KR101729980B1 - Compositions for detecting porcine circovirus type 2 and method for detecting porcine circovirus type 2 using the same - Google Patents

Compositions for detecting porcine circovirus type 2 and method for detecting porcine circovirus type 2 using the same Download PDF

Info

Publication number
KR101729980B1
KR101729980B1 KR1020150152309A KR20150152309A KR101729980B1 KR 101729980 B1 KR101729980 B1 KR 101729980B1 KR 1020150152309 A KR1020150152309 A KR 1020150152309A KR 20150152309 A KR20150152309 A KR 20150152309A KR 101729980 B1 KR101729980 B1 KR 101729980B1
Authority
KR
South Korea
Prior art keywords
primer set
porcine circovirus
type
circovirus type
seq
Prior art date
Application number
KR1020150152309A
Other languages
Korean (ko)
Inventor
박최규
전효성
김은미
Original Assignee
경북대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 경북대학교 산학협력단 filed Critical 경북대학교 산학협력단
Priority to KR1020150152309A priority Critical patent/KR101729980B1/en
Application granted granted Critical
Publication of KR101729980B1 publication Critical patent/KR101729980B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2527/00—Reactions demanding special reaction conditions
    • C12Q2527/101—Temperature
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2531/00—Reactions of nucleic acids characterised by
    • C12Q2531/10—Reactions of nucleic acids characterised by the purpose being amplify/increase the copy number of target nucleic acid
    • C12Q2531/119—Strand displacement amplification [SDA]

Abstract

The present invention relates to a primer set for detection of porcine circovirus type 2, a composition and kit for detecting porcine circovirus type 2 comprising the same, And a method for detecting porcine circovirus type 2 using the same. When the LAMP method is carried out using the primer set for detection of porcine swine virus type 2 of the present invention, it is possible to detect the porcine swine viral type 2 only with a low concentration of the sample, so that the sensitivity is high and other pathogenic agents occurring in pigs are excluded The specificity of detecting only pork serovirus type 2 is excellent. In addition, unlike conventional PCR-based diagnostic methods, gene amplification is performed under isothermal conditions with no temperature change, which shortens the inspection time and can also be achieved with low-cost equipment such as a constant temperature bath. Therefore, it can be effectively used for the detection of porcine swine virus type 2 in a small-scale diagnostic room or a field where high-priced equipment, reagent and professional manpower are not secured as well as a professional diagnosis room.

Description

TECHNICAL FIELD The present invention relates to a composition for detecting porcine circovirus type 2 and a method for detecting porcine circovirus type 2 using the same,

The present invention relates to a primer set for detection of porcine circovirus type 2, a composition and kit for detecting porcine circovirus type 2 comprising the same, And a method for detecting porcine circovirus type 2 using the same.

Porcine circovirus disease (PCVD) caused by infection with porcine circovirus type 2 (PCV2) occurs in almost all countries where pigs are prevalent worldwide and causes the greatest damage to the swine industry Is one of the diseases (Segales et al., 2012, Vet Microbiol 111: 223-229). PCVD induces various clinical symptoms in infected pigs and is often detected in pigs that do not exhibit PCVD specific symptoms. Therefore, in the laboratory for diagnosing porcine diseases, PCV2 is diagnosed at all times for the diagnosis of PCVD and differential diagnosis from similar diseases. 2012, Virus Res 164: 107-113), (Opriessnig et al. 2007, J Vet Diagn Invest 19: 591-615 (2004), J Virol Meth 122: 171-178) ), (Segales et al., 2005, Vet Microbiol 111: 223-229). In the diagnosis of PCV2, various methods such as virus isolation, immunohistochemical staining, and in situ hybridization can be used. However, PCR and real time PCR (rPCR) J et al., 1999, J. Virol Methods 32: 299-306) (Kim et al., 2011, Korean J Vet Res 51: 7-14), (Larochelle et al., 1999, J Virol Methods 80: 75), (Lyoo et al., 2008, J Vet Diagn Invest 20: 283-288), (Trible and Rowland, 2012, Virus Res 164: 68-77)]. However, currently available PCR-based diagnostic methods require special equipment and reagents, and because they require professional testing personnel, they are not easy to apply in clinical diagnosis rooms other than professional diagnostic institutions. Therefore, it is required to develop a diagnostic method that can diagnose quickly and easily even in a clinical diagnosis room with high specificity and sensitivity.

Unlike conventional PCR-based diagnostic methods that require temperature changes, loop-mediated isothermal amplification (LAMP) is a novel method of gene amplification that can amplify genes at constant temperature conditions, resulting in high specificity and sensitivity (Notomi et al., 2000, Nucleic Acids Res 28: 63-69). Especially, due to the characteristic of LAMP which is reacted under isothermal condition, it can be used easily even in the clinical diagnosis room or clinic field where there is no expensive special equipment or specialized workforce. Because of these advantages, recently, LAMP has been widely used in the diagnosis of various pathogens of humans and animals (Dhama et al., 2014, J Biol Sci 17: 151-166), (Mori et al., 2009, J Infect Chemother 15: 62-69 )].

LAMP results can be obtained by electrophoresis of the amplified products, or by characterizing the trapezoidal amplification products or by measuring the turbidity of the amplified products. The amplified product is stained with a DNA staining solution such as SYBR green (Mori et al., 2009, J Infect Chemother 15: 62-69). (Notomi et al., 2000, Nucleic Acids Res 28: 63-69). However, the reading method using electrophoresis or DNA staining solution may cause the problem of nucleic acid contamination in the laboratory because the reaction tube must be opened and the amplification product must be handled. The reading by the turbidity measurement may cause the error (Zhang et al., 2014, Biosensors and Bioelectronics 61: 491-499). Recently, a method for reading LAMP results using hydroxynaphthol blue dye (HNB) has been developed to solve these problems (Goto et al., 2009, Biotechniques 46: 167-172). This method is advantageous in that cross-contamination can be prevented compared to other color analysis methods by adding a staining liquid after the reaction because it is possible to confirm the reaction result without mixing the HNB into the reaction solution before amplification and opening the reaction tube .

Accordingly, the present inventors have conducted a study on rapid and accurate determination of porcine circovirus type 2 (PCV2). As a result of performing a LAMP method using a primer set targeting porcine circovirus type 2, It was confirmed that only the pneumococcal virus type 2 was detected and the sensitivity was high and the specificity of detecting only the pancreatic virus type 2 was excellent, except for the other pathogens occurring in pigs. In addition, the present invention was completed by confirming that the reaction result can be directly visually confirmed without any additional reader by applying HNB, and that the possibility of contamination is low.

It is an object of the present invention to provide a primer set for detecting porcine circovirus type 2.

It is also an object of the present invention to provide a composition for detecting porcine swine virus type 2 comprising the primer set.

It is also an object of the present invention to provide a kit for the detection of porcine circovirus type 2 comprising the above composition.

It is also an object of the present invention to provide a method for detecting porcine circovirus type 2 comprising the above composition.

In order to solve the above problems, the present invention provides a primer set comprising a first primer set consisting of SEQ ID NOS: 1 and 2; A second primer set consisting of SEQ ID NOS: 3 and 4; And a third primer set consisting of SEQ ID NOS: 5 and 6, and a primer set for detecting porcine circovirus type 2.

The present invention also provides a composition for detecting porcine circovirus type 2 comprising the primer set.

The present invention also provides a kit for detecting porcine swine virus type 2 comprising the above composition.

Further, the present invention provides a method for producing a DNA fragment, comprising: (1) extracting DNA of a sample; And (2) a first primer set consisting of SEQ ID NOS: 1 and 2, using the DNA of (1) as a template; A second primer set consisting of SEQ ID NOS: 3 and 4; And a third primer set consisting of SEQ ID NOS: 5 and 6, and then detecting the isothermal amplification product. The present invention also provides a method for detecting porcine circovirus type 2.

When the LAMP method is carried out using the primer set for detection of porcine swine virus type 2 of the present invention, it is possible to detect the porcine swine viral type 2 only with a low concentration of the sample, so that the sensitivity is high and other pathogenic agents occurring in pigs are excluded The specificity of detecting only pork serovirus type 2 is excellent. In addition, unlike conventional PCR-based diagnostic methods, gene amplification is performed under isothermal conditions with no temperature change, which shortens the inspection time and can also be achieved with low-cost equipment such as a constant temperature bath. Therefore, it can be effectively used for the detection of porcine swine virus type 2 in a small-scale diagnostic room or a field where high-priced equipment, reagent and professional manpower are not secured as well as a professional diagnosis room.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a diagram showing an amplification site of a primer set for LAMP of the present invention. FIG.
FIG. 2 is a graph showing a result of confirming a positive reaction at a reaction temperature range of 45 to 68 ° C. in order to establish an optimum condition in the LAMP method using the primer set of the present invention.
FIG. 3 is a graph showing the results of confirming the positive reaction in the reaction time range of 10, 20, 30, and 40 minutes in order to establish the optimum conditions in the LAMP method using the primer set of the present invention.
FIG. 4 is a graph showing the results of confirming the specificity of a pig swine virus type 2, a swine-related virus, or a bacterium when the LAMP method is performed using the primer set of the present invention
FIG. 5 is a graph showing the relationship between the detection sensitivity of porcine circovirus type 2 and the detection sensitivity of porcine circovirus type 2 when performing the conventional PCR method (C) and the real time PCR method (D) using the primer set of the present invention and the LAMP method (A and B) Fig.

The present invention relates to a first primer set consisting of SEQ ID NOS: 1 and 2; A second primer set consisting of SEQ ID NOS: 3 and 4; And a third primer set consisting of SEQ ID NOS: 5 and 6, and a primer set for detecting porcine circovirus type 2.

In the present invention, "porcine circovirus type 2" is a circular single stranded DNA virus belonging to Circoviridae and having a diameter as small as about 17 nm. PCV 2 has been extensively studied and isolated in pigs with symptoms of postweaning multisystemic wasting syndrome (PMWS) in the late 1990s and is known to be widely distributed worldwide. This is mainly caused by the infected pigs being 6 to 8 weeks of age and being infected with various pathogens such as viruses and bacteria in poor breeding environment. The infected pigs show loss of appetite, general weakness, jaundice and respiratory symptoms.

In the present invention, "detection" refers to detection of the presence or absence of a chemical species or microorganism in the sample in the chemical analysis, and in the present invention means detection of porcine circovirus type 2.

In the present invention, the term "primer" refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be amplified, and may serve as a starting point for synthesis of a primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target.

In the present invention, an oligonucleotide used as a primer may comprise a nucleotide analogue such as phosphorothioate, alkylphosphorothioate or peptide nucleic acid, And may include an intercalating agent.

The base sequence represented by SEQ ID NOS: 1 and 2 is the first primer set as the pair of external primers and the base sequence represented by SEQ ID NOS: 3 and 4 is the pair of loop primers as the pair of loop primers 2 primer set. In addition, the nucleotide sequence shown in SEQ ID NOs: 5 and 6 is a third primer set as an inner primer pair.

The primer set is preferably used for the LAMP (Loop Mediated Isothermal Amplification) method, but is not limited thereto.

In the present invention, "LAMP (Loop Mediated Isothermal Amplification)" is a diagnostic method for diagnosing diseases caused by bacteria or viruses and complementing the shortcomings of the PCR method. Unlike the PCR method, annealing is performed at a constant temperature (isothermal temperature) It is possible to amplify a gene under a constant temperature condition without a temperature control device. In addition, the rapidity, specificity and detection sensitivity are high, so that 10 9 copies of the gene can be amplified within 1 hour. Unlike the Taq DNA polymerase used in PCR-based diagnostic methods, the LAMP technique uses Bst DNA polymerase, which can amplify a target gene by a strand displacement method. In addition, unlike conventional PCR-based diagnostics, gene amplification is performed under isothermal conditions with no temperature change, which can shorten the inspection time and enable low-cost equipment such as a constant temperature bath. Therefore, it can be used not only for a specialized diagnosis room, but also for a small-scale diagnosis room or a field diagnosis for which high-priced equipment, reagents and professional manpower are not secured.

The primer set targets the ORF (open reading frame) gene of porcine circovirus type 2, but is not limited thereto.

In the present invention, "ORF (open reading frame)" means a DNA sequence which is translated into an amino acid sequence. That is, it means a base sequence ranging from a start codon (ATG) to a stop codon (TGA, TAA, TAG).

The present invention also provides a composition for detecting porcine circovirus type 2 comprising the primer.

The present invention also provides a kit for detecting porcine swine virus type 2 comprising the above composition.

The kit of the present invention may contain a reagent for carrying out an amplification reaction. In addition, the kit of the present invention may further include a user guide describing optimal reaction performing conditions. The manual is a printed document that explains how to use the kit, for example, how to prepare PCR buffer, the reaction conditions presented, and so on. The brochure includes instructions on the surface of the package including the brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the brochure includes information that is disclosed or provided through an electronic medium such as the Internet

Further, the present invention provides a method for producing a DNA fragment, comprising: (1) extracting DNA of a sample; And (2) a first primer set consisting of SEQ ID NOS: 1 and 2, using the DNA of (1) as a template; A second primer set consisting of SEQ ID NOS: 3 and 4; And a third primer set consisting of SEQ ID NOS: 5 and 6, and then detecting the isothermal amplification product. The present invention also provides a method for detecting porcine circovirus type 2.

The sample of step (1) may be at least one selected from the group consisting of tissue, blood, saliva, urine and body fluid, but is not limited thereto.

The isothermal amplification reaction in step (2) may be performed at 45 to 68 ° C, preferably 60 to 65 ° C, and more preferably 63 ° C.

The isothermal amplification reaction in the step (2) can be performed using LAMP method, but isothermal amplification reaction commonly used in the art can be used, but is not limited thereto.

The detection of step (2) may be performed by one or more kinds selected from the group consisting of gel electrophoresis, turbidity measurement of reaction products, radioactive measurement, fluorescence measurement, phosphorescence measurement and color development indicator measurement, but is not limited thereto.

In the present invention, amplification product detection can be performed using gel electrophoresis, and agarose gel electrophoresis or acrylamide gel electrophoresis can be used depending on the size of the amplification product.

In addition, the amplification product detection can be performed using a turbidity measurement method of the reaction product, and a measurement method using the phenomenon that the turbidity of the reaction product increases due to the precipitate of magnesium pyrophosphate produced during the LAMP reaction positive reaction Turbidity can be measured using a visual observation or a turbidimeter.

In addition, the amplification product detection can be performed using the fluorescence measurement method. When Cy-5 or Cy-3 is labeled at the 5'-end of the primer and amplification is performed, the target is detected as a fluorescent marker capable of detecting the target sequence. And the fluorescence thus labeled is measured using a fluorescence meter. In the above radioactive measurement method, a radioactive isotope such as 32 P or 35 S is added to an amplification reaction solution to mark the amplification product, and then a radioactive measurement instrument, for example, a Geiger counter or a liquid scintillation counter the radioactivity can be measured using a liquid scintillation counter.

The detection of the amplified product can be performed using fluorescent dye materials commonly used in the art, but preferably SYBR Green I, GeneFinder and phenol red can be used, and more preferably, SYBR Green I and GeneFinder can be used . The fluorescent dye material is added to the DNA double strand or RNA single strand so as to make it possible to read out the result without requiring additional experimentation. In particular, SYBR Green I or GeneFinder is a substance that is inserted into DNA double strand or single strand of RNA and expresses green fluorescence when irradiated with ultraviolet light. Therefore, when the porcine circovirus type 2 is amplified by the LAMP method according to the present invention, SYBR Green I or GeneFinder is added to the amplified LAMP product, and then the ultraviolet light is irradiated, green fluorescence appears. That is, the present invention means that when green fluorescence is expressed by SYBR Green I or GeneFinder staining after LAMP amplification experiment without any additional experiment such as electrophoresis, it means that the disease is infected. If green fluorescence is not expressed, It is possible to visually confirm whether or not the infection is caused by the type 2 vaccinia virus with high sensitivity and promptly.

In addition, the amplification product detection can be performed using a colorimetric indicator. Preferably, calcein, HNB (hydroxy naphthol blue) and more preferably HNB can be used. When the coloring indicator is added, the color of the reaction solution changes to orange or blue due to the reaction product (pyrophosphate, Mg 2 + ) generated during the LAMP amplification process. In order to make them readable. In addition, HNB can be added to the reaction solution before amplification to proceed the reaction. Therefore, when HNB is mixed with the reaction solution before amplification, it is possible to confirm the reaction result without opening the reaction tube. Therefore, cross-contamination can be prevented as compared with a method in which a dyeing solution is added after the reaction.

In one embodiment of the present invention, an ORF gene of porcine circovirus type 2 was used as a target to prepare a primer set capable of detecting porcine circovirus type 2. Specifically, the primer set of the present invention comprises a total of 3 pairs, the nucleotide sequence shown in SEQ ID NO: 1 and 2 is the first primer set as the pair of external primers, the nucleotide sequence shown in SEQ ID NO: 3 and 4 is the loop primer And a second primer set as a pair. In addition, the nucleotide sequence shown in SEQ ID NOs: 5 and 6 is a third primer set as an inner primer pair. As a result of establishing optimal reaction conditions of the LAMP method using the above primer set, it was confirmed that porcine circovirus type 2 was detected within one hour (40 minutes) at a constant temperature condition of 63 ° C. In addition, when the LAMP method is performed using the primer set of the present invention, it is possible to detect the porcine circovirus type 2 only with a low concentration of the sample, and the sensitivity is high, and only the porcine circovirus type 2 Specificity is excellent. In addition, it was confirmed that detection efficiency for outdoor samples was superior to conventional PCR and real-time PCR. Therefore, unlike conventional PCR-based diagnostics, gene amplification is performed under isothermal conditions with no temperature change, which can shorten the inspection time and enable low cost equipment such as a constant temperature bath. Therefore, it can be effectively used for the detection of porcine swine virus type 2 in a small-scale diagnostic room or a field where high-priced equipment, reagent and professional manpower are not secured as well as a professional diagnosis room.

Hereinafter, the present invention will be described in detail by way of examples. It is to be understood that the following examples are illustrative only and are not intended to limit the scope of the invention in any way to the scope of the invention as defined by the appended claims. It will be obvious.

Example  1. Pig Circovirus  Type 2 (porcine circovirus  2; PCV2 ) Of nucleic acid extraction

Specifically, the standard positive virus was used by culturing the PCV2 isolate (PCK0201) in pig kidney cells (PK-15) (Park et al., 2004, Korean J Vet Res 44: 561-569) Identified porcine kidney cells (PK-15) were used. Outdoor samples were obtained from 48 pigs (pig) and 52 blood (serum) from pigs in PCVD. Serum samples were centrifuged at 3,000 rpm for 10 minutes, and the supernatant was collected and stored at -20 ° C. Tissue samples were cut into 10% triturate in PBS, and the tissue homogenizer (Bertin technologies, France ). Thereafter, the supernatant was collected by centrifugation at 8,000 rpm for 10 minutes, and then stored at -20 ° C. In addition, DNA extraction for LAMP and PCR was performed using commercially available nucleic acid extraction kit (Inclone biotech, Korea) from the serum and tissue samples stored on the day of the experiment. The pathogen, its isolate, and the source of the pathogen are shown in Table 1.

Pathogen Strain Source * Porcine circovirus 2 PCK0201 ADIC Porcine circovirus 1 Field isolate ADIC PRRS virus, genotype 1 Lelystad virus QIA PRRS virus, genotype 2 LMY strain QIA Classical swine fever virus LOM strain Vaccine strain Swine influenza virus A / Korea / VD01 / 2009 QIA Mycoplasma hyopneumoniae Field isolate ADIC Pasteurella  mμ ltocida Field isolate ADIC Hemophilus parasuis Field isolate ADIC Actinobacillus pleuropneumoniae Field isolate ADIC

Example  2. For LAMP primer  design

A primer set was designed to detect porcine circovirus type 2 using the LAMP method.

Specifically, all PCV1 and PCV2 open reading frame (ORF) 1 and 2 genes registered in GenBank between 2005 and 2014, using the MN-NP162 virus genome sequence (GenBank accession number EF452353) After obtaining the nucleotide sequence information, the most stable site was selected by comparing and analyzing with DNASTAR® Lasergene (DNASTAR, Inc., USA) program. Primer-Explorer V3 software (http://primerexplorer.jp/ (FIP) and backward inner primer (BIP)], two external primers (F3 and B3), and two internal primers (F3 and B3) using E / index.html Loop loop primer (LF) and B loop primer (LB) were designed. The designed primer set was synthesized by a primer manufacturer (Bioneer Co., Korea). The site and specific sequence of the designed primer set are shown in FIG. 1 and Table 2.

Primer characteristics Primer name Sequence (5'-3 ') SEQ ID NO: External primer PCV2-F3 GGGAGTCTGGTGACCGTT SEQ ID NO: 1 PCV2-B3 CCATCCCACCACTTGTTTCT SEQ ID NO: 2 Loop primer PCV2-LF TTCAAAAGTTCAGCCAGCCC SEQ ID NO: 3 PCV2-LB TGGGTGTGGTAAAAGCAAATGG SEQ ID NO: 4 Internal primer PCV2-FIP
(F1c + F2) ACGCTTCTGCATTTTCCCGCTCAGCAGCACCCTGTAACGT SEQ ID NO: 5 PCV2-BIP
(B1 + B2c) CACGTCATTGTGGGGCCACCTTCCAGTATGTGGTTTCCGG SEQ ID NO: 6

Example  3. The primer  Establishment of Optimum Reaction Conditions for LAMP Method Using Set

Optimal reaction conditions of the LAMP method using the primer set of the present invention prepared in Example 2 were established.

Specifically, the composition of the reaction solution for performing LAMP was in accordance with the composition of the reaction solution described in Zhao et al. (2011, Virology J 8: 126). (Sigma-Aldrich, USA), 20 mM Tris-HCl (pH 8.8), 10 mM KCl, 4 mM MgSO 4 , 10 mM (NH 4 ) 2 SO 4, 0.1% Triton X -100, 1.6 mM of dNTPs, 3 mM HNB (Lemongreen, Shanghai, China), loop primer of each of SEQ ID NOS: 1 and 2 5 pmol, SEQ ID NOS: 3 and 4, each 20 pmol, SEQ ID NO: And 40 pmol of each of the internal primers of No. 5 and 6 were added to prepare a reaction solution. 5 μl of the DNA sample extracted in Example 1 was added to the reaction solution, and the final volume was adjusted to 25 μl with sterile distilled water. In order to establish optimal LAMP conditions suitable for PCV2 detection, DNA extracted from virus culture was subjected to LAMP at different reaction temperatures (45-68 ° C) and reaction times (10-40 minutes), followed by treatment at 80 ° C for 5 minutes To remove the enzyme activity in the reaction solution. The reaction solution of the reaction-terminated tube was visually observed to observe the change in color, and the presence or absence of the reaction was read (FIG. 2 (A)). At the same time, 2.0% agarose gel was subjected to electrophoresis, and the amplified gene bands, which were specifically expressed in the LAMP reaction, were identified using an ultraviolet reader (Bio-Rad, USA) 2 (B)). The results are shown in Fig.

FIG. 2 shows the result of positive reaction at a reaction temperature of 45 to 68.degree. C. (A) shows the color change of the reaction solution of the tube after the LAMP reaction, and (B) shows the result of electrophoresis. Lanes 1 to 7 represent 45, 50, 55, 60, 63, 65 and 68 占 폚, respectively. FIG. 3 shows that the lanes 1 to 4 dilute the PCV2 DNA by 10 times as a result of confirming the positive reaction at the reaction times of 10, 20, 30 and 40 minutes.

As shown in FIG. 2, it was confirmed that HNB specific positive hues of sky blue were observed at 55, 60, 63 and 65 ° C. (A). In addition, it was confirmed that a distinctive trapezoidal positive band was most evident on the electrophoresis at a reaction temperature of 63 ° C (B).

Further, as shown in FIG. 3, it was confirmed that positive bands were clearly observed at all dilution ratios when reacted for 40 minutes.

Therefore, all subsequent experiments were carried out with fixed reaction conditions at a reaction temperature of 63 ° C and a reaction time of 40 minutes.

Example  4. The primer  LAMP method using set Seokovirus  Type 2 detection specificity analysis

In order to confirm whether or not only the porcine circovirus type 2 was detected except the porcine origin pathogen at the time of the LAMP method diagnosis using the primer set of the present invention, the nucleic acid-extracted porcine circovirus type 2 and the porcine respiratory and systemic pathogens The detection specificity of porcine circovirus type 2 was analyzed.

Specifically, for the porcine circovirus type 2 and porcine respiratory and systemic pathogens extracted in Example 1 and shown in Table 1, the primer set of the present invention (sequence Lanes 1 to 6) were used to perform LAMP. The results are shown in Fig.

The tube 1 of FIG. 4 is a porcine reproductive and respiratory syndrome virus (PRRSV) genotype 1, the tube 4 is a porcine circovirus syndrome virus Genotype 2, tube 5, classical swine fever virus, tube 6, swine influenza virus, tube 7, Mycoplasma hyopneumoniae ), Tube 8 is Pasteurella multocida , Tube 9 is Haemophilus parasuis , tube 10 is Actinobacillus < RTI ID = 0.0 > pleuropneumoniae ), and NC represents a negative control.

As shown in FIG. 4, the primer set of the present invention specifically amplified only ORF2 gene of porcine circovirus type 2, confirming that HNB-specific positive hue appears (Tube 1).

Therefore, when the primer set of the present invention is used, only the porcine swine virus type 2 is specifically amplified. When the positive reaction is read using HNB, the contamination rate is higher than that of the case of confirming by gel electrophoresis or DNA staining solution addition Low and simple.

Example  5. The primer  LAMP method using different sets of Primer  Conventional PCR  Law and Real-time PCR Law pig Seokovirus  2 Type Sensitivity Analysis

Conventional PCR and real-time PCR using primers of sequences other than the LAMP method using the primer set of the present invention were performed to confirm the difference in sensitivity to detection of porcine circovirus type 2.

5-1. conventional PCR ( cPCR ) Condition to perform

cPCR is recommended by the manufacturer using the commercially available PCV2 diagnostic kit (VDx PCV2 ORF2 PCR kit, Median diagnostics, Korea), which is mainly used for the diagnosis of porcine circovirus type 2 in the agricultural, forestry and livestock quarantine headquarters Respectively. The primers used were the previously known forward primer (CACGGATATTGTAGTCCTGGTCG) and reverse primer (CGCACCTTCGGATATACTG) (Ouardani et al, 1999, J Clin Microbiol 37: 3917-3924). 5 μl of the DNA extracted from Example 1 was added to the PCR premix and then treated at 95 ° C for 5 minutes using a PCR amplifier (Biometra, Germany) and subjected to 35 cycles of PCR (denaturation at 95 ° C for 20 seconds; annealing at 55 ° C , Extension at 72 ° C for 30 seconds) and final reaction at 72 ° C for 5 minutes. PCR amplification products were electrophoresed on a 1.5% agarose gel by adding NEO green staining solution (NEO science, Korea) and then read by observing a 493 bp specific band with an ultraviolet reader (Bio-Rad, USA).

5-2. Real-time PCR ( rPCR ) Condition to perform

Real-time PCR was performed using PCV-tF primer (AGGAGGGCGTTCTGACTGTG), PCV-tR (ACCGCTACCGTTGGAGAAGG) and PCV-tProbe (FAM-TCTTCAACACCCGCCTCTCCCGCAC-TAMRA) according to the method of Kim et al. (2009, Korean J Vet Serv 32: 299-306) Was performed using a commercially available Premix Ex Taq kit (TaKaRa, Japan). 12.5 μL of Premix Ex Taq, 0.4 μL of each primer, and 5 μL of the DNA template extracted in Example 1 were added to the reaction solution to which a probe was added, and the final volume was adjusted to 25 μL with sterilized distilled water. The rPCR reaction was performed using a real-time nucleic acid amplifier (Applied Biosystems, USA) for 30 seconds at 95 ° C and 40 cycles of PCR (denaturation at 95 ° C for 20 seconds, annealing at 56 ° C for 1 minute) Was 37 or less.

5-3. Pigs of each diagnostic method Circovirus  2-type detection sensitivity measurement

The sensitivity between the LAMP method using the primer set of the present invention and the conventional PCR method using the primers of other sequences and the real-time PCR method was confirmed.

Specifically, the culture of the porcine circovirus type 2 was diluted 10-fold with PBS (pH 7.2), and then subjected to conventional PCR and real-time PCR using primers of other sequences than the LAMP method using the primer set of the present invention To compare the sensitivities between the diagnostic methods. For the gene used for the sensitivity measurement, 200 μL of each sample dilution was taken out, and the nucleic acid was extracted by using a commercially available nucleic acid extraction kit (Inclone biotech, Korea) according to the manufacturer's method, and eluted into 50 μL of distilled water. . The results are shown in Fig.

FIG. 5A shows the color change of the reaction solution of the tube after the LAMP reaction using the primer set of the present invention, and FIG. 5B shows the results of electrophoresis. (C) is the result of conventional PCR, and (D) is the result of real time PCR. 1 to 9 of the above (A) to (D) show that the ORF gene of porcine circovirus type 2 was diluted by 10-fold.

As shown in FIG. 5, the sensitivity of the LAMP method using the primer of the present invention was compared with that of the existing cPCR and rPCR. As a result, the LAMP method using the primer of the present invention was 10 -6 to a dilution factor of up to seven times lane), the old cPCR was 10 5 (to dilution factor of up to six lanes) of Figure 5 C, the old rPCR 10 5 (6 detected in Fig. 5 D Line) to the dilution level. Therefore, it was confirmed that the LAMP method using the primer of the present invention was 10 times more sensitive than the conventional cPCR and rPCR. In addition, the detection limit of rPCR is reported to be 10 copies / uL (Kim et al., 2009, Korean J Vet Serv 32: 299-306), and the sensitivity of the LAMP method using the primer set of the present invention is about 1 copy / uL Respectively.

5-4. For outdoor samples cPCR , rPCR  And LAMP Pigs Circovirus  2 Type Detection Efficiency Comparison

The detection efficiency of the outdoor samples was confirmed between the conventional PCR method using the primers of the different sequences and the real-time PCR method using the LAMP method using the primer set of the present invention.

Specifically, nucleic acid was extracted from 48 pig tissue samples and 52 serum samples of PCVD diseased farms, which were stored and stored in the control center of the Veterinary Infectious Disease Control Center of Kyungpook National University in 2015, by the method of Example 1. Thereafter, the LAMP method, the cPCR method and the rPCR method of the present invention were carried out, and the results were compared. The results are shown in Table 3.

Sample No. of sample No. of PCV2 DNA positive / negative
(positive ratio,%) cPCR rPCR LAMP Tissue 48 36/12 (75.0) 36/12 (75.0) 36/12 (75.0) Blood 52 35/17 (67.3) 35/17 (67.3) 39/13 (75.0) Total 100 71/29 (71.0) 71/29 (71.0) 75/25 (75.0)

As shown in Table 3, the conventional cPCR and rPCR of the blood sample were found to be positive in 35 out of 52 points. However, when the LAMP method using the primer set of the present invention was performed, it was judged as a negative sample in the existing cPCR and rPCR 39 points including 4 points were confirmed to be positive. Thus, it was confirmed that the LAMP method using the primer set of the present invention was superior to the conventional detection method.

Therefore, when performing the LAMP using the primer set of the present invention, only the porcine circovirus type 2 is detected even at a low concentration, and the specificity for detecting only the porcine circovirus type 2 except the other pathogen occurring in the pig is high Respectively. In addition, it was confirmed that the possibility of contamination was low because HNB was applied and the result of reaction could be directly visually confirmed without a separate reader.

<110> Kyungpook National University Industry-Academic Cooperation Foundation <120> Compositions for detecting porcine circovirus type 2 and method          for detecting porcine circovirus type 2 using the same <130> 1-270 <160> 6 <170> Kopatentin 2.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Outer Primer PCV2-F3 <400> 1 gggagtctgg tgaccgtt 18 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Outer Primer PCV2-B3 <400> 2 ccatcccacc acttgtttct 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> loop primer PCV2-LF <400> 3 ttcaaaagtt cagccagccc 20 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> loop primer PCV2-LB <400> 4 tgggtgtggt aaaagcaaat gg 22 <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <220> Inner primer PCV2-FIP (F1c + F2) <400> 5 acgcttctgc attttcccgc tcagcagcac cctgtaacgt 40 <210> 6 <211> 40 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > inner primer PCV2-BIP (B1 + B2c) <400> 6 cacgtcattg tggggccacc ttccagtatg tggtttccgg 40

Claims (10)

A first primer set consisting of SEQ ID NOS: 1 and 2; A second primer set consisting of SEQ ID NOS: 3 and 4; And a third primer set consisting of SEQ ID NOS: 5 and 6, and a primer set for detecting porcine circovirus 2 (PCV2). The method according to claim 1,
Wherein the primer set is for LAMP (Loop Mediated Isothermal Amplification). The method according to claim 1,
Wherein the primer set is targeted to an ORF (open reading frame) gene of porcine circovirus type 2. A composition for detecting porcine circovirus type 2 comprising the primer set of any one of claims 1 to 3. A kit for detecting porcine circovirus type 2 comprising the composition of claim 4. (1) extracting DNA of a sample; And
(2) a first primer set consisting of SEQ ID NOS: 1 and 2, using the DNA of (1) as a template; A second primer set consisting of SEQ ID NOS: 3 and 4; And a third primer set consisting of SEQ ID NOS: 5 and 6, and then detecting the isothermal amplification product. The method according to claim 6,
Wherein the sample of step (1) is at least one species selected from the group consisting of tissue, blood, saliva, urine, and body fluids. The method according to claim 6,
Wherein the isothermal amplification reaction in step (2) is performed at 45 to 68 ° C. The method according to claim 6,
Wherein the isothermal amplification reaction in step (2) is carried out with LAMP. The method according to claim 6,
The detection of step (2) is carried out with at least one member selected from the group consisting of gel electrophoresis, turbidity measurement of reaction products, radioactivity measurement, fluorescence measurement, phosphorescence measurement and color development indicator measurement. Type detection method.
KR1020150152309A 2015-10-30 2015-10-30 Compositions for detecting porcine circovirus type 2 and method for detecting porcine circovirus type 2 using the same KR101729980B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020150152309A KR101729980B1 (en) 2015-10-30 2015-10-30 Compositions for detecting porcine circovirus type 2 and method for detecting porcine circovirus type 2 using the same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020150152309A KR101729980B1 (en) 2015-10-30 2015-10-30 Compositions for detecting porcine circovirus type 2 and method for detecting porcine circovirus type 2 using the same

Publications (1)

Publication Number Publication Date
KR101729980B1 true KR101729980B1 (en) 2017-04-25

Family

ID=58703573

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020150152309A KR101729980B1 (en) 2015-10-30 2015-10-30 Compositions for detecting porcine circovirus type 2 and method for detecting porcine circovirus type 2 using the same

Country Status (1)

Country Link
KR (1) KR101729980B1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107881261A (en) * 2017-12-23 2018-04-06 广东省农业科学院动物卫生研究所 Detect LAMP primer group, kit and the application of the type of pig circular ring virus 3
CN109517929A (en) * 2018-12-21 2019-03-26 武汉科前生物股份有限公司 Primer sets and kit for pig circular ring virus detection and 2 type partings
CN112176104A (en) * 2020-10-09 2021-01-05 中国农业科学院兰州兽医研究所 Visual LAMP (loop-mediated isothermal amplification) detection kit for porcine circovirus type 3
CN114381554A (en) * 2022-02-10 2022-04-22 国科宁波生命与健康产业研究院 CDA primer pair and kit for detecting porcine circovirus type II and application of CDA primer pair and kit

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Chen 등. Journal of Virological Methods. Vol. 149, No. 2, 페이지 264-268 (2008.03.19.)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107881261A (en) * 2017-12-23 2018-04-06 广东省农业科学院动物卫生研究所 Detect LAMP primer group, kit and the application of the type of pig circular ring virus 3
CN109517929A (en) * 2018-12-21 2019-03-26 武汉科前生物股份有限公司 Primer sets and kit for pig circular ring virus detection and 2 type partings
CN112176104A (en) * 2020-10-09 2021-01-05 中国农业科学院兰州兽医研究所 Visual LAMP (loop-mediated isothermal amplification) detection kit for porcine circovirus type 3
CN114381554A (en) * 2022-02-10 2022-04-22 国科宁波生命与健康产业研究院 CDA primer pair and kit for detecting porcine circovirus type II and application of CDA primer pair and kit

Similar Documents

Publication Publication Date Title
CN104862406B (en) A kind of primer for field quick detection mycobacterium tuberculosis complex and probe and its kit
KR101729980B1 (en) Compositions for detecting porcine circovirus type 2 and method for detecting porcine circovirus type 2 using the same
CN104946749B (en) A kind of universal primer for field quick detection brucella and probe and kit
Park et al. Loop-mediated isothermal amplification assay for the rapid and visual detection of novel porcine circovirus 3
CN110229932B (en) African swine fever virus nucleic acid extraction-free fluorescent isothermal amplification detection kit
Kim et al. Detection of a novel porcine circovirus 4 in Korean pig herds using a loop-mediated isothermal amplification assay
KR101149422B1 (en) Primers and its application in multiplex PCR to identify Rinderpest, Peste-des-petits-ruminants virus, Bluetongue virus and Rift Valley fever
KR20190092821A (en) Primer set for detection of Foot-and-Mouth Disease virus and use thereof
KR20230101589A (en) Compositions for detecting porcine epidemic diarrhea virus and method for detecting porcine epidemic diarrhea virus using the same
Kim et al. Differential diagnosis of Brucella abortus by real-time PCR based on a single-nucleotide polymorphisms
KR20160053214A (en) Composition for diagnosing porcine reproductive and respiratory syndrome virus and method for diagnosing the same
Zheng et al. RPA-Cas12aDS: A visual and fast molecular diagnostics platform based on RPA-CRISPR-Cas12a method for infectious bursal disease virus detection
JP2008206516A (en) Method for measuring number of oral streptococci, and pcr primer and probe set used for the same
CN110218803B (en) PCR primer pair and kit for human-mouse co-pathogenic microorganisms and application of PCR primer pair and kit
KR20230099206A (en) Compositions for detecting porcine circovirus type 4 and method for detecting porcine circovirus type 4 using the same
KR101729977B1 (en) Compositions for detecting swine influenza virus and method for detecting swine influenza virus using the same
CN116814857A (en) Cat parvovirus and kit thereof and fluorescent recombinase polymerase amplification method
CN104388593B (en) Taqman Real-time PCR (polymerase chain reaction) kit for detecting porcine circovirus
Chae et al. An advanced loop-mediated isothermal amplification assay for the rapid detection of beak and feather disease virus in psittacine birds
KR101758609B1 (en) Compositions for detecting Japanese encephalitis virus and identifying genotype
KR20180136686A (en) Primers for LAMP based detection of virus causing immune suppression in poultry and its use
KR102146394B1 (en) Primer set for detection of serotype A Foot-and-Mouth Disease viruses and uses thereof
CN115572774A (en) Method for identifying new infectious disease virus of three chicken flocks
JP7176682B2 (en) A primer set for detecting a trichophyton gene by the LAMP method, a kit containing the same, and a method for detecting trichophyton using them
Park et al. Development of a colorimetric loop-mediated isothermal amplification assay for rapid and specific detection of Aves polyomavirus 1 from psittacine birds

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant