KR102146394B1 - Primer set for detection of serotype A Foot-and-Mouth Disease viruses and uses thereof - Google Patents

Abstract

The present invention provides a primer set for diagnosing serotype A foot-and-mouth disease virus, a composition for diagnosing serotype A foot-and-mouth disease virus comprising the primer set, a kit for diagnosing serotype A foot-and-mouth disease virus comprising the composition, and serotype A foot-and-mouth disease virus diagnosis using the primer set It's about how. Using the primer set for detecting serotype A foot-and-mouth disease virus of the present invention, it is possible to specifically detect the O serotype of foot-and-mouth disease virus with only a low concentration of a sample, and except for other pathogens, only the A serotype is specific. Can be detected. In addition, compared to the existing primer set, it can detect serotype A foot-and-mouth disease virus in the pool 1 region of Korea. In addition, if the RT-LAMP method using the primer set for detecting serotype A foot-and-mouth disease virus of the present invention is used, the sensitivity can be improved compared to the conventional PCR-based diagnostic method, and the test time can be shortened. The reaction is also possible with equipment. Therefore, it is possible to quickly and effectively diagnose serotype A foot-and-mouth disease virus in a small-sized diagnostic room or field, not a specialized diagnostic room, and thus can be easily utilized in the domestic and foreign virus diagnostic market.

Description

Primer set for detection of serotype A Foot-and-Mouth Disease viruses and uses thereof}

The present invention relates to a primer set for diagnosing serotype A foot-and-mouth disease virus and uses thereof, and more particularly, a primer set for diagnosing serotype A foot-and-mouth disease virus, a composition for diagnosing serotype A foot-and-mouth disease virus comprising the primer set, comprising the composition It relates to a kit for diagnosing serotype A foot-and-mouth disease virus and a method for diagnosing serotype A foot-and-mouth disease virus using the primer set.

Foot-and-mouth disease (FMD) is a highly contagious viral disease that infects cattle and wild animals of cattle and wild animals, and the country suffers serious economic damage due to the reduction in productivity of infected livestock as well as restrictions on international trade of animal and livestock products. Will be worn.

Foot-and-mouth disease virus (FMD virus, FMDV), which is the cause of FMD, is an RNA virus belonging to the family Picornaviridae and the genus Aphthovirus, and is immunologically and genetically distinguished by 7 serotypes, namely O, It is divided into A, Asia 1, C, SAT (Southern African Territories) 1, SAT 2, and SAT 3 types, and various topotypes and genetic lineages exist within the same serotype, and serotypes and regions The distribution of the occurrence area by type has different characteristics. Of the seven serotypes, the C serotype has no longer occurred since its outbreak in Kenya and Brazil in 2004, SAT 1, 2, and 3 serotypes occur mainly in African countries and Asia 1 serotypes mainly in Asian countries. Are doing. On the other hand, foot-and-mouth disease viruses of O and A serotypes show a wide incidence distribution without regional restrictions, and are consistently occurring in countries in Europe, North America, Asia and Africa. Geographically, Korea belongs to the pool 1 region, where foot-and-mouth disease viruses of O, A and Asia 1 serotypes are mainly occurring.Since 2000, O serotypes (2000, 2002, 2010, 2014, 2016 and 2017) and A serotypes ( 2010 and 2017) of foot-and-mouth disease virus has been periodically occurring.

Since FMD is a disease that spreads very quickly, it is essential to develop and apply a diagnostic method that can quickly and accurately diagnose infected livestock for efficient initial quarantine. To achieve this diagnostic purpose, PCR-based diagnostic methods such as Reverse Transcription-Polymerase Chain Reaction (RT-PCR) and real-time RT-PCR (RRT-PCR) have recently been introduced. It has been developed and is widely used, and the current situation is using RT-PCR and RRT-PCR as standard diagnostic methods in Korea's quarantine agencies.

However, the PCR-based diagnostic method requires expensive dedicated equipment and reagents, and can be used only in specialized laboratories equipped with skilled personnel, so it has been limited to use in front-line clinical laboratories or field diagnosis. As one of the methods that can overcome the shortcomings of such PCR-based diagnostic methods, Notomi et al. (Nucleic Acids Res 28(2000), 63~69) have high specificity and sensitivity, while isothermal which can amplify target genes quickly under isothermal conditions. An amplifier method (Loop-mediated isothermal amplification, LAMP) was developed.

Unlike Taq DNA polymerase, which is used in conventional PCR-based diagnostic methods, LAMP uses Bst DNA polymerase, which can amplify a target gene in large quantities by a strand displacement method. Not only is this exceptionally high, but unlike conventional PCR-based diagnostic methods, because the gene amplification is performed under isothermal conditions without temperature change, the test time is shortened, and the reaction is possible with inexpensive equipment such as a thermostat. Therefore, there is an advantage that it can be used not only in a specialized diagnostic room, but also in a small-sized diagnostic room where expensive equipment, reagents, and professional manpower are not secured. In addition, since reverse transcription isothermal amplification method (Reverse Transcription LAMP (RT-LAMP)) that can amplify an RNA template by simply adding reverse transcriptase to the LAMP reaction solution, it is widely used in the diagnosis of various bacteria, parasites and viral diseases. Has become. In addition, in the existing RT-LAMP method, three pairs of primers such as outer primers (F3, B3), loop primers (LF, LB), and inner primers (FIP, BIP) are used.

Meanwhile, in Korea, several researchers in the field of veterinary medicine have recently developed LAMP and RT-LAMP techniques for diagnosing various bacterial and viral pathogens, but they have not yet been applied to A serotype-specific diagnosis of foot-and-mouth disease virus.

Accordingly, the inventors of the present invention were studying to specifically diagnose serotype A foot-and-mouth disease virus, and the serotype A foot-and-mouth disease virus diagnostic primer that can accurately detect only serotype A foot-and-mouth disease virus only with a low concentration sample due to excellent sensitivity and specificity. By developing a set, the present invention was completed.

Accordingly, an object of the present invention is a primer set for diagnosing serotype A foot-and-mouth disease virus, a composition for diagnosing serotype A foot-and-mouth disease virus comprising the primer set, a kit for diagnosing serotype A foot-and-mouth disease virus comprising the above composition, and a serotype using the primer set A is to provide a method of diagnosing foot-and-mouth disease virus.

In order to achieve the above object, the present invention comprises a first primer set consisting of SEQ ID NOs: 1 and 2, a second primer set consisting of SEQ ID NOs: 3 and 4, and a third primer set consisting of SEQ ID NOs: 5 and 6, serum A primer set for diagnosis of type A foot and mouth disease virus (FMDV) is provided.

In addition, the present invention provides a composition for diagnosing serotype A foot-and-mouth disease virus, comprising the primer set for diagnosing the serotype A foot-and-mouth disease virus.

In addition, the present invention provides a kit for diagnosing serotype A foot-and-mouth disease virus, comprising the composition for diagnosing the serotype A foot-and-mouth disease virus.

In addition, the present invention a) obtaining a nucleic acid from a sample; b) amplifying the nucleic acid obtained in step a) using the serotype A foot and mouth disease diagnostic primer set; It provides a method for diagnosing serotype A foot-and-mouth disease virus comprising; and c) detecting the amplified product obtained in step b).

If the primer set for detecting serotype A foot-and-mouth disease virus of the present invention is used, it is possible to specifically detect the O serotype of foot-and-mouth disease virus with high sensitivity and low concentration samples. Of the foot-and-mouth disease virus, only serotype A can be detected. In addition, compared to the existing primer set, it can detect serotype A foot-and-mouth disease virus in the pool 1 region of Korea. In addition, if the RT-LAMP method using the primer set for detecting serotype A foot-and-mouth disease virus of the present invention is used, the sensitivity can be improved compared to the conventional PCR-based diagnostic method, and the test time can be shortened. The reaction is also possible with equipment. Therefore, it is possible to quickly and effectively diagnose serotype A foot-and-mouth disease virus in a small-sized diagnostic room or field, not a specialized diagnostic room, and thus can be easily utilized in the domestic and foreign virus diagnostic market.

1 is a diagram showing the amplification site and specific sequence of the primer set for diagnosing serotype A foot-and-mouth disease virus of the present invention.
FIG. 2 is a diagram showing the results of confirming the positive reaction at all reaction temperatures of 53 to 68° C. by checking the optimum temperature conditions when performing the RT-LAMP method using the primer set of the present invention. (A) shows the color change of the reaction solution in the tube after RT-LAMP reaction, and (B) shows the result of electrophoresis.
3 is a diagram showing the results of confirming that the detection reaction is performed over a reaction time of at least 40 minutes by checking the optimal time conditions when performing the RT-LAMP method using the primer set of the present invention. (A) shows the results of visual confirmation of the reaction in the tube, and (B) shows the results of electrophoresis.
FIG. 4 is a diagram showing the results of confirming that positive reactions appear only in lanes 4 to 6 corresponding to serotype A when the RT-LAMP method is performed using the primer set of the present invention. (A) shows the results of visual confirmation of the reaction in the tube, and (B) shows the results of electrophoresis.
5 is a diagram showing the results of confirming the effect of increasing the sensitivity of detection of serotype A foot-and-mouth disease virus by the RT-LAMP method using the primer set of the present invention. (A) and (B) show the RT-LAMP reaction using the primer set of the present invention, (A) shows the color change of the reaction solution of the tube after the reaction, (B) shows the result of electrophoresis of the reaction product. (C) shows the results of RT-PCR.

The present invention comprises a first primer set consisting of SEQ ID NOs: 1 and 2, a second primer set consisting of SEQ ID NOs: 3 and 4, and a third primer set consisting of SEQ ID NOs: 5 and 6, serotype A foot-and-mouth disease virus (Foot and Mouth disease virus, FMDV) diagnostic primer sets are provided.

In the present invention, the term "diagnosis" means to determine the presence or absence of a chemical species or microorganism in a sample or an experimental sample, and the diagnosis or detection in the present invention is preferably the presence or absence of a serotype A foot-and-mouth disease virus. Means to find out.

In the present invention, the term "primer" refers to a single-stranded oligonucleotide sequence that is complementary to a nucleic acid strand to be amplified, and may serve as a starting point for the synthesis of a primer extension product. The primers are capable of initiating DNA synthesis in the presence of reagents for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at an appropriate buffer and temperature.

In addition, the above primers may incorporate additional features that do not change the basic properties. That is, the nucleic acid sequence can be modified using a number of means known in the art. Examples of such modifications include methylation, encapsulation, substitution of one or more homologs of nucleotides, and uncharged linkers such as phosphonates, phosphotriesters, phosphoroamidates or carbamates, or phosphorothioates or phosphorodithioates. Modification of nucleotides into charged linkers of the back is possible. In addition, nucleic acids are one or more such as nucleases, toxins, antibodies, signal peptides, proteins such as poly L lysine, intercalating agents such as acridine or psoralen, chelating agents such as metals, radioactive metals, iron oxidizing metals, and alkylating agents. It may have additional covalently bonded moieties. In addition, the primer of the present invention may contain a nucleotide analogue, for example, phosphorothioate, alkylphosphorothioate or peptide nucleic acid, or an intercalating agent ) Can be included.

In addition, the primer sequence of the present invention can be modified using a label that can directly or indirectly provide a detectable signal. The primer may include a label that can be detected using spectroscopy, photochemical, biochemical, immunochemical or chemical means. Useful labels include 32P, fluorescent dyes, electron congestion reagents, enzymes (commonly used in ELISA), biotin or hapten, and proteins for which antisera or monoclonal antibodies are available.

In addition, the primers of the present invention include cloning and restriction enzyme digestion of appropriate sequences, and phosphotriester methods such as Narang (1979, Meth, Enzymol. 68:90-99), diethyl phosphora such as Beaucage. It can be chemically synthesized using any other well known method, including direct chemical synthesis, such as the Midite method (1981, Tetrahedron Lett. 22: 1859-1862), and the solids support method of U.S. Patent No. 4458066.

In addition, the nucleotide sequence represented by SEQ ID NO: 5 of the third primer set may be composed of nucleotide sequences represented by SEQ ID NO: 7 and 8, and the nucleotide sequence represented by SEQ ID NO: 6 of the third primer set is SEQ ID NO: 9 and It may consist of a nucleotide sequence represented by 10.

The nucleotide sequences described in SEQ ID NOs: 1 to 10 included in the primer set of the present invention are not limited thereto, and homologs of the nucleotide sequences are included within the scope of the present invention. Specifically, the primer set is a base sequence having a sequence homology of 70% or more, preferably 80% or more, more preferably 90% or more, and most preferably 95% or more, respectively, with the nucleotide sequence of SEQ ID NO: 1 to 10 It may include. The "% of sequence homology" for a polynucleotide is identified by comparing two optimally aligned sequences with a comparison region, and a portion of the polynucleotide sequence in the comparison region is a reference sequence (addition or deletion) for the optimal alignment of the two sequences. It may include additions or deletions (ie, gaps) compared to (not including). In addition, in the nucleotide sequences described in SEQ ID NOs: 1 to 10, “Y” may be T (thymine, thymine) or C (cytosine, cytosine), and “R” is A (adenine, adenine) or G (guanine, guanine). ) Can be.

The term "foot and mouth disease virus (FMDV)" of the present invention is an RNA virus belonging to the genus Aphthovirus of the family Picornaviridae, and is immunologically and genetically distinct from 7 serotypes (O, A, Asia 1, C, SAT (Southern African Territorries) 1, SAT 2, and SAT type 3). The foot-and-mouth disease virus serotype is distinguished by the difference in the base sequence of the VP1 gene. In addition, foot-and-mouth disease virus is a very strong infectious disease that shows fever, drooling, blisters, crusts, ulcers, and decreases appetite in right-winged animals with split hoofs.

The serotype A foot-and-mouth disease virus of the present invention may be a Pool 1 region-derived virus, but is not limited thereto. The “Pool 1 regional type” of the present invention is the region to which Korea belongs among the seven regional types of foot-and-mouth disease virus, and includes Korea, Cambodia, China, Hong Kong, Thailand, Japan, Laos, Malaysia, Mongolia, Myanmar, Russia and Vietnam. It means the area in which there is. Foot-and-mouth disease virus is divided into 7 pools based on the regional type of virus circulating in the area due to antigenic diversity: pool 1 (O, A, Asia 1 type), pool 2 (O, A, Asia 1 type). , pool 3 (O, A, Asia 1 type), pool 4 (O, A, SAT 1, 2, 3 type), pool 5 (O, A, SAT 1, 2 type), pool 6 (SAT 1, 2, 3) and pool 7 (O, A). In the pool 1 region to which Korea belongs, mainly O, A, and Asia-1 viruses circulate, and among them, A is a serotype with the highest incidence after type O.

When the RT-LAMP method was performed using the previously published primer set of Madhanmohan et al.(J. Virol.Methods 187(2013), 195-202), the detection of this pool 1 region-derived serotype A foot-and-mouth disease virus was difficult. On the other hand, the primer set of the present invention is useful for diagnosing A serotype foot-and-mouth disease virus of various regional types at home and abroad by detecting all serotype A foot-and-mouth disease viruses derived from Korean, Vietnamese, Malaysian and Russian states belonging to the pool 1 region. Can be used.

The primer set for diagnosis of serotype A foot-and-mouth disease virus may be a primer set for Loop Mediated Isothermal Amplification (LAMP) or Reverse Transcription-Loop Mediated Isothermal Amplification (RT-LAMP), but is not limited thereto. In addition, when the primer set for diagnosing serotype A foot-and-mouth disease virus of the present invention is used in the LAMP method, the LAMP method can be performed secondarily using cDNA produced by pre-reacting transcriptional reactions to RNA.

In the present invention, the "Reverse Transcription-Loop Mediated Isothermal Amplification (RT-LAMP)" is a diagnostic method that diagnoses diseases caused by bacteria or viruses and compensates for the shortcomings of the PCR method. Unlike the PCR method, at a constant temperature (isothermal temperature) Since annealing and extension are possible, a temperature control device is not required, so genes can be amplified under constant temperature conditions. In addition, it is a method capable of amplifying 10 ⁹ copies of a gene within 1 hour due to its high speed, specificity and detection sensitivity. In addition, the LAMP or RT-LAMP technique is a Bst DNA polymerase that can amplify a target gene in large quantities by a strand displacement method, unlike Taq DNA polymerase used in conventional PCR-based diagnostic methods. ), the gene amplification efficiency is remarkably high. In addition, unlike conventional PCR-based diagnostic methods, because gene amplification is performed under isothermal conditions without temperature change, not only the test time is shortened, but also the reaction can be performed with inexpensive equipment such as a constant temperature bath. Therefore, it is a method that can be used not only for professional diagnosis rooms, but also for small-sized diagnosis rooms where expensive equipment, reagents and experts are not secured, or for field diagnosis.

The primer set for diagnosing the serotype A foot-and-mouth disease virus may be a primer set targeting the P1 gene of the foot-and-mouth disease virus.

In the present invention, “the P1 gene of foot-and-mouth disease virus” refers to a gene constituting the capsid protein of the foot-and-mouth disease virus. The P1 gene is a gene having a large mutation including VP1 that distinguishes serotypes among genes constituting the foot-and-mouth disease virus, and has a large difference between serotypes of the foot-and-mouth disease virus. Therefore, in the present invention, the primer set for diagnosing the serotype A foot-and-mouth disease virus was prepared using the P1 gene, in particular, the VP3 nucleotide sequence, and the primer set of the present invention can specifically diagnose the A serotype of the foot-and-mouth disease virus.

In addition, the detection limit of the primer set for diagnosing serotype A foot-and-mouth disease virus of the present invention may be 10 ¹ to 10 ² TCID ₅₀ /mL, and preferably 10 ² TCID ₅₀ /mL. Therefore, the use of the primer set for diagnosing serotype A foot-and-mouth disease virus of the present invention can accurately diagnose serotype A foot-and-mouth disease virus even in a low concentration sample.

If the primer set for detecting serotype A foot-and-mouth disease virus of the present invention is used, it is possible to detect the A serotype of foot-and-mouth disease virus only with a low concentration sample due to high sensitivity, and except for other pathogens, only the A serotype of foot-and-mouth disease virus is specific. It can be detected as an enemy. In addition, unlike the existing primer set for detecting serotype A foot-and-mouth disease virus in which the virus cannot be detected in the pool 1 area including Korea, the use of the primer set of the present invention can be usefully used for diagnosing A serotype foot-and-mouth disease virus in the pool 1 area. .

The present invention also provides a composition for diagnosing serotype A foot-and-mouth disease virus, comprising the primer set for diagnosing the serotype A foot-and-mouth disease virus.

The composition may further include a reaction amplification mixture, such as a mixture containing a polymerase, dNTPs, a reaction buffer, and the like, and may include a fluorescent dye capable of visually confirming diagnosis, but is not limited thereto.

The present invention also provides a kit for diagnosing serotype A foot-and-mouth disease virus, comprising the composition for diagnosing the serotype A foot-and-mouth disease virus.

The kit may include a reagent for performing an amplification reaction, but is not limited thereto. In addition, the kit may take the form of a bottle, a tub, a sachet, an envelope, a tube, an ampoule, and the like, which are partially or wholly plastic, glass, paper, foil, It can be formed from wax or the like. The container may be equipped with a completely or partially detachable stopper, which is initially part of the container or can be attached to the container by mechanical, adhesive, or other means. The container may also be equipped with a stopper, which allows access to the contents by a needle. The kit may include an external package, and the external package may include instructions for use of components. In addition, the instruction manual may correspond to a user's guide describing the optimum reaction performance conditions for explaining how to use the kit, for example, a method of preparing a LAMP buffer, and suggested reaction conditions. In addition, the instruction manual may include a brochure in the form of a pamphlet or leaflet, a label attached to the kit, and a description on the surface of the package including the kit, and may correspond to information disclosed or provided through electronic media such as the Internet. have.

The present invention also comprises the steps of: a) obtaining a nucleic acid from a sample; b) amplifying the nucleic acid obtained in step a) using the serotype A foot and mouth disease diagnostic primer set; It provides a method for diagnosing serotype A foot-and-mouth disease virus comprising; and c) detecting the amplified product obtained in step b).

The serotype A foot-and-mouth disease virus may be a Pool 1 region-derived virus, but is not limited thereto.

In addition, the amplification of step b) may be performed using the LAMP method or the RT-LAMP method, and preferably, it may be performed using the RT-LAMP method, but is not limited thereto.

The amplification of step b) may be performed at 45 to 75°C, preferably 50 to 70°C, more preferably 53 to 68°C. As the amplification of step b) is performed in the above temperature range, the amplification reaction can be stably and efficiently performed without rapid temperature change, and energy required for heating can be saved and the time required for temperature change can also be shortened. I can.

In addition, the amplification of step b) may be performed for 35 to 60 minutes, preferably 40 to 60 minutes, and the upper limit range is not limited thereto. Compared with the conventional PCR method such as RT-PCR or RRT-PCR for about 1 hour 30 minutes to 2 hours, in the present invention, as the amplification of step b) is performed within the above time range, rapid detection is possible. Even with a short reaction time, even low concentration samples can be accurately detected. Therefore, if the method for diagnosing serotype A foot-and-mouth disease virus of the present invention is used, a faster and more efficient diagnosis is possible compared to the existing method.

The detection in step c) may be by using one or more methods selected from the group consisting of gel electrophoresis, capillary electrophoresis, DNA chip, turbidity measurement of reaction products, radioactivity measurement, fluorescence measurement, phosphorescence measurement, and color development indicator measurement. And, preferably, gel electrophoresis, turbidity measurement of the reaction product, fluorescence measurement, or color development indicator measurement method may be used, and more preferably, gel electrophoresis or color development indicator measurement method may be used, but is not limited thereto. .

The gel electrophoresis may use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. In addition, the turbidity measurement method of the reaction product is a measurement method using the phenomenon that the turbidity of the reaction product is increased by the precipitate of magnesium pyrophosphate generated during a positive LAMP reaction, and the turbidity in real time using a visual observation or a turbidimeter. It can mean a way to measure. In addition, a fluorescent dyeing material generally used in the art may be applied to the fluorescence measurement, and preferably, SYBR Green I, Quant-iT PicoGreen, GeneFinder, Ethdium bromide may be used, and more preferably SYBR Green You can use I. The fluorescent dyeing material may be a material added so that the result can be read without requiring additional experiments by using the characteristic of selectively binding to the double strand. In particular, the SYBR Green I is inserted into the RT-LAMP product. It refers to a substance that exhibits green fluorescence in natural light or when irradiated with ultraviolet rays. For example, a serotype A foot-and-mouth disease virus nucleic acid is amplified by the RT-LAMP method using the serotype A foot-and-mouth disease virus diagnostic primer set of the present invention, and when the SYBR Green I is added to the amplified RT-LAMP product, green fluorescence is displayed. Therefore, by using the above fluorescence measurement method, it is possible to identify infection with serotype A foot-and-mouth disease virus by recognizing green fluorescence that appears through SYBR Green I after RT-LAMP amplification experiment, without undergoing additional experiments such as electrophoresis. That is, if green fluorescence is not displayed, it means non-infection. Therefore, whether or not the sample is infected with the serotype A foot-and-mouth disease virus can be checked with the naked eye quickly and with high sensitivity. In addition, when the fluorescent dyeing material is added and reacted with a real-time fluorescence reading device, the reaction result can be read in real time.

In addition, in the colorimetric indicator measurement method, as a color development indicator, calcein or hydroxy naphthol blue (HNB), preferably HNB may be used. When the color development indicator is added, the color of the reaction solution is changed to orange or blue due to the reaction product (pyrophosphate, Mg ²⁺ ) generated during the LAMP amplification process, and no additional experiment is performed. You can quickly read whether it is detected or not. In addition, the HNB may be added in advance to the reaction solution before amplification to proceed with the reaction. When HNB is mixed with the reaction solution before amplification, it is possible to check the reaction result without opening the reaction tube, so there is an advantage of preventing cross-contamination compared to the method in which a dye solution must be added after the reaction.

Using the method for diagnosing serotype A foot-and-mouth disease virus using the primer set for detecting serotype A foot-and-mouth disease virus of the present invention, it is possible to detect serotype A of foot-and-mouth disease virus with only a low concentration sample due to high sensitivity, excluding other pathogens. Only the A serotype of foot-and-mouth disease virus can be specifically detected. In addition, when the LAMP method or RT-LAMP method is used for amplification, the test time can be effectively shortened because the gene amplification is performed under isothermal conditions without temperature change, unlike conventional PCR-based diagnostic methods.

Hereinafter, the present invention will be described in more detail based on examples. The examples are only for describing the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the invention is not limited by these examples according to the gist of the present invention.

Example 1. Extraction of nucleic acid from foot-and-mouth disease virus

In order to prepare primers specific for A serotype of foot and mouth disease virus (FMDV), the nucleic acid of foot and mouth disease virus was first extracted.

Specifically, as for the A serotype of foot-and-mouth disease virus used in the experiment, nucleic acids were extracted using the A/Pocheon/001/KOR/2010 isolate. All experiments using the disclosed virus were carried out by the Ministry of Agriculture, Forestry and Livestock Quarantine.

In addition, to verify the specificity of the serotype A foot-and-mouth disease virus-specific primer set of the present invention, other serotypes of foot-and-mouth disease virus (A, Asia 1, C, SAT 1, SAT 2, SAT 3) and Agriculture and Forestry Nucleic acid was extracted and used in the same manner from the virus (Seneca A virus) and cultured cells (BHK21, PK-15, Vero cells) that cause swine vesicular disease stored in the Livestock Quarantine Division. The extracted nucleic acid was stored at -80°C and used in the experiment. Table 1 shows the pathogen used, its isolate, and other information.

No. Serotype
(Serotype) Regional/Genotype
(Topotype
/lineage) Separation name
(Isolate name) Accession number
(GenBank
Accession No.) Proper concentration
(Viral titer
(TCID ₅₀ /mL)) Remark
(Notice) One O SEA/
Mya-98 O/Andong/KOR/2010 KC503937 8.4 x 10 ⁶ Korean isolate 2 O ME-SA/
Ind2001 O/Boeun/KOR/2017 Unregistered 1.4 x 10 ⁷ Korean isolate 3 O ME-SA O/Manisa/Turkey/69 AY593823 1.1 x 10 ⁶ Vaccine strain 4 A Asia/
Sea-97 A/Pocheon/001/KOR/2010 KC588943 4.7 x 10 ⁶ Korean isolate 5 A Asia/
Sea-97 A/Yeoncheon/KOR/2017 Unregistered 1.5 x 10 ⁶ Korean isolate 6 A Asia/
Sea-97 A/VN15/2014 Unregistered 2.7 x 10 ⁶ Vietnamese
isolate 7 Asia 1 Asia As1/Shamir/89 JF739177 1.1 x 10 ⁷ Vaccine strain 8 C EURO-SA C3/Resende/BRA/55 AY593807 4.7 x 10 ⁷ Brazilian isolate 9 SAT 1 Ⅲ-WZ SAT1/BOT/1/68 AY593845 2.0 x 10 ⁷ Botswanan isolate 10 SAT 2 Ⅱ-WZ SAT2/ZIM/5/81 KF112972 6.3 x 10 ⁶ Zimbabwean
isolate 11 SAT 3 I-SEZ SAT3/ZIM/4/81 KY825732 2.7 x 10 ⁷ Zimbabwean
isolate 12 Seneca A virus ATCC (PTA-5343) DQ641257 1.5 x 10 ⁵ American isolate

Example 2. Design of primers specific to A serotype of foot-and-mouth disease virus

A primer set that can be used for the Reverse Transcription-Loop Mediated Isothermal Amplification (RT-LAMP) method and specifically detects the A serotype of foot-and-mouth disease virus was designed as follows.

Specifically, among the P1 gene sequence information of foot-and-mouth disease virus registered in the GenBank database of NCBI (National Center for Biotechnology Information) since 2000, regional and genotypes were evenly included for each serotype, so that a total of 125 (O serotype 73 , A serotype 21, Asia 1 serotype 14, C serotype 2, SAT1 serotype 5, SAT2 serotype 7 and SAT3 serotype 3) were obtained. The secured foot-and-mouth disease virus 7 serotype gene sequences were compared and analyzed with the DNASTAR® Lasergene (DNASTAR, Inc, USA) program to select the most specific VP1 site for the A serotype of foot-and-mouth disease virus.

After that, using Primer-Explorer V3 software (http://primerexplorer.jp/e/index.html; Eiken Chemical Co. Ltd, Japan), a primer design program for LAMP, two types of forward inner primes (FIP ) And backward inner primer (BIP)), two kinds of outer primers (F3 and B3), and two kinds of loop primers (forward loop primer (LF) and backward loop primer (LB)) were designed.

The designed primer set was synthesized by requesting a primer manufacturer (Bioneer Co, Korea), and the sites and specific sequences of the designed primer set are shown in FIGS. 1 and 2.

Primer features Primer name Base sequence (5’-3’) Sequence number External primer
(1st primer set) FMDV-F3 CAGACCCYGTCACAACCA One FMDV-B3 ACCACAATCTCAAGRTCAGA 2 Loop primer
(2nd primer set) FMDV-LF CGYCGCTGYACTTGTGTC 3 FMDV-LB CATGCARACACACCAACAC 4 Inner primer
(3rd primer set) FMDV-FIP
(F1c+F2) AAGCYGACGTCGGTGTGGTGTYGAGAACTACGGTGGY 5 FMDV-BIP
(B1c+B2) GCCCCACACATGTCATTGACCAACATRGCGCCTACCAGC 6 Inner primer composition FMDV-F1c AAGCYGACGTCGGTGTGGT 7 FMDV-F2 GTYGAGAACTACGGTGGY 8 FMDV-B1c GCCCCACACATGTCATTGACC 9 FMDV-B2 AACATRGCGCCTACCAGC 10

Poem 3. Serotype A foot-and-mouth disease virus specific of the present invention primer RT- with set LAMP method Establish optimal reaction conditions

The optimal reaction conditions of the RT-LAMP method using the primer set of the present invention prepared in Example 2 were established as follows.

3-1. Reaction solution preparation

Specifically, as a reaction solution for the RT-LAMP method, 1 μL of Bst DNA polymerase (8U/μL, NEW England Biolabs, USA), 0.2 μL of AMV reverse transcriptase (10U/μL, Promega, Durham, NC, USA), 0.8 M betaine (Sigma-Aldrich, USA), 20 mM Tris-HCl (pH 8.8), 10 mM KCl, 4 mM MgSO ₄ , 10 mM (NH ₄ ) ₂ SO ₄ , 0.1% Triton X-100, 1.6 mM dNTPs and 3 mM hydroxy naphthol blue (HNB: Lemongreen, Shanghai, China) were used.

In addition, each of the primers represented by SEQ ID NOs: 1 to 6, that is, each 2.5 pmol / μL of outer primers F3 and B3 (SEQ ID NOs: 1 and 2), each of 10 pmol / μL of loop primers LF and LB (SEQ ID NOs: 3 and 4 ), each 20 pmol / μL of the inner primers FIP and BIP (SEQ ID NOs: 5 and 6) 2 μL were added to prepare a reaction solution. 5 μL of an RNA sample of the nucleic acids extracted in Example 1 was added to the prepared reaction solution, and the final volume was adjusted to 25 μL with sterile distilled water.

3-2. Establishment of temperature conditions for RT-LAMP method

In addition, in order to establish the optimal RT-LAMP condition suitable for detection of serotype A foot-and-mouth disease virus, the reaction temperature (53 to 68°C) was changed using RNA extracted from the culture medium of the publicly disclosed virus (A/Pocheon/001/KOR/2010). Then, the RT-LAMP method was performed. Thereafter, the reaction solution was treated at 80° C. for 5 minutes to remove the enzyme activity in the reaction solution, and the reaction solution in the reaction tube was visually observed and the color change was observed to determine whether it was positive. In addition, after electrophoresis was performed on 2.0% agarose gel, it was confirmed whether or not a ladder-shaped gene amplification band was formed specifically appearing in the LAMP reaction using an ultraviolet reader (Bio-Rad, USA), and the results are shown in FIG. Indicated. Figure 2 is a result of confirming the positive reaction in the reaction temperature condition of 53 to 68 ℃, (A) shows the color change of the reaction solution of the tube after RT-LAMP reaction, (B) shows the result of electrophoresis will be. In addition, lanes 1 to 6 of FIG. 2 indicate the results at 53, 56, 59, 62, 65 and 68°C, respectively, and NC indicates negative control.

As shown in FIG. 2, it was confirmed that a positive reaction appeared at the reaction temperature of 53 to 68°C, which is all reaction temperatures. In particular, as shown in FIG. 2A, the color change of the positive reaction was most clearly confirmed at 59 and 62° C. corresponding to lanes 3 to 4 with the naked eye, and also at 59 and 62° C. corresponding to lanes 3 to 4 in the electrophoresis result of FIG. 2B. It was confirmed that the positive band peculiar to LAMP appeared most clearly.

3-3. RT- LAMP method Establish time conditions

In addition, in order to establish the RT-LAMP method suitable for detection of serotype A foot-and-mouth disease virus, the RT-LAMP method was performed by varying the reaction time (20 to 50 minutes) under the experimental conditions of 3-2. The results are shown in FIG. 3.

3 is a result of confirming the presence or absence of a positive reaction with reaction times under conditions of 20, 30, 40 and 50 minutes, lanes 1 to 3 are results for 10 ⁵ , 10 ⁴ and 10 ³ TCID ₅₀ /mL dilution factors, respectively, NC stands for voice control. In addition, Figure 3A is a result of visually confirming the reaction in the tube, Figure 3B shows the result of electrophoresis.

As shown in Fig. 3, in the case of RT-LAMP, the reaction can be visually confirmed from 30 minutes, and it was confirmed that a positive reaction clearly appeared in the sample of 10 ³ TCID ₅₀ /mL from 40 minutes. Therefore, it was confirmed that the detection reaction took place over a reaction time of at least 40 minutes.

Accordingly, all subsequent experiments were carried out by fixing the reaction conditions at a reaction temperature of 62° C. and a reaction time of 40 minutes according to the results of 3-2 and 3-3.

Example 4. In the present invention primer RT- with set In the LAMP method Serotype A foot and mouth disease detection specificity analysis

In order to confirm whether the A serotype of foot-and-mouth disease virus can be specifically detected when diagnosing the RT-LAMP method using a primer set consisting of SEQ ID NOs: 1 to 6 of the present invention, 7 serotypes of foot-and-mouth disease virus extracted in Example 1 (O, A, Asia 1, C, SAT1, SAT2, SAT3), the specificity of detection of serotype A of foot-and-mouth disease virus was analyzed for the nucleic acids of 4 types of porcine-derived pathogens and cultured cells.

Specifically, in the nucleic acids of the 7 serotypes (O, A, Asia 1, C, SAT1, SAT2, SAT3) of the foot-and-mouth disease virus extracted in Example 1 and described in Table 1, pig-derived pathogens and cultured cells On the other hand, RT-LAMP was performed using the primer set of the present invention under the reaction conditions of 62° C. and 40 minutes established in Example 3, and the results are shown in FIG. 4.

In Figure 4, Figure 4A is a result of visually confirming the reaction in the tube, Figure 4B shows the result of electrophoresis. In addition, lanes 1 to 3 are O serum types among the 7 serotypes of foot and mouth disease virus, respectively O/Andong/KOR/2010, O/Boeun/KOR/2017 and O/Manisa/Turkey/69, lanes 4 to 6 are A serum types. And A/Pocheon/001/KOR/2010, A/Yeoncheon/KOR/2017 and A/VN15/2014 respectively, lane 7 is Asia1 serum type, As1/Shamir/89, lane 8 is C serum type, and C3/Resende/ BRA/55, lane 9 is SAT1 serum type, SAT1/BOT/1/68, lane 10 is SAT2 serum type, SAT2/ZIM/5/81, lane 11 is SAT3 serum type, SAT3/ZIM/4/81, lane 12 to 15 are Control, lane 12 is Seneca A virus, lanes 13 to 15 are the results of cultured cells BHK21, PK-15 and Vero cells, respectively, and NC indicates negative control.

As shown in Fig. 4, when the RT-LAMP method was performed using the primer set of the present invention, it was confirmed that all positive reactions were shown only in lanes 4 to 6 corresponding to serotype A. Accordingly, it was confirmed that only the A serotype of foot-and-mouth disease virus can be specifically detected by using the primer set of the present invention.

Example 5. Of the present invention primer RT- with set LAMP method Confirmation of the effect of increasing the sensitivity of detection of serotype A foot-and-mouth disease virus

When the RT-LAMP method using the primer set of the present invention is performed, the RT-PCR method is used to determine whether the sensitivity of detection of serotype A foot-and-mouth disease virus is increased compared to the diagnostic method using other types of primers used in the existing detection kit. And compared with the RT-LAMP method of the present invention.

5-1. RT-PCR performance conditions and methods

RT-PCR is a commercially available Inclone ^TM using a primer set that can specifically amplify the VP1-2B gene region of A serotype, referring to Le et al. (2011) (J Virol Methods 175: 101-108). It was carried out using a one-step RT-PCR kit (Inclone biotech, Korea).

To 12.5 μL of reaction mix solution, forward primer and reverse primer were added to 0.2 μM, and 1 μL of Enzyme mix was added, and 5 μL of RNA extracted from the specimen was added to adjust the final volume to 25 μL. A PCR amplifier (Biometra, Germany) was used for reverse transcription at 45°C for 50 minutes, followed by treatment at 95°C for 15 minutes, and a PCR process of 35 rotations (denaturation 95°C, 20 seconds; annealing 55°C, 40 seconds; extension) 72°C, 45 seconds), and the final reaction was performed at 72°C for 5 minutes.

The PCR amplification product was subjected to electrophoresis on a 1.5% agarose gel by adding NEO green staining solution (NEO science, Korea), and then observed and read whether a specific band of 651 bp was amplified with an ultraviolet reader (Bio-Rad, USA).

5-2. Measurement of sensitivity of foot-and-mouth disease virus detection for each diagnostic method

In order to compare the sensitivity between the RT-LAMP method using the primer set of the present invention and the previously known RT-PCR method, first, the public foot-and-mouth disease virus was extracted from the virus culture medium using a commercially available RNA extraction kit (Inclone biotech, Korea). RNA was extracted and then diluted.

For each of the dilutions, RT-LAMP using the primer set of the present invention was performed under the reaction conditions of Example 3, and RT-PCR was performed under the conditions of 5-1, respectively, to compare detection limits, and A of foot-and-mouth disease virus The detection results for serotypes are shown in FIG. 5. In FIG. 5, (A) and (B) represent the RT-LAMP reaction using the primer set of the present invention, (A) is the color change of the reaction solution in the reaction tube, (B) is the reaction product subjected to electrophoresis. It shows the results. On the other hand, (C) is the result of RT-PCR. In addition, lanes 1 to 8 in (A) to (C) represent 10 ⁶ to 10 ^-1 TCID ₅₀ /mL obtained by diluting the RNA of foot-and-mouth disease virus in 10-fold steps, and NC represents negative control. In addition, the results of comparing the detection limit between the RT-LAMP method using the primer set of the present invention and the previously known RT-PCR method are shown in Table 3 below.

Detection method Foot-and-mouth disease virus A serotype detection limit (TCID ₅₀ /mL) PCR RT-PCR 10 ³ LAMP RT-LAMP 10 ²

As shown in Fig. 5 and Table 3, as a result of performing RT-LAMP and conventional RT-PCR using the primer set of the present invention targeting the extracted foot-and-mouth disease virus A serotype gene, the detection limit of RT-LAMP is 10 ² TCID ₅₀ /mL. On the other hand, the detection limit of RT-PCR, a standard diagnostic method, was 10 ³ TCID ₅₀ /mL. Therefore, it was also confirmed that the sensitivity of RT-LAMP using the primer set of the present invention was improved 10 times compared to the conventional RT-PCR.

These results confirmed that the RT-LAMP method using the primer set of the present invention can be used as a breakthrough serotype O foot-and-mouth disease virus diagnosis method that can replace the existing PCR method by showing more excellent sensitivity than the existing RT-PCR method. .

As confirmed in the above examples, the serotype A foot-and-mouth disease virus-specific primer set of the present invention is specific by accurately detecting only the A serotype of foot-and-mouth disease virus without detecting other genes such as pig-derived pathogens and three cultured cells. It was confirmed that the degree was high. In addition, it was confirmed that the RT-LAMP method using the primer set of the present invention has a higher sensitivity compared to the conventional RT-PCR method.

Example 6. In the present invention primer RT- with set LAMP method Confirmation of effectiveness of detection of domestic and foreign foot and mouth disease virus

In order to confirm whether the RT-LAMP method using the primer set of the present invention can specifically detect not only domestic but also foreign foot-and-mouth disease virus, 37 points of domestic and foreign standard foot-and-mouth disease virus cultures held by the Ministry of Agriculture, Forestry and Livestock Quarantine The extracted nucleic acid was tested. In addition, the RT-LAMP method was performed on nucleic acids extracted from 37 domestic and foreign standard foot-and-mouth disease virus cultures using a primer set of Madhanmohan et al. (J. Virol. Methods 187 (2013), 195-202) previously published. The results are shown in Table 4.

No. Serotype
(Serotype) Regional/Genotype
(Topotype/lineage) Separation name
(Isolate name) preRT-LAMP
(Madhanmohan, 2013) RT-LAMP
(Invention) One O ME-SA/Ind2001 O/Boeun/KOR/2017 - - 2 O ME-SA/Ind2001 O/Jeongup/KOR/2017 - - 3 O ME-SA/PanAsia O1/SKR/2002 - - 4 O ME-SA/PanAsia O/Chungju/KOR/2000 - - 5 O SEA/Mya-98 O/GJ/KOR/2016 - - 6 O SEA/Mya-98 O/GC/KOR/2016 - - 7 O SEA/Mya-98 O/2016/SKR/03 - - 8 O SEA/Mya-98 O/SKR/JC/2014 - - 9 O SEA/Mya-98 O/Hapcheon/KOR/2014 - - 10 O SEA/Mya-98 O/Andong/KOR/2010 - - 11 O SEA/Mya-98 O/Yangju/KOR/2010 - - 12 O SEA/Mya-98 O/Paju/KOR/2010 - - 13 O ME-SA/PanAsia O/Son La/VN/2013 - - 14 O ME-SA/PanAsia O/Bac/Ninh/VN/2013 - - 15 O SEA/Mya-98 O/VN1/2014 - - 16 O SEA/Mya-98 O/VN6/2014 - - 17 O Cathay O/Yunlin/Taiwan/97 - - 18 O ME-SA O/Manisa/Turkey/69 - - 19 O SEA/Mya-98 O/Primorskiy/RUS/2014 - - 20 O Cathay O/3039 - - 21 O Euro-SA O1/BFS1860/UK/67 - - 22 O Euro-SA O1/Campos/BRA/58 - - 23 A Asia/Sea-97 A/Yeoncheon/KOR/2017 - + 24 A Asia/Sea-97 A/Pocheon/001/KOR/2010 - + 25 A Asia/Sea-97 A/VN18/2014 - + 26 A Asia/Sea-97 A/VN25/2014 - + 27 A Asia/Sea-97 A/BacNinh/T11D/2013 - + 28 A Asia/Sea-97 A/VN/15/2014 - + 29 A Asia/Sea-97 A/Zabaikalsky/RUS/2013 - + 30 A Asia/Sea-97 A/Malaysia/97 - + 31 Asia 1 Asia/G-Ⅴ Asia1/MOG/05 - - 32 Asia 1 Asia CAM/9/80 - - 33 Asia 1 Asia As1/Shamir/89 - - 34 C EURO-SA C3/Resende/BRA/55 - - 35 SAT1 Ⅲ-WZ SAT1/BOT/1/68 - - 36 SAT2 Ⅱ-WZ SAT2/ZIM/5/81 - - 37 SAT3 I-SEZ SAT3/ZIM/4/81 - -

Experimental results As shown in Table 4 above, it was confirmed that all 8 serotypes of A serotypes among 37 domestic and foreign 37 foot-and-mouth disease virus samples can be specifically detected when the RT-LAMP method using the primer set of the present invention is performed. . On the other hand, it was confirmed that the A serotype foot-and-mouth disease virus was not detected when the RT-LAMP method was performed using the previously published primer set such as Madhanmohan.

In the case of the serotype A foot-and-mouth disease virus culture solution of Table 4, 2 Korean strains (A/Pocheon/001/KOR/2010, A/Yeoncheon/KOR/2017), 4 Vietnamese strains (A/VN18/2014, A/VN25 /2014, A/BacNinh/T11D/2013, A/VN/15/2014), 1 Malaysian state (A/Malaysia/97), 1 Russian state (A/Zabaikalsky/RUS/2013), all of which are Pool 1 Belongs to the region. Therefore, it is impossible to diagnose A serotype foot-and-mouth disease virus occurring in Pool 1 when using the previously published primer set, whereas when using the primer set of the present invention, serotype A foot-and-mouth disease virus generated in foreign Pool 1 area as well as domestic A serotype foot-and-mouth disease virus It was confirmed that it can be usefully used for diagnosis of

<110> Kyungpook National University Industry-Academic Cooperation Foundation REPUBLIC OF KOREA (Animal and Plant Quarantine Agency) <120> Primer set for detection of serotype A Foot-and-Mouth Disease viruses and uses thereof <130> KNU1.317P <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> FMDV-F3 <400> 1 cagacccygt cacaacca 18 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FMDV-B3 <400> 2 accacaatct caagrtcaga 20 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> FMDV-LF <400> 3 cgycgctgya cttgtgtc 18 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> FMDV-LB <400> 4 catgcaraca caccaacac 19 <210> 5 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> FMDV-FIP <400> 5 aagcygacgt cggtgtggtg tygagaacta cggtggy 37 <210> 6 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> FMDV-BIP <400> 6 gccccacaca tgtcattgac caacatrgcg cctaccagc 39 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> FMDV-F1c <400> 7 aagcygacgt cggtgtggt 19 <210> 8 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> FMDV-F2 <400> 8 gtygagaact acggtggy 18 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> FMDV-B1c <400> 9 gccccacaca tgtcattgac c 21 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> FMDV-B2 <400> 10 aacatrgcgc ctaccagc 18

Claims (13)

Serotype A foot and mouth disease virus, comprising a first primer set consisting of SEQ ID NOs: 1 and 2, a second primer set consisting of SEQ ID NOs: 3 and 4, and a third primer set consisting of SEQ ID NOs: 5 and 6 , FMDV) diagnostic primer set.
The method of claim 1,
The serotype A foot-and-mouth disease virus is a Pool 1 region-derived virus, a primer set for diagnosing serotype A foot-and-mouth disease virus.
The method of claim 1,
The primer set for diagnosis of serotype A foot-and-mouth disease virus is a primer set for LAMP (Loop Mediated Isothermal Amplification) or RT-LAMP (Reverse Transcription-Loop Mediated Isothermal Amplification).
The method of claim 1,
The primer set for diagnosis of serotype A foot-and-mouth disease virus is a primer set that targets the P1 gene of foot-and-mouth disease virus.
The method of claim 1,
The detection limit of the serotype A foot-and-mouth disease virus diagnostic primer set is 10 ¹ to 10 ² TCID ₅₀ /mL, characterized in that, serotype A foot-and-mouth disease virus diagnostic primer set.
A composition for diagnosing serotype A foot-and-mouth disease virus, comprising the primer set of any one of claims 1 to 5.
A kit for diagnosing serotype A foot-and-mouth disease virus, comprising the composition for diagnosing serotype A foot-and-mouth disease virus according to claim 6.
a) obtaining a nucleic acid from the sample;
b) amplifying the nucleic acid obtained in step a) by using the primer set of any one of claims 1 to 5; And
c) detecting the amplification product obtained in step b); including,
The sample is a mammal other than human, serotype A foot-and-mouth disease virus diagnosis method.
The method of claim 8,
The serotype A foot-and-mouth disease virus is a Pool 1 region-derived virus.
The method of claim 8, wherein the amplification in step b) is performed using the LAMP method or the RT-LAMP method.
The method of claim 8, wherein the amplification in step b) is performed at 45 to 75°C.
The method of claim 8, wherein the amplification in step b) is performed for 35 to 60 minutes.
The method of claim 8,
The detection in step c) is characterized by using at least one method selected from the group consisting of gel electrophoresis, capillary electrophoresis, DNA chip, turbidity measurement of reaction products, radioactivity measurement, fluorescence measurement, phosphorescence measurement, and color development indicator measurement. Serotype A foot-and-mouth disease virus diagnosis method.

Images