctgcggc gagcggtatc agctcactca aaggcggtaa tacggttatc cacagaatca 1620 ggggataacg caggaaagaa catgtgagca aaaggccagc aaaaggccag gaaccgtaaa 1680 aaggccgcgt tgctggcgtt tttccatagg ctccgccccc ctgacgagca tcacaaaaat 1740 cgacgctcaa gtcagaggtg gcgaaacccg acaggactat aaagatacca ggcgtttccc 1800 cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc 1860 gcctttctcc cttcgggaag cgtggcgctt tctcatagct cacgctgtag gtatctcagt 1920 tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt tcagcccgac 1980 cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc cggtaagaca cgacttatcg 2040 ccactggcag cagccactgg taacaggatt agcagagcga ggtatgtagg cggtgctaca 2100 gagttcttga agtggtggcc taactacggc tacactagaa gaacagtatt tggtatctgc 2160 gctctgctga agccagttac cttcggaaaa agagttggta gctcttgatc cggcaaacaa 2220 accaccgctg gtagcggtgg tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa 2280 ggatctcaag aagatccttt gatcttttct acggggtctg acgctcagtg gaacgaaaac 2340 tcacgttaag ggattttggt catgagatta tcaaaaagga tcttcaccta gatcctttta 2400 aattaaaaat gaagttttaa atcaatctaa agtatatatg agtaaacttg gtctgacagt 2460 taccaatgct taatcagtga ggcacctatc tcagcgatct gtctatttcg ttcatccata 2520 gttgcctgac tccccgtcgt gtagataact acgatacggg agggcttacc atctggcccc 2580 agtgctgcaa tgataccgcg agacccacgc tcaccggctc cagatttatc agcaataaac 2640 cagccagccg gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag 2700 tctattaatt gttgccggga agctagagta agtagttcgc cagttaatag tttgcgcaac 2760 gttgttgcca ttgctacagg catcgtggtg tcacgctcgt cgtttggtat ggcttcattc 2820 agctccggtt cccaacgatc aaggcgagtt acatgatccc ccatgttgtg caaaaaagcg 2880 gttagctcct tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt gttatcactc 2940 atggttatgg cagcactgca taattctctt actgtcatgc catccgtaag atgcttttct 3000 gtgactggtg agtactcaac caagtcattc tgagaatagt gtatgcggcg accgagttgc 3060 tcttgcccgg cgtcaatacg ggataatacc gcgccacata gcagaacttt aaaagtgctc 3120 atcattggaa aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct gttgagatcc 3180 agttcgatgt aacccactcg tgcacccaac tgatcttcag catcttttac tttcaccagc 3240 gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat aagggcgaca 3300 cggaaatgtt gaatactcat actcttcctt tttcaatatt attgaagcat ttatcagggt 3360 tattgtctca tgagcggata catatttgaa tgtatttaga aaaataaaca aataggggtt 3420 ccgcgcacat ttccccgaaa agtgccacct gacgcgccct gtagcggcgc attaagcgcg 3480 gcgggtgtgg tggttacgcg cagcgtgacc gctacacttg ccagcgccct agcgcccgct 3540 cctttcgctt tcttcccttc ctttctcgcc acgttcgccg gctttccccg tcaagctcta 3600 aatcgggggc tccctttagg gttccgattt agtgctttac ggcacctcga ccccaaaaaa 3660 cttgattagg gtgatggttc acgtagtggg ccatcgccct gatagacggt ttttcgccct 3720 ttgacgttgg agtccacgtt ctttaatagt ggactcttgt tccaaactgg aacaacactc 3780 aaccctatct cggtctattc ttttgattta taagggattt tgccgatttc ggcctattgg 3840 ttaaaaaatg agctgattta acaaaaattt aacgcgaatt ttaacaaaat attaacgctt 3900 acaatttgcc attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc 3960 tcttcgctat tacgccagcc caagctacca tgataagtaa gtaatattaa ggtacgggag 4020 gtacttggag cggccgcaat aaaatatctt tattttcatt acatctgtgt gttggttttt 4080 tgtgtgaatc gatagtacta acatacgctc tccatcaaaa caaaacgaaa caaaacaaac 4140 tagcaaaata ggctgtcccc agtgcaagtg caggtgccag aacatttctc tatcgata 4198 <110> Industry-University Cooperation Foundation Hanyang University <120> Composition for preventing or treating inflammatory lung disease for nasal administration using complex for drug/gene delivery <130> P18U10C1157 <150> KR 10-2017-0146712 <151> 2017-11-06 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 600 <212> DNA <213> Artificial Sequence <220> <223> plasmid DNA <400> 1 tcaatattgg ccattagcca tattattcat tggttatata gcataaatca atattggcta 60 ttggccattg catacgttgt atctatatca taatatgtac atttatattg gctcatgtcc 120 aatatgaccg ccatgttggc attgattatt gactagttat taatagtaat caattacggg 180 gtcattagtt catagcccat atatggagtt ccgcgttaca taacttacgg taaatggccc 240 gcctggctga ccgcccaacg acccccgccc attgacgtca ataatgacgt atgttcccat 300 agtaacgcca atagggactt tccattgacg tcaatgggtg gagtatttac ggtaaactgc 360 ccacttggca gtacatcaag tgtatcatat gccaagtccg ccccctattg acgtcaatga 420 cggtaaatgg cccgcctggc attatgccca gtacatgacc ttacgggact ttcctacttg 480 gcagtacatc tacgtattag tcatcgctat taccatggtg atgcggtttt ggcagtacac 540 caatgggcgt ggatagcggt ttgactcacg gggatttcca agtctccacc ccattgacgt 600 600 <210> 2 <211> 5866 <212> DNA <213> Artificial Sequence <220> <223> pluc gene <400> 2 gtcgaggtga gccccacgtt ctgcttcact ctccccatct cccccccctc cccaccccca 60 attttgtatt tatttatttt ttaattattt tgtgcagcga tgggggcggg gggggggggg 120 gcgcgcgcca ggcggggcgg ggcggggcga ggggcggggc ggggcgaggc ggagaggtgc 180 ggcggcagcc aatcagagcg gcgcgctccg aaagtttcct tttatggcga ggcggcggcg 240 gcggcggccc tataaaaagc gaagcgcgcg gcgggcggga gtcgctgcgt tgccttcgcc 300 ccgtgccccg ctccgcgccg cctcgcgccg cccgccccgg ctctgactga ccgcgttact 360 cccacaggtg agcgggcggg acggcccttc tcctccgggc tgtaattagc gcttggttta 420 atgacggctc gtttcttttc tgtggctgcg tgaaagcctt aaagggctcc gggagggccc 480 tttgtgcggg ggggagcggc tcggggggtg cgtgcgtgtg tgtgtgcgtg gggagcgccg 540 cgtgcggccc gcgctgcccg gcggctgtga gcgctgcggg cgcggcgcgg ggctttgtgc 600 gctccgcgtg tgcgcgaggg gagcgcggcc gggggcggtg ccccgcggtg cgggggggct 660 gcgaggggaa caaaggctgc gtgcggggtg tgtgcgtggg ggggtgagca gggggtgtgg 720 gcgcggcggt cgggctgtaa cccccccctg cacccccctc cccgagttgc tgagcacggc 780 ccggcttcgg gtgcggggct ccgtgcgggg cgtggcgcgg ggctcgccgt gccgggcggg 840 gggtggcggc aggtgggggt gccgggcggg gcggggccgc ctcgggccgg ggagggctcg 900 ggggaggggc gcggcggccc cggagcgccg gcggctgtcg aggcgcggcg agccgcagcc 960 attgcctttt atggtaatcg tgcgagaggg cgcagggact tcctttgtcc caaatctggc 1020 ggagccgaaa tctgggaggc gccgccgcac cccctctagc gggcgcgggc gaagcggtgc 1080 ggcgccggca ggaaggaaat gggcggggag ggccttcgtg cgtcgccgcg ccgccgtccc 1140 cttctccatc tccagcctcg gggctgccgc agggggacgg ctgccttcgg gggggacggg 1200 gcagggcggg gttcggcttc tggcgtgtga ccggcggggt ttatatcttc ccttctctgt 1260 tcctccgcag cccccaagct tggtaccatg gaagacgcca aaaacataaa gaaaggcccg 1320 gcgccattct atccgctgga agatggaacc gctggagagc aactgcataa ggctatgaag 1380 agatacgccc tggttcctgg aacaattgct tttacagatg cacatatcga ggtggacatc 1440 acttacgctg agtacttcga aatgtccgtt cggttggcag aagctatgaa acgatatggg 1500 ctgaatacaa atcacagaat cgtcgtatgc agtgaaaact ctcttcaatt ctttatgccg 1560 gtgttgggcg cgttatttat cggagttgca gttgcgcccg cgaacgacat ttataatgaa 1620 cgtgaattgc tcaacagtat gggcatttcg cagcctaccg tggtgttcgt ttccaaaaag 1680 gggttgcaaa aaattttgaa cgtgcaaaaa aagctcccaa tcatccaaaa aattattatc 1740 atggattcta aaacggatta ccagggattt cagtcgatgt acacgttcgt cacatctcat 1800 ctacctcccg gttttaatga atacgatttt gtgccagagt ccttcgatag ggacaagaca 1860 attgcactga tcatgaactc ctctggatct actggtctgc ctaaaggtgt cgctctgcct 1920 catagaactg cctgcgtgag attctcgcat gccagagatc ctatttttgg caatcaaatc 1980 attccggata ctgcgatttt aagtgttgtt ccattccatc acggttttgg aatgtttact 2040 acactcggat atttgatatg tggatttcga gtcgtcttaa tgtatagatt tgaagaagag 2100 ctgtttctga ggagccttca ggattacaag attcaaagtg cgctgctggt gccaacccta 2160 ttctccttct tcgccaaaag cactctgatt gacaaatacg atttatctaa tttacacgaa 2220 attgcttctg gtggcgctcc cctctctaag gaagtcgggg aagcggttgc caagaggttc 2280 catctgccag gtatcaggca aggatatggg ctcactgaga ctacatcagc tattctgatt 2340 acacccgagg gggatgataa accgggcgcg gtcggtaaag ttgttccatt ttttgaagcg 2400 aaggttgtgg atctggatac cgggaaaacg ctgggcgtta atcaaagagg cgaactgtgt 2460 gtgagaggtc ctatgattat gtccggttat gtaaacaatc cggaagcgac caacgccttg 2520 attgacaagg atggatggct acattctgga gacatagctt actgggacga agacgaacac 2580 ttcttcatcg ttgaccgcct gaagtctctg attaagtaca aaggctatca ggtggctccc 2640 gctgaattgg aatccatctt gctccaacac cccaacatct tcgacgcagg tgtcgcaggt 2700 cttcccgacg atgacgccgg tgaacttccc gccgccgttg ttgttttgga gcacggaaag 2760 acgatgacgg aaaaagagat cgtggattac gtcgccagtc aagtaacaac cgcgaaaaag 2820 ttgcgcggag gagttgtgtt tgtggacgaa gtaccgaaag gtcttaccgg aaaactcgac 2880 gcaagaaaaa tcagagagat cctcataaag gccaagaagg gcggaaagat cgccgtgtaa 2940 tctagagtcg acccgggcgg ccgcttcgag cagacatgat aagatacatt gatgagtttg 3000 gacaaaccac aactagaatg cagtgaaaaa aatgctttat ttgtgaaatt tgtgatgcta 3060 ttgctttatt tgtaaccatt ataagctgca ataaacaagt taacaacaac aattgcattc 3120 attttatgtt tcaggttcag ggggagatgt gggaggtttt ttaaagcaag taaaacctct 3180 acaaatgtgg taaaatcgat aaggatccgg gctggcgtaa tagcgaagag gcccgcaccg 3240 atcgcccttc ccaacagttg cgcagcctga atggcgaatg gacgcgccct gtagcggcgc 3300 attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc gctacacttg ccagcgccct 3360 agcgcccgct cctttcgctt tcttcccttc ctttctcgcc acgttcgccg gctttccccg 3420 tcaagctcta aatcgggggc tccctttagg gttccgattt agtgctttac ggcacctcga 3480 ccccaaaaaa cttgattagg gtgatggttc acgtagtggg ccatcgccct gatagacggt 3540 ttttcgccct ttgacgttgg agtccacgtt ctttaatagt ggactcttgt tccaaactgg 3600 aacaacactc aaccctatct cggtctattc ttttgattta taagggattt tgccgatttc 3660 ggcctattgg ttaaaaaatg agctgattta acaaaaattt aacgcgaatt ttaacaaaat 3720 attaacgctt acaatttcct gatgcggtat tttctcctta cgcatctgtg cggtatttca 3780 caccgcatat ggtgcactct cagtacaatc tgctctgatg ccgcatagtt aagccagccc 3840 cgacacccgc caacacccgc tgacgcgccc tgacgggctt gtctgctccc ggcatccgct 3900 tacagacaag ctgtgaccgt ctccgggagc tgcatgtgtc agaggttttc accgtcatca 3960 ccgaaacgcg cgagacgaaa gggcctcgtg atacgcctat ttttataggt taatgtcatg 4020 ataataatgg tttcttagac gtcaggtggc acttttcggg gaaatgtgcg cggaacccct 4080 atttgtttat ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga 4140 taaatgcttc aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc 4200 cttattccct tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg 4260 aaagtaaaag atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc 4320 aacagcggta agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact 4380 tttaaagttc tgctatgtgg cgcggtatta tcccgtattg acgccgggca agagcaactc 4440 ggtcgccgca tacactattc tcagaatgac ttggttgagt actcaccagt cacagaaaag 4500 catcttacgg atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat 4560 aacactgcgg ccaacttact tctgacaacg atcggaggac cgaaggagct aaccgctttt 4620 ttgcacaaca tgggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa 4680 gccataccaa acgacgagcg tgacaccacg atgcctgtag caatggcaac aacgttgcgc 4740 aaactattaa ctggcgaact acttactcta gcttcccggc aacaattaat agactggatg 4800 gaggcggata aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttatt 4860 gctgataaat ctggagccgg tgagcgtggg tctcgcggta tcattgcagc actggggcca 4920 gatggtaagc cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat 4980 gaacgaaata gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca 5040 gaccaagttt actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg 5100 atctaggtga agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg 5160 ttccactgag cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt 5220 ctgcgcgtaa tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg 5280 ccggatcaag agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata 5340 ccaaatactg ttcttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca 5400 ccgcctacat acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag 5460 tcgtgtctta ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc 5520 tgaacggggg gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga 5580 tacctacagc gtgagctatg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg 5640 tatccggtaa gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac 5700 gcctggtatc tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg 5760 tgatgctcgt caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg 5820 ttcctggcct tttgctggcc ttttgctcac atggctcgac agatct 5866 <210> 3 <211> 4198 <212> DNA <213> Artificial Sequence <220> <223> Plasmid DNA comprising HO-1 cDNA <400> 3 ggtaccgagc tcttacgcgt gctagcccgg gctcgagatc tgcgatctgc atctcaatta 60 gtcagcaacc atagtcccgc ccctaactcc gcccatcccg cccctaactc cgcccagttc 120 cgcccattct ccgccccatc gctgactaat tttttttatt tatgcagagg ccgaggccgc 180 ctcggcctct gagctattcc agaagtagtg aggaggcttt tttggaggcc taggcttttg 240 caaaaagctt atggagcgtc cgcaacccga cagcatgccc caggatttgt cagaggccct 300 gaaggaggcc accaaggagg tgcacaccca ggcagagaat gctgagttca tgaggaactt 360 tcagaagggc caggtgaccc gagacggctt caagctggtg atggcctccc tgtaccacat 420 ctatgtggcc ctggaggagg agattgagcg caacaaggag agcccagtct tcgcccctgt 480 ctacttccca gaagagctgc accgcaaggc tgccctggag caggacctgg ccttctggta 540 cgggccccgc tggcaggagg tcatccccta cacaccagcc atgcagcgct atgtgaagcg 600 gctccacgag gtggggcgca cagagcccga gctgctggtg gcccacgcct acacccgcta 660 cctgggtgac ctgtctgggg gccaggtgct caaaaagatt gcccagaaag ccctggacct 720 gcccagctct ggcgagggcc tggccttctt caccttcccc aacattgcca gtgccaccaa 780 gttcaagcag ctctaccgct cccgcatgaa ctccctggag atgactcccg cagtcaggca 840 gagggtgata gaagaggcca agactgcgtt cctgctcaac atccagctct ttgaggagtt 900 gcaggagctg ctgacccatg acaccaagga ccagagcccc tcacgggcac cagggcttcg 960 ccagcgggcc agcaacaaag tgcaagattc tgcccccgtg gagactccca gagggaagcc 1020 cccactcaac acccgctccc aggctccgct tctccgatgg gtccttacac tcagctttct 1080 ggtggcgaca gttgctgtag ggctttatgc catgtgaatg ctctagagtc ggggcggccg 1140 gccgcttcga gcagacatga taagatacat tgatgagttt ggacaaacca caactagaat 1200 gcagtgaaaa aaatgcttta tttgtgaaat ttgtgatgct attgctttat ttgtaaccat 1260 tataagctgc aataaacaag ttaacaacaa caattgcatt cattttatgt ttcaggttca 1320 gggggaggtg tgggaggttt tttaaagcaa gtaaaacctc tacaaatgtg gtaaaatcga 1380 taaggatccg tcgaccgatg cccttgagag ccttcaaccc agtcagctcc ttccggtggg 1440 cgcggggcat gactatcgtc gccgcactta tgactgtctt ctttatcatg caactcgtag 1500 gacaggtgcc ggcagcgctc ttccgcttcc tcgctcactg actcgctgcg ctcggtcgtt 1560 cggctgcggc gagcggtatc agctcactca aaggcggtaa tacggttatc cacagaatca 1620 ggggataacg caggaaagaa catgtgagca aaaggccagc aaaaggccag gaaccgtaaa 1680 aaggccgcgt tgctggcgtt tttccatagg ctccgccccc ctgacgagca tcacaaaaat 1740 cgacgctcaa gtcagaggtg gcgaaacccg acaggactat aaagatacca ggcgtttccc 1800 cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc 1860 gcctttctcc cttcgggaag cgtggcgctt tctcatagct cacgctgtag gtatctcagt 1920 tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt tcagcccgac 1980 cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc cggtaagaca cgacttatcg 2040 ccactggcag cagccactgg taacaggatt agcagagcga ggtatgtagg cggtgctaca 2100 gagttcttga agtggtggcc taactacggc tacactagaa gaacagtatt tggtatctgc 2160 gctctgctga agccagttac cttcggaaaa agagttggta gctcttgatc cggcaaacaa 2220 accaccgctg gtagcggtgg tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa 2280 ggatctcaag aagatccttt gatcttttct acggggtctg acgctcagtg gaacgaaaac 2340 tcacgttaag ggattttggt catgagatta tcaaaaagga tcttcaccta gatcctttta 2400 aattaaaaat gaagttttaa atcaatctaa agtatatatg agtaaacttg gtctgacagt 2460 taccaatgct taatcagtga ggcacctatc tcagcgatct gtctatttcg ttcatccata 2520 gttgcctgac tccccgtcgt gtagataact acgatacggg agggcttacc atctggcccc 2580 agtgctgcaa tgataccgcg agacccacgc tcaccggctc cagatttatc agcaataaac 2640 cagccagccg gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag 2700 tctattaatt gttgccggga agctagagta agtagttcgc cagttaatag tttgcgcaac 2760 gttgttgcca ttgctacagg catcgtggtg tcacgctcgt cgtttggtat ggcttcattc 2820 agctccggtt cccaacgatc aaggcgagtt acatgatccc ccatgttgtg caaaaaagcg 2880 gttagctcct tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt gttatcactc 2940 atggttatgg cagcactgca taattctctt actgtcatgc catccgtaag atgcttttct 3000 gtgactggtg agtactcaac caagtcattc tgagaatagt gtatgcggcg accgagttgc 3060 tcttgcccgg cgtcaatacg ggataatacc gcgccacata gcagaacttt aaaagtgctc 3120 atcattggaa aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct gttgagatcc 3180 agttcgatgt aacccactcg tgcacccaac tgatcttcag catcttttac tttcaccagc 3240 gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat aagggcgaca 3300 cggaaatgtt gaatactcat actcttcctt tttcaatatt attgaagcat ttatcagggt 3360 tattgtctca tgagcggata catatttgaa tgtatttaga aaaataaaca aataggggtt 3420 ccgcgcacat ttccccgaaa agtgccacct gacgcgccct gtagcggcgc attaagcgcg 3480 gcgggtgtgg tggttacgcg cagcgtgacc gctacacttg ccagcgccct agcgcccgct 3540 cctttcgctt tcttcccttc ctttctcgcc acgttcgccg gctttccccg tcaagctcta 3600 aatcgggggc tccctttagg gttccgattt agtgctttac ggcacctcga ccccaaaaaa 3660 cttgattagg gtgatggttc acgtagtggg ccatcgccct gatagacggt ttttcgccct 3720 ttgacgttgg agtccacgtt ctttaatagt ggactcttgt tccaaactgg aacaacactc 3780 aaccctatct cggtctattc ttttgattta taagggattt tgccgatttc ggcctattgg 3840 ttaaaaaatg agctgattta acaaaaattt aacgcgaatt ttaacaaaat attaacgctt 3900 acaatttgcc attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc 3960 tcttcgctat tacgccagcc caagctacca tgataagtaa gtaatattaa ggtacgggag 4020 gtacttggag cggccgcaat aaaatatctt tattttcatt acatctgtgt gttggttttt 4080 tgtgtgaatc gatagtacta acatacgctc tccatcaaaa caaaacgaaa caaaacaaac 4140 tagcaaaata ggctgtcccc agtgcaagtg caggtgccag aacatttctc tatcgata 4198

Claims (16)

소수성 약물이 포함된 콜레스테롤이 접합된 양이온성 고분자 마이셀 표면에 유전자가 결합된 것으로,
상기 소수성 약물은 레스베라트롤 또는 커큐민이며,
상기 양이온성 고분자는 폴리(아미도아민) 계열 덴드리머이고,
상기 유전자가 플라스미드 DNA이며,
상기 콜레스테롤이 접합된 양이온성 고분자 마이셀 내부에 소수성 약물이 봉입되고, 양이온성 고분자 표면에 유전자가 결합되고,
상기 콜레스테롤이 접합된 양이온성 고분자와 소수성 약물이 1 : 0.4 ~ 1.0의 중량비로 혼합되며,
소수성 약물이 봉입된 콜레스테롤이 접합된 양이온성 고분자 마이셀 및 유전자가 12 ~ 25 : 1 의 중량비로 혼합된 것을 특징으로 하는 비강 투여용 약물/유전자 전달 복합체.
A gene is bound to the surface of cationic polymer micelles to which cholesterol containing a hydrophobic drug is conjugated,
The hydrophobic drug is resveratrol or curcumin,
The cationic polymer is a poly(amidoamine)-based dendrimer,
The gene is plasmid DNA,
A hydrophobic drug is encapsulated inside the cationic polymer micelle to which cholesterol is conjugated, and a gene is bound to the cationic polymer surface,
The cholesterol-conjugated cationic polymer and a hydrophobic drug are mixed in a weight ratio of 1: 0.4 to 1.0,
A drug/gene delivery complex for nasal administration, characterized in that the cationic polymer micelles conjugated with cholesterol encapsulated with a hydrophobic drug and genes are mixed in a weight ratio of 12 to 25:1.
삭제delete 삭제delete 삭제delete 삭제delete 삭제delete 청구항 1의 복합체를 포함하는 비강 투여용 염증성 폐질환 예방 또는 치료용 조성물.
A composition for preventing or treating inflammatory lung disease for nasal administration comprising the complex of claim 1.
제 7 항에 있어서,
상기 염증성 폐질환은 천식, 만성 폐쇄성 폐질환(COPD), 급성 폐손상(acute lung injury), 농흉, 폐농양, 폐렴, 폐결핵 및 기관지염으로 구성된 군으로부터 선택되는 비강 투여용 염증성 폐질환 예방 또는 치료용 조성물.
The method of claim 7,
The inflammatory lung disease is selected from the group consisting of asthma, chronic obstructive pulmonary disease (COPD), acute lung injury, empyema, lung abscess, pneumonia, pulmonary tuberculosis, and bronchitis. Composition.
양이온성 고분자에 콜레스테롤을 접합시키는 단계;
소수성 약물을 봉입시키는 단계; 및
양이온성 고분자 표면에 유전자를 결합시키는 단계
를 포함하되,
상기 소수성 약물은 레스베라트롤 또는 커큐민이며,
상기 양이온성 고분자는 폴리(아미도아민) 계열 덴드리머이고,
상기 유전자가 플라스미드 DNA이며,
상기 콜레스테롤이 접합된 양이온성 고분자와 소수성 약물이 1 : 0.4 ~ 1.0의 중량비로 혼합되고,
소수성 약물이 봉입된 콜레스테롤이 접합된 양이온성 고분자 마이셀 및 유전자가 12 ~ 25 : 1 의 중량비로 혼합된 것을 특징으로 하는 제 1 항의 비강 투여용 약물/유전자 전달 복합체의 제조방법.
Conjugating cholesterol to a cationic polymer;
Encapsulating a hydrophobic drug; And
Binding the gene to the surface of the cationic polymer
Including,
The hydrophobic drug is resveratrol or curcumin,
The cationic polymer is a poly(amidoamine)-based dendrimer,
The gene is plasmid DNA,
The cholesterol-conjugated cationic polymer and a hydrophobic drug are mixed in a weight ratio of 1: 0.4 to 1.0,
The method for producing a drug/gene delivery complex for nasal administration of claim 1, wherein the cationic polymer micelles and genes conjugated with a hydrophobic drug-encapsulated cholesterol are mixed in a weight ratio of 12 to 25:1.
삭제delete 삭제delete 삭제delete 삭제delete 삭제delete 삭제delete 삭제delete
KR1020180123068A 2017-11-06 2018-10-16 Composition for preventing or treating inflammatory lung disease for nasal administration using complex for drug/gene delivery KR102187144B1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020170146712 2017-11-06
KR20170146712 2017-11-06

Publications (2)

Publication Number Publication Date
KR20190051792A KR20190051792A (en) 2019-05-15
KR102187144B1 true KR102187144B1 (en) 2020-12-04

Family

ID=66579641

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020180123068A KR102187144B1 (en) 2017-11-06 2018-10-16 Composition for preventing or treating inflammatory lung disease for nasal administration using complex for drug/gene delivery

Country Status (1)

Country Link
KR (1) KR102187144B1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220101914A (en) 2021-01-12 2022-07-19 연세대학교 산학협력단 A pH-sensitive amphiphilic block copolymer, a manufacturing method thereof, a polymer micelle comprising the pH-sensitive amphiphilic block copolymer
WO2023043367A3 (en) * 2021-09-15 2023-05-04 Agency For Science, Technology And Research Green tea-based nanocomplexes for eye disease

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120121730A1 (en) * 2010-10-07 2012-05-17 Trinity Laboratories, Inc. Pharmaceutical and nutraceutical compositions for treating respiratory disease and associated phlegm

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120121730A1 (en) * 2010-10-07 2012-05-17 Trinity Laboratories, Inc. Pharmaceutical and nutraceutical compositions for treating respiratory disease and associated phlegm

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220101914A (en) 2021-01-12 2022-07-19 연세대학교 산학협력단 A pH-sensitive amphiphilic block copolymer, a manufacturing method thereof, a polymer micelle comprising the pH-sensitive amphiphilic block copolymer
WO2023043367A3 (en) * 2021-09-15 2023-05-04 Agency For Science, Technology And Research Green tea-based nanocomplexes for eye disease

Also Published As

Publication number Publication date
KR20190051792A (en) 2019-05-15

Similar Documents

Publication Publication Date Title
Cheng et al. Circulating myocardial microRNAs from infarcted hearts are carried in exosomes and mobilise bone marrow progenitor cells
Anliker et al. Specific gene transfer to neurons, endothelial cells and hematopoietic progenitors with lentiviral vectors
KR102662049B1 (en) Complement inactivation-resistant enveloped virus for cancer treatment
KR102187144B1 (en) Composition for preventing or treating inflammatory lung disease for nasal administration using complex for drug/gene delivery
CN112680466B (en) Animal model for expressing humanized ACE2 and application thereof
Jayasinghe et al. Surface-engineered extracellular vesicles for targeted delivery of therapeutic RNAs and peptides for cancer therapy
KR20200089289A (en) Method and composition for non-myeloablative bone marrow reconstruction
Zhang et al. Non-viral nanoparticle delivers small interfering RNA to macrophages in vitro and in vivo
KR20190096329A (en) AAV2-mediated gene delivery of SFASL as a neuroprotective therapy in glaucoma
CN104357459B (en) The full-length infectious clone of japanese encephalitis virus of Carrying Green Fluorescent Protein gene and preparation method and application
KR20080036244A (en) Promoter for introducing a gene into a lymphocyte or blood cell and application thereof
US9850497B2 (en) Gene targeting methods and tools
Roerig et al. Standardization approaches for extracellular vesicle loading with oligonucleotides and biologics
KR101885438B1 (en) Gene therapy vector system and prodrug genes
US20150216999A1 (en) Compositions and methods for treating cardiovascular diseases using smad3
CN110225977B (en) Gene therapy vector system and prodrug genes
CN112574991B (en) Oligonucleotide, carrier, preparation method and application
KR20110123721A (en) Cells, nucleic acid constructs, cells comprising said constructs and methods utilizing said cells in the treatment of diseases
KR102624831B1 (en) Production of transgenic dogs overexpressing muscle-specific PCK1
KR20230051223A (en) Methods of treating WWOX-related diseases
CN116670769A (en) Compositions and methods for modulating TCF4 gene expression and treating petehypgold syndrome
CN111150748A (en) Application of recombinant oncolytic virus in preparation of medicine for treating digestive tract cancer
CN107384921A (en) MiR216a is used for propagation, invasion and attack and the migration for suppressing osteosarcoma cell
CN109097333A (en) It resists cell ageing and extends the mescenchymal stem cell and its preparation method and application of blood glucose-control effect time-histories
CN110279705A (en) A method for the treatment of steirert-Batten-Gibb syndrome I type

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant