KR102161623B1 - Composition for Osteogenic Differentiation or Osteogenesis Comprising Inhibitor of CUEDC2 - Google Patents

Abstract

The present invention relates to a composition for promoting bone differentiation or bone regeneration comprising a CUEDC2 inhibitor as an active ingredient, a pharmaceutical composition for preventing or treating bone diseases, and a method for screening a substance for preventing or treating bone diseases, the CUEDC2 inhibitors can induce differentiation of osteoblasts and calcification of the matrix to regenerate bone, thereby repairing bone damage.

Description

Composition for promoting bone differentiation or bone regeneration comprising a CUEDC2 inhibitor as an active ingredient {Composition for Osteogenic Differentiation or Osteogenesis Comprising Inhibitor of CUEDC2}

The present invention relates to a composition for inducing the differentiation of osteoblasts by inhibiting the expression or activity of CUEDC2, and specifically, a composition for promoting bone differentiation or bone regeneration comprising the CUEDC2 inhibitor as an active ingredient, and prevention of bone disease comprising the same or It relates to a therapeutic pharmaceutical composition, a method for screening a substance for preventing or treating bone diseases.

Bone is a hard tissue that forms the skeleton of a living body, supports the soft tissue and weight of the human body, surrounds internal organs to protect from external shocks, and is a storage of ions such as calcium and other essential minerals such as phosphorus and magnesium in the body. It functions to regulate and maintain. These bones include cells that make up bone tissue such as osteoprogenitor cells, osteoblasts, and osteoclasts, and bone sialoprotein, osteocalcin, and collagen I type. ), etc. It is composed of matrix proteins that make up the bone matrix. In the case of grown-up adults, the process of generation and absorption in which old bones are removed and replaced with new bones is very dynamic, and bone is regenerated continuously, which is called bone remodeling. Bone turnover, which removes old bones and replaces them with new bones, is essential to recovering microscopic damage to bones caused by growth and stress, and maintaining proper bone function.

It is known that two types of cells are largely involved in bone remodeling. One of the two cells is an osteoblast that produces bone, and the other is an osteoclast that destroys bone. Osteoblasts secrete signaling molecules or proteins to induce calcification of the matrix around the cells to form bone. Small scratches or cracks on the bone are not a big problem because they are regenerated to their original tissue state due to the presence of these osteoblasts. However, if extensive bone tissue is damaged by external factors such as traffic accidents, falls, or etiology such as diabetes, natural bone regeneration by osteoblasts becomes impossible, and surgical treatment and active treatment to promote bone regeneration must be performed.

Current bone regeneration treatments include transplanting bone tissue to the damaged area (autologous bone graft, xenograft, synthetic bone graft), or artificial bone made of metal, polymer, or ceramic. However, since autologous bone tissue transplantation has limitations in the amount of damage or collection of the patient's body, most of the researches on improving the components of synthetic bones or artificial bones customized to individuals are being actively conducted. However, these bone substitutes differ in composition from the original bone tissue, and the surrounding cells do not enter the bone substitute, so blood vessels important for nutrition and oxygen supply are not created. Recently, bone regeneration studies using secreted proteins such as BMP2 (bone morphogenetic protein 2) or PTH (parathyroid hormone), and transcription factors such as Runx2 (runt-related transcription factor 2) have been known.

Korean Patent No. 1570832 Korean Patent Registration No.1762580

In order to solve the above problems, an object of the present invention is to provide a composition for promoting bone differentiation or bone regeneration comprising an inhibitor of CUEDC2 expression or activity as an active ingredient.

Here, the expression or activity inhibitor of CUEDC2 may be at least one selected from the group consisting of antisense oligonucleotides, siRNAs, and shRNAs complementarily binding to CUEDC2 mRNA. In this case, the shRNA may be a retroviral vector or an adenovirus vector system.

The expression or activity inhibitor of CUEDC2 may be one having an action of promoting bone formation, promoting bone differentiation, or inducing matrix calcification.

The composition may further include bone sialoprotein, osteocalcin, or bone morphogenetic protein 2 (BMP2) derived from human or rat.

In addition, an object of the present invention is to provide a pharmaceutical composition for preventing or treating bone diseases comprising the composition for promoting bone differentiation or bone regeneration as an active ingredient.

Here, the bone disease is a group consisting of bone defects, osteoporosis, osteomalacia, osteopenia, bone insufficiency, bone formation disorders, osteoarthritis, bone necrosis, degenerative bone disease, osteoarthritis, metastatic bone cancer, bone tumors, periodontal disease, fractures and Paget's disease It may be selected from.

In addition, the present invention comprises the steps of (a) contacting a test substance to be analyzed with a cell containing the CUEDC2 gene or CUEDC2 protein; (b) measuring the expression level of the CUEDC2 gene, the expression level of the CUEDC2 protein, or the activity of the CUEDC2 protein; And (c) in the measurement result of step (b), when the test material decreases the expression level of the CUEDC2 gene, the expression level of the CUEDC2 protein, or the activity of the CUEDC2 protein, the test material is used as a substance for preventing or treating bone diseases. An object of the present invention is to provide a method for screening a substance for preventing or treating bone diseases, including the step of determining.

Here, the test substance may be selected from the group consisting of antisense oligonucleotide, siRNA, shRNA, miRNA, ribozyme, DNAzyme, PNA, antibody, aptamer, natural extract, and synthetic compound.

The measurement of step (b) is reverse transcriptase-polymerase chain reaction, real time-polymerase chain reaction, western blot, northern blot, ELISA (enzyme linked immunosorbent assay), radioimmunoassay, radioimmunodiffusion, immunoprecipitation assay, and immunohistochemical analysis (immunohistochemical analysis) It may be selected from the group consisting of.

<Composition for promoting bone differentiation or bone regeneration>

According to one embodiment of the present invention, the present invention provides a composition for promoting bone differentiation or bone regeneration, comprising an inhibitor of CUEDC2 expression or activity as an active ingredient.

CUEDC2 (CUE domain-containing protein 2) is a protein related to ubiquitination containing the CUE domain, although its function has not been clearly identified. It acts in a variety of ways from inflammatory cytokine expression, cell proliferation, and free radical production. It is known.

As a result of trying to develop a new biomolecule that induces the differentiation of osteoblasts, the present inventors have found that it is possible to prevent or treat bone diseases by inducing the differentiation of osteoblasts and promoting calcification of the matrix by inhibiting the expression of the CUEDC2 gene or protein. Confirmed. Accordingly, in the present invention, an inhibitor that inhibits the expression or activity of CUEDC2 was applied to induce the differentiation of osteoblasts and promote calcification of the matrix.

The CUEDC2 gene may include a polynucleotide composed of any sequence known in the art, and may be a polynucleotide composed of the nucleotide sequence of SEQ ID NO: 1.

The inhibitor that inhibits the expression or activity of CUEDC2 (hereinafter referred to as'CUEDC2 inhibitor') refers to a substance that reduces the mRNA expression or protein activity of CUEDC2. More specifically, any substance that reduces the expression or activity of CUEDC2 by reducing the expression of CUEDC2 at the transcriptional level or interfering with its activity through a method such as acting directly on CUEDC2 or indirectly acting on its ligand or receptor. It may include. The substance that inhibits CUEDC2 expression may be used without limitation in its form, such as a compound, nucleic acid, peptide, virus, or vector containing the nucleic acid capable of inhibiting the expression or activity of CUEDC2 by targeting CUEDC2. Examples of substances that inhibit CUEDC2 expression include antisense oligonucleotides, siRNA, shRNA, miRNA, ribozyme, DNAzyme, and peptide nucleic acids (PNA) that specifically bind to CUEDC2 mRNA and inhibit the expression of CUEDC2 mRNA. Can be mentioned. Examples of substances that inhibit CUEDC2 activity include antibodies or antigen-binding fragments thereof, aptamers, and compounds that specifically bind to CUEDC2 protein and inhibit the activity of CUEDC2 protein. Preferably, the CUEDC2 inhibitor according to the present invention may be at least one selected from the group consisting of antisense oligonucleotides, siRNAs, and shRNAs that bind complementarily to CUEDC2 mRNA.

The "antisense oligonucleotide" refers to DNA, RNA, or derivatives thereof that contain a nucleic acid sequence that is complementary to a specific mRNA sequence. By binding to a complementary sequence in the mRNA, translation of the mRNA into a protein is performed. It has an inhibitory effect.

The "siRNA (small interfering RNA)" refers to a nucleic acid molecule capable of inducing RNA interference through cleavage of a specific mRNA, and refers to a short double-stranded RNA having a size of 21 to 25 nucleotides. The siRNA according to the present invention may have a structure in which a sense strand (a sequence corresponding to a CUEDC2 mRNA sequence) and an antisense strand (a sequence complementary to a CUEDC2 mRNA sequence) are located on opposite sides to form a double chain, and self-complementary (self -complementary) may have a single-chain structure with sense and antisense strands.

The "shRNA (short hairpin RNA)" is a double-stranded RNA that binds complementarily to a specific mRNA like siRNA and cuts the mRNA by forming a hairpin structure palindromicly linked by a loop region. It was developed to overcome the shortcomings of siRNA such as high cost during siRNA biosynthesis and short-term maintenance of RNA interference effects due to low cell transfection efficiency. shRNA is a retroviral vector, adeno from the promoter of RNA polymerase III. A virus (adenoviral vector), a lentivirus (lentivirus vector), a plasmid expression vector (plasmid expression vector) system, such as using a system that is introduced into the cell and expressed. Preferably, the shRNA may be one using a retroviral vector or an adenovirus vector system.

The composition for promoting bone differentiation or bone regeneration comprising a CUEDC2 inhibitor according to the present invention reduces the expression of CUEDC2 mRNA or protein and reduces the activity of the expressed protein, thereby promoting excellent bone formation, promoting bone differentiation, or inducing calcification. I can. In order to further enhance this effect, the composition may further include a protein related to bone formation together with a CUEDC2 inhibitor. The bone formation-related protein is bone sialoprotein, which helps bone formation by osteoblasts by increasing expression by transcription factors such as Runx2 and Osterix during the differentiation of osteoblasts. It may be osteocalcin or may be a bone morphogenetic protein family, a cytokine that induces bone formation. These proteins can be derived from humans or mice.

<Pharmaceutical composition for preventing or treating bone disease>

According to another embodiment of the present invention, the present invention provides a pharmaceutical composition for preventing or treating bone diseases comprising an inhibitor of expression or activity of CUEDC2 as an active ingredient.

Since the CUEDC2 expression or activity inhibitor is the same as described above, it is omitted to avoid redundant description.

The pharmaceutical composition according to the present invention includes bone defects, osteoporosis, osteomalacia, osteopenia, bone insufficiency, bone formation disorders, osteoarthritis, bone necrosis, degenerative bone disease, osteoarthritis, metastatic bone cancer, bone tumors, periodontal disease, fractures, Paget's disease, etc. It can be used to prevent or treat bone disease.

Such pharmaceutical compositions may further include pharmaceutically acceptable additives, wherein pharmaceutically acceptable additives include starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, lactose, Mannitol, syrup, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, Opadry, sodium starch glycolate, lead carnauba, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, calcium stearate, Sucrose, dextrose, sorbitol, talc, and the like can be used. The acceptable additive may be included in an amount of 0.1 to 90 parts by weight based on the pharmaceutical composition.

In addition, the pharmaceutical composition may be parenterally administered (for example, intravenously, subcutaneously, intraperitoneally or topically applied) or orally according to a desired method. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations, suppositories, and the like. Liquid formulations for oral administration include suspensions, liquid solutions, emulsions, syrups, etc., and various excipients, such as wetting agents, sweeteners, fragrances, preservatives, etc., may be included in addition to water and liquid paraffin, which are commonly used simple diluents. have. At this time, the dosage range varies according to the patient's weight, age, sex, health status, diet, administration time, administration method, excretion rate, and severity of disease. The daily dosage of the pharmaceutical composition according to the present invention is 0.5 mg/kg to 70 mg/kg, and may be administered once to several times a day.

<Method of screening substances for preventing or treating bone diseases>

According to another embodiment of the present invention, the present invention provides a method for screening a substance for preventing or treating bone diseases. Specifically, the screening method includes the steps of: (a) contacting the cell containing the CUEDC2 gene or CUEDC2 protein with a test substance to be analyzed; (b) measuring the expression level of the CUEDC2 gene, the expression level of the CUEDC2 protein, or the activity of the CUEDC2 protein; And (c) in the measurement result of step (b), when the test material decreases the expression level of the CUEDC2 gene, the expression level of the CUEDC2 protein, or the activity of the CUEDC2 protein, the test material is used as a substance for preventing or treating bone diseases. It proceeds to the determining step.

In step (a), the test substance to be analyzed is brought into contact with the cells expressing CUEDC2. The cells expressing CUEDC2 include cells that endogenous CUEDC2 or cells transiently overexpressing CUEDC2, and are preferably osseous tissue-derived cells. The "test substance" means an unknown substance used in screening to test whether it affects the expression of CUEDC2. The test substance may be an antisense oligonucleotide, siRNA, shRNA, miRNA, ribozyme, DNAzyme, PNA, antibody, aptamer, natural extract, synthetic compound, and the like.

In the step (b), the expression level of CUEDC2 mRNA or protein and the activity of CUEDC2 protein are analyzed in the cells treated with the test substance. At this time, reverse transcriptase-polymerase chain reaction, real time-polymerase chain reaction, western blot, northern blot, enzyme linked immunosorbent assay (ELISA) ), radioimmunoassay (RIA), radioimmunodiffusion, immunoprecipitation assay, immunohistochemical analysis, etc., the expression level or activity can be measured and analyzed. .

In the step (c), when the test material reduces or inhibits the expression level of CUEDC2 mRNA, the expression level of CUEDC2 protein, or the activity of CUEDC2 protein according to the measurement result, the test material is determined as a treatment for bone disease.

The composition containing the CUEDC2 inhibitor according to the present invention induces the efficient differentiation of osteoblasts, unlike the conventional method of replacing the lost bone with artificial bone in case of bone loss due to a traffic accident, a fall, etc., differentiation of osteoblasts And it is possible to directly induce calcification of the substrate to regenerate the bone, thereby repairing the lost bone. Accordingly, it is possible to significantly reduce the cost and duration required to repair the bone damage. On the other hand, normal artificial bones may require reoperation because bone adhesion between the artificial bone and the patient's bone is not properly achieved due to an unexpected inflammatory reaction at the treatment site. However, this problem occurs when the CUEDC2 inhibitor according to the present invention is used. Does not occur. In addition, by treating the composition containing the CUEDC2 inhibitor according to the present invention during an implant procedure, it is possible to prevent the lack of bone adhesion due to poor bone quality and insufficient bone mass of the alveolar bone.

Figure 1 is an experimental result for one embodiment of the present invention: (a) a graph measuring the expression levels of CUEDC2, bone cyanoprotein (Bsp), and osteocalcin (Oc) mRNA according to osteoblast differentiation by qPCR (b ) This is a photograph of measuring the expression levels of CUEDC2, bone cyanoprotein (Bsp), and osteocalcin (Oc) proteins according to osteoblast differentiation by Western blot.
2 is an experimental result for an embodiment of the present invention, a graph measuring the expression level of bone cyanoprotein (Bsp) and osteocalcin (Oc) mRNA by qPCR when CUEDC2 is overexpressed.
3 is an experimental result for an embodiment of the present invention, graphs and photographs measuring the degree of (a) ALP staining, (b) AR staining, and (c) ectopic bone formation in order to confirm the ability to inhibit calcification upon overexpression of CUEDC2. .
4 is an experimental result for an embodiment of the present invention, when CUEDC2 expression is reduced, the expression level of bone cyanoprotein (Bsp) and osteocalcin (Oc) mNRA is measured by qPCR.
5 is an experimental result for an embodiment of the present invention, in order to confirm the ability to induce calcification when the expression of CUEDC2 is reduced, (a) ALP staining, (b) AR staining, and (c) measuring the degree of skull bone formation One is a graph and a picture.

Hereinafter, a composition for promoting bone differentiation or bone regeneration according to the present invention will be described in more detail with reference to the accompanying drawings. However, these descriptions are provided by way of example only to aid understanding of the present invention, and the scope of the present invention is not limited by these exemplary descriptions.

1. Materials and methods

1-1. Cell culture and viral infection

MC3T3-E1 cells capable of differentiating into osteoblasts were used. Cells were cultured in α-MEM (α-minimal essential medium) medium containing 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 mg/mL streptomycin.

In order to induce differentiation in gastric cells, cells were cultured with 50 ㎍/mL of ascorbic acid, 5 mM beta-glycerophosphate, and 250 ng/mL BMP for 1 to 2 weeks. Cultured in.

For viral infection, osteoblasts are cultured in a medium containing 10% FBS for 24 hours, and then adenovirus(ad)-CUEDC2 that overexpresses CUEDC2 or ad-shRNA(sh)CUEDC2 that reduces the expression of CUEDC2 is added to serum-free ( serum-free) medium. After 4 hours, 20% FBS was added, and after 20 hours, it was replaced with a medium capable of differentiating into osteoblasts. ad-GFP (green fluorescent protein) was used as a control.

1-2. RNA isolation and qPCR analysis

After culturing MC3T3-E1 cells in an osteogenic medium or a general medium for a specified time, total RNA (total RNA) was extracted using Trizol reagent.

cDNA was synthesized from 1.5 μg of RNA using random primer (0.2 μg), MMLV (200 U), dNTP (0.5 mM), and RNAsin (40 U). PCR performance conditions are as follows: After 5 minutes at 95 °C, 40 cycles of 95 °C, 55 °C, and 72 °C were repeated for 30 seconds each, and then finally extended at 72 °C for 7 minutes.

For qPCR analysis, the results were analyzed using the StepOnePlusTM Real-Time PCR System. β-Actin was used as an internal control.

1-3. Western blot analysis

Lysis buffer was added to the culture vessel, and then left on ice to harvest cell lysates and centrifuged at 4° C. and 12,000 rpm for 15 minutes to obtain a supernatant containing total protein.

Protein concentration was normalized with bovine serum albumin (BSA) and quantified using a Lowry protein assay reagent.

Protein samples were transferred to a PVDF membrane by electrophoresis on a 10% or 8% SDS-PAGE gel. Blocks non-specific binding of transferred proteins in Tris buffer containing 5% fat-free dry milk (skim milk), and CUEDC2, Runx2, Osx, Actin antibodies and each secondary antibody for specific analysis (secondary antibody).

The presence of each protein was visualized using an enhanced chemiluminescence reagent and a LAS-4000 mini imager.

1-4. Alkaline phosphatase (ALP) staining

MC3T3-E1 cells cultured for 5 days in each experimental condition were washed with PBS and then fixed with 4% formalin for 15 minutes. The remaining formalin was washed 3 times with distilled water to remove, and observed by staining for 20 minutes with BCIP®/NBT Liquid Substrate System.

For quantitative analysis, it was shown using the image J program.

1-5. Alizarin red (AR) staining

MC3T3-E1 cells cultured for 12 days in each experimental condition were washed with PBS and then fixed with 70% ethanol for 1 hour. The remaining ethanol was removed by washing with distilled water three times, and stained with an alizarin red solution for 10 minutes and observed.

For quantitative analysis, the stained cells were bleached using 10% cetylpyridinium chloride, and absorbance was measured at a wavelength of 540 nm using a multiplate reader.

1-6. Animal surgery and histological and radiological analysis

The animals used in the experiment were rat C57BL/6, and were purchased from Damul Science, and all animal experiments were conducted in accordance with the regulations of the Animal Experimental Ethics Committee of Chonnam National University (Animal Experiment Number: CNU IACUC-YB-2017-73).

In order to investigate the bone formation ability of CUEDC2 gene, an ectopic bone formation model and a rat skull injury model were used.

In the ectopic bone formation model, a mixture of 3 µg of BMP2 and ad-GFP, or a mixture of 3 µg of BMP2 and ad-CUEDC2, respectively, was injected into a collagen sponge, and then implanted subcutaneously in a 6-week-old C57BL/6 mouse for 4 weeks.

In the rat skull injury model, 6-week-old C57BL/6 mice were anesthetized and perforated in the rat skull with a 5 mm diameter trephine bur, after which ad-GFP alone, BMP 2500 ng and ad-GFP mixed. Alternatively, ad-shCUEDC2 alone, a mixture of 2500 ng of BMP and ad-shCUEDC2 was injected into a collagen sponge, respectively, and implanted for 4 weeks. Thereafter, all animal experimental samples were harvested, fixed in 4% paraformaldehyde, demineralized in 10% EDTA, embedded in paraffin, stained with hematoxylin-eosin, and analyzed histologically.

In addition, animal samples were scanned with a high-resolution microcomputerized tomography (Skyscan1172, Bruker) for radiological analysis. An aluminum filter having a thickness of 0.5 mm was used as the scanning condition, the voltage and current of the X-ray generator were set to 50 ㎸ and 200 ㎂, and the size of the unit pixel was set to 30 µm. Three-dimensional images of bones were obtained using the CTvol program using the obtained two-dimensional photographs, and bone volume and bone mineral density were analyzed using the CTAnalyzer program.

For quantitative analysis, bone volume was measured to observe the change in the amount of regenerated bone for each group, and bone density indicating bone strength was measured through qualitative analysis to compare and analyze the bone quality of each control group and the experimental group.

1-7. Statistical analysis

All experimental values were expressed as mean and standard deviation. Results were analyzed using ANOVA Tukey test or T test, and statistical significance was verified within p <0.05.

2. Experiment result

2-1. Analysis of changes in expression of CUEDC2 gene according to osteoblast differentiation

In order to investigate the expression level of CUEDC2 during the differentiation process of osteoblasts, the cells were cultured for 2, 4, and 6 days in bone formation medium, respectively, and then confirmed by qPCR and Western blot.

As a result of the experiment, as osteoblast differentiation progressed, osteoblast marker factors such as bone sialoprotein (Bsp), osteocalcin (Oc), Runx2, and Osxia increased, and at the same time, the mRNA of CUEDC2 And the degree of protein expression decreased. This indicates that CUEDC2 is related to osteoblast differentiation (FIG. 1).

2-2. Analysis of osteoblast differentiation and bone formation degree when CUEDC2 is overexpressed

To investigate the effect of CUEDC2 on osteoblast differentiation function, wild-type CUEDC2 plasmid vector (manufactured by ORIGENE, CUEDC2 Mouse Tagged ORF Clone, #MR216274) and adenovirus (ad)-CUEDC2 (manufactured by VECTOR BIOLABS, Ad-GFP-m-) CUEDC2, #ADV-256367) was used to overexpress CUEDC2 and then an experiment was performed.

The wild-type CUEDC2 plasmid vector was transfected by concentration using Lipofectamine 2000, and then cultured in bone formation medium for 3 days to evaluate the expression level of bone sialoprotein (Bsp) and osteocalcin (Oc) mRNA by qPCR. As a result, upon overexpression of CUEDC2, the expression of bone sialoprotein and osteocalcin, which are marker genes for osteoblasts, decreased (FIG. 2).

In order to analyze the ALP activity, which is an early marker of osteogenic differentiation, or the degree of mineral deposition, which is a late marker, cells were overexpressed with adenovirus CUEDC2 (ad-CUEDC2), and then cultured in osteogenic medium for 6 and 12 days, respectively. As a result, both ALP staining and AR staining showed that the degree of staining decreased as CUEDC2 expression increased (Fig. 3 a and b).

In addition, in vivo ectopic bone formation experiments were performed to evaluate the effect of CUEDC2 on bone regeneration directly. To this end, BMP2 and ad-GFP (control group) or BMP2 and ad-CUEDC2 (experimental group) were added to a collagen sponge, which was implanted on the back of a mouse, and the bone formation level was measured by microcomputerized tomography (μ-CT) and tissue It was evaluated through staining. As a result, bones of a certain shape were well formed in the mice transplanted with the control group, but bones were partially formed in the mice transplanted with the experimental group. In the experimental group, the bone volume, mineral density, and bone area degree were significantly reduced compared to the control group. Through this, it was confirmed that CUEDC2 can reduce not only the degree of differentiation of osteoblasts, but also bone formation (Fig. 3c).

2-3. Induction of osteoblast differentiation and bone regeneration through inhibition of CUEDC2 expression

To evaluate bone regeneration upon inhibition of CUEDC2 expression, si-RNA CUEDC2 (manufactured by BIONEER, #1344395) and ad-shCUEDC2 (manufactured by VECTOR BIOLABS, Ad-GFP-U6-m-CUEDC2-shRNA, #shADV-) of Table 1 below. 256367) was used to perform osteoblast differentiation and rat skull injury model experiments.

Base sequence (5'> 3') si-RNA CUEDC2 sense
(SEQ ID NO: 2) GATACATCGACAACCAAGT Antisense
(SEQ ID NO: 3) ACTTGGTTGTCGATGTATC ad-shCUEDC2
(SEQ ID NO: 4) CCGGGACCATCAGAGGAGAACTTTGCTCGAGCAAAGTTCTCCTCTGATGGTCTTTTTG

si-RNA CUEDC2 was transfected for each concentration using Lipofectamine RNAiMAX and cultured in bone formation medium for 3 days to evaluate the expression levels of bone sialoprotein and osteocalcin mRNA by qPCR. As a result, it was confirmed that when the expression of CUEDC2 was suppressed, the expression of bone sialoprotein (Bsp) and osteocalcin (Oc), which are marker genes for osteoblasts, increased compared to the BMP2 treatment group (FIG. 4).

In order to analyze the ALP activity, which is an early marker of osteogenic differentiation, or the degree of mineral deposition, which is a late marker, cells were overexpressed with adenovirus CUEDC2 (ad-shCUEDC2), and then cultured in osteogenic medium for 6 and 12 days, respectively. As a result, it was observed that the ALP activity and the degree of mineral deposition were increased (Fig. 5a, b).

In order to evaluate whether the inhibition of CUEDC2 expression can directly promote bone regeneration, BMP2 and ad-GFP (control) or BMP2 and ad-CUEDC2 (experimental group) were treated with a collagen sponge, which was transplanted into a rat skull injury site. As a result, ad-shCUEDC2 treatment alone reproduced bones compared to the control group, but there was no statistical significance, and that the ad-shCUEDC2 experimental group containing BMP2 produced more bones than the control group with the naked eye through 3D images. It could be confirmed, and it was found that the bone volume was also increased through quantitative analysis (FIG. 5).

In conclusion, it was confirmed that the inhibition of CUEDC2 expression can affect bone regeneration by inducing osteoblast differentiation.

<110> INDUSTRY FOUNDATION OF CHONNAM NATIONAL UNIVERSITY <120> Composition for Osteogenic Differentiation or Osteogenesis Comprising Inhibitor of CUEDC2 <130> PN190048 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 1932 <212> RNA <213> Artificial Sequence <220> <223> CUEDC2 <400> 1 gggccccgcc tttgatctcg ttggtggggc tagggggggt gataagaact gcaccgcgcg 60 ggacaagttg ctggcggcgc ctgacggagc aggcctgtct cgtcatgtga ctcaccctct 120 cccgaggcgg ctgctgcatc cctgtgtcct caggccagct cttctggagg cttatgagtg 180 ccctgctaac gaagacccag catggagttg gagaggatcg tcggctcagc cctcctcacc 240 ttcgttcagg cacacctgcc agaggcagac ctcagtggct tggatgaagt catcttctcc 300 tatgtgcttg gggtcctgga ggacctgggc ccctcaggac catcagagga gaactttgat 360 atggaggcct tcactgaaat gatggaggct tatgtgcctg gctttgccca catccccaga 420 ggtataatag gagacatgat gcagaagctc tcggtgcagc tgagcgatgc taggaacaaa 480 gagaacctgc acccacagag ctcctgtgtc caaggtcagg tgcccatttt tccagagacc 540 ccgaggcaag ctgaaaagct cgaagaagag agcaggcctc ccgctgctcc cgggaacacc 600 ctagatgagg cagctgcggc agaagaactg ccaggagtcg atgtgctcct ggaggtcttc 660 cctacctgct ctatggagca ggcccagtgg gtgctggcca aagctcgggg ggacttggag 720 gaagctgtgc acatgctggt agagggcaag gaagaggggc ctccaggctg ggacggccca 780 agtcaggact tgcccaggcg tctcagaggc ccccaaaagg atgacttgaa gtctttcatc 840 cttcagaagt acatgatggt ggacagggcg gaggaccaga agactcaccg acctatggct 900 cccaaggagg cccccaagaa gctgatccga tacatcgaca accaagtagt gagcaccaag 960 ggagagcgat tcaaagatgt ccggaaccct gaggccgagg agatgaaggc cacatacatc 1020 aacctcaagc cggccagaaa gtaccgcttc cactgagaca gtgctggatc ctgccgagca 1080 ctgctgatcc cagagggatg cagacaccct cccatccacc ctgtcccttc tggaggccct 1140 tgctctagtg ttctattctt ggggcttcct tcaagagcac agtaaaagtg gtccaaggaa 1200 ggtatatgct cattctgctc atttctgccc ccagggcagg gaaaaaacct gtctctctga 1260 ctagttccca gcttcccgtc ccctatgcac cacgcaagaa ggggtaaaaa gctctttatt 1320 tgaaattcca gggtgggaca ggggatttca caggcctgtc aaccacaggc ccccacagtt 1380 cagtttccct atggctcagg gtcaagcccg ggctacacag tccagctgtg ctcccacccc 1440 aaggaaagtt agtcagacct gtaggttgac aaagggtgcg aagcctgcca tgtcctggag 1500 tagcaccaga gcctggtgca ggggtggttc cacgtcgatg tccacaccac gcttccgcaa 1560 gcggctcagg ctcggttcag ccacatggtg gcagtgccgc acccgcagag agcgcagcgc 1620 cgggcagtac tcggccagtg tcctgaggga ggagtatggt gatgctaggt gctgaatctc 1680 acggtctgga gggccagccc tctaaacccg cagctggctc cagcaagttc tagctttccc 1740 tccagctcag ggtctgctct tttttactgt acctaaagga aggggccagg aaggaattac 1800 agactccagg ctcatttggg gtttctggtt cttagagagt accaatccat agttccttcc 1860 agtgtttcta gattacccac cttgttgcag aaatgccaga aatcaacttt atgtgacatt 1920 tctcagtgtg tc 1932 <210> 2 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> si-RNA CUEDC2_sense <400> 2 gatacatcga caaccaagt 19 <210> 3 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> si-RNA CUEDC2_antisense <400> 3 acttggttgt cgatgtatc 19 <210> 4 <211> 58 <212> RNA <213> Artificial Sequence <220> <223> ad-shCUEDC2 <400> 4 ccgggaccat cagaggagaa ctttgctcga gcaaagttct cctctgatgg tctttttg 58

Claims (10)

It contains an inhibitor of the expression or activity of CUEDC2 (CUE domain-containing protein 2) as an active ingredient,
The CUEDC2 expression or activity inhibitor is an siRNA or shRNA that complementarily binds to CUEDC2 mRNA. A composition for promoting bone differentiation or bone regeneration.
delete The method of claim 1,
The shRNA is a composition for promoting bone differentiation or bone regeneration using a retroviral vector or an adenovirus vector system.
The method of claim 1,
The expression or activity inhibitor of CUEDC2 is a composition for promoting bone differentiation or bone regeneration that has the action of promoting bone formation, promoting bone differentiation, or inducing matrix calcification.
The method of claim 1,
The composition is a composition for promoting bone differentiation or bone regeneration further comprising a bone sialoprotein, osteocalcin or BMP2 (bone morphogenetic protein 2) derived from human or rat.
A pharmaceutical composition for the prevention or treatment of bone diseases comprising the composition for promoting bone differentiation or bone regeneration according to any one of claims 1, 3 to 5 as an active ingredient.
The method of claim 6,
The bone disease is selected from the group consisting of bone defect, osteoporosis, osteomalacia, osteopenia, bone insufficiency, bone dysplasia, osteoarthritis, bone necrosis, degenerative bone disease, osteoarthritis, metastatic bone cancer, bone tumor, periodontal disease, fracture and Paget's disease A pharmaceutical composition for the prevention or treatment of bone disease.
(a) contacting a test substance to be analyzed with cells containing CUEDC2 gene or CUEDC2 protein;
(b) measuring the expression level of the CUEDC2 gene, the expression level of the CUEDC2 protein, or the activity of the CUEDC2 protein; And
(c) If the test substance decreases the expression level of the CUEDC2 gene, the expression level of the CUEDC2 protein, or the activity of the CUEDC2 protein in the measurement result of step (b), the test material is determined as a substance for preventing or treating bone diseases. Steps to
Method for screening a substance for the prevention or treatment of bone disease comprising a.
The method of claim 8,
The test substance is selected from the group consisting of antisense oligonucleotides, siRNA, shRNA, miRNA, ribozymes, DNAzyme, PNA, antibodies, aptamers, natural extracts, and synthetic compounds to screen substances for the prevention or treatment of bone diseases. Way.
The method of claim 8,
The measurement of step (b) is reverse transcriptase-polymerase chain reaction, real time-polymerase chain reaction, western blot, northern blot, Prevention of bone disease, selected from the group consisting of enzyme linked immunosorbent assay (ELISA), radioimmunoassay, radioimmunodiffusion, immunoprecipitation assay, and immunohistochemical analysis. Or a method of screening a therapeutic substance.

Images