KR102145000B1 - Enzyme used in synthesis of 1,4-BDO, variant thereof and method for 1,4-butanediol using the same - Google Patents

Abstract

In one embodiment, the reaction of producing 4-hydroxybutylaldehyde in 4-hydroxybutyryl-CoA, which is two reactions at the end of the 1,4-butanediol biosynthetic pathway, and the reaction for producing 1,4-BDO from 4-hydroxybutylaldehyde. On the other hand, the enzymes butylaldehyde dehydrogenase and butanol dehydrogenase, which have not been reported to date, were introduced from Clostridium saccharoperbutylacetonicum and expressed in Escherichia coli, indicating that they have the ability to produce 1,4-BDO. Confirmed. In particular, the butylaldehyde dehydrogenase enzyme was enhanced by a directed evolution method to increase the production concentration of 1,4-BDO by more than two times.

Description

Enzyme used in synthesis of 1,4-BDO, variant thereof and method for 1,4-butanediol using the enzyme used in the biosynthesis of 1,4-butanediol in E. coli, its variant, and the method for producing 1,4-butanediol using the same the same}

One aspect relates to an improved butylaldehyde dehydrogenase and a transforming microorganism comprising the same to efficiently produce 1,4-BDO.

One aspect relates to a method capable of producing 1,4-BDO with high efficiency using the transformed microorganism.

4-Butanediol (1,4-BDO) is a solvent that uses about 1.3 million tonnes per year worldwide and is produced from petroleum-based materials such as acetylene, butane, propylene and butadiene. The 1,4-butanediol is widely used in the chemical industry as various chemical substances such as polymers, solvents, and fine chemical intermediates. Currently, most of the chemicals having 4 carbon atoms are derived from 1,4-butanediol and maleic anhydride and are synthesized. However, as the oil price increases, the production cost increases, so the development of a process that complements and replaces the chemical production process is difficult. It is a demanded situation. Thus, as an alternative to the chemical production process, a biological process using microorganisms has been proposed.

Unlike the conventional method of producing by a chemical method, in Genomatica in 2011, succinyl-CoA synthetase (succinyl-CoA synthetase) in E. coli Cat 1), succinate semialdehyde dehydrogenase ( SucCD), 4-hydroxybutyrate dehydrogenase (NAD dependent 4-hydroxybutyrate dehydrogenase, 4hbd), 4-hydroxybutyryl CoA: acetyl- CoA transferase (4-hydroxybutyryl CoA: acetyl-CoA transferase (Cat2) and alcohol dehydrogenase (AdhE2) genes were used to construct a 1,4-BDO biosynthetic circuit. However, many studies are being conducted to more efficiently produce 1,4-BDO. In order to increase the efficiency of 1,4-BDO biosynthesis, a new biosynthetic pathway was constructed by modifying the biosynthetic circuit already revealed in E. coli. In addition, a microorganism capable of efficiently producing 1,4-BDO was developed by discovering the most suitable butylaldehyde dehydrogenase gene variant for this pathway.

One aspect provides a recombinant butylaldehyde dehydrogenase capable of producing 1,4-BOD with high efficiency.

Another aspect provides a transforming microorganism comprising a recombinant butylaldehyde dehydrogenase so that 1,4-BDO can be produced with high efficiency.

Another aspect provides a transformed microorganism comprising a recombinant butylaldehyde dehydrogenase gene and a butanol dehydrogenase gene so that 1,4-BDO can be produced with high efficiency.

Another aspect is the succinyl-CoA: coenzyme A transferase gene, coenzyme A dependent succinate semialdehyde dehydrogenase gene, and 4-hydroxybutyrate dehydrogenase so that 1,4-BDO can be efficiently produced. A transgenic microorganism comprising a gene, a 4-hydroxybutyryl CoA:acetyl-CoA transferase gene, a butylaldehyde dehydrogenase gene, and a butanol dehydrogenase gene is provided.

One aspect is for butylaldehyde dehydrogenase variants.

One embodiment provides a butylaldehyde dehydrogenase or a variant thereof having the activity of catalyzing the conversion of 4-hydroxybutyryl CoA to 4-hydroxybutylaldehyde. The butylaldehyde dehydrogenase is an enzyme having an activity of catalyzing the conversion of butyryl-CoA to butyraldehyde. The butylaldehyde dehydrogenase is also referred to as "butyraldehyde dehydrogenase" or "bld". In this case, the enzyme may be an enzyme classified as EC 1.2.1. At this time, the enzyme may have an activity of catalyzing the conversion of 4-hydroxybutyryl CoA to 4-hydroxybutylaldehyde. In addition, the enzyme may be a gene derived from Clostridium saccharoperbutylacetonicum. The butylaldehyde dehydrogenase may have the polypeptide of SEQ ID NO: 1.

At this time, the butylaldehyde dehydrogenase may be SEQ ID NO: 1. In addition, in the butylaldehyde dehydrogenase variant, the 273 th Leu in SEQ ID NO: 1 may be substituted with Ile, Cys, Met, Ser, Thr or Val. In addition, the butylaldehyde dehydrogenase variant may have any one amino acid sequence selected from the group consisting of SEQ ID NOs: 2 to 7.

In addition, the butylaldehyde dehydrogenase variant is at least one selected from the group consisting of 409 th Asn, 361 th Arg, 467 th Ala, 371 th Met, 176 th Ala, 273 th Leu and 279 th Lys in SEQ ID NO: 1 The amino acid may be substituted with another amino acid.

In addition, in the butylaldehyde dehydrogenase variant SEQ ID NO: 1, the 409 th Asn may be substituted with Thr, the 361 th Arg may be substituted with Ser, and the 467 th Ala may be substituted with Ser. In addition, in the bld variant SEQ ID NO: 1, the 361 th Arg may be substituted with Ser, and the 467 th Ala may be substituted with Ser. In addition, in the bld variant SEQ ID NO: 1, 371 th Met may be substituted with Arg, 361 th Arg may be substituted with Ser, and 467 th Ala may be substituted with Ser. In addition, in the bld variant, the 176th Ala in SEQ ID NO: 1 is substituted with Thr, the 273th Leu is substituted with Ile, the 279th Lys is substituted with Arg, the 361th Arg is substituted with Ser, and the 467th Ala is It may be substituted with Ser. In addition, the butylaldehyde dehydrogenase variant may be one in which the 176th Ala in SEQ ID NO: 1 is substituted with Thr. In addition, the butylaldehyde dehydrogenase variant may be one in which the 279th Lys in SEQ ID NO: 1 is substituted with Arg. In addition, the butylaldehyde dehydrogenase variant may be one in which the 361 th Arg in SEQ ID NO: 1 is substituted with Ser. In addition, the butylaldehyde dehydrogenase variant may be one in which the 467 th Ala in SEQ ID NO: 1 is substituted with Ser. In addition, the butylaldehyde dehydrogenase variant may be one in which the 409 th Asn in SEQ ID NO: 1 is substituted with Thr. In addition, the butylaldehyde dehydrogenase variant may be one in which the 361 th Arg in SEQ ID NO: 1 is substituted with Ser.

In addition, the variant has an active site (catalytic site) in SEQ ID NO: 1, Thr at 43, Asn at 144, Ala at 241, Gly at 242, Ala at 243, Ala at 244 Gly on the 246th, Leu on the 273th, Pro on the 274th, Ile on the 276th, Ala on the 277th, Lys on the 279th, Glu on the 368th, His on the 398th , At least one amino acid selected from the group consisting of Val at the 432th position and Thr at the 441th position may be substituted with another amino acid.

In addition, the active site of the variant is Thr at the 43rd position, Asp at the 144th position, Asn at the 144th position, Ala at the 241st position, Val, the 242nd at Gly at Ser, the 243th at Ala at Gly, 244th Gly located at Ser, Pro at 246th is Tyr, Leu at 273th is Ile, Cys, Met, Ser, Thr or Val, Pro at 274th is Tyr, and Ile at 276th is Leu, 277th Ala at the position of Val, Lys at the 279th position is Arg, Glu at the 368th position is Gln, His at the 398th position is Lys, Val at the 432th position is Leu, and Thr at the 441th position is substituted with Asp. have.

In addition, the variant is Met at the 91st position in SEQ ID NO: 1, Ile at the 139th position, Thr at the 140th position, Pro at the 141st position, Ser at the 142nd position, Thr at the 143th position, Asn at the 166th position. , Gly at 167, His at 168, Pro at 169, Gly at 170, Asn at 201, Pro at 202, Thr at 203, Met at 204, Met, 207 Leu at the 208th, Asp at the 208th, Ile at the 210th, Ile at the 211th, Lys at the 212th, Thr at the 222nd, Gly at the 223th, Gly at the 224th, Gly at the 225th Pro at the 227th, Thr at the 230th, Leu at the 231st, Ala at the 241st, Gly at the 242nd, Ala at the 243th, Gly at the 244th, Leu at the 273th ,, Pro at 274, Cys at 275, Ser at 326, Ile at 327, Asn at 328, Lys at 329, Val at 332, Thr at 367, At least one amino acid selected from the group consisting of Glu at position 368, Leu at position 369, Met at position 370, and Arg at position 396 may be a butylaldehyde dehydrogenase variant in which at least one amino acid is substituted with another amino acid. have.

In particular, in SEQ ID NO: 1, Met at the 91st position is Asp, Ile at the 139th position is Leu, Thr at the 140th position is Lys, Pro at the 141st position is Tyr, and Ser at 142th position is Gly, 143 Thr at the 166th is Lys, Asn at the 166th is Asp, Gly at the 167th is Ser, His at the 168th is Lys, Pro at the 169th is Tyr, Gly at the 170th is Ser, and 201th Asn is located at Asp, Pro at 202 is Tyr, Thr at 203 is Lys, Met at 204 is Asp, Leu at 207 is Ile, Asp at 208 is Asn, Ile at 210th This Leu, Ile at the 211th is Leu, Lys at the 212th, Thr at the 222nd is Lys, Gly at the 223th is Ser, Gly at the 224th is Ser, and Pro at the 225th is His, 227 The Met at the second is Lys, the Thr at the 230th is Lys, the Leu at the 231th is Val, the Ala at the 241th is Val, Gly at the 242th is Ser, Ala at the 243th is Val, and 244th Gly is located at Ser, Leu at 273 is Ile, Cys, Met, Ser, Thr or Val, Pro at 274 is His, Cys at 275 is Met, Ser at 326 is Gly, 327 is Ile is located at Leu, Asn at the 328th is Asp, Lys at the 329th, Val at the 332th is Leu, Thr at the 367th is Lys, Glu is Gln at the 368th, Leu at the 369th is Leu , Met at the 370th position may be Lys and Arg at the 396th position may be substituted with Lys.

In addition, the butylaldehyde dehydrogenase variant may be a polypeptide of the sequence of SEQ ID NO: 2 in which the 273 th amino acid of SEQ ID NO: 1 is Ile.

Further, the variant may be a polypeptide of the sequence of SEQ ID NO: 3 in which the 273 th amino acid of SEQ ID NO: 1 is Cys.

In addition, the variant may be a polypeptide of the sequence of SEQ ID NO: 4 in which the 273 th amino acid of SEQ ID NO: 1 is Met.

In addition, the variant may be a polypeptide of the sequence of SEQ ID NO: 5 in which the 273 th amino acid of SEQ ID NO: 1 is Ser.

In addition, the variant may be a polypeptide of the sequence of SEQ ID NO: 6 in which the 273 th amino acid of SEQ ID NO: 1 is Thr.

In addition, the variant may be a polypeptide of the sequence of SEQ ID NO: 7 in which the 273 th amino acid of SEQ ID NO: 1 is Val. Another embodiment is the butylaldehyde dehydrogenase gene encoding the butylaldehyde dehydrogenase variant. to provide. At this time, the gene may be derived from Clostridium saccharoperbutylacetonicum.

Another embodiment provides a microorganism capable of producing 1,4-BDO into which the gene has been introduced. The microorganism contains an enzyme having an activity to catalyze the conversion of 4-hydroxybutylaldehyde to 1,4-BDO. At this time, the enzyme having the above activity is referred to as "butanol dehydrogenase" or "bdh". The microorganism may have a butanol dehydrogenase gene further introduced therein. In this case, the gene may have the amino acid sequence of SEQ ID NO: 8. The polynucleotide encoding the butanol dehydrogenase may have a nucleotide sequence of SEQ ID NO: 9.

Microorganisms capable of producing 1,4-BDO include an enzyme that converts succinate to succinyl-CoA, an enzyme that converts succinyl-CoA to succinyl semialdehyde, and succinyl semialdehyde to 4-hydroxybutyrate ( It may include an enzyme that converts 4-hydroxybutyrate) and an enzyme that converts 4-hydroxybutyrate to 4-hydroxybutyrate-CoA.

The term "polynucleotide" used in the specification has a meaning that comprehensively includes DNA (gDNA and cDNA) and RNA molecules, and nucleotides, which are basic structural units in polynucleotides, are not only natural nucleotides, but also sugar or base moieties modified. Also includes an analogue. At this time, the enzyme that converts the succinate to succinyl-CoA may be succinyl-CoA: coenzyme A transferase (succinyl-CoA: coenzyme A transferase). The enzyme may be an enzyme classified as EC.2.8.3. In one embodiment, the enzyme may be Cat1. The Cat1 is of SEQ ID NO: 10 (see PN098079) It may have an amino acid sequence. The polynucleotide encoding Cat1 may have a nucleotide sequence of SEQ ID NO: 11.

At this time, the enzyme that converts the succinyl-CoA to succinyl semialdehyde may be the coenzyme A-dependent succinate semialdehyde dehydrogenase (CoA-dependent succinate semialdehyde dehydrogenase). The enzyme may be an enzyme classified as EC 1.2.1. In one embodiment, the enzyme may be SucD. Coenzyme A-dependent succinic acid-semialdehyde dehydrogenase is a protein derived from Escherichia coli, Corynebacterium or Porphyromonas Can be At this time, the sucD protein may have the amino acid sequence of SEQ ID NO: 12. The polynucleotide encoding SucD may have a nucleotide sequence of SEQ ID NO: 13.

In addition, an enzyme that converts succinyl semialdehyde to 4-hydroxybutyrate may be 4-hydroxybutyrate dehydrogenase. The enzyme may be an enzyme classified as EC 1.1.1. In addition, the enzyme may be 4Hbd. At this time, 4HB dehydrogenase may be a protein derived from E. coli, Corynebacterium, or Porphyromonas. In this case, the 4Hbd protein may have the amino acid sequence of SEQ ID NO: 14. The polynucleotide encoding 4HbD may have a nucleotide sequence of SEQ ID NO: 15.

In addition, the enzyme that converts 4-hydroxybutyrate to 4-hydroxybutyrate-CoA may be 4-hydroxybutyryl CoA:acetyl-CoA transferase (4-hydroxybutyryl CoA:acetyl-CoA transferase). The enzyme may be an enzyme classified as EC 2.8.3. In one embodiment, the enzyme may be Cat2. At this time, the 4-hydroxybutyryl CoA transferase may be a protein derived from Escherichia coli, Corynebacterium, or Porphyromonas. At this time, the Cat2 protein may have the amino acid sequence of SEQ ID NO: 16. The polynucleotide encoding Cat2 may have a nucleotide sequence of SEQ ID NO: 17.

In addition, as an example, the microorganism producing 1,4-BDO may be a microorganism expressing SucD protein, 4Hbd protein, Cat2 protein, and Cat1 protein. In this case, the microorganism may be E. coli .

As used herein, the term "protein expression" means that a protein or enzyme is present and active in a microorganism. In addition, the protein or enzyme may be transcribed into mRNA from a polynucleotide encoding a protein present in a microorganism and translated into a protein. At this time, the polynucleotide encoding the protein may exist by being inserted into a chromosome in a microorganism, and may exist in a plasmid vector.

The microorganism producing the 1,4-BDO compound may be a microorganism in which a pathway for synthesizing lactate from pyruvate is inactivated or reduced. The microorganism may have the activity of L-lactate dehydrogenase (Ldh) removed or reduced. The Ldh may have an activity of catalyzing a reaction of converting pyruvate to lactate. The Ldh may be an enzyme classified as EC.1.1.1.27. The microorganism may be a gene encoding L-lactate dehydrogenase is inactivated or attenuated.

The term "inactivation" as used in the specification may mean that a gene that is not expressed at all or a gene that has no activity even if it is expressed is generated. The term "attenuation" may mean that the expression of a gene is reduced to a low level compared to a wild strain, an unmanipulated strain, or a parent strain, or even when expressed, a gene whose activity is reduced is generated. . The decrease in the activity of Ldh among the microorganisms may be 30% or less, 20% or less, or 10% or less compared to the activity of Ldh in the wild-type microorganism. In addition, the activity of Ldh in the microorganism may be completely removed. The inactivation or attenuation can be caused by homologous recombination. In the inactivation or attenuation, a vector containing a partial sequence of the gene is transformed into a cell, and the cell is cultured so that the sequence is homologous recombination with the endogenous gene of the cell, and then the cell in which the homologous recombination has occurred is selected as a selection marker. It can be achieved by selecting by The microorganism may be one in which the activity of the enzyme encoded by the gene is removed or decreased due to inactivation or attenuation of the gene. The term "reduction" may refer to the activity in the engineered microorganism relative to the non-engineered microorganism.

Inactivation or attenuation of the activity of lactate dehydrogenase among the microorganisms may be achieved by mutation of a gene encoding lactate dehydrogenase. The mutation may be a nucleotide substitution, partial or full deletion, or addition. In addition, the decrease in the activity of lactate dehydrogenase among the microorganisms can be achieved by removing the intrinsic lactate dehydrogenase gene. The removal includes not only physical removal of the gene, but also rendering it not functionally expressed. The removal may be accomplished by homologous recombination.

As used herein, the term "transformation" means introducing a gene into a microorganism so that it can be expressed in a microorganism. Transformed genes include anything inserted into the chromosome or located outside the chromosome, as long as it can be expressed in the microorganism. In addition, the gene is a polynucleotide capable of encoding a polypeptide and includes DNA and RNA. As long as the gene is introduced into a microorganism and can be expressed, it may be introduced in any form. For example, the gene may be introduced into a microorganism in the form of an expression cassette, which is a polynucleotide structure containing all elements necessary for self-expression. The expression cassette usually includes a promoter operably linked to the gene, a transcription termination signal, a ribosome binding site, and a translation termination signal. The expression cassette may be in the form of an expression vector capable of self-replicating. In addition, the gene may be introduced into a host cell by itself or in the form of a polynucleotide structure, and may be operably linked to a sequence required for expression in a microorganism.

In addition, it provides a recombinant expression vector comprising a gene encoding the butylaldehyde dehydrogenase variant.

The term “vector” refers to a DNA preparation containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in a suitable host. As the vector, a plasmid vector, a bacteriophage vector, a cosmid vector, and the like may be used. To function as an expression vector, it must contain an origin of replication, a promoter, MCS and a selection marker. The origin of replication gives the plasmid the ability to replicate separately from the chromosome of the host cell, the promoter acts on the transcription process of the inserted foreign gene, and MCS is a multiple cloning site, where foreign genes are inserted through various restriction enzyme sites. The selection marker serves to confirm that the vector has entered the host cell properly. Selectable markers include antibiotic resistance genes commonly used in the art, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin, and tetracycline resistance genes. And, preferably, there is an ampicillin or gentamicin resistance gene in consideration of cost.

On the other hand, when the vector of the present invention uses a prokaryotic cell as a host, it preferably contains a strong promoter such as a lambda PL promoter, a trp promoter, a lac promoter, a T7 promoter, etc., and when using a eukaryotic cell as a host, it is preferably Is a promoter derived from the genome of a mammalian cell (e.g., metallotionine promoter) or a promoter derived from mammalian virus (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, and HSV's tk promoter). Preferably, the promoter is a lambda PL promoter, trp promoter, lac promoter or T7 promoter. Such a promoter is operably linked to the sequence encoding the gene.

In the present specification, the term "operably linked" refers to a functional linkage between a nucleic acid expression control sequence (eg, a promoter, a signal sequence, or an array of transcriptional regulatory factor binding sites) and another nucleic acid sequence, thereby regulating the The sequence controls the transcription and/or translation of the nucleic acid sequence encoding the gene.

Another aspect provides a method of producing 4-hydroxybutylaldehyde comprising the step of contacting 4-hydroxybutyryl CoA with the butylaldehyde dehydrogenase or a variant thereof. The butylaldehyde dehydrogenase or a variant thereof may have an amino acid sequence of SEQ ID NO: 1 to SEQ ID NO: 7.

Another aspect provides a method of producing 1,4-butanediol comprising contacting 4-hydroxybutylaldehyde with butanol dehydrogenase.

Another aspect is the step of contacting 4-hydroxybutyryl CoA and the butylaldehyde dehydrogenase or a variant thereof; And it provides a method for producing 1,4-butanediol comprising the step of contacting butanol dehydrogenase to the reaction product obtained above.

Another aspect is the step of introducing the butylaldehyde dehydrogenase or a variant thereof, butanol dehydrogenase into a microorganism; Culturing the microorganism; And it provides a method for producing 1,4-BDO comprising the step of separating 1,4-BDO from the culture medium.

The carbon source that the microorganism can use may be cultured from monosaccharides, disaccharides, or polysaccharides. Specifically, glucose, fructose, mannose, galactose, and the like may be used. In addition, the nitrogen source that can be used by microorganisms may be organic nitrogen compounds, inorganic nitrogen compounds, and the like. Specifically, it may be an amino acid, an amide, an amine, a nitrate or an ammonium salt. The oxygen condition for culturing the microorganism may be an aerobic condition of a normal oxygen partial pressure, a hypoxic condition containing 0.1 to 10% oxygen in the atmosphere, or an anaerobic condition without oxygen. The term "anaerobic condition" refers to a condition in which the oxygen content is less than that of a normal atmospheric condition. Anaerobic conditions can be created, for example, by supplying carbon dioxide or nitrogen at a flow rate of about 0.1 to 0.4 vvm (Volume per Volume per minute), about 0.2 to 0.3 vvm, or about 0.25 vvm. In addition, the anaerobic condition may have a ventilation rate of about 0 to 0.4 vvm, about 0.1 to 0.3 vvm, and about 0.15 to 0.25 vvm.

In the method of producing 1,4-BDO, the microorganism is succinyl-CoA, which has an activity of converting succinate to succinyl-CoA: a gene encoding coenzyme A transferase, succinyl-CoA. Gene encoding coenzyme A-dependent succinate semialdehyde dehydrogenase having activity to convert to semialdehyde, 4-hydroxybutylate dehydrogena having activity to convert succinyl semialdehyde to 4-hydroxybutyrate The gene encoding the agent and the gene encoding the 4-hydroxybutyryl CoA:acetyl-CoA transferase having the activity of converting 4-hydroxybutyrate to 4-hydroxybutyrate-CoA may be further introduced. have.

In addition, introducing a butylaldehyde dehydrogenase or a butylaldehyde dehydrogenase variant into the microorganism to provide a microorganism; Contacting the culture with a schiff's reagent; And measuring the absorbance to provide a method of confirming the production of 1,4-BDO. At this time, the production amount of 1,4-BDO is confirmed by measuring the production amount of 4-hydroxybutylaldehyde.

In one aspect, it was confirmed that butylaldehyde dehydrogenase and butanol dehydrogenase were introduced and expressed in E. coli in the 1,4-butanediol biosynthetic pathway, resulting in 1,4-BDO production ability. Specifically, a butylaldehyde dehydrogenase variant capable of producing 1,4-BDO with high efficiency was specifically obtained, and a recombinant transgenic microorganism having an improved production concentration of 1,4-BDO by 2 times or more was obtained using this. When the transforming microorganism is used, 1,4-BDO can be efficiently produced.

Figure 1a shows the 1,4-BDO biosynthetic metabolic pathway constructed in E. coli. (A) shows the 1,4-BDO metabolic pathway material constructed from succinate and its enzyme. (B) shows a schematic diagram of a vector introduced into E. coli. Figure 1b shows the 1,4-BDO biosynthetic metabolic pathway constructed in E. coli.
2 shows the results of an aldehyde detection experiment on a plate using Schiff's reagent. (A) shows TOP10 to which foreign genes were not introduced. (B) shows TOP10 into which pSTV-cs4c and pUCM were introduced. (C) shows TOP10 into which pSTV-cs4c and pUCM-bld were introduced.
3 shows the result of confirming the aldehyde reaction when the supernatant obtained by culturing the selected colonies and Schiff's reagent were reacted. A graph is shown when the absorbance was measured at 540 nm after 1 hour reaction. When bld has good activity, a lot of 4-hydroxybutylaldehyde comes out, and it can be confirmed that it can be usefully used for screening due to its color appearance by binding with Schiff's reagent.
Figure 4 is a WT-Bld and various bld variants (Bld-M1 to Bld-M5) cs4c (cat1, sucD, 4hbd and cat2 genes) and Bdh were introduced into the microorganism to show the production of 1,4-BDO according to the bld variant. I confirmed it. In addition, it was confirmed that 1,4-BDO was produced by introducing cs4c and adhE genes into the microorganism as positive controls.
5 is a Bld mutant having one mutation was produced in order to confirm which mutation of the modified Bld-M1 to Bld-M5 mutation positions in Table 3 best induces the activity of the Bld mutant. As a result, mutant Bld-S1 to Bld-S6 were produced, and the 1,4-BDO production capacity was confirmed using the produced Bld mutant. As a result, it was confirmed that 1,4-BDO was remarkably produced in Bld-2, and it was confirmed that the mutant 273 of the wild type Bld (see SEQ ID NO: 1) has the best 1,4-BDO production ability. .
6 shows a common sequence by comparing bld with a protein sequence predicted to have similar activity.
7 shows a three-dimensional structure of bld. Figure 7a shows the three-dimensional structure of the entire bld, Figure 7b shows the active site of bld and its substrate, NADPH. Figure 7c shows the three-dimensional structure of bld, amino acids and substrates that affect its activity, NADPH. 7D shows amino acids that affect the three-dimensional structure and activity of bld.
Figure 8 shows the activity of 6 amino acids of the L273X mutation. It shows the relative 1,4-BDO titer obtained with E. coli expressing wild-type Bld and six variants, including CS4C and Bdh.
9 shows the results of enzyme assays of wild-type Bld, L273I, L273T, and AdhE2. (A) shows the specific activity values of purified wild-type Bld, L273I, and L273T. Specific activity values were measured by measuring the decrease in NADH concentration in a reaction mixture containing butyryl-CoA as a substrate. (B) shows the specific activity values of purified wild type Bld, L273I, and L273T, by measuring the decrease in NADH concentration in a reaction mixture containing purified Bdh and butyryl-CoA as a substrate, specific activity value Was measured. The specific activity value of AdhE2 is as shown in (A).

Hereinafter, the present invention will be described in more detail through examples. These examples are for illustrative purposes only, and it is obvious to those of ordinary skill in the art that the scope of the present invention is not construed as being limited by these examples.

Example 1. Transformation host and constructed expression vector for transformation

The recombinant microorganism used to efficiently produce 1,4-BDO and the expression vector for transforming the microorganism are shown in Table 1 below.

Strains and plasmids Relevant properties Source or reference Strains Escherichia coli XL1-Blue F'::Tn10 proA+B+ lacIq Δ(lacZ)M15/ recA1 endA1 gyrA96 (Nalr)
thihsdR17 (rK-mK+) glnV44 relA1 lac Stratagene E.coli TOP10 F- mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 nupG recA1 araD139 Δ(ara-leu)7697 galE15 galK16 rpsL(StrR) endA1 Invitrogen E.coli BL21 (DE3) F- ompT gal [dcm] [lon ] hsdSB (rB - mB -; an E. coli B strain) with DE3, a λ prophage carrying the T7 RNA polymerase gene NEB Clostridium saccharoperbutylacetonicum KCTC 5577
Source for bld and bdh
KCTCa Clostridium
acetobutylicum KTCT 1790 Source for adh1, adhE1, adhE2, bdhA, and bdhB KCTC
Plasmids pUCM Cloning vector modified from pUC19; constitutive lac promoter, Apr (Kim et al., 2010) pUCM-bld Constitutively expressed bld of C. saccharoperbutylacetonicum This study pUCM-adh1 Constitutively expressed adh1 of C.acetobutylicum This study pUCM-adhE1 Constitutively expressed adhE1 of C.acetobutylicum This study pUCM-adhE2 Constitutively expressed adhE2 of C.acetobutylicum This study pUCM-bdhA Constitutively expressed bdhA of C.acetobutylicum This study pUCM-bdhB Constitutively expressed bdhB of C.acetobutylicum This study pUCM-bdh Constitutively expressed bdh of C. saccharoperbutylacetonicum This study pUCM-bld-M1-5 series Constitutively expressed bld mutant 1-5 generated by random mutagenesis This study pUCM-bld-S1-6 series Constitutively expressed Bld mutant A176T, L273I, K279R, M371R, N409T, or A467S. This study pUCM-bld-L273X series Constitutively expressed 18 Bld mutants having different amino acids at the position of Leu273 except for L273I This study pBBR1MCS2 Broad-host-range plasmid, Kmr (Kovach et al., 1995) pBBR-bdh Constitutively expressed bdh of C. saccharoperbutylacetonicum, Kmr This study pBBR-bdhA Constitutively expressed bdhA of C.acetobutylicum This study pBBR-bdhB Constitutively expressed bdhB of C.acetobutylicum This study pSTV28 Plasmid with a replication origin of pACYC184, Cmr Takara pSTV-cs4c Constitutively expressed cat1, sucD, 4hbd, and cat2 together This study pET21a f1 origin, T7 promoter, C-terminal His-tag sequence, Apr Novagen pET-bld_WT Inducible expression of Hig6-tagged wild-type Bld on pET21a This study pET- bld_L273I Inducible expression of Hig6-tagged Bld L273I on pET21a This study pET- bld_L273T Inducible expression of Hig6-tagged Bld L273T on pET21a This study pET-AdhE2 Inducible expression of Hig6-tagged AdhE2 on pET21a This study pET-Bdh Inducible expression of Hig6-tagged Bdh on pET21a This study

Example 2. Modularization of metabolic circuit genes

The cat1-sucD-4hbd-cat2 gene synthesized in the pGEM vector was cloned into the Xba I and Not I sites of the pUCM vector so that the gene was expressed under the control of the promoter. Thereafter, subcloning was performed at the SacI and BamHI sites of the pSTV 28 vector (pSTV-cs4c: SEQ ID NO: 98).

AdhE2 is a Clostridium After amplification from chromosomal DNA of acetobutylicum by PCR, cloning was performed at the sites Xba I and Not I of the pUCM vector. PCR was performed using a DNA engine thermal cycler (Bio-Rad), followed by 4 minutes at 95℃, followed by 3 steps of 94℃ for 1 minute, 50℃ for 40 seconds, and 72℃ for 1 minute, repeated 32 times, and finally 72℃ It was carried out by reacting for 7 minutes. The DNA sequence for each primer is shown in Table 2.

Gene Sequence Sequence number Enzyme site bdh F; 5'- GCTCTAGAAGGAGGATTACAAAATGGAGAATTTTAGATTTAATG SEQ ID NO: 18 XbaⅠ R; 5'- TTCCCTTGCGGCCGCTTAAAGGGACATTTCTAA SEQ ID NO: 19 NotⅠ bld
F; 5'- GCCCCGGGAGGAGGATTACAAAATGATTAAAGACACGCTAGTTTC SEQ ID NO: 20 XmaⅠ R; 5'- TTCCCTTGCGGCCGCTTAACCGGCGAGTACACATC SEQ ID NO: 21 NotⅠ cs4c
F; 5'- GCTCTAGAAGGAGGATTACAAAATGAGTAAAGGGATTAAGAAC SEQ ID NO: 22 XbaⅠ R; 5'- TTCCCTTGCGGCCGCTTAACCAAAACGTTTGCG SEQ ID NO: 23 NotⅠ Sub _ BamH Ⅰ_R R; 5'- CGGGATCCCGGTGTGAAATACCG SEQ ID NO: 24 BamHⅠ Sub _ EcoR Ⅰ_R R; 5'- GAATTCCGGTGTGAAATACCG SEQ ID NO: 25 EcoRⅠ Sub _ SacI _F F; 5'- GAGCTCCCGACTGGAAAGCG SEQ ID NO: 26 SacⅠ Sub _ SalI _F
adhE2 F; 5'- ACGCGTCGACCCGACTGGAAAGCG SEQ ID NO: 27 SalI F; 5'- GCTCTAGAAGGAGGATTACAAAATGATTTTGCATCTGCTG SEQ ID NO: 28 XbaI R; 5'- TTCCCTTGCGGCCGCTTAAAACGACTTGATGTAGAT SEQ ID NO: 29 NotI adh1 F; 5'- GCTCTAGA AGGAGGATTACAAAATGATGAGATTTACATTACCAAG SEQ ID NO: 30 Xba I R; 5'- TTCCCTTGCGGCCGCTTAAAAATCAACTTCTGTACC SEQ ID NO: 31 Not I adhE1 F; 5'- GCTCTAGAAGGAGGATTACAAAATGAAAGTCACAACAGTAAAG SEQ ID NO: 32 Xba I R; 5'- TTCCCTTGCGGCCGCTTAAGGTTGTTTTTTAAAAC SEQ ID NO: 33 Not I adhE2 F; 5'- GCTCTAGA AGGAGGATTACAAAATGATTTTGCATCTGCTG SEQ ID NO: 34 Xba I R; 5'- TTCCCTT GCGGCCGCTTAAAACGACTTGATGTAGAT SEQ ID NO: 35 Not I bdhA F; 5'- GCTCTAGAAGGAGGATTACAAAATGCTAAGTTTTGATTATTCA SEQ ID NO: 36 Xba I R; 5'- TTCCCTTGCGGCCGCTTATAAGATTTTTTAAATATCTC SEQ ID NO: 37 Not I bdhB F;5'- GCCCCGGGAGGAGGATTACAAAATGGTTGATTTCGAATATTCAATAC SEQ ID NO: 38 Xma I R; 5'- TTCCCTTGCGGCCGCTTACACAGATTTTTTGAATATTTG SEQ ID NO: 39 Not I bld (pET21a) F; 5'- GCGAATTCATGATTAAAGACACGCTAGTTTC SEQ ID NO: 40 Eco RI R; 5'- AAAA CTCGAG ACCGGCGAGTACACATCT SEQ ID NO: 41 Xho I adhE2 (pET21a) F; 5'- GCGGATCCATGATTTTGCATCTGCTGCGA SEQ ID NO: 42 Bam HI R; 5'- AAAACTCGAGAAACGACTTGATGTAGATATCC SEQ ID NO: 43 Xho I bdh (pET21a) F; 5'- GCGAATTCATG GAGAATTTTAGATTTAAT SEQ ID NO: 44 Eco RI R; 5'- AAAACTCGAGAAGGGACATTTCTAAAATTTTATA SEQ ID NO: 45 Xho I

Example 3. Bld And bdh Gene selection

In order to produce 4-hydroxybutyryl CoA in E. coli, a vector (pSTV-cs4c) was prepared. The synthesized CS4C expresses cat1, sucD, 4hbd and cat2 genes. When the CS4C module is expressed, a small amount of 1.4-BDO is produced (~2.0 mg/L). Bld, Adh1 and AdhE1 were examined to investigate the production of 1,4-BDO. As a result, it was confirmed that Bld is an enzyme that converts from 4-hydroxybutyryl CoA to 4-hydroxybutylaldehyde. It was confirmed that the 1,4-BDO production of the three candidates produced 29 mg/L for AdhE2, 10 mg/L for bld, 1.8 mg/L for Adh1, and 1.6 mg/L for AdhE1. I did.

After that, 1,4-BDO production was confirmed with CS4S module and bld and three candidate groups. The three candidate enzymes are Bdh, BdhA and BdhB. At this time, it was confirmed that Bdh has an activity of converting from 4-hydroxybutylaldehyde to 1,4-BDO. As a result of expressing the CS4S module and bld and each of the three enzymes, it was confirmed that 1,4-BDO was produced as follows. In the case of Bdh, 19 mg/L of 1,4-BDO, 16 mg/L of BdhB, and 15 mg/L of BdhA were produced.

Example 4. Gene improvement and screening

4.1. bld Mutant production

In order to increase the production of 1,4-BDO, the bld gene was improved by a directed evolution method. The sequence of bld was changed using the error prone PCR method. 2.5 mM MgCl ₂ and a primer for subcloning were used. Variety of errors using G-rich dNTP (T:A:C:G = 1:1:1:4) and T-rich dNTP (T:A:C:G = 4:1:1:1) respectively Raised. They performed cloning in the Xma I and Not I sites of the pUCM vector.

4.2. 1,4- BDO To produce high-efficiency bld Mutation screening

pSTV 28- cat1-sucD-4hbd-cat2 (pSTV-cs4c) pUCM-bld was introduced into TOP10 into which the vector was introduced. Schiff's reagent was used to search for genes that can increase production in the library. Schiff's reagent is a solution in which 30 mg/ml sodium bisulfate (in water), 0.5 M KCl (in water), and 2 mg/ml pararosaniline (in ethanol) are mixed in a ratio of 2:1:2 and reacted on a plate with colonies. To do this, a solution was added to 0.8% agar (in water). After mixing the two solutions well, poured into a plate and allowed to react at 37°C for about 3 hours. After that, red colony was selected and cultured in 2 ml LB medium at 37°C and 250 rpm for 12 hours. 1 ml of the culture solution was centrifuged at 13000 rpm for 10 minutes, and 200 ul of the obtained supernatant and 100 ul of Schiff's reagent were well mixed and reacted at 37° C. for 1 to 5 hours. Absorbance was measured at 540 nm, and genes showing high absorbance were introduced into TOP10 together with pSTV-cs4c and pBBR-bdh and cultured. 2 and 3 correspond to the above description.

Example 5. E. coli culture and 1,4- BDO production

Escherichia coli strain TOP10 was used for the production of 1,4-BDO by expression of gene modules including cloning described above. Recombinant E. coli containing three plasmids was incubated for 48 hours at 30°C and 250 rpm under anaerobic conditions using a serum bottle. The medium composition was 100 ml of LB containing 0.6% calcium carbonate and 2% glucose, and 50 μg/ml chloramphenicol, 100 μg/ml ampicillin, and 50 μg/ml kanamycin were all added. The culture conditions were anaerobic by injecting nitrogen, and cultured at 30°C and 250 rpm for 18 hours. The medium composition was 1 L of LB medium containing 2% glucose, and 50 μg/ml chloramphenicol, 100 μg/ml ampicillin, and 50 μg/ml kanamycin were all added. The pH of the medium was adjusted with 5 N NaOH.

When the genes related to 1,4-BDO biosynthesis were modularized by the method described above and transformed into E. coli, the recombinant E. coli produced 1,4-BDO. As a result of the experiment, it was found that the production of 1,4-BDO was small due to accumulation from 4-hydroxybutyrate. So, first, the experiment was constructed so that the metabolic pathway proceeds toward 1,4-BDO by making a lot of 4-hydroxybutylaldehyde.

Example 6. 1,4- BDO Analysis of

A sample was prepared by taking 1 ml from 100 ml medium and centrifuging at 13000 rpm for 30 minutes, and centrifuging the supernatant once again under the same conditions, and then filtering 800 ul with a 0.45 um filter. Of these, 10 ul of a sample was used for HPLC analysis. HPLC used an Agilent 1100 device equipped with a Refractive index detector (RID). A 4 mM H2SO4 solution was used as a mobile phase and a BIO-RAD Aminex HPX-87H Column was used as a stationary phase, at which time the flow rate was 0.7 ml/min. The temperature of both the column and the detector is 50℃. As a result of analyzing the production amount of 1,4-BDO, when the conventional bld was expressed in TOP10 with cs4c and bdh genes, when cultured with the introduction of improved bld , It was possible to secure a greater amount of 1,4-BDO. It can be seen that the difference is more than twice and that the sample 2-1 produces 1,4-BDO at a concentration of about 0.4 g/L (see FIG. 4). In addition, the remaining Bld-M1, Bld-M3, M4, and M5 samples also showed higher 1,4-BDO productivity than control (Bld-WT) (see FIG. 4). As a result of analyzing the base sequence of the Bld mutants, it was found that the modification occurred as shown in Table 3. From the above results, it could be confirmed that if bld has good activity, a lot of 4-hydroxybutylaldehyde is produced, which is combined with Schiff's reagent to appear color, which can be usefully used for screening.

Mutant Nucleotide mutation Amino acid mutation Bld-M1 AAC -> ACC
AGG -> AGT
GCC -> TCC N409T
R361S
A467S Bld-M2 AGG -> AGT R361S Bld-M3 AGG -> AGT
GCC -> TCC R361S
A467S Bld-M4 AGG -> AGT
ATG -> AGG
GCC -> TCC R361S
M371R
A467S Bld-M5 GCT -> ACT
TTA -> ATA
AAA -> AGA
AGG -> AGT
GCC -> TCC A176T
L273I
K279R
R361S
A467S Bld-S1 GCT -> ACT A176T Bld-S2 TTA -> ATA L273I Bld-S3 AAA -> AGA K279R Bld-S4 ATC -> AGG M371R Bld-S5 AAC -> ACC N409T Bld-S6 GCC -> TCC A467S

Example 7. Selecting the most effective mutation among mutations

As shown in Table 3, it was confirmed that mutations in Bld-M1 to Bld-M5 occurred in as few as 1 to as many as 5 amino acids. Accordingly, in order to find out which mutation shows the greatest effect, the 1,4-BDO production was confirmed in the same manner as in Examples 5 and 6 for each of a total of six mutations. As a result, it was confirmed that the Bld-S2 (L273I) strain showed the highest 1,4-BDO production (0.08 g/L) as shown in FIG. 5. Other mutations (Bld-S5, S6) also showed a slight improvement. It is worth noting that Bld-S2 containing the L273I mutation was confirmed to be more than three times more effective than AdhE2, which is known to have the best performance so far.

Example 8. Through the identification of the 273th mutation Butylaldehyde Dehydrogenase Variant Active check

Among the butylaldehyde dehydrogenase mutations, L273I most influenced 1,4-BDO production. In addition, as a result of the three-dimensional structure analysis of butylaldehyde dehydrogenase, it was confirmed that the 273 th residue is a catalytic site including the NAD(P)H bonding site. Therefore, in order to make a variant such that butylaldehyde dehydrogenase produces more 4-hydroxybutylaldehyde in 4-hydroxybutyryl CoA, residue 273 was substituted with 18 different amino acids. At this time, it was confirmed that L273T showed 15-18% higher activity compared to L273I (FIG. 8). In addition, it was confirmed that the four butylaldehyde dehydrogenase variants of L273C, L273M, L273S, or L273V are between the wild-type butylaldehyde dehydrogenase activity and the L273I butylaldehyde dehydrogenase variant activity. In addition, it was confirmed that the activity of the other 13 variants decreased compared to wild-type butylaldehyde dehydrogenase.

Gene Sequence Sequence number A176T F; 5'- GCTAAAAAATGTGTTACCTTTGCTGTCGAA /
R; 5'- TTCGACAGCAAAGGTAACACATTTTTTAGC SEQ ID NO: 46
SEQ ID NO: 47 L273I F; 5'- TCTTTTGATAATAATATACCTTGTATTGCA /
R; 5'- TGCAATACAAGGTATATTATTATCAAAAGA SEQ ID NO: 48
SEQ ID NO: 49 K279R F; 5'- CCTTGTATTGCAGAAAGAGAAGTATTTGTT/
R; 5'- AACAAATACTTCTCTTTCTGCAATACAAGG SEQ ID NO: 50
SEQ ID NO: 51 M371R F; 5'- TATGACAGAACTCATGAGGCCAATATTACC /
R; 5'- GGTAATATTGGCCTCATGAGTTCTGTCATA SEQ ID NO: 52
SEQ ID NO: 53 N409T F; 5'- TCAAAAAATATAGACACCCTAAATAGGTTTG /
R; 5'- CAAACCTATTTAGGGTGTCTATATTTTTTGA SEQ ID NO: 54
SEQ ID NO: 55 A467S F; 5'- AGAAGATGTGTACTCTCCGGTTAAGCGGCC /
R; 5'- GGCCGCTTAACCGGAGAGTACACATCTTCT SEQ ID NO: 56
SEQ ID NO: 57 L273A F; 5'-TCTTTTGATAATAATGCGCCTTGTATTGCA /
R; 5'- TGCAATACAAGGGCGATTATTATCAAAAGA SEQ ID NO: 58
SEQ ID NO: 59 L273C F; 5'-TCTTTTGATAATAATTGCCCTTGTATTGCA /
R; 5'- TGCAATACAAGGGCAATTATTATCAAAAGA SEQ ID NO: 60
SEQ ID NO: 61 L273D F; 5'-TCTTTTGATAATAATGATCCTTGTATTGCA /
R; 5'- TGCAATACAAGGATCATTATTATCAAAAGA SEQ ID NO: 62
SEQ ID NO: 63 L273E F; 5'-TCTTTTGATAATAATGAACCTTGTATTGCA /
R; 5'- TGCAATACAAGGTTCATTATTATCAAAAGA SEQ ID NO: 64
SEQ ID NO: 65 L273F F; 5'-TCTTTTGATAATAATTTTCCTTGTATTGCA /
R; 5'- TGCAATACAAGGAAAATTATTATCAAAAGA SEQ ID NO: 66
SEQ ID NO: 67 L273G F; 5'-TCTTTTGATAATAATGGCCCTTGTATTGCA /
R; 5'- TGCAATACAAGGGCCATTATTATCAAAAGA SEQ ID NO: 68
SEQ ID NO: 69 L273H F; 5'-TCTTTTGATAATAATCATCCTTGTATTGCA /
R; 5'- TGCAATACAAGGATGATTATTATCAAAAGA SEQ ID NO: 70
SEQ ID NO: 71 L273K F; 5'-TCTTTTGATAATAATAAACCTTGTATTGCA /
R; 5'- TGCAATACAAGGTTTATTATTATCAAAAGA SEQ ID NO: 72
SEQ ID NO: 73 L273M F; 5'-TCTTTTGATAATAATATGCCTTGTATTGCA /
R; 5'- TGCAATACAAGGCATATTATTATCAAAAGA SEQ ID NO: 74
SEQ ID NO: 75 L273N F; 5'-TCTTTTGATAATAATAACCCTTGTATTGCA /
R; 5'- TGCAATACAAGGGTTATTATTATCAAAAGA SEQ ID NO: 76
SEQ ID NO: 77 L273P F; 5'-TCTTTTGATAATAATCCGCCTTGTATTGCA /
R; 5'- TGCAATACAAGGCGGATTATTATCAAAAGA SEQ ID NO: 78
SEQ ID NO: 79 L273Q F; 5'-TCTTTTGATAATAATCAGCCTTGTATTGCA /
R; 5'- TGCAATACAAGGCTGATTATTATCAAAAGA SEQ ID NO: 80
SEQ ID NO: 81 L273S F; 5'-TCTTTTGATAATAATAGCCCTTGTATTGCA /
R; 5'- TGCAATACAAGGGCTATTATTATCAAAAGA SEQ ID NO: 82
SEQ ID NO: 83 L273T F; 5'-TCTTTTGATAATAATACCCCTTGTATTGCA /
R; 5'- TGCAATACAAGGGGTATTATTATCAAAAGA SEQ ID NO: 84
SEQ ID NO: 85 L273V F; 5'-TCTTTTGATAATAATGTGCCTTGTATTGCA /
R; 5'- TGCAATACAAGGCACATTATTATCAAAAGA SEQ ID NO: 86
SEQ ID NO: 87 L273W F; 5'-TCTTTTGATAATAATTGGCCTTGTATTGCA /
R; 5'- TGCAATACAAGGCCAATTATTATCAAAAGA SEQ ID NO: 88
SEQ ID NO: 89 L273Y F; 5'-TCTTTTGATAATAATTATCCTTGTATTGCA /
R; 5'- TGCAATACAAGGATAATTATTATCAAAAGA SEQ ID NO: 90
SEQ ID NO: 91

Bld Mutant Nucleotide change Amino acid change L273I TTA->ATA L273I L273A TTA->GCG L273A L273C TTA->TGC L273C L273D TTA->GAT L273D L273E TTA->GAA L273E L273F TTA->TTT L273F L273G TTA->GGC L273G L273H TTA->CAT L273H L273K TTA->AAA L273K L273M TTA->ATG L273M L273N TTA->AAC L273N L273P TTA->CCG L273P L273Q TTA->CAG L273Q L273R TTA->CGT L273R L273S TTA->AGC L273S L273T TTA->ACC L273T L273V TTA->GTG L273V L273W TTA->TGG L273W L273Y TTA->TAT L273Y

Example 9. Wild type Butylaldehyde Dehydrogenase , L273I And L273T Enzyme activity measurement

To confirm the correlation between the butylaldehyde dehydrogenase variant and the fortified 1,4-BDO production, purified His6-tagged wild-type butylaldehyde dihydrogenase was used using butyryl-CoA as a substrate. The specific activity of genase, L273I mutant, L273T mutant, and AdhE2 was measured (D'Ambrosio et al., 2006). Activity of the mutant L273I, L273T variants were 2.9 ± 0.60 and ^{3.1 ± 0.30 pmol · mg -1 ·} min - ^1. As expected, the specific activity value of the variant was about 25-30% higher than that of the wild-type butylaldehyde dehydrogenase, 2.3 ± 0.46 pmol·mg ^-1 ·min ^-1 .

For the evaluation of butylaldehyde dehydrogenase and butanol dehydrogenase as a substitute for AdhE2 having two functions, purified butanol dehydrogenase was used in the enzyme assay of wild-type butylaldehyde dehydrogenase, L273I variant, and L273T variant. Included. In conditions containing butanol dehydrogenase, the specific activities of wild-type butylaldehyde dehydrogenase, L273I variant, and L273T variant were measured as 2.0 ± 0.48, 2.5 ± 0.44, and 3.0 ± 0.47 pmol mg ^-1 min ^{- 1} , respectively. This specific activity value was 2 to 3 times higher than the AdhE2 value of 0.9 ± 0.16 pmol·mg ⁻¹ ·min ⁻¹ (see Fig. 9B). As a result of these experiments, it can be seen that butylaldehyde dehydrogenase and butanol dehydrogenase can be utilized by replacing AdhE2 in the 1,4-BDO production route.

In the case of using the enzyme according to an embodiment, 1,4-BDO can be efficiently produced by replacing AdhE2 and utilizing butylaldehyde dehydrogenase and butanol dehydrogenase. As it can increase the production efficiency of 1,4-BDO, it is considered to be a technology with excellent industrial applicability.

<110> Samsung Electronics Co. Ltd <120> Enzyme used in synthesis of 1,4-BDO, variant thereof and method for 1,4-butanediol using the same <130> PN102944 <160> 98 <170> KopatentIn 2.0 <210> 1 <211> 468 <212> PRT <213> Clostridium saccharoperbutylacetonicum <400> 1 Met Ile Lys Asp Thr Leu Val Ser Ile Thr Lys Asp Leu Lys Leu Lys 1 5 10 15 Thr Asn Val Glu Asn Ala Asn Leu Lys Asn Tyr Lys Asp Asp Ser Ser 20 25 30 Cys Phe Gly Val Phe Glu Asn Val Glu Asn Ala Ile Ser Asn Ala Val 35 40 45 His Ala Gln Lys Ile Leu Ser Leu His Tyr Thr Lys Glu Gln Arg Glu 50 55 60 Lys Ile Ile Thr Glu Ile Arg Lys Ala Ala Leu Glu Asn Lys Glu Ile 65 70 75 80 Leu Ala Thr Met Ile Leu Glu Glu Thr His Met Gly Arg Tyr Glu Asp 85 90 95 Lys Ile Leu Lys His Glu Leu Val Ala Lys Tyr Thr Pro Gly Thr Glu 100 105 110 Asp Leu Thr Thr Thr Ala Trp Ser Gly Asp Asn Gly Leu Thr Val Val 115 120 125 Glu Met Ser Pro Tyr Gly Val Ile Gly Ala Ile Thr Pro Ser Thr Asn 130 135 140 Pro Thr Glu Thr Val Ile Cys Asn Ser Ile Gly Met Ile Ala Ala Gly 145 150 155 160 Asn Thr Val Val Phe Asn Gly His Pro Gly Ala Lys Lys Cys Val Ala 165 170 175 Phe Ala Val Glu Met Ile Asn Lys Ala Ile Ile Ser Cys Gly Gly Pro 180 185 190 Glu Asn Leu Val Thr Thr Ile Lys Asn Pro Thr Met Asp Ser Leu Asp 195 200 205 Ala Ile Ile Lys His Pro Ser Ile Lys Leu Leu Cys Gly Thr Gly Gly 210 215 220 Pro Gly Met Val Lys Thr Leu Leu Asn Ser Gly Lys Lys Ala Ile Gly 225 230 235 240 Ala Gly Ala Gly Asn Pro Pro Val Ile Val Asp Asp Thr Ala Asp Ile 245 250 255 Glu Lys Ala Gly Lys Ser Ile Ile Glu Gly Cys Ser Phe Asp Asn Asn 260 265 270 Leu Pro Cys Ile Ala Glu Lys Glu Val Phe Val Phe Glu Asn Val Ala 275 280 285 Asp Asp Leu Ile Ser Asn Met Leu Lys Asn Asn Ala Val Ile Ile Asn 290 295 300 Glu Asp Gln Val Ser Lys Leu Ile Asp Leu Val Leu Gln Lys Asn Asn 305 310 315 320 Glu Thr Gln Glu Tyr Ser Ile Asn Lys Lys Trp Val Gly Lys Asp Ala 325 330 335 Lys Leu Phe Leu Asp Glu Ile Asp Val Glu Ser Pro Ser Ser Val Lys 340 345 350 Cys Ile Ile Cys Glu Val Ser Ala Arg His Pro Phe Val Met Thr Glu 355 360 365 Leu Met Met Pro Ile Leu Pro Ile Val Arg Val Lys Asp Ile Asp Glu 370 375 380 Ala Ile Glu Tyr Ala Lys Ile Ala Glu Gln Asn Arg Lys His Ser Ala 385 390 395 400 Tyr Ile Tyr Ser Lys Asn Ile Asp Asn Leu Asn Arg Phe Glu Arg Glu 405 410 415 Ile Asp Thr Thr Ile Phe Val Lys Asn Ala Lys Ser Phe Ala Gly Val 420 425 430 Gly Tyr Glu Ala Glu Gly Phe Thr Thr Phe Thr Ile Ala Gly Ser Thr 435 440 445 Gly Glu Gly Ile Thr Ser Ala Arg Asn Phe Thr Arg Gln Arg Arg Cys 450 455 460 Val Leu Ala Gly 465 <210> 2 <211> 468 <212> PRT <213> mutant of butyraldehyde dehydrogenase_L273I <400> 2 Met Ile Lys Asp Thr Leu Val Ser Ile Thr Lys Asp Leu Lys Leu Lys 1 5 10 15 Thr Asn Val Glu Asn Ala Asn Leu Lys Asn Tyr Lys Asp Asp Ser Ser 20 25 30 Cys Phe Gly Val Phe Glu Asn Val Glu Asn Ala Ile Ser Asn Ala Val 35 40 45 His Ala Gln Lys Ile Leu Ser Leu His Tyr Thr Lys Glu Gln Arg Glu 50 55 60 Lys Ile Ile Thr Glu Ile Arg Lys Ala Ala Leu Glu Asn Lys Glu Ile 65 70 75 80 Leu Ala Thr Met Ile Leu Glu Glu Thr His Met Gly Arg Tyr Glu Asp 85 90 95 Lys Ile Leu Lys His Glu Leu Val Ala Lys Tyr Thr Pro Gly Thr Glu 100 105 110 Asp Leu Thr Thr Thr Ala Trp Ser Gly Asp Asn Gly Leu Thr Val Val 115 120 125 Glu Met Ser Pro Tyr Gly Val Ile Gly Ala Ile Thr Pro Ser Thr Asn 130 135 140 Pro Thr Glu Thr Val Ile Cys Asn Ser Ile Gly Met Ile Ala Ala Gly 145 150 155 160 Asn Thr Val Val Phe Asn Gly His Pro Gly Ala Lys Lys Cys Val Ala 165 170 175 Phe Ala Val Glu Met Ile Asn Lys Ala Ile Ile Ser Cys Gly Gly Pro 180 185 190 Glu Asn Leu Val Thr Thr Ile Lys Asn Pro Thr Met Asp Ser Leu Asp 195 200 205 Ala Ile Ile Lys His Pro Ser Ile Lys Leu Leu Cys Gly Thr Gly Gly 210 215 220 Pro Gly Met Val Lys Thr Leu Leu Asn Ser Gly Lys Lys Ala Ile Gly 225 230 235 240 Ala Gly Ala Gly Asn Pro Pro Val Ile Val Asp Asp Thr Ala Asp Ile 245 250 255 Glu Lys Ala Gly Lys Ser Ile Ile Glu Gly Cys Ser Phe Asp Asn Asn 260 265 270 Ile Pro Cys Ile Ala Glu Lys Glu Val Phe Val Phe Glu Asn Val Ala 275 280 285 Asp Asp Leu Ile Ser Asn Met Leu Lys Asn Asn Ala Val Ile Ile Asn 290 295 300 Glu Asp Gln Val Ser Lys Leu Ile Asp Leu Val Leu Gln Lys Asn Asn 305 310 315 320 Glu Thr Gln Glu Tyr Ser Ile Asn Lys Lys Trp Val Gly Lys Asp Ala 325 330 335 Lys Leu Phe Leu Asp Glu Ile Asp Val Glu Ser Pro Ser Ser Val Lys 340 345 350 Cys Ile Ile Cys Glu Val Ser Ala Arg His Pro Phe Val Met Thr Glu 355 360 365 Leu Met Met Pro Ile Leu Pro Ile Val Arg Val Lys Asp Ile Asp Glu 370 375 380 Ala Ile Glu Tyr Ala Lys Ile Ala Glu Gln Asn Arg Lys His Ser Ala 385 390 395 400 Tyr Ile Tyr Ser Lys Asn Ile Asp Asn Leu Asn Arg Phe Glu Arg Glu 405 410 415 Ile Asp Thr Thr Ile Phe Val Lys Asn Ala Lys Ser Phe Ala Gly Val 420 425 430 Gly Tyr Glu Ala Glu Gly Phe Thr Thr Phe Thr Ile Ala Gly Ser Thr 435 440 445 Gly Glu Gly Ile Thr Ser Ala Arg Asn Phe Thr Arg Gln Arg Arg Cys 450 455 460 Val Leu Ala Gly 465 <210> 3 <211> 468 <212> PRT <213> mutant of butyraldehyde dehydrogenase_L273C <400> 3 Met Ile Lys Asp Thr Leu Val Ser Ile Thr Lys Asp Leu Lys Leu Lys 1 5 10 15 Thr Asn Val Glu Asn Ala Asn Leu Lys Asn Tyr Lys Asp Asp Ser Ser 20 25 30 Cys Phe Gly Val Phe Glu Asn Val Glu Asn Ala Ile Ser Asn Ala Val 35 40 45 His Ala Gln Lys Ile Leu Ser Leu His Tyr Thr Lys Glu Gln Arg Glu 50 55 60 Lys Ile Ile Thr Glu Ile Arg Lys Ala Ala Leu Glu Asn Lys Glu Ile 65 70 75 80 Leu Ala Thr Met Ile Leu Glu Glu Thr His Met Gly Arg Tyr Glu Asp 85 90 95 Lys Ile Leu Lys His Glu Leu Val Ala Lys Tyr Thr Pro Gly Thr Glu 100 105 110 Asp Leu Thr Thr Thr Ala Trp Ser Gly Asp Asn Gly Leu Thr Val Val 115 120 125 Glu Met Ser Pro Tyr Gly Val Ile Gly Ala Ile Thr Pro Ser Thr Asn 130 135 140 Pro Thr Glu Thr Val Ile Cys Asn Ser Ile Gly Met Ile Ala Ala Gly 145 150 155 160 Asn Thr Val Val Phe Asn Gly His Pro Gly Ala Lys Lys Cys Val Ala 165 170 175 Phe Ala Val Glu Met Ile Asn Lys Ala Ile Ile Ser Cys Gly Gly Pro 180 185 190 Glu Asn Leu Val Thr Thr Ile Lys Asn Pro Thr Met Asp Ser Leu Asp 195 200 205 Ala Ile Ile Lys His Pro Ser Ile Lys Leu Leu Cys Gly Thr Gly Gly 210 215 220 Pro Gly Met Val Lys Thr Leu Leu Asn Ser Gly Lys Lys Ala Ile Gly 225 230 235 240 Ala Gly Ala Gly Asn Pro Pro Val Ile Val Asp Asp Thr Ala Asp Ile 245 250 255 Glu Lys Ala Gly Lys Ser Ile Ile Glu Gly Cys Ser Phe Asp Asn Asn 260 265 270 Cys Pro Cys Ile Ala Glu Lys Glu Val Phe Val Phe Glu Asn Val Ala 275 280 285 Asp Asp Leu Ile Ser Asn Met Leu Lys Asn Asn Ala Val Ile Ile Asn 290 295 300 Glu Asp Gln Val Ser Lys Leu Ile Asp Leu Val Leu Gln Lys Asn Asn 305 310 315 320 Glu Thr Gln Glu Tyr Ser Ile Asn Lys Lys Trp Val Gly Lys Asp Ala 325 330 335 Lys Leu Phe Leu Asp Glu Ile Asp Val Glu Ser Pro Ser Ser Val Lys 340 345 350 Cys Ile Ile Cys Glu Val Ser Ala Arg His Pro Phe Val Met Thr Glu 355 360 365 Leu Met Met Pro Ile Leu Pro Ile Val Arg Val Lys Asp Ile Asp Glu 370 375 380 Ala Ile Glu Tyr Ala Lys Ile Ala Glu Gln Asn Arg Lys His Ser Ala 385 390 395 400 Tyr Ile Tyr Ser Lys Asn Ile Asp Asn Leu Asn Arg Phe Glu Arg Glu 405 410 415 Ile Asp Thr Thr Ile Phe Val Lys Asn Ala Lys Ser Phe Ala Gly Val 420 425 430 Gly Tyr Glu Ala Glu Gly Phe Thr Thr Phe Thr Ile Ala Gly Ser Thr 435 440 445 Gly Glu Gly Ile Thr Ser Ala Arg Asn Phe Thr Arg Gln Arg Arg Cys 450 455 460 Val Leu Ala Gly 465 <210> 4 <211> 468 <212> PRT <213> mutant of butyraldehyde dehydrogenase_L273M <400> 4 Met Ile Lys Asp Thr Leu Val Ser Ile Thr Lys Asp Leu Lys Leu Lys 1 5 10 15 Thr Asn Val Glu Asn Ala Asn Leu Lys Asn Tyr Lys Asp Asp Ser Ser 20 25 30 Cys Phe Gly Val Phe Glu Asn Val Glu Asn Ala Ile Ser Asn Ala Val 35 40 45 His Ala Gln Lys Ile Leu Ser Leu His Tyr Thr Lys Glu Gln Arg Glu 50 55 60 Lys Ile Ile Thr Glu Ile Arg Lys Ala Ala Leu Glu Asn Lys Glu Ile 65 70 75 80 Leu Ala Thr Met Ile Leu Glu Glu Thr His Met Gly Arg Tyr Glu Asp 85 90 95 Lys Ile Leu Lys His Glu Leu Val Ala Lys Tyr Thr Pro Gly Thr Glu 100 105 110 Asp Leu Thr Thr Thr Ala Trp Ser Gly Asp Asn Gly Leu Thr Val Val 115 120 125 Glu Met Ser Pro Tyr Gly Val Ile Gly Ala Ile Thr Pro Ser Thr Asn 130 135 140 Pro Thr Glu Thr Val Ile Cys Asn Ser Ile Gly Met Ile Ala Ala Gly 145 150 155 160 Asn Thr Val Val Phe Asn Gly His Pro Gly Ala Lys Lys Cys Val Ala 165 170 175 Phe Ala Val Glu Met Ile Asn Lys Ala Ile Ile Ser Cys Gly Gly Pro 180 185 190 Glu Asn Leu Val Thr Thr Ile Lys Asn Pro Thr Met Asp Ser Leu Asp 195 200 205 Ala Ile Ile Lys His Pro Ser Ile Lys Leu Leu Cys Gly Thr Gly Gly 210 215 220 Pro Gly Met Val Lys Thr Leu Leu Asn Ser Gly Lys Lys Ala Ile Gly 225 230 235 240 Ala Gly Ala Gly Asn Pro Pro Val Ile Val Asp Asp Thr Ala Asp Ile 245 250 255 Glu Lys Ala Gly Lys Ser Ile Ile Glu Gly Cys Ser Phe Asp Asn Asn 260 265 270 Met Pro Cys Ile Ala Glu Lys Glu Val Phe Val Phe Glu Asn Val Ala 275 280 285 Asp Asp Leu Ile Ser Asn Met Leu Lys Asn Asn Ala Val Ile Ile Asn 290 295 300 Glu Asp Gln Val Ser Lys Leu Ile Asp Leu Val Leu Gln Lys Asn Asn 305 310 315 320 Glu Thr Gln Glu Tyr Ser Ile Asn Lys Lys Trp Val Gly Lys Asp Ala 325 330 335 Lys Leu Phe Leu Asp Glu Ile Asp Val Glu Ser Pro Ser Ser Val Lys 340 345 350 Cys Ile Ile Cys Glu Val Ser Ala Arg His Pro Phe Val Met Thr Glu 355 360 365 Leu Met Met Pro Ile Leu Pro Ile Val Arg Val Lys Asp Ile Asp Glu 370 375 380 Ala Ile Glu Tyr Ala Lys Ile Ala Glu Gln Asn Arg Lys His Ser Ala 385 390 395 400 Tyr Ile Tyr Ser Lys Asn Ile Asp Asn Leu Asn Arg Phe Glu Arg Glu 405 410 415 Ile Asp Thr Thr Ile Phe Val Lys Asn Ala Lys Ser Phe Ala Gly Val 420 425 430 Gly Tyr Glu Ala Glu Gly Phe Thr Thr Phe Thr Ile Ala Gly Ser Thr 435 440 445 Gly Glu Gly Ile Thr Ser Ala Arg Asn Phe Thr Arg Gln Arg Arg Cys 450 455 460 Val Leu Ala Gly 465 <210> 5 <211> 468 <212> PRT <213> mutant of butyraldehyde dehydrogenase_L273S <400> 5 Met Ile Lys Asp Thr Leu Val Ser Ile Thr Lys Asp Leu Lys Leu Lys 1 5 10 15 Thr Asn Val Glu Asn Ala Asn Leu Lys Asn Tyr Lys Asp Asp Ser Ser 20 25 30 Cys Phe Gly Val Phe Glu Asn Val Glu Asn Ala Ile Ser Asn Ala Val 35 40 45 His Ala Gln Lys Ile Leu Ser Leu His Tyr Thr Lys Glu Gln Arg Glu 50 55 60 Lys Ile Ile Thr Glu Ile Arg Lys Ala Ala Leu Glu Asn Lys Glu Ile 65 70 75 80 Leu Ala Thr Met Ile Leu Glu Glu Thr His Met Gly Arg Tyr Glu Asp 85 90 95 Lys Ile Leu Lys His Glu Leu Val Ala Lys Tyr Thr Pro Gly Thr Glu 100 105 110 Asp Leu Thr Thr Thr Ala Trp Ser Gly Asp Asn Gly Leu Thr Val Val 115 120 125 Glu Met Ser Pro Tyr Gly Val Ile Gly Ala Ile Thr Pro Ser Thr Asn 130 135 140 Pro Thr Glu Thr Val Ile Cys Asn Ser Ile Gly Met Ile Ala Ala Gly 145 150 155 160 Asn Thr Val Val Phe Asn Gly His Pro Gly Ala Lys Lys Cys Val Ala 165 170 175 Phe Ala Val Glu Met Ile Asn Lys Ala Ile Ile Ser Cys Gly Gly Pro 180 185 190 Glu Asn Leu Val Thr Thr Ile Lys Asn Pro Thr Met Asp Ser Leu Asp 195 200 205 Ala Ile Ile Lys His Pro Ser Ile Lys Leu Leu Cys Gly Thr Gly Gly 210 215 220 Pro Gly Met Val Lys Thr Leu Leu Asn Ser Gly Lys Lys Ala Ile Gly 225 230 235 240 Ala Gly Ala Gly Asn Pro Pro Val Ile Val Asp Asp Thr Ala Asp Ile 245 250 255 Glu Lys Ala Gly Lys Ser Ile Ile Glu Gly Cys Ser Phe Asp Asn Asn 260 265 270 Ser Pro Cys Ile Ala Glu Lys Glu Val Phe Val Phe Glu Asn Val Ala 275 280 285 Asp Asp Leu Ile Ser Asn Met Leu Lys Asn Asn Ala Val Ile Ile Asn 290 295 300 Glu Asp Gln Val Ser Lys Leu Ile Asp Leu Val Leu Gln Lys Asn Asn 305 310 315 320 Glu Thr Gln Glu Tyr Ser Ile Asn Lys Lys Trp Val Gly Lys Asp Ala 325 330 335 Lys Leu Phe Leu Asp Glu Ile Asp Val Glu Ser Pro Ser Ser Val Lys 340 345 350 Cys Ile Ile Cys Glu Val Ser Ala Arg His Pro Phe Val Met Thr Glu 355 360 365 Leu Met Met Pro Ile Leu Pro Ile Val Arg Val Lys Asp Ile Asp Glu 370 375 380 Ala Ile Glu Tyr Ala Lys Ile Ala Glu Gln Asn Arg Lys His Ser Ala 385 390 395 400 Tyr Ile Tyr Ser Lys Asn Ile Asp Asn Leu Asn Arg Phe Glu Arg Glu 405 410 415 Ile Asp Thr Thr Ile Phe Val Lys Asn Ala Lys Ser Phe Ala Gly Val 420 425 430 Gly Tyr Glu Ala Glu Gly Phe Thr Thr Phe Thr Ile Ala Gly Ser Thr 435 440 445 Gly Glu Gly Ile Thr Ser Ala Arg Asn Phe Thr Arg Gln Arg Arg Cys 450 455 460 Val Leu Ala Gly 465 <210> 6 <211> 468 <212> PRT <213> mutant of butyraldehyde dehydrogenase_L273T <400> 6 Met Ile Lys Asp Thr Leu Val Ser Ile Thr Lys Asp Leu Lys Leu Lys 1 5 10 15 Thr Asn Val Glu Asn Ala Asn Leu Lys Asn Tyr Lys Asp Asp Ser Ser 20 25 30 Cys Phe Gly Val Phe Glu Asn Val Glu Asn Ala Ile Ser Asn Ala Val 35 40 45 His Ala Gln Lys Ile Leu Ser Leu His Tyr Thr Lys Glu Gln Arg Glu 50 55 60 Lys Ile Ile Thr Glu Ile Arg Lys Ala Ala Leu Glu Asn Lys Glu Ile 65 70 75 80 Leu Ala Thr Met Ile Leu Glu Glu Thr His Met Gly Arg Tyr Glu Asp 85 90 95 Lys Ile Leu Lys His Glu Leu Val Ala Lys Tyr Thr Pro Gly Thr Glu 100 105 110 Asp Leu Thr Thr Thr Ala Trp Ser Gly Asp Asn Gly Leu Thr Val Val 115 120 125 Glu Met Ser Pro Tyr Gly Val Ile Gly Ala Ile Thr Pro Ser Thr Asn 130 135 140 Pro Thr Glu Thr Val Ile Cys Asn Ser Ile Gly Met Ile Ala Ala Gly 145 150 155 160 Asn Thr Val Val Phe Asn Gly His Pro Gly Ala Lys Lys Cys Val Ala 165 170 175 Phe Ala Val Glu Met Ile Asn Lys Ala Ile Ile Ser Cys Gly Gly Pro 180 185 190 Glu Asn Leu Val Thr Thr Ile Lys Asn Pro Thr Met Asp Ser Leu Asp 195 200 205 Ala Ile Ile Lys His Pro Ser Ile Lys Leu Leu Cys Gly Thr Gly Gly 210 215 220 Pro Gly Met Val Lys Thr Leu Leu Asn Ser Gly Lys Lys Ala Ile Gly 225 230 235 240 Ala Gly Ala Gly Asn Pro Pro Val Ile Val Asp Asp Thr Ala Asp Ile 245 250 255 Glu Lys Ala Gly Lys Ser Ile Ile Glu Gly Cys Ser Phe Asp Asn Asn 260 265 270 Thr Pro Cys Ile Ala Glu Lys Glu Val Phe Val Phe Glu Asn Val Ala 275 280 285 Asp Asp Leu Ile Ser Asn Met Leu Lys Asn Asn Ala Val Ile Ile Asn 290 295 300 Glu Asp Gln Val Ser Lys Leu Ile Asp Leu Val Leu Gln Lys Asn Asn 305 310 315 320 Glu Thr Gln Glu Tyr Ser Ile Asn Lys Lys Trp Val Gly Lys Asp Ala 325 330 335 Lys Leu Phe Leu Asp Glu Ile Asp Val Glu Ser Pro Ser Ser Val Lys 340 345 350 Cys Ile Ile Cys Glu Val Ser Ala Arg His Pro Phe Val Met Thr Glu 355 360 365 Leu Met Met Pro Ile Leu Pro Ile Val Arg Val Lys Asp Ile Asp Glu 370 375 380 Ala Ile Glu Tyr Ala Lys Ile Ala Glu Gln Asn Arg Lys His Ser Ala 385 390 395 400 Tyr Ile Tyr Ser Lys Asn Ile Asp Asn Leu Asn Arg Phe Glu Arg Glu 405 410 415 Ile Asp Thr Thr Ile Phe Val Lys Asn Ala Lys Ser Phe Ala Gly Val 420 425 430 Gly Tyr Glu Ala Glu Gly Phe Thr Thr Phe Thr Ile Ala Gly Ser Thr 435 440 445 Gly Glu Gly Ile Thr Ser Ala Arg Asn Phe Thr Arg Gln Arg Arg Cys 450 455 460 Val Leu Ala Gly 465 <210> 7 <211> 468 <212> PRT <213> mutant of butyraldehyde dehydrogenase_L273V <400> 7 Met Ile Lys Asp Thr Leu Val Ser Ile Thr Lys Asp Leu Lys Leu Lys 1 5 10 15 Thr Asn Val Glu Asn Ala Asn Leu Lys Asn Tyr Lys Asp Asp Ser Ser 20 25 30 Cys Phe Gly Val Phe Glu Asn Val Glu Asn Ala Ile Ser Asn Ala Val 35 40 45 His Ala Gln Lys Ile Leu Ser Leu His Tyr Thr Lys Glu Gln Arg Glu 50 55 60 Lys Ile Ile Thr Glu Ile Arg Lys Ala Ala Leu Glu Asn Lys Glu Ile 65 70 75 80 Leu Ala Thr Met Ile Leu Glu Glu Thr His Met Gly Arg Tyr Glu Asp 85 90 95 Lys Ile Leu Lys His Glu Leu Val Ala Lys Tyr Thr Pro Gly Thr Glu 100 105 110 Asp Leu Thr Thr Thr Ala Trp Ser Gly Asp Asn Gly Leu Thr Val Val 115 120 125 Glu Met Ser Pro Tyr Gly Val Ile Gly Ala Ile Thr Pro Ser Thr Asn 130 135 140 Pro Thr Glu Thr Val Ile Cys Asn Ser Ile Gly Met Ile Ala Ala Gly 145 150 155 160 Asn Thr Val Val Phe Asn Gly His Pro Gly Ala Lys Lys Cys Val Ala 165 170 175 Phe Ala Val Glu Met Ile Asn Lys Ala Ile Ile Ser Cys Gly Gly Pro 180 185 190 Glu Asn Leu Val Thr Thr Ile Lys Asn Pro Thr Met Asp Ser Leu Asp 195 200 205 Ala Ile Ile Lys His Pro Ser Ile Lys Leu Leu Cys Gly Thr Gly Gly 210 215 220 Pro Gly Met Val Lys Thr Leu Leu Asn Ser Gly Lys Lys Ala Ile Gly 225 230 235 240 Ala Gly Ala Gly Asn Pro Pro Val Ile Val Asp Asp Thr Ala Asp Ile 245 250 255 Glu Lys Ala Gly Lys Ser Ile Ile Glu Gly Cys Ser Phe Asp Asn Asn 260 265 270 Ile Pro Cys Ile Ala Glu Lys Glu Val Phe Val Phe Glu Asn Val Ala 275 280 285 Asp Asp Leu Ile Ser Asn Met Leu Lys Asn Asn Ala Val Ile Ile Asn 290 295 300 Glu Asp Gln Val Ser Lys Leu Ile Asp Leu Val Leu Gln Lys Asn Asn 305 310 315 320 Glu Thr Gln Glu Tyr Ser Ile Asn Lys Lys Trp Val Gly Lys Asp Ala 325 330 335 Lys Leu Phe Leu Asp Glu Ile Asp Val Glu Ser Pro Ser Ser Val Lys 340 345 350 Cys Ile Ile Cys Glu Val Ser Ala Arg His Pro Phe Val Met Thr Glu 355 360 365 Leu Met Met Pro Ile Leu Pro Ile Val Arg Val Lys Asp Ile Asp Glu 370 375 380 Ala Ile Glu Tyr Ala Lys Ile Ala Glu Gln Asn Arg Lys His Ser Ala 385 390 395 400 Tyr Ile Tyr Ser Lys Asn Ile Asp Asn Leu Asn Arg Phe Glu Arg Glu 405 410 415 Ile Asp Thr Thr Ile Phe Val Lys Asn Ala Lys Ser Phe Ala Gly Val 420 425 430 Gly Tyr Glu Ala Glu Gly Phe Thr Thr Phe Thr Ile Ala Gly Ser Thr 435 440 445 Gly Glu Gly Ile Thr Ser Ala Arg Asn Phe Thr Arg Gln Arg Arg Cys 450 455 460 Val Leu Ala Gly 465 <210> 8 <211> 382 <212> PRT <213> Clostridium saccharoperbutylacetonicum <400> 8 Met Glu Asn Phe Arg Phe Asn Ala Tyr Thr Glu Met Leu Phe Gly Lys 1 5 10 15 Gly Gln Ile Glu Lys Leu Pro Glu Val Leu Lys Arg Tyr Gly Lys Asn 20 25 30 Ile Leu Leu Ala Tyr Gly Gly Gly Ser Ile Lys Lys Asn Gly Leu Tyr 35 40 45 Asp Thr Ile Gln Lys Leu Leu Lys Asp Phe Asn Ile Val Glu Leu Ser 50 55 60 Gly Ile Glu Pro Asn Pro Arg Ile Glu Thr Val Arg Arg Gly Val Glu 65 70 75 80 Leu Cys Arg Lys Asn Lys Val Asp Val Ile Leu Ala Val Gly Gly Gly 85 90 95 Ser Thr Ile Asp Cys Ser Lys Val Ile Gly Ala Gly Tyr Tyr Tyr Ala 100 105 110 Gly Asp Ala Trp Asp Leu Val Lys Asn Pro Ala Lys Ile Gly Glu Val 115 120 125 Leu Pro Ile Val Thr Val Leu Thr Met Ala Ala Thr Gly Ser Glu Met 130 135 140 Asn Arg Asn Ala Val Ile Ser Lys Met Asp Thr Asn Glu Lys Leu Gly 145 150 155 160 Thr Gly Ser Pro Lys Met Ile Pro Gln Thr Ser Ile Leu Asp Pro Glu 165 170 175 Tyr Leu Tyr Thr Leu Pro Ala Ile Gln Thr Ala Ala Gly Cys Ala Asp 180 185 190 Ile Met Ser His Ile Phe Glu Gln Tyr Phe Asn Lys Thr Thr Asp Ala 195 200 205 Phe Val Gln Asp Lys Phe Ala Glu Gly Leu Leu Gln Thr Cys Ile Lys 210 215 220 Tyr Cys Pro Val Ala Leu Lys Glu Pro Lys Asn Tyr Glu Ala Arg Ala 225 230 235 240 Asn Ile Met Trp Ala Ser Ser Met Ala Leu Asn Gly Leu Leu Gly Ser 245 250 255 Gly Lys Ala Gly Ala Trp Thr Cys His Pro Ile Glu His Glu Leu Ser 260 265 270 Ala Phe Tyr Asp Ile Thr His Gly Val Gly Leu Ala Ile Leu Thr Pro 275 280 285 Ser Trp Met Arg Tyr Ile Leu Ser Asp Val Thr Val Asp Lys Phe Val 290 295 300 Asn Val Trp His Leu Glu Gln Lys Glu Asp Lys Phe Ala Leu Ala Asn 305 310 315 320 Glu Ala Ile Asp Ala Thr Glu Lys Phe Phe Lys Ala Cys Gly Ile Pro 325 330 335 Met Thr Leu Thr Glu Leu Gly Ile Asp Lys Ala Asn Phe Glu Lys Met 340 345 350 Ala Lys Ala Ala Val Glu His Gly Ala Leu Glu Tyr Ala Tyr Val Ser 355 360 365 Leu Asn Ala Glu Asp Val Tyr Lys Ile Leu Glu Met Ser Leu 370 375 380 <210> 9 <211> 1149 <212> DNA <213> Clostridium saccharoperbutylacetonicum <400> 9 atggagaatt ttagatttaa tgcatataca gagatgcttt ttggaaaggg acaaatagag 60 aagcttccag aggttttaaa aagatatggt aaaaatatat tacttgcata tggtggtgga 120 agtataaaaa agaatggact ctatgatact atccaaaagc tattgaaaga ttttaatatt 180 gttgaattaa gtggtattga accaaatcca agaattgaaa ctgtaagacg tggagttgaa 240 ctttgcagaa aaaataaagt agatgttatt ttagctgttg gtggagggag tacaatagac 300 tgctcaaagg ttataggggc aggttattat tatgctggag atgcatggga ccttgtaaaa 360 aatccagcta aaataggtga ggttttacca atagtgacag ttttaacaat ggcagctact 420 ggttctgaaa tgaatagaaa tgctgttatt tcaaagatgg atacaaatga aaagcttgga 480 acaggatcac ctaagatgat ccctcaaact tctattttag atccagaata tttgtataca 540 ttgccagcaa ttcaaacagc tgcaggttgt gctgatatta tgtcacacat atttgaacaa 600 tattttaata aaactacaga tgcttttgta caagataaat ttgcggaagg tttgttgcaa 660 acttgtataa aatattgccc tgttgcttta aaggaaccaa agaattatga agctagagca 720 aatataatgt gggctagttc aatggctctt aacggacttt taggaagtgg gaaagctgga 780 gcttggactt gtcatccaat agaacatgaa ttaagtgcat tttatgatat aactcatgga 840 gtaggtcttg caattttaac tccaagttgg atgagatata tcttaagtga tgtaacagtt 900 gataagtttg ttaacgtatg gcatttagaa caaaaagaag ataaatttgc tcttgcaaat 960 gaagcaatag atgcaacaga aaaattcttt aaagcttgtg gtattccaat gactttaact 1020 gaacttggaa tagataaagc aaactttgaa aagatggcaa aagctgcagt agaacatggt 1080 gctttagaat atgcatatgt ttcattaaat gccgaggatg tatataaaat tttagaaatg 1140 tccctttaa 1149 <210> 10 <211> 538 <212> PRT <213> Clostridium kluyveri <400> 10 Met Ser Lys Gly Ile Lys Asn Ser Gln Leu Lys Lys Lys Asn Val Lys 1 5 10 15 Ala Ser Asn Val Ala Glu Lys Ile Glu Glu Lys Val Glu Lys Thr Asp 20 25 30 Lys Val Val Glu Lys Ala Ala Glu Val Thr Glu Lys Arg Ile Arg Asn 35 40 45 Leu Lys Leu Gln Glu Lys Val Val Thr Ala Asp Val Ala Ala Asp Met 50 55 60 Ile Glu Asn Gly Met Ile Val Ala Ile Ser Gly Phe Thr Pro Ser Gly 65 70 75 80 Tyr Pro Lys Glu Val Pro Lys Ala Leu Thr Lys Lys Val Asn Ala Leu 85 90 95 Glu Glu Glu Phe Lys Val Thr Leu Tyr Thr Gly Ser Ser Thr Gly Ala 100 105 110 Asp Ile Asp Gly Glu Trp Ala Lys Ala Gly Ile Ile Glu Arg Arg Ile 115 120 125 Pro Tyr Gln Thr Asn Ser Asp Met Arg Lys Lys Ile Asn Asp Gly Ser 130 135 140 Ile Lys Tyr Ala Asp Met His Leu Ser His Met Ala Gln Tyr Ile Asn 145 150 155 160 Tyr Ser Val Ile Pro Lys Val Asp Ile Ala Ile Ile Glu Ala Val Ala 165 170 175 Ile Thr Glu Glu Gly Asp Ile Ile Pro Ser Thr Gly Ile Gly Asn Thr 180 185 190 Ala Thr Phe Val Glu Asn Ala Asp Lys Val Ile Val Glu Ile Asn Glu 195 200 205 Ala Gln Pro Leu Glu Leu Glu Gly Met Ala Asp Ile Tyr Thr Leu Lys 210 215 220 Asn Pro Pro Arg Arg Glu Pro Ile Pro Ile Val Asn Ala Gly Asn Arg 225 230 235 240 Ile Gly Thr Thr Tyr Val Thr Cys Gly Ser Glu Lys Ile Cys Ala Ile 245 250 255 Val Met Thr Asn Thr Gln Asp Lys Thr Arg Pro Leu Thr Glu Val Ser 260 265 270 Pro Val Ser Gln Ala Ile Ser Asp Asn Leu Ile Gly Phe Leu Asn Lys 275 280 285 Glu Val Glu Glu Gly Lys Leu Pro Lys Asn Leu Leu Pro Ile Gln Ser 290 295 300 Gly Val Gly Ser Val Ala Asn Ala Val Leu Ala Gly Leu Cys Glu Ser 305 310 315 320 Asn Phe Lys Asn Leu Ser Cys Tyr Thr Glu Val Ile Gln Asp Ser Met 325 330 335 Leu Lys Leu Ile Lys Cys Gly Lys Ala Asp Val Val Ser Gly Thr Ser 340 345 350 Ile Ser Pro Ser Pro Glu Met Leu Pro Glu Phe Ile Lys Asp Ile Asn 355 360 365 Phe Phe Arg Glu Lys Ile Val Leu Arg Pro Gln Glu Ile Ser Asn Asn 370 375 380 Pro Glu Ile Ala Arg Arg Ile Gly Val Ile Ser Ile Asn Thr Ala Leu 385 390 395 400 Glu Val Asp Ile Tyr Gly Asn Val Asn Ser Thr His Val Met Gly Ser 405 410 415 Lys Met Met Asn Gly Ile Gly Gly Ser Gly Asp Phe Ala Arg Asn Ala 420 425 430 Tyr Leu Thr Ile Phe Thr Thr Glu Ser Ile Ala Lys Lys Gly Asp Ile 435 440 445 Ser Ser Ile Val Pro Met Val Ser His Val Asp His Thr Glu His Asp 450 455 460 Val Met Val Ile Val Thr Glu Gln Gly Val Ala Asp Leu Arg Gly Leu 465 470 475 480 Ser Pro Arg Glu Lys Ala Val Ala Ile Ile Glu Asn Cys Val His Pro 485 490 495 Asp Tyr Lys Asp Met Leu Met Glu Tyr Phe Glu Glu Ala Cys Lys Ser 500 505 510 Ser Gly Gly Asn Thr Pro His Asn Leu Glu Lys Ala Leu Ser Trp His 515 520 525 Thr Lys Phe Ile Lys Thr Gly Ser Met Lys 530 535 <210> 11 <211> 1617 <212> DNA <213> Clostridium kluyveri <400> 11 atgtctaaag gaatcaagaa tagccaattg aaaaaaaaga acgtcaaggc cagtaacgtt 60 gctgagaaga tcgaagagaa ggtggaaaag accgacaagg tcgttgagaa ggctgctgag 120 gtgaccgaaa agcgcattcg aaacttaaag ctccaggaaa aagttgtgac cgcagatgtc 180 gcagctgaca tgatcgagaa tggcatgatc gtcgcaatta gcggcttcac gccatccggg 240 tatccaaagg aggttccaaa agcccttact aagaaggtta atgcgctgga ggaggagttc 300 aaggtgacgc tgtataccgg ttctagcaca ggcgctgata ttgacggaga atgggcgaag 360 gcaggaataa tcgaacggcg tatcccatac cagaccaact ctgacatgag gaaaaaaata 420 aacgatggtt caatcaagta cgcagatatg cacctgagcc acatggctca atacattaac 480 tattctgtga ttcctaaggt tgacattgcc atcatcgagg cggtggccat taccgaggaa 540 ggggatatta ttcctagtac tggaatcggc aacacagcta cgtttgtcga gaatgcggat 600 aaggtaattg tggaaataaa cgaggctcag ccgcttgagt tggaaggcat ggcagatatc 660 tataccctga agaaccctcc acgtcgcgag cccatcccga tagtcaacgc aggcaaccgc 720 atagggacca cttacgtcac ctgtggctct gaaaaaatct gcgcgatcgt catgaccaac 780 acccaagaca aaacccgccc actcaccgaa gtttctcctg tcagtcaggc aatctccgat 840 aacctgattg gcttcctgaa caaagaagta gaggagggta aactcccaaa aaacctgctc 900 cccatacagt caggtgtcgg ttcggttgct aacgccgttc tagccggact ctgcgaatca 960 aacttcaaaa atttgagctg ctacacagaa gtgatccagg attcgatgtt gaagctcatc 1020 aaatgtggaa aggcagatgt ggtgtccggc acctcgatct cgccatcacc ggaaatgctg 1080 cccgagttca taaaggacat aaattttttt cgcgagaaga tagtactgcg cccccaggaa 1140 atatctaata atccggaaat agctcgtcgt ataggagtga tctccataaa cactgctttg 1200 gaagtagaca tctacggtaa tgtgaactcc acgcatgtca tgggctccaa gatgatgaac 1260 ggcatcggcg gcagcggcga ctttgcccgc aacgcatacc tcaccatatt cactacggag 1320 tccatcgcga agaagggcga catttcctct atcgttccta tggtttccca cgtggaccac 1380 accgagcatg acgtaatggt catcgttacc gaacaggggg ttgcggatct gcgcggtctt 1440 tcccctcggg aaaaggccgt ggcgataatt gagaattgcg tccacccgga ttacaaggat 1500 atgctcatgg agtacttcga ggaggcttgt aagtcctcag gtggcaacac cccacacaac 1560 cttgaaaaag ccctatcctg gcacactaag ttcataaaaa ctggctcgat gaagtaa 1617 <210> 12 <211> 451 <212> PRT <213> Porphyromonas gingivalis <400> 12 Met Glu Ile Lys Glu Met Val Ser Leu Ala Arg Lys Ala Gln Lys Glu 1 5 10 15 Tyr Gln Ala Thr His Asn Gln Glu Ala Val Asp Asn Ile Cys Arg Ala 20 25 30 Ala Ala Lys Val Ile Tyr Glu Asn Ala Ala Ile Leu Ala Arg Glu Ala 35 40 45 Val Asp Glu Thr Gly Met Gly Val Tyr Glu His Lys Val Ala Lys Asn 50 55 60 Gln Gly Lys Ser Lys Gly Val Trp Tyr Asn Leu His Asn Lys Lys Ser 65 70 75 80 Ile Gly Ile Leu Asn Ile Asp Glu Arg Thr Gly Met Ile Glu Ile Ala 85 90 95 Lys Pro Ile Gly Val Val Gly Ala Val Thr Pro Thr Thr Asn Pro Ile 100 105 110 Val Thr Pro Met Ser Asn Ile Ile Phe Ala Leu Lys Thr Cys Asn Ala 115 120 125 Ile Ile Ile Ala Pro His Pro Arg Ser Lys Lys Cys Ser Ala His Ala 130 135 140 Val Arg Leu Ile Lys Glu Ala Ile Ala Pro Phe Asn Val Pro Glu Gly 145 150 155 160 Met Val Gln Ile Ile Glu Glu Pro Ser Ile Glu Lys Thr Gln Glu Leu 165 170 175 Met Gly Ala Val Asp Val Val Val Ala Thr Gly Gly Met Gly Met Val 180 185 190 Lys Ser Ala Tyr Ser Ser Gly Lys Pro Ser Phe Gly Val Gly Ala Gly 195 200 205 Asn Val Gln Val Ile Val Asp Ser Asn Ile Asp Phe Glu Ala Ala Ala 210 215 220 Glu Lys Ile Ile Thr Gly Arg Ala Phe Asp Asn Gly Ile Ile Cys Ser 225 230 235 240 Gly Glu Gln Ser Ile Ile Tyr Asn Glu Ala Asp Lys Glu Ala Val Phe 245 250 255 Thr Ala Phe Arg Asn His Gly Ala Tyr Phe Cys Asp Glu Ala Glu Gly 260 265 270 Asp Arg Ala Arg Ala Ala Ile Phe Glu Asn Gly Ala Ile Ala Lys Asp 275 280 285 Val Val Gly Gln Ser Val Ala Phe Ile Ala Lys Lys Ala Asn Ile Asn 290 295 300 Ile Pro Glu Gly Thr Arg Ile Leu Val Val Glu Ala Arg Gly Val Gly 305 310 315 320 Ala Glu Asp Val Ile Cys Lys Glu Lys Met Cys Pro Val Met Cys Ala 325 330 335 Leu Ser Tyr Lys His Phe Glu Glu Gly Val Glu Ile Ala Arg Thr Asn 340 345 350 Leu Ala Asn Glu Gly Asn Gly His Thr Cys Ala Ile His Ser Asn Asn 355 360 365 Gln Ala His Ile Ile Leu Ala Gly Ser Glu Leu Thr Val Ser Arg Ile 370 375 380 Val Val Asn Ala Pro Ser Ala Thr Thr Ala Gly Gly His Ile Gln Asn 385 390 395 400 Gly Leu Ala Val Thr Asn Thr Leu Gly Cys Gly Ser Trp Gly Asn Asn 405 410 415 Ser Ile Ser Glu Asn Phe Thr Tyr Lys His Leu Leu Asn Ile Ser Arg 420 425 430 Ile Ala Pro Leu Asn Ser Ser Ile His Ile Pro Asp Asp Lys Glu Ile 435 440 445 Trp Glu Leu 450 <210> 13 <211> 1356 <212> DNA <213> Porphyromonas gingivalis <400> 13 atggagatta aagagatggt cagtcttgcg cgcaaagctc agaaggagta tcaggccacc 60 cataaccaag aagctgtgga caacatctgc cgagcagcag cgaaggttat ttacgaaaat 120 gcagcaattc tggcacgcga ggcagtggac gaaaccggca tgggtgttta cgagcacaag 180 gtggccaaga atcaaggcaa gtccaaaggt gtttggtaca acctgcataa caagaagtcg 240 attggcatcc tcaatatcga cgagcgtacc ggcatgatcg agatcgcaaa acctatcggg 300 gttgtaggcg ccgttacgcc aaccaccaac cctatcgtta ctccgatgag caacatcatc 360 tttgctctta agacctgcaa cgccatcatt atcgccccac acccgcgctc caaaaagtgc 420 tctgcccacg cagttcggct gatcaaagag gctatcgctc cgttcaacgt gcccgaaggt 480 atggttcaga tcatcgagga gcctagcatc gagaagacgc aggaattgat gggcgccgta 540 gacgtggtcg ttgctaccgg gggcatgggc atggtcaagt ctgcctactc ctcagggaag 600 ccttctttcg gtgtcggagc cggcaatgtt caggtgatag tggacagcaa catcgacttc 660 gaagcggcag cagaaaagat catcaccgga cgtgccttcg acaacggtat catctgctca 720 ggcgaacagt ccatcatcta caacgaggct gacaaggaag cagttttcac agcattccgc 780 aaccacggtg cgtacttttg cgacgaggcc gagggagatc gggctcgtgc agcgatcttc 840 gaaaatggag ccatcgcgaa agatgttgtg ggccagtccg ttgcctttat tgcaaagaag 900 gcgaacatta atatccccga gggtactcgt attctcgtgg tcgaagctcg cggagtaggc 960 gccgaagatg tcatctgtaa agaaaagatg tgtccagtca tgtgcgccct ctcctacaag 1020 cacttcgaag agggggtaga gatcgcaagg acgaacctcg caaacgaagg caatggccat 1080 acctgtgcta tccactccaa caaccaagca cacatcatct tggcaggctc ggagctgacc 1140 gtgtctcgca tcgtggtcaa cgcgccaagt gctaccacag caggcggtca catccagaac 1200 ggtcttgccg tcaccaatac tctaggctgc ggctcttggg gtaacaactc gatctccgaa 1260 aacttcactt ataaacacct gctcaacatt tcacgcatcg ccccgttgaa ctccagcatt 1320 catatcccag atgataagga aatctgggaa ctctaa 1356 <210> 14 <211> 371 <212> PRT <213> Clostridium kluyveri <400> 14 Met Gln Leu Phe Lys Leu Lys Ser Val Thr His His Phe Asp Thr Phe 1 5 10 15 Ala Glu Phe Ala Lys Glu Phe Cys Leu Gly Glu Arg Asp Leu Val Ile 20 25 30 Thr Asn Glu Phe Ile Tyr Glu Pro Tyr Met Lys Ala Cys Gln Leu Pro 35 40 45 Cys His Phe Val Met Gln Glu Lys Tyr Gly Gln Gly Glu Pro Ser Asp 50 55 60 Glu Met Met Asn Asn Ile Leu Ala Asp Ile Arg Asn Ile Gln Phe Asp 65 70 75 80 Arg Val Ile Gly Ile Gly Gly Gly Thr Val Ile Asp Ile Ser Lys Leu 85 90 95 Phe Val Leu Lys Gly Leu Asn Asp Val Leu Asp Ala Phe Asp Arg Lys 100 105 110 Ile Pro Leu Ile Lys Glu Lys Glu Leu Ile Ile Val Pro Thr Thr Cys 115 120 125 Gly Thr Gly Ser Glu Val Thr Asn Ile Ser Ile Ala Glu Ile Lys Ser 130 135 140 Arg His Thr Lys Met Gly Leu Ala Asp Asp Ala Ile Val Ala Asp His 145 150 155 160 Ala Ile Ile Ile Pro Glu Leu Leu Lys Ser Leu Pro Phe His Phe Tyr 165 170 175 Ala Cys Ser Ala Ile Asp Ala Leu Ile His Ala Ile Glu Ser Tyr Val 180 185 190 Ser Pro Lys Ala Ser Pro Tyr Ser Arg Leu Phe Ser Glu Ala Ala Trp 195 200 205 Asp Ile Ile Leu Glu Val Phe Lys Lys Ile Ala Glu His Gly Pro Glu 210 215 220 Tyr Arg Phe Glu Lys Leu Gly Glu Met Ile Met Ala Ser Asn Tyr Ala 225 230 235 240 Gly Ile Ala Phe Gly Asn Ala Gly Val Gly Ala Val His Ala Leu Ser 245 250 255 Tyr Pro Leu Gly Gly Asn Tyr His Val Pro His Gly Glu Ala Asn Tyr 260 265 270 Gln Phe Phe Thr Glu Val Phe Lys Val Tyr Gln Lys Lys Asn Pro Phe 275 280 285 Gly Tyr Ile Val Glu Leu Asn Trp Lys Leu Ser Lys Ile Leu Asn Cys 290 295 300 Gln Pro Glu Tyr Val Tyr Pro Lys Leu Asp Glu Leu Leu Gly Cys Leu 305 310 315 320 Leu Thr Lys Lys Pro Leu His Glu Tyr Gly Met Lys Asp Glu Glu Val 325 330 335 Arg Gly Phe Ala Glu Ser Val Leu Lys Thr Gln Gln Arg Leu Leu Ala 340 345 350 Asn Asn Tyr Val Glu Leu Thr Val Asp Glu Ile Glu Gly Ile Tyr Arg 355 360 365 Arg Leu Tyr 370 <210> 15 <211> 1116 <212> DNA <213> Clostridium kluyveri <400> 15 atgcagcttt tcaagctcaa gagcgtcaca catcactttg atacttttgc agagtttgcc 60 aaggagttct gtctcggtga acgcgacttg gtaattacca acgagttcat ctacgaaccg 120 tatatgaagg catgccagct gccttgtcat tttgtgatgc aggagaaata cggccaaggc 180 gagccttctg acgagatgat gaacaacatc ctagcagata tccgtaatat ccagttcgac 240 cgcgtgatcg ggatcggagg tggtacggtt attgacatct caaaactctt tgttctgaag 300 ggattaaatg atgttctcga cgcgttcgat cgcaagattc cccttatcaa agagaaagaa 360 ctgatcattg tgcccaccac ctgcggaacc ggctcggagg tgacgaacat ttccatcgcc 420 gagatcaagt cccggcacac caagatgggt ttggctgacg atgcaattgt tgctgaccac 480 gccataatca tccctgaact tctgaagagc ttgcccttcc acttctatgc atgctccgca 540 atcgacgctc ttattcatgc catcgagtca tacgtttctc caaaagcgtc tccatactcc 600 cgtctgttca gtgaggcggc gtgggacatt atcctggaag ttttcaagaa aatcgccgaa 660 cacggcccag agtaccgctt cgagaagctg ggggaaatga tcatggccag caactatgcc 720 ggtatcgctt tcggcaacgc aggcgttggc gccgtccacg ctctatccta cccgttgggc 780 ggcaactatc acgtgccgca tggagaagca aactatcagt tcttcaccga ggtctttaaa 840 gtataccaaa agaagaatcc gttcggctat attgtcgaac tcaactggaa gctctccaag 900 attctgaact gccagccaga gtacgtgtac ccgaagctgg atgaactgct cggttgcctt 960 cttaccaaga aacctttgca cgaatacggc atgaaggacg aagaggttcg tggcttcgcg 1020 gaatcggtcc tgaagaccca gcaacgcttg ctcgccaaca actacgtcga acttactgtc 1080 gatgagatcg aaggtatcta ccgacgtctc tactag 1116 <210> 16 <211> 431 <212> PRT <213> Porphyromonas gingivalis <400> 16 Met Lys Asp Val Leu Ala Glu Tyr Ala Ser Arg Ile Val Ser Ala Glu 1 5 10 15 Glu Ala Val Lys His Ile Lys Asn Gly Glu Arg Val Ala Leu Ser His 20 25 30 Ala Ala Gly Val Pro Gln Ser Cys Val Asp Ala Leu Val Gln Gln Ala 35 40 45 Asp Leu Phe Gln Asn Val Glu Ile Tyr His Met Leu Cys Leu Gly Glu 50 55 60 Gly Lys Tyr Met Ala Pro Glu Met Ala Pro His Phe Arg His Ile Thr 65 70 75 80 Asn Phe Val Gly Gly Asn Ser Arg Lys Ala Val Glu Glu Asn Arg Ala 85 90 95 Asp Phe Ile Pro Val Phe Phe Tyr Glu Val Pro Ser Met Ile Arg Lys 100 105 110 Asp Ile Leu His Ile Asp Val Ala Ile Val Gln Leu Ser Met Pro Asp 115 120 125 Glu Asn Gly Tyr Cys Ser Phe Gly Val Ser Cys Asp Tyr Ser Lys Pro 130 135 140 Ala Ala Glu Ser Ala His Leu Val Ile Gly Glu Ile Asn Arg Gln Met 145 150 155 160 Pro Tyr Val His Gly Asp Asn Leu Ile His Ile Ser Lys Leu Asp Tyr 165 170 175 Ile Val Met Ala Asp Tyr Pro Ile Tyr Ser Leu Ala Lys Pro Lys Ile 180 185 190 Gly Glu Val Glu Glu Ala Ile Gly Arg Asn Cys Ala Glu Leu Ile Glu 195 200 205 Asp Gly Ala Thr Leu Gln Leu Gly Ile Gly Ala Ile Pro Asp Ala Ala 210 215 220 Leu Leu Phe Leu Lys Asp Lys Lys Asp Leu Gly Ile His Thr Glu Met 225 230 235 240 Phe Ser Asp Gly Val Val Glu Leu Val Arg Ser Gly Val Ile Thr Gly 245 250 255 Lys Lys Lys Thr Leu His Pro Gly Lys Met Val Ala Thr Phe Leu Met 260 265 270 Gly Ser Glu Asp Val Tyr His Phe Ile Asp Lys Asn Pro Asp Val Glu 275 280 285 Leu Tyr Pro Val Asp Tyr Val Asn Asp Pro Arg Val Ile Ala Gln Asn 290 295 300 Asp Asn Met Val Ser Ile Asn Ser Cys Ile Glu Ile Asp Leu Met Gly 305 310 315 320 Gln Val Val Ser Glu Cys Ile Gly Ser Lys Gln Phe Ser Gly Thr Gly 325 330 335 Gly Gln Val Asp Tyr Val Arg Gly Ala Ala Trp Ser Lys Asn Gly Lys 340 345 350 Ser Ile Met Ala Ile Pro Ser Thr Ala Lys Asn Gly Thr Ala Ser Arg 355 360 365 Ile Val Pro Ile Ile Ala Glu Gly Ala Ala Val Thr Thr Leu Arg Asn 370 375 380 Glu Val Asp Tyr Val Val Thr Glu Tyr Gly Ile Ala Gln Leu Lys Gly 385 390 395 400 Lys Ser Leu Arg Gln Arg Ala Glu Ala Leu Ile Ala Ile Ala His Pro 405 410 415 Asp Phe Arg Glu Glu Leu Thr Lys His Leu Arg Lys Arg Phe Gly 420 425 430 <210> 17 <211> 1296 <212> DNA <213> Porphyromonas gingivalis <400> 17 atgaaggatg tactggcgga atacgcctcc cgcattgttt cggcggagga ggccgttaag 60 cacatcaaaa acggtgaacg ggtagctttg tcacacgctg ccggcgtgcc tcagagttgc 120 gttgacgcac tggtgcagca ggccgacctt ttccagaatg tggaaatcta tcacatgctg 180 tgcctcggtg agggtaagta tatggcgcct gagatggccc ctcacttccg ccacatcacc 240 aactttgtcg gtggtaactc ccgtaaggcg gtcgaagaaa accgggccga tttcattccg 300 gtattctttt acgaggtgcc aagcatgatt cgcaaagaca tcctccacat tgatgtcgcc 360 atcgttcagc tttcaatgcc tgacgaaaat ggttactgtt cctttggagt atcttgcgat 420 tactccaagc cggcagcaga gagcgctcac ctggttatcg gagaaatcaa ccgtcaaatg 480 ccatacgtac acggcgacaa cttgattcat atctccaagt tggattacat cgtgatggca 540 gactacccca tctactctct tgcaaagccc aagatcgggg aagtcgagga agctatcggg 600 aggaattgtg ccgagcttat tgaagatggt gccactctcc agctgggaat cggcgcgatt 660 cctgatgcgg ccctgttatt tctcaaggac aaaaaggatc tgggcatcca taccgaaatg 720 ttctccgatg gtgttgtcga attggttcgc tccggcgtta tcacaggcaa gaaaaagact 780 cttcaccccg gaaagatggt cgcaaccttc ctgatgggaa gcgaggacgt gtatcatttc 840 atcgataaaa accccgatgt agaactgtat ccagtagatt acgtgaatga cccgcgtgtg 900 atcgcccaaa acgacaatat ggtctcgatt aacagctgca tcgaaatcga ccttatggga 960 caggtcgtgt ccgagtgcat cggctcaaag caattcagcg gcaccggcgg ccaagttgac 1020 tacgtgcgtg gcgcagcatg gtctaaaaac ggcaaatcga tcatggcaat cccgtccact 1080 gcaaaaaacg gtacggcatc tcgaattgta cctatcatcg cggagggcgc tgctgtcacc 1140 accctgcgca acgaggtcga ttacgttgta accgagtacg gtatcgctca gctcaagggc 1200 aagagcctgc gccagcgcgc agaggctttg atcgcgatag cccaccccga cttccgtgag 1260 gaactaacga aacatctccg caagcgattc ggataa 1296 <210> 18 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> forward primer of bdh <400> 18 gctctagaag gaggattaca aaatggagaa ttttagattt aatg 44 <210> 19 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of bdh <400> 19 ttcccttgcg gccgcttaaa gggacatttc taa 33 <210> 20 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> forward primer of bld <400> 20 gccccgggag gaggattaca aaatgattaa agacacgcta gtttc 45 <210> 21 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of bld <400> 21 ttcccttgcg gccgcttaac cggcgagtac acatc 35 <210> 22 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> forward primer of cs4c <400> 22 gctctagaag gaggattaca aaatgagtaa agggattaag aac 43 <210> 23 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of cs4c <400> 23 ttcccttgcg gccgcttaac caaaacgttt gcg 33 <210> 24 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Sub_BamHI_R <400> 24 cgggatcccg gtgtgaaata ccg 23 <210> 25 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Sub_EcoRI_R <400> 25 cgggatcccg gtgtgaaata ccg 23 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sub_SacI_F <400> 26 gagctcccga ctggaaagcg 20 <210> 27 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Sub_SalI_F <400> 27 acgcgtcgac ccgactggaa agcg 24 <210> 28 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> forward primer of adhE2 <400> 28 gctctagaag gaggattaca aaatgatttt gcatctgctg 40 <210> 29 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of adhE2 <400> 29 ttcccttgcg gccgcttaaa acgacttgat gtagat 36 <210> 30 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> forward primer of adh1 <400> 30 gctctagaag gaggattaca aaatgatgag atttacatta ccaag 45 <210> 31 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of adh1 <400> 31 ttcccttgcg gccgcttaaa aatcaacttc tgtacc 36 <210> 32 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> forward primer of adhE1 <400> 32 gctctagaag gaggattaca aaatgaaagt cacaacagta aag 43 <210> 33 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of adhE1 <400> 33 ttcccttgcg gccgcttaag gttgtttttt aaaac 35 <210> 34 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> forward primer of adhE2 <400> 34 gctctagaag gaggattaca aaatgatttt gcatctgctg 40 <210> 35 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of adhE2 <400> 35 ttcccttgcg gccgcttaaa acgacttgat gtagat 36 <210> 36 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> forward primer of bdhA <400> 36 gctctagaag gaggattaca aaatgctaag ttttgattat tca 43 <210> 37 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of bdhA <400> 37 ttcccttgcg gccgcttata agatttttta aatatctc 38 <210> 38 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> forward primer of bdhB <400> 38 gccccgggag gaggattaca aaatggttga tttcgaatat tcaatac 47 <210> 39 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of bdhB <400> 39 ttcccttgcg gccgcttaca cagatttttt gaatatttg 39 <210> 40 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> forward primer of bld (pET21a) <400> 40 gcgaattcat gattaaagac acgctagttt c 31 <210> 41 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of bld (pET21a) <400> 41 aaaactcgag accggcgagt acacatct 28 <210> 42 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> forward primer of adhE2 (pET21a) <400> 42 gcggatccat gattttgcat ctgctgcga 29 <210> 43 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of adhE2 (pET21a) <400> 43 aaaactcgag aaacgacttg atgtagatat cc 32 <210> 44 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> forward primer of bdh (pET21a) <400> 44 gcgaattcat ggagaatttt agatttaat 29 <210> 45 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of bdh (pET21a) <400> 45 aaaactcgag aagggacatt tctaaaattt tata 34 <210> 46 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer for A176T <400> 46 gctaaaaaat gtgttacctt tgctgtcgaa 30 <210> 47 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for A176T <400> 47 ttcgacagca aaggtaacac attttttagc 30 <210> 48 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer for L273I <400> 48 tcttttgata ataatatacc ttgtattgca 30 <210> 49 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for L273I <400> 49 tgcaatacaa ggtatattat tatcaaaaga 30 <210> 50 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer for K279R <400> 50 ccttgtattg cagaaagaga agtatttgtt 30 <210> 51 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for K279R <400> 51 aacaaatact tctctttctg caatacaagg 30 <210> 52 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer for M371R <400> 52 tatgacagaa ctcatgaggc caatattacc 30 <210> 53 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for M371R <400> 53 ggtaatattg gcctcatgag ttctgtcata 30 <210> 54 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> forward primer for N409T <400> 54 tcaaaaaata tagacaccct aaataggttt g 31 <210> 55 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for N409T <400> 55 caaacctatt tagggtgtct atattttttg a 31 <210> 56 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer for A467S <400> 56 agaagatgtg tactctccgg ttaagcggcc 30 <210> 57 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for A467S <400> 57 ggccgcttaa ccggagagta cacatcttct 30 <210> 58 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer for L273A <400> 58 tcttttgata ataatgcgcc ttgtattgca 30 <210> 59 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for L273A <400> 59 tgcaatacaa gggcgattat tatcaaaaga 30 <210> 60 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer for L273C <400> 60 tcttttgata ataattgccc ttgtattgca 30 <210> 61 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for L273C <400> 61 tgcaatacaa gggcaattat tatcaaaaga 30 <210> 62 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer for L273D <400> 62 tcttttgata ataatgatcc ttgtattgca 30 <210> 63 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for L273D <400> 63 tgcaatacaa ggatcattat tatcaaaaga 30 <210> 64 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer for L273E <400> 64 tcttttgata ataatgaacc ttgtattgca 30 <210> 65 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for L273E <400> 65 tgcaatacaa ggttcattat tatcaaaaga 30 <210> 66 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer for L273F <400> 66 tcttttgata ataattttcc ttgtattgca 30 <210> 67 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for L273F <400> 67 tgcaatacaa ggaaaattat tatcaaaaga 30 <210> 68 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer for L273G <400> 68 tcttttgata ataatggccc ttgtattgca 30 <210> 69 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for L273G <400> 69 tgcaatacaa gggccattat tatcaaaaga 30 <210> 70 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer for L273H <400> 70 tcttttgata ataatcatcc ttgtattgca 30 <210> 71 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for L273H <400> 71 tgcaatacaa ggatgattat tatcaaaaga 30 <210> 72 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer for L273K <400> 72 tcttttgata ataataaacc ttgtattgca 30 <210> 73 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for L273K <400> 73 tgcaatacaa ggtttattat tatcaaaaga 30 <210> 74 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer for L273M <400> 74 tcttttgata ataatatgcc ttgtattgca 30 <210> 75 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for L273M <400> 75 tgcaatacaa ggcatattat tatcaaaaga 30 <210> 76 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer for L273N <400> 76 tcttttgata ataataaccc ttgtattgca 30 <210> 77 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for L273N <400> 77 tgcaatacaa gggttattat tatcaaaaga 30 <210> 78 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer for L273P <400> 78 tcttttgata ataatccgcc ttgtattgca 30 <210> 79 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for L273P <400> 79 tgcaatacaa ggcggattat tatcaaaaga 30 <210> 80 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer for L273Q <400> 80 tcttttgata ataatcagcc ttgtattgca 30 <210> 81 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for L273Q <400> 81 tgcaatacaa ggctgattat tatcaaaaga 30 <210> 82 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer for L273S <400> 82 tcttttgata ataatagccc ttgtattgca 30 <210> 83 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for L273S <400> 83 tgcaatacaa gggctattat tatcaaaaga 30 <210> 84 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer for L273T <400> 84 tcttttgata ataatacccc ttgtattgca 30 <210> 85 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for L273T <400> 85 tgcaatacaa ggggtattat tatcaaaaga 30 <210> 86 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer for L273V <400> 86 tcttttgata ataatgtgcc ttgtattgca 30 <210> 87 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for L273V <400> 87 tgcaatacaa ggcacattat tatcaaaaga 30 <210> 88 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer for L273W <400> 88 tcttttgata ataattggcc ttgtattgca 30 <210> 89 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for L273W <400> 89 tgcaatacaa ggccaattat tatcaaaaga 30 <210> 90 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer for L273Y <400> 90 tcttttgata ataattatcc ttgtattgca 30 <210> 91 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for L273Y <400> 91 tgcaatacaa ggataattat tatcaaaaga 30 <210> 92 <211> 1000 <212> DNA <213> NAD-dependent aldehyde dehydrogenase of Clostridium saccharoperbutylacetonicum <400> 92 atgattaaag acacgctagt ttctataaca aaagatttaa aattaaaaac aaatgttgaa 60 aatgccaatc taaagaacta caaggatgat tcttcatgtt tcggagtttt cgaaaatgtt 120 gaaaatgcta taagcaatgc cgtacacgca caaaagatat tatcccttca ttatacaaaa 180 gaacaaagag aaaaaatcat aactgagata agaaaggccg cattagaaaa taaagagatt 240 ctagctacaa tgattcttga agaaacacat atgggaagat atgaagataa aatattaaag 300 catgaattag tagctaaata cactcctggg acagaagatt taactactac tgcttggtca 360 ggagataacg ggcttacagt tgtagaaatg tctccatatg gcgttatagg tgcaataact 420 ccttctacga atccaactga aactgtaata tgtaatagta taggcatgat agctgctgga 480 aatactgtgg tatttaacgg acatccaggc gctaaaaaat gtgttgcttt tgctgtcgaa 540 atgataaata aagctattat ttcatgtggt ggtcctgaga atttagtaac aactataaaa 600 aatccaacta tggactctct agatgcaatt attaagcacc cttcaataaa actactttgc 660 ggaactggag ggccaggaat ggtaaaaacc ctcttaaatt ctggtaagaa agctataggt 720 gctggtgctg gaaatccacc agttattgta gatgatactg ctgatataga aaaggctggt 780 aagagtatca ttgaaggctg ttcttttgat aataatttac cttgtattgc agaaaaagaa 840 gtatttgttt ttgagaacgt tgcagatgat ttaatatcta acatgctaaa aaataatgct 900 gtaattataa atgaagatca agtatcaaag ttaatagatt tagtattaca aaaaaataat 960 gaaactcaag aatactctat aaataagaaa tgggtcggaa 1000 <210> 93 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> constitutive lac promoter of cat1-sucD-4hbd-cat2 module <400> 93 tttacacttt atgcttccgg ctcgtatgtt 30 <210> 94 <211> 1617 <212> DNA <213> Artificial Sequence <220> <223> cat1 gene <400> 94 atgagtaaag ggattaagaa ctcgcaacta aaaaaaaaaa atgtgaaggc cagtaatgtg 60 gcagaaaaga ttgaagagaa agttgaaaaa acggataagg ttgttgaaaa agccgctgag 120 gttacagaga aacggattag aaacctgaag ctgcaggaga aagttgttac agcggatgtg 180 gcggctgata tgattgaaaa tggcatgatt gtggcaatca gcggttttac tccgtccggt 240 tatccaaagg aagtccctaa agcactgact aaaaaagtta atgccctgga ggaggagttc 300 aaggtcacct tatataccgg gtcaagcacg ggggccgaca tcgacgggga atgggcaaag 360 gcaggaatca tagaacggcg tatcccctac cagacaaatt ctgacatgcg aaaaaaaata 420 aatgacggtt ctattaagta cgctgatatg catttaagcc atatggctca atatattaat 480 tattctgtca ttcctaaagt cgatatagct ataatagaag cggtagctat tacggaagaa 540 ggggatataa ttccttcgac gggaattggc aataccgcga cttttgtgga aaacgcggac 600 aaagtgatag tggaaattaa cgaagcccaa ccgctggaat tggagggcat ggcagacata 660 tacacattaa aaaacccccc gcgtagagag ccgattccaa tagttaatgc tggcaatcgc 720 atagggacca catatgtgac ctgtggctcg gaaaaaatct gcgccatcgt catgacaaat 780 acgcaagaca aaacaagacc tcttacagag gtgtctcctg tatctcaggc catctccgac 840 aatctgatag gttttttaaa caaagaagtg gaagagggca aattacctaa aaacctgctc 900 cccatacagt caggagttgg tagtgtcgca aatgcggttt tggccggtct ttgtgaatca 960 aactttaaaa acctaagttg ttacacggag gttatccagg atagcatgct gaagcttata 1020 aaatgtggaa aagcagatgt ggtgtcaggc acctccataa gtccatcacc ggagatgctg 1080 cctgagttca tcaaggacat aaacttcttt agagaaaaga tagtattaag accacaggaa 1140 atcagcaata acccagagat agcacgcaga atcggtgtga tatccataaa caccgccttg 1200 gaagtagaca tatatggtaa tgtaaacagt acgcacgtta tgggaagcaa aatgatgaat 1260 ggcataggcg gttctggcga ctttgcccgc aatgcatatc tcactatctt cactacagag 1320 tctatcgcca aaaaaggcga tatctcaagc atagtgccta tggtatccca tgtggatcat 1380 accgaacatg atgtaatggt catcgttacc gaacagggag tagcggatct gcgcggtctt 1440 tctcctaggg aaaaggcggt ggctataatc gaaaattgcg ttcatccgga ctataaggat 1500 atgctgatgg agtattttga agaagcgtgc aaatcgtcag gtgggaacac cccacacaat 1560 cttgaaaaag ctctttcatg gcacacaaaa tttataaaaa cgggtagcat gaaataa 1617 <210> 95 <211> 1356 <212> DNA <213> Artificial Sequence <220> <223> sucD gene <400> 95 atggaaataa aagagatggt gtcgttggca aggaaagctc agaaggaata tcaagcgacc 60 cataatcaag aagcagttga taacatttgc cgagctgcag caaaagtgat ttatgaaaat 120 gcagctatac tggctcgcga agcagtagac gaaaccggca tgggcgtata tgaacataaa 180 gtggccaaga atcaggggaa atccaaaggc gtctggtaca atttgcacaa taaaaaatcg 240 atcggtatct taaatataga cgagagaacc gggatgatcg agatagcaaa acctatcggg 300 gttgttggag ccgtaacccc gacgacaaac ccgattgtga ctccaatgag caacatcatt 360 tttgccctta agacatgcaa tgccattatt atcgccccac atcccagatc caaaaaatgc 420 tcagcacatg cagttcgtct gataaaggaa gcaatcgctc cgtttaatgt cccggaggga 480 atggttcaga tcattgaaga gcccagcatc gagaaaactc aggaactaat gggcgccgtg 540 gatgtggtag ttgcgacggg tggtatgggt atggtgaaat ctgcatattc ttcagggaag 600 ccttcttttg gtgtaggagc cggtaacgtt caagtgatcg tggatagtaa tatcgatttt 660 gaagctgcgg cagaaaaaat tatcaccggc cgtgctttcg acaatgggat catctgttca 720 ggcgaacaga gtatcatcta caacgaagct gacaaggaag ctgtcttcac agccttccgc 780 aaccatggtg catatttttg tgatgaagcg gagggagatc gggcccgtgc tgcgattttt 840 gagaatggcg ccatcgcgaa agatgtagtc ggccagagcg ttgcctttat cgcgaagaaa 900 gcaaatatca atataccgga gggtacccgt attctggttg ttgaagctcg cggcgtcgga 960 gcagaggatg tcatatgtaa ggaaaaaatg tgtccagtta tgtgcgcctt aagctacaag 1020 cacttcgagg aaggtgtaga aatcgcacgt acgaacttgg ccaacgaagg taacggccat 1080 acctgtgcga tccattccaa caatcaggcg catatcatac tggcaggttc agaactgacg 1140 gtttcgcgga tcgtggtcaa tgcgccgagt gccactacag caggcggtca catccaaaat 1200 ggtctggcag tgacaaatac gctcggatgc gggagttggg gtaataactc tatctccgag 1260 aactttactt ataaacacct gttaaacatt agccgcatag cgccgcttaa ttcaagcatt 1320 cacattcctg atgacaaaga gatctgggaa ctctaa 1356 <210> 96 <211> 1116 <212> DNA <213> Artificial Sequence <220> <223> 4hbd gene <400> 96 atgcaactgt tcaaactgaa atcagtcaca catcacttcg atactttcgc ggaatttgcc 60 aaagagttct gtcttggaga acgtgattta gtaattacca acgaattcat ttacgaaccg 120 tatatgaagg catgtcagtt gccctgccat tttgttatgc aggagaaata tgggcaaggc 180 gagccatctg acgagatgat gaataacatc ttggcagaca tccgtaatat ccagtttgac 240 cgcgtgatcg gtattggggg tggtacggtt attgacatct cgaaattatt tgtgctgaaa 300 ggactaaatg atgtgctcga tgcgttcgat cgcaagatac cgctgattaa agagaaagaa 360 ctgatcattg tgcccaccac atgcgggacg ggtagcgagg tgacgaatat ttcgatcgcg 420 gagatcaaaa gccgtcatac caaaatgggt ttggctgacg atgctattgt tgcagaccac 480 gcgatcatca taccagagct tctgaaaagc ctgccgttcc atttttatgc atgcagtgca 540 atagatgctc tgatccatgc catcgagtca tatgtttctc ctaaagccag tccatattct 600 cgtctgttca gtgaggcggc atgggatatt atcctggagg tattcaagaa aatagccgaa 660 cacggccctg aataccgctt tgagaagctg ggagaaatga tcatggcctc caactatgct 720 ggtatagcct tcgggaatgc aggcgtgggt gccgttcacg ctctaagcta tccattggga 780 ggcaattatc atgtgccgca tggcgaggct aactatcagt tttttacaga ggtctttaaa 840 gtataccaaa agaaaaatcc tttcggctat atagtcgaac tcaactggaa gctgtccaag 900 attctgaact gtcagcctga atacgtctat ccgaaactgg atgagttact cggctgtctt 960 ctgaccaaaa aaccgctgca cgaatacggc atgaaagatg aagaggtacg tggatttgcg 1020 gaatcagtgc ttaagactca gcagcggttg ctcgcgaata attatgttga gcttactgtt 1080 gatgaaattg aaggtatcta cagacgactg tactaa 1116 <210> 97 <211> 1296 <212> DNA <213> Artificial Sequence <220> <223> cat2 gene <400> 97 atgaaagacg tgttagcgga atatgcctcc cgaattgttt cggccgaaga ggcagtcaaa 60 catatcaaaa atggagagcg tgtcgcttta tcacatgctg ccggagttcc tcagagttgt 120 gttgacgcac tggtgcaaca ggcggacctg tttcagaatg tggagattta ccacatgctg 180 tgtctcggcg aaggaaaata tatggcacct gaaatggccc ctcacttccg gcacataacc 240 aattttgttg gtggtaactc tcgtaaagca gtggaggaaa atagagccga cttcattccg 300 gtattctttt atgaagtgcc atcaatgatt cggaaagata tccttcatat agatgtggcc 360 attgtccaac tctcaatgcc agatgagaat ggttactgca gctttggcgt atcttgcgat 420 tatagcaaac cggcggcgga atcggcgcat ttagttattg gggaaatcaa ccgtcagatg 480 ccatatgtgc atggtgacaa cttgattcac atatcgaagt tggattacat cgtgatggcg 540 gattacccaa tttattctct ggcgaagccc aaaatcggag aagtagagga agctatcggc 600 cgtaactgtg ccgagcttat tgaagatggt gccaccctac agctgggtat cggcgcgatt 660 ccggatgcag ctctgctgtt tctgaaggac aaaaaagatc tggggattca tactgaaatg 720 ttctccgatg gcgttgttga actggtgcgc agtggtgtaa ttactggaaa aaaaaagaca 780 ttgcatcccg gtaagatggt cgcgacgttt cttatgggat cagaagacgt gtatcatttc 840 atcgacaaga atccggatgt ggaactgtat ccggttgatt acgtcaatga tccgagggtt 900 atcgctcaga atgataatat ggtcagcatc aatagctgta tcgagatcga tctaatgggc 960 caagtggtga gcgagtgcat aggctccaaa cagtttagtg gcaccggggg tcaagtagat 1020 tatgtccgcg gggcagcttg gtctaaaaac ggcaaaagca tcatggcaat tccctcaaca 1080 gccaaaaacg gtactgcatc tcggatagtt cctataattg cagagggcgc tgctgtaaca 1140 accctccgca acgaagtcga ctacgttgtt acggaatatg ggatagcaca gttaaaaggt 1200 aagagtttgc gtcagcgcgc agaagctctt attgcgatag cccacccgga ctttagagag 1260 gaactgacga agcatctgcg caaacgtttt ggttaa 1296 <210> 98 <211> 8613 <212> DNA <213> Artificial Sequence <220> <223> pSTV-cs4c full sequence <400> 98 cgtatggcaa tgaaagacgg tgagctggtg atatgggata gtgttcaccc ttgttacacc 60 gttttccatg agcaaactga aacgttttca tcgctctgga gtgaatacca cgacgatttc 120 cggcagtttc tacacatata ttcgcaagat gtggcgtgtt acggtgaaaa cctggcctat 180 ttccctaaag ggtttattga gaatatgttt ttcgtctcag ccaatccctg ggtgagtttc 240 accagttttg atttaaacgt ggccaatatg gacaacttct tcgcccccgt tttcaccatg 300 ggcaaatatt atacgcaagg cgacaaggtg ctgatgccgc tggcgattca ggttcatcat 360 gccgtttgtg atggcttcca tgtcggcaga atgcttaatg aattacaaca gtactgcgat 420 gagtggcagg gcggggcgta atttttttaa ggcagttatt ggtgccctta aacgcctggt 480 gctacgcctg aataagtgat aataagcgga tgaatggcag aaattcgaaa gcaaattcga 540 cccggtcgtc ggttcagggc agggtcgtta aatagccgct tatgtctatt gctggtttac 600 cggtttattg actaccggaa gcagtgtgac cgtgtgcttc tcaaatgcct gaggccagtt 660 tgctcaggct ctccccgtgg aggtaataat tgacgatatg atcatttatt ctgcctccca 720 gagcctgata aaaacggtta gcgcttcgtt aatacagatg taggtgttcc acagggtagc 780 cagcagcatc ctgcgatgca gatccggaac ataatggtgc agggcgcttg tttcggcgtg 840 ggtatggtgg caggccccgt ggccggggga ctgttgggcg ctgccggcac ctgtcctacg 900 agttgcatga taaagaagac agtcataagt gcggcgacga tagtcatgcc ccgcgcccac 960 cggaaggagc taccggacag cggtgcggac tgttgtaact cagaataaga aatgaggccg 1020 ctcatggcgt tccaatacgc aaaccgcctc tccccgcgcg ttggccgatt cattaatgca 1080 gctggcacga caggtttccc gactggaaag cgggcagtga gcgcaacgca attaatgtga 1140 gttagctcac tcattaggca ccccaggctt tacactttat gcttccggct cgtatgttgt 1200 gtggaattgt gagcggataa caatttcaca caggaaacag ctatgaccat gattacgaat 1260 tcgagctccc gactggaaag cgggcagtga gcgcaacgca attaatgtga gttagctcac 1320 tcattaggca ccccaggctt tacactttat gcttccggct cgtatgttgt gtggaattgt 1380 gagcgtctag aaggaggatt acaaaatgag taaagggatt aagaactcgc aactaaaaaa 1440 aaaaaatgtg aaggccagta atgtggcaga aaagattgaa gagaaagttg aaaaaacgga 1500 taaggttgtt gaaaaagccg ctgaggttac agagaaacgg attagaaacc tgaagctgca 1560 ggagaaagtt gttacagcgg atgtggcggc tgatatgatt gaaaatggca tgattgtggc 1620 aatcagcggt tttactccgt ccggttatcc aaaggaagtc cctaaagcac tgactaaaaa 1680 agttaatgcc ctggaggagg agttcaaggt caccttatat accgggtcaa gcacgggggc 1740 cgacatcgac ggggaatggg caaaggcagg aatcatagaa cggcgtatcc cctaccagac 1800 aaattctgac atgcgaaaaa aaataaatga cggttctatt aagtacgctg atatgcattt 1860 aagccatatg gctcaatata ttaattattc tgtcattcct aaagtcgata tagctataat 1920 agaagcggta gctattacgg aagaagggga tataattcct tcgacgggaa ttggcaatac 1980 cgcgactttt gtggaaaacg cggacaaagt gatagtggaa attaacgaag cccaaccgct 2040 ggaattggag ggcatggcag acatatacac attaaaaaac cccccgcgta gagagccgat 2100 tccaatagtt aatgctggca atcgcatagg gaccacatat gtgacctgtg gctcggaaaa 2160 aatctgcgcc atcgtcatga caaatacgca agacaaaaca agacctctta cagaggtgtc 2220 tcctgtatct caggccatct ccgacaatct gataggtttt ttaaacaaag aagtggaaga 2280 gggcaaatta cctaaaaacc tgctccccat acagtcagga gttggtagtg tcgcaaatgc 2340 ggttttggcc ggtctttgtg aatcaaactt taaaaaccta agttgttaca cggaggttat 2400 ccaggatagc atgctgaagc ttataaaatg tggaaaagca gatgtggtgt caggcacctc 2460 cataagtcca tcaccggaga tgctgcctga gttcatcaag gacataaact tctttagaga 2520 aaagatagta ttaagaccac aggaaatcag caataaccca gagatagcac gcagaatcgg 2580 tgtgatatcc ataaacaccg ccttggaagt agacatatat ggtaatgtaa acagtacgca 2640 cgttatggga agcaaaatga tgaatggcat aggcggttct ggcgactttg cccgcaatgc 2700 atatctcact atcttcacta cagagtctat cgccaaaaaa ggcgatatct caagcatagt 2760 gcctatggta tcccatgtgg atcataccga acatgatgta atggtcatcg ttaccgaaca 2820 gggagtagcg gatctgcgcg gtctttctcc tagggaaaag gcggtggcta taatcgaaaa 2880 ttgcgttcat ccggactata aggatatgct gatggagtat tttgaagaag cgtgcaaatc 2940 gtcaggtggg aacaccccac acaatcttga aaaagctctt tcatggcaca caaaatttat 3000 aaaaacgggt agcatgaaat aatagaagga gatataaata tggaaataaa agagatggtg 3060 tcgttggcaa ggaaagctca gaaggaatat caagcgaccc ataatcaaga agcagttgat 3120 aacatttgcc gagctgcagc aaaagtgatt tatgaaaatg cagctatact ggctcgcgaa 3180 gcagtagacg aaaccggcat gggcgtatat gaacataaag tggccaagaa tcaggggaaa 3240 tccaaaggcg tctggtacaa tttgcacaat aaaaaatcga tcggtatctt aaatatagac 3300 gagagaaccg ggatgatcga gatagcaaaa cctatcgggg ttgttggagc cgtaaccccg 3360 acgacaaacc cgattgtgac tccaatgagc aacatcattt ttgcccttaa gacatgcaat 3420 gccattatta tcgccccaca tcccagatcc aaaaaatgct cagcacatgc agttcgtctg 3480 ataaaggaag caatcgctcc gtttaatgtc ccggagggaa tggttcagat cattgaagag 3540 cccagcatcg agaaaactca ggaactaatg ggcgccgtgg atgtggtagt tgcgacgggt 3600 ggtatgggta tggtgaaatc tgcatattct tcagggaagc cttcttttgg tgtaggagcc 3660 ggtaacgttc aagtgatcgt ggatagtaat atcgattttg aagctgcggc agaaaaaatt 3720 atcaccggcc gtgctttcga caatgggatc atctgttcag gcgaacagag tatcatctac 3780 aacgaagctg acaaggaagc tgtcttcaca gccttccgca accatggtgc atatttttgt 3840 gatgaagcgg agggagatcg ggcccgtgct gcgatttttg agaatggcgc catcgcgaaa 3900 gatgtagtcg gccagagcgt tgcctttatc gcgaagaaag caaatatcaa tataccggag 3960 ggtacccgta ttctggttgt tgaagctcgc ggcgtcggag cagaggatgt catatgtaag 4020 gaaaaaatgt gtccagttat gtgcgcctta agctacaagc acttcgagga aggtgtagaa 4080 atcgcacgta cgaacttggc caacgaaggt aacggccata cctgtgcgat ccattccaac 4140 aatcaggcgc atatcatact ggcaggttca gaactgacgg tttcgcggat cgtggtcaat 4200 gcgccgagtg ccactacagc aggcggtcac atccaaaatg gtctggcagt gacaaatacg 4260 ctcggatgcg ggagttgggg taataactct atctccgaga actttactta taaacacctg 4320 ttaaacatta gccgcatagc gccgcttaat tcaagcattc acattcctga tgacaaagag 4380 atctgggaac tctaatagaa ggagatataa atatgcaact gttcaaactg aaatcagtca 4440 cacatcactt cgatactttc gcggaatttg ccaaagagtt ctgtcttgga gaacgtgatt 4500 tagtaattac caacgaattc atttacgaac cgtatatgaa ggcatgtcag ttgccctgcc 4560 attttgttat gcaggagaaa tatgggcaag gcgagccatc tgacgagatg atgaataaca 4620 tcttggcaga catccgtaat atccagtttg accgcgtgat cggtattggg ggtggtacgg 4680 ttattgacat ctcgaaatta tttgtgctga aaggactaaa tgatgtgctc gatgcgttcg 4740 atcgcaagat accgctgatt aaagagaaag aactgatcat tgtgcccacc acatgcggga 4800 cgggtagcga ggtgacgaat atttcgatcg cggagatcaa aagccgtcat accaaaatgg 4860 gtttggctga cgatgctatt gttgcagacc acgcgatcat cataccagag cttctgaaaa 4920 gcctgccgtt ccatttttat gcatgcagtg caatagatgc tctgatccat gccatcgagt 4980 catatgtttc tcctaaagcc agtccatatt ctcgtctgtt cagtgaggcg gcatgggata 5040 ttatcctgga ggtattcaag aaaatagccg aacacggccc tgaataccgc tttgagaagc 5100 tgggagaaat gatcatggcc tccaactatg ctggtatagc cttcgggaat gcaggcgtgg 5160 gtgccgttca cgctctaagc tatccattgg gaggcaatta tcatgtgccg catggcgagg 5220 ctaactatca gttttttaca gaggtcttta aagtatacca aaagaaaaat cctttcggct 5280 atatagtcga actcaactgg aagctgtcca agattctgaa ctgtcagcct gaatacgtct 5340 atccgaaact ggatgagtta ctcggctgtc ttctgaccaa aaaaccgctg cacgaatacg 5400 gcatgaaaga tgaagaggta cgtggatttg cggaatcagt gcttaagact cagcagcggt 5460 tgctcgcgaa taattatgtt gagcttactg ttgatgaaat tgaaggtatc tacagacgac 5520 tgtactaata gaaggagata taaatatgaa agacgtgtta gcggaatatg cctcccgaat 5580 tgtttcggcc gaagaggcag tcaaacatat caaaaatgga gagcgtgtcg ctttatcaca 5640 tgctgccgga gttcctcaga gttgtgttga cgcactggtg caacaggcgg acctgtttca 5700 gaatgtggag atttaccaca tgctgtgtct cggcgaagga aaatatatgg cacctgaaat 5760 ggcccctcac ttccggcaca taaccaattt tgttggtggt aactctcgta aagcagtgga 5820 ggaaaataga gccgacttca ttccggtatt cttttatgaa gtgccatcaa tgattcggaa 5880 agatatcctt catatagatg tggccattgt ccaactctca atgccagatg agaatggtta 5940 ctgcagcttt ggcgtatctt gcgattatag caaaccggcg gcggaatcgg cgcatttagt 6000 tattggggaa atcaaccgtc agatgccata tgtgcatggt gacaacttga ttcacatatc 6060 gaagttggat tacatcgtga tggcggatta cccaatttat tctctggcga agcccaaaat 6120 cggagaagta gaggaagcta tcggccgtaa ctgtgccgag cttattgaag atggtgccac 6180 cctacagctg ggtatcggcg cgattccgga tgcagctctg ctgtttctga aggacaaaaa 6240 agatctgggg attcatactg aaatgttctc cgatggcgtt gttgaactgg tgcgcagtgg 6300 tgtaattact ggaaaaaaaa agacattgca tcccggtaag atggtcgcga cgtttcttat 6360 gggatcagaa gacgtgtatc atttcatcga caagaatccg gatgtggaac tgtatccggt 6420 tgattacgtc aatgatccga gggttatcgc tcagaatgat aatatggtca gcatcaatag 6480 ctgtatcgag atcgatctaa tgggccaagt ggtgagcgag tgcataggct ccaaacagtt 6540 tagtggcacc gggggtcaag tagattatgt ccgcggggca gcttggtcta aaaacggcaa 6600 aagcatcatg gcaattccct caacagccaa aaacggtact gcatctcgga tagttcctat 6660 aattgcagag ggcgctgctg taacaaccct ccgcaacgaa gtcgactacg ttgttacgga 6720 atatgggata gcacagttaa aaggtaagag tttgcgtcag cgcgcagaag ctcttattgc 6780 gatagcccac ccggacttta gagaggaact gacgaagcat ctgcgcaaac gttttggtta 6840 agcggccgct gcggtatttt ctccttacgc atctgtgcgg tatttcacac cggatcctct 6900 agagtcgacc tgcaggcatg caagcttggc actggccgtc gttttacaac gtcgtgactg 6960 ggaaaaccct ggcgttaccc aacttaatcg ccttgcagca catccccctt tcgccagctg 7020 gcgtaatagc gaagaggccc gcaccgatcg cccttcccaa cagttgcgca gcctgaatgg 7080 cgaatgagct tatcgatgat aagctgtcaa acatgagaat tacaacttat atcgtatggg 7140 gctgacttca ggtgctacat ttgaagagat aaattgcact gaaatctaga aatattttat 7200 ctgattaata agatgatctt cttgagatcg ttttggtctg cgcgtaatct cttgctctga 7260 aaacgaaaaa accgccttgc agggcggttt ttcgaaggtt ctctgagcta ccaactcttt 7320 gaaccgaggt aactggcttg gaggagcgca gtcaccaaaa cttgtccttt cagtttagcc 7380 ttaaccggcg catgacttca agactaactc ctctaaatca attaccagtg gctgctgcca 7440 gtggtgcttt tgcatgtctt tccgggttgg actcaagacg atagttaccg gataaggcgc 7500 agcggtcgga ctgaacgggg ggttcgtgca tacagtccag cttggagcga actgcctacc 7560 cggaactgag tgtcaggcgt ggaatgagac aaacgcggcc ataacagcgg aatgacaccg 7620 gtaaaccgaa aggcaggaac aggagagcgc acgagggagc cgccagggga aacgcctggt 7680 atctttatag tcctgtcggg tttcgccacc actgatttga gcgtcagatt tcgtgatgct 7740 tgtcaggggg gcggagccta tggaaaaacg gctttgccgc ggccctctca cttccctgtt 7800 aagtatcttc ctggcatctt ccaggaaatc tccgccccgt tcgtaagcca tttccgctcg 7860 ccgcagtcga acgaccgagc gtagcgagtc agtgagcgag gaagcggaat atatcctgta 7920 tcacatattc tgctgacgca ccggtgcagc cttttttctc ctgccacatg aagcacttca 7980 ctgacaccct catcagtgcc aacatagtaa gccagtatac actccgctag cgctgatgtc 8040 cggcggtgct tttgccgtta cgcaccaccc cgtcagtagc tgaacaggag ggacagctga 8100 tagaaacaga agccactgga gcacctcaaa aacaccatca tacactaaat cagtaagttg 8160 gcagcatcac ccgacgcact ttgcgccgaa taaatacctg tgacggaaga tcacttcgca 8220 gaataaataa atcctggtgt ccctgttgat accgggaagc cctgggccaa cttttggcga 8280 aaatgagacg ttgatcggca cgtaagaggt tccaactttc accataatga aataagatca 8340 ctaccgggcg tattttttga gttatcgaga ttttcaggag ctaaggaagc taaaatggag 8400 aaaaaaatca ctggatatac caccgttgat atatcccaat ggcatcgtaa agaacatttt 8460 gaggcatttc agtcagttgc tcaatgtacc tataaccaga ccgttcagct ggatattacg 8520 gcctttttaa agaccgtaaa gaaaaataag cacaagtttt atccggcctt tattcacatt 8580 cttgcccgcc tgatgaatgc tcatccggaa ttt 8613

Claims (21)

As a butylaldehyde dehydrogenase (bld) variant having an activity to catalyze the conversion of 4-hydroxybutyryl CoA to 4-hydroxybutylaldehyde, the butylaldehyde dehydrogenase variant is in SEQ ID NO: 1 The butylaldehyde dehydrogenase variant in which Leu at position 273 is substituted with Ile, Cys, Met, Ser, Thr or Val. The butylaldehyde dehydrogenase variant of claim 1, wherein the butylaldehyde dehydrogenase has the amino acid sequence of SEQ ID NO: 1. delete The butylaldehyde dehydrogenase variant according to claim 1, wherein the butylaldehyde dehydrogenase variant has any one amino acid sequence selected from the group consisting of SEQ ID NO: 2 to SEQ ID NO: 7. A polynucleotide encoding the butylaldehyde dehydrogenase variant of any one of claims 1, 2 and 4. The polynucleotide of claim 5, wherein the polynucleotide encoding the butylaldehyde dehydrogenase is derived from Clostridium saccharoperbutylacetonicum. A microorganism producing 1,4-BDO comprising the butylaldehyde dehydrogenase variant of any one of claims 1, 2 and 4. The microorganism according to claim 7, wherein the microorganism is prepared by introducing the polynucleotide of claim 5 into a microorganism. The microorganism according to claim 7, wherein the microorganism further comprises a butanol dehydrogenase having an activity of catalyzing the conversion of 4-hydroxybutylaldehyde to 1,4-butanediol. The microorganism of claim 9, wherein the gene of the butanol dehydrogenase is derived from Clostridium saccharoperbutylacetonicum. The method of claim 7, wherein the microorganism is a gene encoding succinyl-CoA: coenzyme A transferase having an activity of converting succinate to succinyl CoA, a semi having an activity of converting succinyl CoA to succinic semialdehyde. The gene encoding the aldehyde dehydrogenase, the gene encoding the 4-hydroxybutylate dehydrogenase having the activity of converting succinic semialdehyde to 4-hydroxybutyrate, and the 4-hydroxybutyrate are 4 -A microorganism comprising a gene encoding a 4-hydroxybutyryl CoA:acetyl-CoA transferase having an activity to convert to hydroxybutyryl CoA. The microorganism according to claim 7, wherein the microorganism is E. coli. A method of producing 4-hydroxybutylaldehyde comprising contacting 4-hydroxybutyryl CoA with the butylaldehyde dehydrogenase variant of claim 1. A method of producing 1,4-butanediol comprising the step of contacting 4-hydroxybutylaldehyde with the butylaldehyde dehydrogenase variant of claim 1. Contacting 4-hydroxybutyryl CoA with the butylaldehyde dehydrogenase variant of claim 1; And
A method for producing 1,4-BDO comprising the step of contacting butanol dehydrogenase with the reactant obtained in the above step. Introducing the butylaldehyde dehydrogenase variant of claim 1, and the butanol dehydrogenase into a microorganism;
Culturing the microorganism; And
A method of producing 1,4-BDO comprising the step of separating 1,4-BDO from the culture medium. The method of claim 16, wherein the microorganism is a gene encoding succinyl-CoA: coenzyme A transferase having an activity of converting succinate to succinyl-CoA, and having an activity of converting succinyl-CoA to succinic semialdehyde. The gene encoding the coenzyme A dependent succinate semialdehyde dehydrogenase, the gene encoding the 4-hydroxybutylate dehydrogenase having the activity of converting succinic semialdehyde to 4-hydroxybutyrate, and 4- Produces 1,4-BDO in which a gene encoding 4-hydroxybutyryl CoA:acetyl-CoA transferase having an activity of converting hydroxybutyrate to 4-hydroxybutyrate-CoA is further introduced How to. The microorganism according to claim 8, wherein the microorganism is E. coli. The microorganism according to claim 9, wherein the microorganism is E. coli. The microorganism according to claim 10, wherein the microorganism is E. coli. The microorganism according to claim 11, wherein the microorganism is E. coli.

Images