KR102186838B1 - Cancer vaccine composition comprising attenuated Salmonella mutant expressing SLURP-1 as effective component - Google Patents

Abstract

The present invention expresses the SLURP-1 (Secreted Ly-6/uPAR-related protein-1) antigen consisting of the amino acid sequence of SEQ ID NO: 2, and the lon, cpxR, rfaL and asd genes are deleted, and the attenuated Salmonella mutant strain and the attenuated It relates to a cancer vaccine composition containing the Salmonella strain as an active ingredient.

Description

Cancer vaccine composition comprising attenuated Salmonella mutant expressing SLURP-1 as effective component}

The present invention relates to a cancer vaccine composition containing an attenuated Salmonella strain expressing SLURP-1 as an active ingredient.

Human Secreted Ly-6/uPAR-related protein-1, a proliferation inhibitory protein, is a member of the Ly-6/uPAR family as demonstrated by amino acid sequence comparison. The SLURP-1 protein has recently been shown to have a proliferative inhibitory effect on certain epithelial cancer cells. The SLURP-1 protein, an endogenous protein of the Ly-6/uPAR family family produced in higher animals, is structurally similar to three finger snake venom (snake alpha neurotoxin). Considering that alpha neurotoxins exhibit specific affinity for acetylcholine receptors in muscle and nerve cells, which prevents them from functioning after irreversible binding, the SLURP-1 protein similar in structure to nicotinic acetylcholine receptors receptor, nAChRs), and it can be inferred that it can act as an inhibitor that inhibits its function. In previous studies, it has been reported that SLURP-1 recombinant analogs made from human keratinocytes act as allosteric modulators for α7-nAChRs and are involved in the proliferation and differentiation of epithelial cells. Considering the study that nicotine, an acetylcholine receptor agonist, causes tumors of various organs and epithelial cells in the body, SLURP-1 protein, which acts as an antagonist of the nicotine receptor, has the opposite tendency of nicotine, that is, the effect of tumor suppression. May have, suggesting the value of SLURP-1 as a recombinant therapeutic protein.

Since cancer was regarded as an object to be conquered by humans, research on all-round anticancer treatment from basic research at the cellular level has been promoted around the world. The mechanism of cancer is still unclear, and it is difficult to prevent and cure recurrence, so the demand for anticancer drugs is exploding, and enormous research funds are being invested. However, expensive chemotherapy costs are not only direct medical costs, but also indirect costs for the contraction of social economic activities after the onset, rehabilitation, and patient care are added, creating a large economic burden on the entire family and members of society of cancer patients. New technologies are being introduced. Currently, a viral vector, a non-viral vector using nano-particles, and a bacterial vector using anaerobic microorganisms ( bacterial vector) is being used. Among them, viral vectors showing high drug delivery efficiency are used not only for chemotherapy, but also for gene therapy of other diseases. However, the recently reported side effects of viral vectors clearly show the limitations of viral vectors (the range of host cells is wide and causes immune side effects when repeated administration), and thus, the development of a safer gene delivery system is required.

In 2006, Dr. Gnjatic of Yale University combined Salmonella tumor markers with the secretion signals of the Type III secretion system (TTSS) to secrete them into cancer tissues, and then activate CD8+ T cells in the body to prevent cancer. An anticancer vaccine system that reduced the size of was reported (Nishikawa H, et al., J Clin Invest. 2006, 116(7):1946-54).

On the other hand, Korean Patent Application Publication No. 2018-0037948 discloses'VEGFR-2 targeting DNA vaccine for combination therapy' related to a Salmonella attenuated strain containing at least one DNA molecule copy containing an expression cassette encoding a VEGF receptor protein. Korean Patent Application Publication No. 2016-0062289 discloses'Salmonella strains for the treatment of new cancers and uses thereof' using as an active ingredient a Salmonella strain in which the ppGpp-producing gene and Salmonella pathogenic gene have been deleted, but the ' There is no description of'a cancer vaccine composition containing an attenuated Salmonella strain expressing SLURP-1 as an active ingredient'.

The present invention was derived from the above requirements, the inventors of the present inventors Bla (β-lactamse) signal sequence and the SLURP-1 protein linked to the attenuated Salmonella mutant JOL1800 strain in which the lon, cpxR, rfaL and asd genes are deleted A recombinant vector containing the coding gene was transformed to produce an attenuated Salmonella mutant JOL2238 that secretes and expresses the SLURP-1 protein. The JOL2238 strain showed excellent tumor tropism to colon cancer and cervical cancer cells in vitro , and showed an effect of reducing tumor size in vivo . The present invention was completed by confirming that the attenuated Salmonella strain expressing SLURP-1 can be used as a material for a vaccine or pharmaceutical composition for cancer treatment.

In order to solve the above problem, the present invention expresses the SLURP-1 (Secreted Ly-6/uPAR-related protein-1) antigen consisting of the amino acid sequence of SEQ ID NO: 2, and the lon, cpxR, rfaL and asd genes are deleted. Provides an attenuated Salmonella mutant.

In addition, the present invention (a) amplifying a gene encoding the SLURP-1 antigen consisting of the amino acid sequence of SEQ ID NO: 2; (b) obtaining a cloned plasmid by cloning the amplified gene of step (a) into a recombinant vector having an asd gene; And (c) transforming the cloned plasmid of step (b) into an attenuated Salmonella strain by deleting the lon, cpxR, rfaL and asd genes, thereby selecting and obtaining a transformed Salmonella mutant strain; It provides a method for producing an attenuated Salmonella mutant with tumor-tropism and a tumor-trophic attenuated Salmonella mutant prepared by the method.

In addition, the present invention provides a cancer vaccine composition and a pharmaceutical composition for cancer treatment comprising the attenuated Salmonella mutant as an active ingredient.

The vaccine composition of the present invention can selectively act on tumor cells by expressing SLURP-1, an anti-proliferative protein, on tumor-bearing attenuated Salmonella strains, so immunotherapy vaccines mainly used in conventional cancer vaccines (cancer cells It is simpler than the mechanism of activating the immune system by artificially controlling the activity of T cells that specifically destroy T cells or administering a cancer-specific antigen to a patient), so that it can be easily used in a therapeutic method targeting a tumor.

1 is a schematic (A) of the plasmid used in the present invention and the results of Western blot (B) of the SLURP-1 protein expressed in the JOL2338 strain. (A) pJHL65::SLURP-1 plasmid; (1) PUC Ori, (2) asd gene, (3) Ptrc promoter, (4) Bla signal sequence, (5) SLURP-1 coding sequence, (6) 5ST1T2 termination signal. (B) M; protein marker, V; Salmonella containing pJHL65 vector only, C-1; Salmonella containing pJHL65::SLURP-1.
(A) of Figure 2 is a result of confirming the invasion ability of the attenuated Salmonella mutant strains (JOL911 and JOL1800 strains) in the cell, the number of bacteria observed is compared to the number of strains observed when checking the invasion ability of the outdoor strain (WT) in% Marked. (B) Induction of apoptosis (apoptosis) of the attenuated Salmonella mutant was observed in Caco2 cells. It was stained with Annexin V and checked for each time period using an IncuCyte live imaging system, and the green fluorescent mark indicates the degree of apoptosis. (C) is the result of confirming through flow cytometry (FACS) cells that died after infection with outdoor strains, JOL910, JOL911, and JOL1800. All results were expressed as the average of 3 repetitions. ***; p<0.05.
Figure 3 is a result of confirming the in vivo toxicity and tumor resilience of the attenuated Salmonella mutant, (A) is the body weight change of mice after inoculating each attenuated Salmonella mutant into the abdominal cavity of BALB/c mice (n=6 per group) Is confirmed, and (B) shows the number of strains of JOL1800 found in the spleen and tumor at 3 days (left graph) and 6 days (right graph) after inoculation of the JOL1800 strain. ***; p<0.05, DPI; days post inoculation.
Figure 4 is a result of confirming the biological properties of the recombinant SLURP-1 protein, (A) is the result of confirming the anti-proliferative properties of the SLURP-1 protein for each cell line by MTT analysis, (B) is the cell of the SLURP-1 protein This is the result of confirming the effect on the cycle in HeLa cells. ***; p<0.05.
5 is an analysis of the expression of the SLURP-1 protein in the body, (A) is an ELISA result, (B) is a Western blot result, and (C) is a fluorescence image analysis result.
6 is an analysis of the anticancer effect of the strain JOL2338 ( S. Typhimurium pJHL1800 harboring pJHL65:: SLURP-1), and is a result of observing the change in tumor size according to the inoculation of the attenuated Salmonella mutant strain.

In order to achieve the object of the present invention, the present invention expresses the SLURP-1 (Secreted Ly-6/uPAR-related protein-1) antigen consisting of the amino acid sequence of SEQ ID NO: 2, and the lon, cpxR, rfaL and asd genes are Provides the fruiting attenuated Salmonella mutant.

The scope of the SLURP-1 antigen according to the present invention includes a protein having an amino acid sequence represented by SEQ ID NO: 2 and functional equivalents thereof, and as a result of addition, substitution or deletion of amino acids, the term "functional equivalent", the sequence number Having at least 60% or more, preferably 80% or more, more preferably 90% or more, even more preferably 95% or more of sequence homology with the amino acid sequence represented by the amino acid of 2, represented by SEQ ID NO: 2 It refers to a protein that exhibits substantially the same physiological activity as a protein. "Substantially homogenous physiological activity" means anti-proliferative activity. The invention also includes fragments, derivatives and analogs of the SLURP-1 antigen.

In addition, the range of the gene encoding the SLURP-1 antigen of the present invention includes all of the genomic DNA, cDNA, and synthetic DNA encoding the SLURP-1 antigen (protein). Preferably, the gene encoding the SLURP-1 antigen of the present invention may include a nucleotide sequence represented by SEQ ID NO: 1. In addition, homologs of the nucleotide sequence are included within the scope of the present invention. Specifically, the gene includes a nucleotide sequence having a sequence homology of 70% or more, more preferably 80% or more, more preferably 90% or more, most preferably 95% or more, respectively, with the nucleotide sequence of SEQ ID NO: 1 can do. The "% of sequence homology" for a polynucleotide is identified by comparing two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is a reference sequence (not including additions or deletions) for the optimal alignment of the two sequences. May include additions or deletions (i.e., gaps) compared to). In addition, the gene encoding the SLURP-1 antigen of the present invention may include a nucleotide sequence represented by SEQ ID NO: 5 optimized for the Salmonella codon.

The Salmonella mutant of the present invention may be an attenuated Salmonella mutant in which an asd (aspartate β-semialdehyde dehydrogenase) gene is deleted. Preferably lon (Lon protease) , cpxR (transcriptional regulatory protein CpxR) and asd genes are deleted Salmonella mutant strains, more preferably lon, cpxR, rfaL (O-antigen ligase) And Salmonella mutant strains in which the asd gene is deleted, but are not limited thereto.

In the Salmonella mutant strain according to an embodiment of the present invention, the Salmonella mutant strain ( Δlon , ΔcpxR , ΔrfaL , Δasd Salmonella typhimurium mutant, JOL1800) in which the lon, cpxR, rfaL and asd genes are deleted is DAP (diaminopimellic acid) in which the asd gene is deleted. ) Not only was it produced to select recombinant antigen strains without antibiotics as a requesting strain, but also by deleting the cpxR gene, lymphatic tissue penetration is increased to increase immunogenicity, and pathogenicity can be attenuated by deletion of the lon gene.

In one embodiment of the present invention, in order to increase the expression of foreign antigens in the existing attenuated Salmonella strains, deletion of genes related to the expression of lipopolysaccharide (LPS) of Salmonella was performed. LPS is a part that forms the outer membrane in Gram-negative bacteria, and by removing the rfaL gene involved in the synthesis of O antigen polysaccharide (O-PS) polymerase in LPS, the length of LPS synthesized in the outer membrane was shortened. . Therefore, when the Salmonella outer membrane of the foreign antigen protein is expressed, the immune response stimulated by the foreign antigen can be enhanced by further exposure to LPS without being covered.

The attenuated Salmonella mutant is a Bla (β-lactamse) signal sequence, a SLURP-1 (Secreted Ly-6/uPAR-related protein-1) antigen-coding gene linked thereto; And asd gene; may be transformed with a recombinant vector including, but is not limited thereto. In one embodiment of the present invention, the recombinant vector may be pJHL65 (Asd+ vector, pBR ori, 6xHis) or pJHL80 (Asd+ vector, p15A ori, 6xHis) having a secretion system based on the Bla signal sequence, but is limited thereto. It doesn't work.

Further, in the Salmonella mutants of the present invention, wherein the Salmonella is Salmonella typhimurium (Salmonella typhimurium), Salmonella tie blood (S. typi), Salmonella para tie blood (S. paratyphi), Salmonella Sendai (S. sendai), Salmonella gallinarium ( S. gallinarium ) or Salmonella enteritidis ( S. enteritidis ) may be, and the like, preferably Salmonella typhimurium, but is not limited thereto.

The present invention also,

(a) amplifying the gene encoding the SLURP-1 (Secreted Ly-6/uPAR-related protein-1) antigen consisting of the amino acid sequence of SEQ ID NO: 2;

(b) obtaining a cloned plasmid by cloning the amplified gene of step (a) into a recombinant vector having an asd gene; And

(c) transforming the cloned plasmid of step (b) into an attenuated Salmonella strain by deleting the lon, cpxR, rfaL, and asd genes, thereby selecting and obtaining the transformed Salmonella mutant strain; (tumor-tropism) provides a method of manufacturing attenuated Salmonella mutant.

The asd gene is an enzyme related to the initiation point of DAP synthesis, which is involved in the cross-linking of peptidoglycans in cell wall synthesis, and it is possible to confirm whether the asd gene was introduced into the asd gene-deficient strain in a DAP-deficient medium. It is a useful marker for plasmids.

The present invention also provides an attenuated Salmonella mutant strain having tumor resistance prepared by the above method.

The attenuated Salmonella mutant strain is as described above.

The present invention also provides a cancer vaccine composition comprising the attenuated Salmonella mutant according to the present invention as an active ingredient.

The vaccine composition of the present invention contains as an active ingredient a Salmonella mutant that expresses the SLURP-1 antigen having anti-proliferative activity on Salmonella attenuated by gene deletion, and the vaccine composition is treated in mammals other than humans. To cure cancer. The attenuated Salmonella mutant according to the present invention has tumor-tropism, so tumor target treatment is possible.

In the vaccine composition according to an embodiment of the present invention, the Salmonella mutant strain may be prepared in the form of a live or dead cell, and preferably may be in the form of a mutant live cell, but is not limited thereto.

In addition, the cancer vaccine composition may further include a cancer-specific antigen, but is not limited thereto. The cancer-specific antigen promotes an immune response to the antigen in the body, thereby inhibiting the growth of cancer cells when a cancer cell expressing the antigen occurs later, and thus can effectively treat cancer.

In the cancer vaccine composition of the present invention, the cancer is from the group consisting of colon cancer, colon cancer, cervical cancer, stomach cancer, liver cancer, lung cancer, bladder cancer, prostate cancer, breast cancer, ovarian cancer, kidney cancer, skin cancer, fibrosarcoma, and melanoma. It may be one or more selected, but is not limited thereto.

In addition, the vaccine composition is formulated for oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, and nasal formulations such as drip or spray, and sterile injectable solutions, respectively, according to a conventional method. It can be formulated and used in a form. In the case of formulation, it can be prepared using diluents or excipients such as generally used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and these solid preparations include at least one excipient such as starch, calcium carbonate, and sucrose in the lecithin-like emulsifier. Alternatively, it can be prepared by mixing lactose or gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc can also be used. As liquid preparations for oral administration, suspensions, solvents, emulsions, syrups, etc. can be used. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, fragrances, preservatives, etc. Can be included. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous agents, suspensions, emulsions, and lyophilized formulations. As the non-aqueous preparation and suspension, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used, but are not limited thereto. Penetrants suitable for formulations for intranasal administration are generally known to those of skill in the art. Such suitable formulations are preferably formulated to be sterile, isotonic and buffered for stability and compliance. Formulations for intranasal administration are also formulated to stimulate mucus secretion in several respects to maintain normal ciliary function, and suitable formulations are preferably isotonic, slightly buffered formulations maintaining a pH of 5.5 to 6.5, most preferably Antimicrobial preservatives and suitable drug stabilizers.

The vaccine composition of the present invention may be administered orally or parenterally according to a desired method (eg, intramuscularly, intravenously, subcutaneously, intraperitoneally or topically applied), but is not limited thereto. In addition, the dosage of the composition varies according to the weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and severity of disease of humans or animals.

The present invention also provides a pharmaceutical composition for treating cancer comprising the attenuated Salmonella mutant of the present invention as an active ingredient.

The pharmaceutical composition for cancer treatment of the present invention contains a Salmonella mutant strain expressing SLURP-1 antigen having anti-proliferative activity against Salmonella attenuated by gene deletion as an active ingredient, and the Salmonella mutant strain is Salmonella mutant strains expressing the SLURP-1 antigen can migrate to cancer cells and induce the death of cancer cells through the anti-proliferative activity of SLURP-1.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are only illustrative of the present invention, and the contents of the present invention are not limited to the following examples.

Materials and methods

1. Experimental material

Information on the strain, plasmid, and primer set used in the production of the Salmonella mutant strain expressing the SLURP-1 (Secreted Ly-6/uPAR-related protein-1) antigen is shown in Table 1 below.

Strains, plasmids and primer sets used in the present invention Strain/plasmid/primer Description S.Typhimurium JOL990 S. Typhimurium wild-type strain JOL910 S.Typhimurium ΔcpxR JOL911 S.Typhimurium Δlon ΔcpxR JOL1800 S. Typhimurium delivery vector, rough strain Δlon ΔcpxR ΔrfaL JOL2238 S. Typhimurium pJHL1800 harboring pJHL65::SLURP-1 E. coli BL21(DE3)pLysS F-, omp T, hsd SB (rB-, mB-), dcm , gal , λ (DE3), pLysS , Cmr (Promeaga) pJHL2237 E.coli BL21 harboring pET28+::SLURP-1 Plasmids pET28a+ IPTG-inducible expression vector; Kanamycin resistant (Novagen) pJHL65 asd + vector, PBR ori, β-lactamase signal sequence-based periplasmic secretion plasmid, 6xHis, high copy number pJHL65:: SLURP-1 Plasmid vector harboring codon optimized human SLURP-1 CDS Primers FP-SLUsal-EcoRI GAGA GAATTC ATGGCATCACGCTGGGCCGT (SEQ ID NO: 3) RP-SLUsal-BamHI GGATCC TCATAATTCAGAGTTACATA GAGA (SEQ ID NO: 4)

As for the experimental animals, BALB/c mice before and after 8 weeks of age were purchased and used from Samtaco. Mice were maintained and managed under the conditions of SPF (specific pathogen free) for the entire experimental period in accordance with the laboratory regulations, in a 12-hour cycle of day and night environment and supply of sufficient feed and drinking water. For the tumor cell inoculation experiment, CT26 (ATCC; CRL-2638), a colon cancer cell line derived from BALB/c, was used. In addition, the HeLa cell line and the Caco2 cell line were used in the laboratory stock (stock). For tumor-bearing mice, CT26 tumor cells were used subcutaneously (10 ⁶ cells/50 µl) on the lower back of the test animal. After 3 weeks after tumor cell transplantation, it was confirmed that a tumor having a size of 100 to 150 mm ³ was expressed at the inoculation site, and then used for experiments.

2. Experiment to confirm tumor resilience of JOL1800 Salmonella strain

The invasiveness, in vivo and in vitro toxicity, and tumor resilience of the JOL1800 Salmonella strain were confirmed. Invasion assay was carried out using HeLa, Caco2, and CT26 cells. Each cell monolayer was infected with about 40 MOI (Multiplicity of infection) Salmonella strains JOL1800 and JOL901, respectively. After 1 hour, the cell layer was washed 3 times with PBS, and then treated with 100 µg/ml gentamicin (Sigma-Aldrich, USA) to kill the Salmonella strain remaining in the medium and cultured for an hour. To count the number of Salmonella bacteria invading cells, JOL1800 invaded each cell after one hour of antibiotic treatment, treated with Triton X-100 (0.25%), lysed, and cultured in 1.5% LB solid medium for 24 hours. The number of strains and JOL901 strains were confirmed. In addition, the degree of Salmonella-induced apoptosis was observed in Caco2 cells using an annexin V dead cell apoptosis kit (Invitrogen, Eugene, Oregon, USA), and then confirmed using an IncuCyte live imaging system. In addition, cells that died from infection with Salmonella field strains, JOL910, JOL911, and JOL1800, respectively, were analyzed by fluorescent assisted cell sorting (FACS). In vivo toxicity was confirmed in four groups of BALB/c mice. Each group was inoculated with PBS (control), JOL911 (1x10 ⁶ CFU/mice), JOL1800 (harboring pJHL65 vector only) and JOL2338 (harboring therapeutic vector pJHL65::SLURP-1) (1x10 ⁷ CFU/mice) respectively. Body weight was measured every day for 18 days (in the case of JOL911, the experimental animals died when inoculated at 1×10 ⁷ CFU/mice). In addition, in order to confirm the propensity of tumor localization when inoculating the JOL1800 strain, the tumor research model test animals with CT26 tumors were divided into two groups, and the strain was inoculated. After 3 and 6 days, the tumor site and the spleen were The number of detected strains was compared.

3. Analysis of biological activity of recombinant SLURP-1

The effects of the recombinant SLURP-1 protein on inhibiting cell proliferation and inducing apoptosis were measured in vitro . To confirm the degree of inhibition of cell proliferation, Caco-2, HeLa, and CT26 were treated with recombinant SLURP-1 protein, followed by MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide). Cell proliferation was analyzed. Each of the cells was cultured in a 96-well cell culture plate at about 10,000 per well and treated with SLURP-1 protein at different concentrations (0, 10, 50, 100 and 200 nmol/well). The number of cells that survived after 24 hours incubation was stained using MTT reagent and measured at a wavelength of 540 nm. In addition, the effect of cell cycle arrest of the recombinant protein was compared with the control through flow cytometry by treating the recombinant protein in HeLa cells and staining with PI (Propidium iodide). The number of cells was measured at the G1, S, and G2/M stages of the cell cycle, respectively, and the degree of apoptosis was also analyzed in HeLa cells using the FITC Annexin V/Dead Cell Apoptosis kit (Invitrogen, Eugene, Oregon, USA). After treatment with the recombinant protein, changes in cell density and morphology were observed under a microscope.

4. In vivo Protein secretion

The expression level of the recombinant antigen SLURP-1 expressed in Salmonella in the body of the experimental animals was measured in mice bearing CT26 tumors. The JOL2238 strain was inoculated intraperitoneally into four groups of mice at a concentration of 1x10 ⁷ CFU/mice, and on the 3rd, 6th, 9th, and 12th days, the experimental animals were sacrificed to isolate and homogenize the tumor cells (40% amplitude, 5 seconds on and off cycles) centrifuged at 1,000 rpm for 5 minutes. As for the supernatant, the concentration of the recombinant protein in the supernatant was measured using an ELISA (enzyme-linked immunosorbent assay) analysis. In addition, the presence of the protein was confirmed using SDS-PAGE and Western blot, and immunohistochemical observation analysis was performed to confirm the level of expression of the recombinant antigen SLURP-1 in tumor cells.

5. In vivo tumor regression

The anticancer effect of JOL2338 expressing the recombinant protein SLURP-1 was analyzed using four groups of CT26 tumor-expressing mice. In each group, mice were intraperitoneally inoculated with PBS, JOL911 (1x10 ⁶ CFU/mice), JOL1800 with the empty pJHL65 vector and JOL2338 (therapeutic vector pJHL65::SLURP-1) (1x10 ⁷ CFU/ml). Nine days after inoculation, a second inoculation (booster inoculation) was made with the same dose and route. The tumor volume (volume = width ² x length / 2) was measured at 7 days intervals for 3 weeks after inoculation.

6. Statistical processing

For comparison of experimental values between all groups, significance was verified using the Mann-Whitney method, a nonparametric test among SPSS 12 programs, and p=0.05 was used as the criterion.

Example 1. Analysis of invasiveness of attenuated Salmonella mutants

As a result of confirming the intracellular invasion ability of the attenuated Salmonella mutant strains (JOL911 and JOL1800 strains) in HeLa, Caco2, CT26 cells, attenuated Salmonella mutant strains for three cell lines compared to the outdoor strain (WT) as disclosed in FIG. 2A Although invasiveness was partially reduced, it was observed that the intracellular invasion ability of about 70% on average was maintained. In addition, when the attenuated Salmonella strain was treated with Caco2 cells, it was observed that the rate of apoptosis was significantly reduced compared to that of the outdoor strain infection, confirming the safety (low cytotoxicity) of the attenuated strain (Figs. 2B, 2C). ).

Example 2. In vivo toxicity and tumor yield analysis of attenuated Salmonella mutant strains

After inoculation of the attenuated Salmonella mutant strains (JOL911 and JOL1800 strains) to the experimental animals, as a result of analyzing the weight change of the experimental animals, no dead experimental animals were identified, and the weight change seemed to decrease until 4 days after inoculation. It recovered to the normal range after about 1 week (Fig. 3A). In addition, the JOL1800 strain showed significant tumor resistance. Three days after inoculation, the number of JOL1800 strains observed in the tumor and spleen was similarly confirmed, but 6 days after inoculation, the number of JOL1800 observed in the tumor was significantly increased compared to the number of JOL1800 observed in the spleen (Fig. 3B).

Example 3. Analysis of biological properties of SLURP-1 protein

Caco2, HeLa and CT26 were used to confirm the biological properties of the recombinant SLURP-1 protein. In order to investigate the degree of cell proliferation inhibition, various concentrations of recombinant protein were treated in each cell line. At a concentration of 200 nmol/well, the most significant effect of inhibiting cell proliferation was confirmed (Fig. 4A). In addition, the number of cells was analyzed at the G1, S and G2/M stages of the cell cycle, respectively. As a result, a significant decrease in the number of cells (from 64% to 57%) was observed in the G1 stage of the cell cycle, and a significant increase in the number of cells (from 13% to 18%) was observed in the S stage (FIG. 4B).

Example 4. Analysis of anticancer effect of Salmonella mutant strain expressing SLURP-1 protein

In order to maximize the anticancer effect of the SLURP-1 protein, the ligand, nAChRs, must act on the surface of tumor cells abundantly distributed. Therefore, the ability of the Salmonella mutant to invade the space outside the cells of the tumor tissue is essential. In the present invention, the efficient secretion of the SLURP-1 recombinant protein was promoted by the Bla signal sequence, and the expression efficiency was confirmed through Western blot analysis (Fig. 1B). In addition, the expressed SLURP-1 protein was observed 9 days after the first inoculation of the Salmonella mutant strain (Figs. 5A, 5B), and the anticancer effect of JOL2338 ( S. Typhimurium pJHL1800 harboring pJHL65::SLURP-1) expressing the recombinant protein SLURP-1 Was observed in CT26 tumor expressing mice. A significant decrease in tumor cell size was observed in all mice inoculated with the Salmonella strain (FIG. 6A), but in tumor-expressing mice inoculated with the JOL2338 mutant strain, the tumor size was significantly reduced compared to other treatment groups (FIG. 6B).

<110> INDUSTRIAL COOPERATION FOUNDATION CHONBUK NATIONAL UNIVERSITY <120> Cancer vaccine composition comprising attenuated Salmonella mutant expressing SLURP-1 as effective component <130> PN19041 <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 312 <212> DNA <213> Homo sapiens <400> 1 atggcctctc gctgggctgt gcagctgctg ctcgtggcag cctggagcat gggctgtggt 60 gaggccctca agtgctacac ctgcaaggag cccatgacca gtgcttcctg caggaccatt 120 acccgctgca agccagagga cacagcctgc atgaccacgc tggtgacggt ggaggcagag 180 taccccttca accagagccc cgtggtgacc cgctcctgct ccagctcctg tgtggccacc 240 gaccccgaca gcatcggggc cgcccacctg atcttctgct gcttccgaga cctctgcaac 300 tcggaactct ga 312 <210> 2 <211> 103 <212> PRT <213> Homo sapiens <400> 2 Met Ala Ser Arg Trp Ala Val Gln Leu Leu Leu Val Ala Ala Trp Ser 1 5 10 15 Met Gly Cys Gly Glu Ala Leu Lys Cys Tyr Thr Cys Lys Glu Pro Met 20 25 30 Thr Ser Ala Ser Cys Arg Thr Ile Thr Arg Cys Lys Pro Glu Asp Thr 35 40 45 Ala Cys Met Thr Thr Leu Val Thr Val Glu Ala Glu Tyr Pro Phe Asn 50 55 60 Gln Ser Pro Val Val Thr Arg Ser Cys Ser Ser Ser Cys Val Ala Thr 65 70 75 80 Asp Pro Asp Ser Ile Gly Ala Ala His Leu Ile Phe Cys Cys Phe Arg 85 90 95 Asp Leu Cys Asn Ser Glu Leu 100 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 gagagaattc atggcatcac gctgggccgt 30 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gagaggatcc tcataattca gagttacata 30 <210> 5 <211> 312 <212> DNA <213> Artificial Sequence <220> <223> codon-optimized SLURP-1 <400> 5 atggcatcac gctgggccgt tcagttgctg ttggttgcag cttggagcat gggctgcggg 60 gaggctctga aatgctatac atgcaaggaa ccgatgacct cagctagttg ccgcactatc 120 acgcgttgta aacctgaaga tacggcctgc atgacaacct tggtcactgt tgaggcggaa 180 taccccttca accaaagccc cgtagtgacg cggagttgct cctcgtcgtg tgtagcaaca 240 gatcctgact cgattggtgc cgctcacctt atcttttgtt gttttcggga tttatgtaac 300 tctgaattat ga 312

Claims (7)

delete delete delete delete The gene encoding the SLURP-1 (Secreted Ly-6/uPAR-related protein-1) antigen consisting of the Bla (β-lactamse) signal sequence and the amino acid sequence of SEQ ID NO: 2 in which the lon , cpxR , rfaL and asd genes are deleted ; And asd gene; Salmonella typhimurium transformed with a recombinant vector comprising a ( Salmonella typhimurium ) cancer vaccine composition comprising a mutant as an active ingredient. The method of claim 5, wherein the cancer is one selected from the group consisting of colon cancer, colon cancer, cervical cancer, stomach cancer, liver cancer, lung cancer, bladder cancer, prostate cancer, breast cancer, ovarian cancer, kidney cancer, skin cancer, fibrosarcoma, and melanoma. Cancer vaccine composition, characterized in that the above. The gene encoding the SLURP-1 (Secreted Ly-6/uPAR-related protein-1) antigen consisting of the Bla (β-lactamse) signal sequence and the amino acid sequence of SEQ ID NO: 2 in which the lon , cpxR , rfaL and asd genes are deleted ; And asd gene; Salmonella typhimurium transformed with a recombinant vector comprising a ( Salmonella typhimurium ) a pharmaceutical composition for cancer treatment comprising a mutant as an active ingredient.

Images