WO2017074061A1 - Method for producing heavy chain diol - Google Patents

Method for producing heavy chain diol Download PDF

Info

Publication number
WO2017074061A1
WO2017074061A1 PCT/KR2016/012170 KR2016012170W WO2017074061A1 WO 2017074061 A1 WO2017074061 A1 WO 2017074061A1 KR 2016012170 W KR2016012170 W KR 2016012170W WO 2017074061 A1 WO2017074061 A1 WO 2017074061A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
fatty
fatty alcohol
recombinant microorganism
genes
Prior art date
Application number
PCT/KR2016/012170
Other languages
French (fr)
Korean (ko)
Inventor
안정오
이홍원
장민정
김천석
박규연
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Priority to EP16860244.9A priority Critical patent/EP3378940B1/en
Priority to US15/771,799 priority patent/US11091741B2/en
Priority claimed from KR1020160141017A external-priority patent/KR101903551B1/en
Publication of WO2017074061A1 publication Critical patent/WO2017074061A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/18—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic polyhydric

Definitions

  • the present invention relates to a method for producing heavy chain diols, and more particularly, the fatty alcohol dehydrogenase and / or fatty alcohol oxidase genes in the ⁇ -oxidative metabolic pathway are removed and optionally fat
  • a method for producing heavy chain diols from alcohols or alkanes derived from fatty acids by culturing recombinant microorganisms in which the aldehyde dehydrogenase gene has been removed and the ⁇ -oxidation metabolic pathway related gene has been removed.
  • Bioplatform compounds are produced through biological or chemical conversion based on biomass-derived raw materials, and are used for synthesis of polymer monomers and new materials.
  • medium chain diols are used as monomers of polyesters, and polyesters are widely used for various purposes, including fibers, films, and combinations due to their excellent properties.
  • polyethylene terephthalate obtained by polycondensation of ethylene glycol and terephthalic acid is used in many applications because of its excellent mechanical strength, chemical properties, and the like, and has been mass produced in the world as the most suitable synthetic fiber for medical use.
  • polytrimethylene terephthalate as a raw material of 1,3-propanediol and terephthalic acid has recently been developed a low-cost 1,3-propanediol synthesis method, the market tends to increase, excellent elastic modulus recovery, and a Young's modulus The development as a soft touch medical use utilizing the low polymer characteristic is anticipated.
  • polyester derived from biomass resources has been attracting attention due to concern about higher and depletion of petroleum resources.
  • heavy chain diols can be achieved by biological methods through chemical synthesis or microbial fermentation.
  • the use of such biological methods requires the development of new strains and optimization of fermentation processes using metabolic engineering techniques.
  • strains capable of producing heavy chain diols may be microorganisms having a ⁇ -oxidative metabolic pathway and a ⁇ -oxidative metabolic pathway, for example, Klebsiella oxytoca and Klebsiella pneumoniae. pneumoniae, aerobacter aerogenes, and recombinant Saccharomyces cerevisiae are known to be able to produce 2,3-butanediol with high yield and high productivity.
  • the present invention removes fatty alcohol dehydrogenase and / or fatty alcohol oxidase related genes in the ⁇ -oxidative metabolic pathway, optionally removes fatty aldehyde dehydrogenase gene, and also eliminates ⁇ -oxidative metabolic pathway related genes. It is an object of the present invention to provide a method for producing heavy chain diols from alcohols or alkanes derived from fatty acids by culturing the recombinant microorganisms and the recombinant microorganisms.
  • the present invention removes one or more genes selected from the group consisting of fatty alcohol dehydrogenase and fatty alcohol oxidase in the ⁇ -oxidation metabolic pathway, and optionally the fatty aldehyde dehydrogenase gene It also provides a recombinant microorganism that has been removed, and in which genes related to ⁇ -oxidation metabolic pathways have been removed.
  • the fatty alcohol dehydrogenase, fatty alcohol oxidase, fatty aldehyde dehydrogenase and ⁇ -oxidation pathway related genes are preferably all homologous genes present in the microorganism are removed. But it is not limited thereto. According to another embodiment of the present invention, the fatty alcohol dehydrogenase, fatty alcohol oxidase, fatty aldehyde dehydrogenase and ⁇ -oxidation metabolic pathway related genes are preferably removed from some homologous genes present in the microorganism. But it is not limited thereto.
  • the fatty alcohol dehydrogenase gene may be selected from the group consisting of ADH1, ADH2, ADH3, ADH4, ADH5, ADH6, ADH7, ADH8 and FADH gene, but is not limited thereto.
  • the fatty alcohol oxidase gene may be a FAO gene, but is not limited thereto.
  • the fatty aldehyde dehydrogenase gene may be a gene selected from the group consisting of FALDH1, FALDH2, FALDH3 and FALDH4 genes, but is not limited thereto.
  • the ⁇ -oxidation pathway related gene may be an acyl-CoA oxidase gene, but is not limited thereto.
  • the acyl-CoA oxidase gene may be selected from the group consisting of ACO1, ACO2, ACO3, ACO4, ACO5 and ACO6 genes, but is not limited thereto.
  • the microorganism may be yeast or E. coli, but is not limited thereto.
  • the yeast may be a yeast selected from the group consisting of genus Yarrowia, genus Saccharomyces, Pichia and Candida, but is not limited thereto.
  • the yeast of the genus Yarrowia may be, but is not limited to Yarrowia repolitica.
  • the present invention (1) at least one gene selected from the group consisting of fatty alcohol dehydrogenase and fatty alcohol oxidase in the ⁇ -oxidation metabolic pathway is removed, optionally the fatty aldehyde dehydrogenase gene is removed, In addition, preparing a recombinant microorganism from which the gene related to the ⁇ -oxidation metabolic pathway has been removed; And (2) provides a method for producing a heavy chain diol comprising the step of culturing the substrate to the recombinant microorganism.
  • the substrate may be selected from the group consisting of alcohols and alkanes derived from fatty acids, but is not limited thereto.
  • the alcohol, alkanes and heavy chain diols derived from fatty acids may each have 5 to 30 carbon atoms, preferably 6 to 20 carbon atoms, more preferably 8 to 16 carbon atoms, but are not limited thereto. no.
  • the alkanes may be dodecane, but is not limited thereto.
  • the heavy chain diol may be 1,12-dodecanediol, but is not limited thereto.
  • the recombinant microorganism of the present invention removes the fatty alcohol dehydrogenase and / or fatty alcohol oxidase genes in the ⁇ -oxidative metabolic pathway, optionally the fatty aldehyde dehydrogenase gene, and also the ⁇ -oxidative metabolic pathway related genes. Can be removed to prevent further oxidation of the fatty alcohol and ⁇ -oxidation metabolism to produce heavy chain diols in high yield.
  • FIG. 2 is a process for preparing a recombinant microorganism of the present invention in which the fatty alcohol dehydrogenase, fatty alcohol oxidase gene and fatty aldehyde dehydrogenase gene related to ⁇ -oxidation and the acyl-CoA oxidase gene associated with ⁇ -oxidation are removed. It is shown schematically.
  • Figure 3 schematically shows a vector having a ura3 gene to be used as a selection marker for gene knockout for strain improvement and a pop-out for removing the ura3 gene after the knockout cassette insertion.
  • Figure 4 is a schematic diagram showing the manufacturing process of the knock-out cassette used in the production of the transformed microorganism of the present invention.
  • 5 is a graph showing the types of genes knocked out in the transformed microorganism of the present invention.
  • 6 is a graph showing the amount of heavy chain diols produced from alkanes as substrates of the transformed microorganism of the present invention.
  • FIG. 7 is a graph showing the amount of heavy chain diols produced from alkanes as substrates when the Y4-20 strain of the present invention is cultured in a flask.
  • the present invention removes one or more genes selected from the group consisting of fatty alcohol dehydrogenases and fatty alcohol oxidases in the ⁇ -oxidation metabolic pathway, optionally removes fatty aldehyde dehydrogenase genes, and also ⁇ -oxidation metabolism.
  • fatty alcohol dehydrogenases and fatty alcohol oxidases in the ⁇ -oxidation metabolic pathway, optionally removes fatty aldehyde dehydrogenase genes, and also ⁇ -oxidation metabolism.
  • ⁇ -oxidation refers to a metabolic process in which a methyl group terminal of a fatty acid is oxidized to form a dicarboxylic acid
  • ⁇ -oxidation means that a ⁇ -site carbon atom is oxidized in a carboxy group. It is a metabolic process that releases acetyl CoA and gradually breaks down into fatty acids with two carbon atoms each time.
  • the concepts of ⁇ -oxidation and ⁇ -oxidation and the enzymes involved in this metabolic process are well known to those skilled in the biochemistry art.
  • ⁇ -hydroxy fatty acid is first produced by the action of cytochrome P450 and NADPH-cytochrome P450 reductase, and the ⁇ -hydroxy fatty acid is ⁇ -aldehyde fatty acid is produced by the action of fatty alcohol dehydrogenase and fatty alcohol oxidase, and the ⁇ -aldehyde fatty acid is produced by the action of fatty aldehyde dehydrogenase.
  • acyl-CoA oxidase produces fatty acids having two carbon atoms (see FIG. 1).
  • the fatty alcohol dehydrogenase and fatty alcohol oxidase gene, and the fatty aldehyde dehydrogenase gene that can be selectively removed is that all homologous genes present in the microorganism are removed Preferably, however, recombinant microorganisms in which some of these genes have been removed may also be applied in the present invention.
  • the fatty alcohol dehydrogenase gene may be selected from the group consisting of ADH1, ADH2, ADH3, ADH4, ADH5, ADH6, ADH7, ADH8 and FADH gene, but is not limited thereto.
  • the ADH1, ADH2, ADH3, ADH4, ADH5, ADH6, ADH7, ADH8 and FADH gene may include a base sequence consisting of SEQ ID NO: 1 and SEQ ID NO: 9, but is not limited thereto. no.
  • the fatty alcohol oxidase gene may be a FAO gene, but is not limited thereto.
  • the FAO gene may include a nucleotide sequence consisting of SEQ ID NO: 10, but is not limited thereto.
  • the fatty aldehyde dehydrogenase gene may be selected from the group consisting of FALDH1, FALDH2, FALDH3 and FALDH4 genes, but is not limited thereto.
  • the FALDH1, FALDH2, FALDH3 and FALDH4 genes may include, but are not limited to, nucleotide sequences consisting of SEQ ID NO: 11 and SEQ ID NO: 14, respectively.
  • the ⁇ -oxidation metabolic pathway related gene is preferably all homologous genes present in the microorganism is removed, but in some cases, the recombinant microorganism from which some of the genes are removed Can be applied.
  • the ⁇ -oxidation pathway related gene is an acyl-CoA oxidase gene, and the acyl-CoA oxidase gene may be selected from the group consisting of ACO1, ACO2, ACO3, ACO4, ACO5 and ACO6 genes, but is not limited thereto. No (see Figure 2).
  • the ACO1, ACO2, ACO3, ACO4, ACO5 and ACO6 gene may include a base sequence consisting of SEQ ID NO: 15 and SEQ ID NO: 20, but is not limited thereto.
  • genes selected from the fatty alcohol dehydrogenase gene, fatty alcohol oxidase gene, fatty aldehyde dehydrogenase and acyl-CoA oxidase are removed using conventional genetic recombination techniques known in the art.
  • Recombinant microorganisms can be prepared.
  • the term "removal" is not only a part or all of the gene is physically removed, but also a state in which a protein is not made from mRNA transcribed from the gene and the protein expressed from the gene function The state of not being able to be used is also used in the sense of comprehensive inclusion.
  • Genetic recombination techniques that can be used include, but are not limited to, methods such as transformation, transduction, transfection, microinjection, electroporation, and the like. .
  • any microorganism that can be used may be used without limitation any microorganism having both ⁇ -oxidation and ⁇ -oxidation metabolic processes, for example, eukaryotes including yeast and prokaryotes including E. coli are used. Can be.
  • the microorganism is preferably using yeast, and as the yeast Yarrowia sp., Saccharomyces sp., Pichia sp. Yeasts such as Candida sp.
  • Yarrowia lipolytica Candida tropicalis, Candida infanticola
  • saccharo Preference is given to using Saccharomyces cerevisiae, Pichia alcoholophia or Candida mycoderma, more preferably to Yarrowia repolitica.
  • cytochrome P450 As described above, in the case of microorganisms in which the fatty alcohol dehydrogenase, fatty alcohol oxidase gene and ⁇ -oxidation pathway related gene, and optionally the fatty aldehyde dehydrogenase gene are removed, cytochrome P450 and The action of NADPH-cytochrome P450 reductase oxidizes either end to form a primary alcohol, but prevents further oxidation because the fatty alcohol dehydrogenase gene and fatty alcohol oxidase gene are removed. do.
  • the primary alcohol formed as described above becomes a substrate again, and the other end is oxidized by the action of cytochrome P450 and NADPH-cytochrome P450 reductase to form a diol, which is a secondary alcohol.
  • cytochrome P450 and NADPH-cytochrome P450 reductase to form a diol, which is a secondary alcohol.
  • one or more genes selected from the group consisting of fatty alcohol dehydrogenase and fatty alcohol oxidase in the ⁇ -oxidation metabolic pathway are removed, optionally the fatty aldehyde dehydrogenase gene is removed, and also ⁇ -oxidation metabolism Preparing a recombinant microorganism from which pathway related genes have been removed;
  • the fatty alcohol dehydrogenase and / or fatty alcohol oxidase genes in the ⁇ -oxidative metabolic pathway are removed, optionally the fatty aldehyde dehydrogenase gene is removed, and the ⁇ -oxidative metabolic pathway related genes are also removed.
  • the recombinant microorganisms from which the polysaccharides have been removed can be used to prevent heavy oxidation and ⁇ -oxidation metabolism of fatty alcohols to produce heavy chain diols in high yield.
  • the fatty alcohol dehydrogenase, fatty alcohol oxidase, fatty aldehyde dehydrogenase and ⁇ -oxidation pathway related genes are preferably all homologous genes present in the microorganism, but in some cases some of them Recombinant microorganisms having been removed can also be applied in the present invention.
  • any microorganism that can be used may be used without limitation any microorganism having both ⁇ -oxidation and ⁇ -oxidation metabolic processes, for example, eukaryotes including yeast and prokaryotes including E. coli are used. Can be.
  • the microorganism is preferably using yeast, and yeasts such as Yarrowia genus, Saccharomyces genus, Pichia genus, Candida genus and the like may be used without limitation.
  • Yarrowia Lipolitica Saccharomyces cerevisiae, Candida Tropicalis, Candida Infanticola, Pichia Alcoholopia or Candida Mycoderma, and more preferably Yarrowia Lipolitica. desirable.
  • genes selected from the fatty alcohol dehydrogenase gene, fatty alcohol oxidase gene, fatty aldehyde dehydrogenase and acyl-CoA oxidase are removed using conventional genetic recombination techniques known in the art. Recombinant microorganisms can be prepared.
  • the term "removal" is not only a part or all of the gene is physically removed, but also a state in which a protein is not made from mRNA transcribed from the gene and the protein expressed from the gene function The state of not being able to be used is also used in the sense of comprehensive inclusion.
  • diol refers to a compound containing two hydroxyl groups (-OH group), “heavy chain diol” is 5 to 30 carbon atoms, preferably 6 to 20 carbon atoms, more preferably carbon atoms It is used with the meaning including all the diol compounds which have 8-16.
  • the substrate of step (2) may be selected from the group consisting of alcohols and alkanes derived from fatty acids, but is not limited thereto.
  • the alcohol derived from the fatty acid may be an alcohol having 5 to 30 carbon atoms, preferably 6 to 20 carbon atoms, more preferably 8 to 16 carbon atoms, but is not limited thereto.
  • the alkanes may be used alkanes having 5 to 30 carbon atoms, preferably 6 to 20 carbon atoms, more preferably 8 to 16 carbon atoms, but are not limited thereto.
  • the alkanes may be dodecane, but is not limited thereto.
  • the heavy chain diol may be 1,12-dodecanediol, but is not limited thereto.
  • a vector having a ura3 gene to be used as a selection marker for gene knock-out for strain improvement and a pop-out for removing the ura3 gene after insertion of the knock-out cassette was constructed (FIG. 3).
  • the primers used to PCR the pop-out region and ura3 in two pieces are shown in Table 3.
  • the cultured cells were scraped with a loop and vortexed in 100 ⁇ l of one-step buffer (45% PEG4000, 100 mM DTT, 0.1 L LiAc, 25 ⁇ g single-strand carrier DNA), followed by addition of a knock-out cassette (1 ng or more).
  • a knock-out cassette (1 ng or more).
  • the cultured samples were loaded into selection medium (YNB w / o amino acid 6.7g / L, Glucose 20g / L) and incubated at 30 ° C. for 48 hours to select the inserted strain. Then, it was confirmed by PCR using the fries included in the gene deletion of Table 2 to confirm that the cassettes are correctly inserted on the genome of the selected strain.
  • the strain into which the cassette was inserted went through a pop-out process to proceed with the insertion of another cassette.
  • 200 ⁇ l of the culture medium was mixed with 5 ′ FOA medium (YNB w / o amino acid 6.7g / L, Glucose 20g / L, 5 'FOA).
  • 5 ′ FOA medium YNB w / o amino acid 6.7g / L, Glucose 20g / L, 5 'FOA.
  • the strain to be tested was inoculated in 2 ml of YPD medium (Bacto Laboratories, Yeast extract 10g / L, peptone 20g / L, glucose 20g / L) the day before at 30 °C, 200rpm.
  • 2 ml of growth stage medium (pH 6.0) having the composition shown in Table 5 was placed in a 24-well plate, and then inoculated with 1% of the pre-cultured culture, followed by incubation at 30 ° C. and 450 rpm for one day in a plate stirrer.
  • the Y1-28 and Y1-36 strains that only knocked out the ⁇ -oxidation metabolism related gene and the fatty aldehyde dehydrogenase gene could not produce 1,12-dodecanediol from the substrate dodecane, but the fat
  • the Y1-36 strain additionally knocked out the alcohol oxidase gene and the Y4-2, Y4-20 and Y4-30 strains additionally knocked out the fatty alcohol oxidase gene and the fatty alcohol dehydrogenase gene were all excellent. It showed the ability to synthesize 1,12-dodecanediol (FIG. 6).
  • the Y4-20 strain showed a 1,12-dodecanediol synthesis capacity of about 18 mg / L when cultured in the flask (Fig. 7).
  • a sample analysis experiment using the Y4-20 strain was performed.

Abstract

The present invention relates to a method for producing heavy chain diol and, more particularly to recombinant microorganisms in which fatty alcohol dehydrogenase and/or fatty alcohol oxidase genes on a ω-oxidative metabolism pathway are removed, the fatty aldehyde dehydrogenase genes are optionally removed, and β-oxidative metabolism pathway-related genes are removed, and to a method for producing heavy chain diol from fatty acid-derived alcohol or alkane by culturing the recombinant microorganisms. The recombinant microorganisms of the present invention can produce a high yield of heavy chain diol by preventing further oxidation and β-oxidative metabolism of fatty alcohols.

Description

중쇄 디올의 생산 방법Method of producing heavy chain diols
본 발명은 중쇄 디올의 생산 방법에 관한 것으로, 보다 상세하게는 ω-산화 대사 경로 중의 지방 알코올 디하이드로게나아제(fatty alcohol dehydrogenase) 및/또는 지방 알코올 옥시다아제(oxidase) 유전자가 제거되고, 선택적으로 지방 알데히드 디하이드로게나아제 유전자가 제거되며, 또한 β-산화 대사 경로 관련 유전자가 제거된 재조합 미생물을 배양함으로써, 지방산 유래의 알코올 또는 알칸(alkane)으로부터 중쇄 디올을 생산하는 방법에 관한 것이다.The present invention relates to a method for producing heavy chain diols, and more particularly, the fatty alcohol dehydrogenase and / or fatty alcohol oxidase genes in the ω-oxidative metabolic pathway are removed and optionally fat A method for producing heavy chain diols from alcohols or alkanes derived from fatty acids by culturing recombinant microorganisms in which the aldehyde dehydrogenase gene has been removed and the β-oxidation metabolic pathway related gene has been removed.
바이오플랫폼 화합물은 바이오매스 유래 원료를 기반으로 하여 생물학적 또는 화학적 전환을 통해 생산된 것으로, 고분자 모노머, 신소재 등의 합성에 사용되고 있다.Bioplatform compounds are produced through biological or chemical conversion based on biomass-derived raw materials, and are used for synthesis of polymer monomers and new materials.
바이오플랫폼 화합물 중 중쇄 디올은 폴리에스테르의 단량체로 사용되는 물질로서, 폴리에스테르는 그 뛰어난 성질로부터 섬유용, 필름용, 병용을 비롯해 널리 여러 가지 용도로 사용되고 있다. 예를 들면, 에틸렌글리콜과 테레프탈산의 중축합으로 얻어지는 폴리에틸렌테레프탈레이트는 기계적 강도, 화학 특성 등에 뛰어나서 많은 용도에 사용되고 있고, 의료용(衣料用)으로 가장 적합한 합성 섬유로서 전세계에서 대량 생산되고 있다. 또한, 1,3-프로판디올과 테레프탈산을 원료로 하는 폴리트리메틸렌테레프탈레이트는 최근 저렴한 1,3-프로판디올 합성법이 개발된 것도 있어서 시장은 증가 경향에 있고, 신장탄성 회복성이 뛰어나고, 영률이 낮은 폴리머 특성을 살린 소프트한 촉감의 의료 용도로서의 전개가 기대된다. 아울러, 최근에는 석유 자원의 고등(高騰)·고갈을 우려하여 바이오매스 자원 유래의 폴리에스테르가 주목받고 있다.Among the bioplatform compounds, medium chain diols are used as monomers of polyesters, and polyesters are widely used for various purposes, including fibers, films, and combinations due to their excellent properties. For example, polyethylene terephthalate obtained by polycondensation of ethylene glycol and terephthalic acid is used in many applications because of its excellent mechanical strength, chemical properties, and the like, and has been mass produced in the world as the most suitable synthetic fiber for medical use. In addition, polytrimethylene terephthalate as a raw material of 1,3-propanediol and terephthalic acid has recently been developed a low-cost 1,3-propanediol synthesis method, the market tends to increase, excellent elastic modulus recovery, and a Young's modulus The development as a soft touch medical use utilizing the low polymer characteristic is anticipated. In addition, in recent years, polyester derived from biomass resources has been attracting attention due to concern about higher and depletion of petroleum resources.
중쇄 디올의 생산은 화학적 합성이나 미생물 발효를 통한 생물학적 방법으로 이루어질 수 있는데, 이러한 생물학적 방법을 이용할 경우에는 대사공학 기술을 이용한 신규 균주 개발 및 발효공정의 최적화가 요구된다.The production of heavy chain diols can be achieved by biological methods through chemical synthesis or microbial fermentation. The use of such biological methods requires the development of new strains and optimization of fermentation processes using metabolic engineering techniques.
종래에 중쇄 디올을 생산할 수 있는 균주로는 β-산화 대사 경로와 ω-산화 대사 경로를 함께 갖고 있는 미생물이 이용될 수 있고, 예컨대 크렙실라 옥시토카(Klebsiella oxytoca), 크렙실라 뉴모니애(Klebsiella pneumoniae), 애어로박터 애어로제네스(Aerobacter aerogenes), 재조합 사카로마이세스 세레비지애(Saccharomyces cerevisiae) 등의 균주들은 2,3-부탄디올을 고수율 및 고생산성으로 생산할 수 있는 것으로 알려져 있다(대한민국 특허공개번호 제10-2012-0107021호, 대한민국 특허공개번호 제10-2012-0128776호 및 대한민국 특허공개번호 제10-2015-0068581호). 그러나, 이들 미생물 중 일부는 병원성 미생물로 분류되고 있어, 안전 및 산업화 측면에 제약이 따르고, 또한 중쇄 디올은 ω-산화 대사 경로의 중간 생성물에 해당하기 때문에, 상기 미생물들을 이용한 중쇄 디올의 생산에 있어서는 그 수율이 높지 않다는 문제점이 있었다.Conventionally, strains capable of producing heavy chain diols may be microorganisms having a β-oxidative metabolic pathway and a ω-oxidative metabolic pathway, for example, Klebsiella oxytoca and Klebsiella pneumoniae. pneumoniae, aerobacter aerogenes, and recombinant Saccharomyces cerevisiae are known to be able to produce 2,3-butanediol with high yield and high productivity. Patent Publication No. 10-2012-0107021, Republic of Korea Patent Publication No. 10-2012-0128776 and Republic of Korea Patent Publication No. 10-2015-0068581). However, some of these microorganisms have been classified as pathogenic microorganisms, which are limited in terms of safety and industrialization, and since heavy chain diols correspond to intermediate products of the ω-oxidative metabolic pathway, the production of heavy chain diols using these microorganisms There was a problem that the yield is not high.
본 발명은 ω-산화 대사 경로 중의 지방 알코올 디하이드로게나아제 및/또는 지방 알코올 옥시다아제 관련 유전자가 제거되고, 선택적으로 지방 알데히드 디하이드로게나아제 유전자가 제거되며, 또한 β-산화 대사 경로 관련 유전자가 제거된 재조합 미생물 및 상기 재조합 미생물을 배양함으로써, 지방산 유래의 알코올 또는 알칸으로부터 중쇄 디올을 생산하는 방법을 제공하는 것을 목적으로 한다.The present invention removes fatty alcohol dehydrogenase and / or fatty alcohol oxidase related genes in the ω-oxidative metabolic pathway, optionally removes fatty aldehyde dehydrogenase gene, and also eliminates β-oxidative metabolic pathway related genes. It is an object of the present invention to provide a method for producing heavy chain diols from alcohols or alkanes derived from fatty acids by culturing the recombinant microorganisms and the recombinant microorganisms.
상기 기술적 과제를 달성하기 위하여, 본 발명은 ω-산화 대사 경로 중의 지방 알코올 디하이드로게나아제 및 지방 알코올 옥시다아제로 이루어진 군으로부터 선택되는 하나 이상의 유전자가 제거되고, 선택적으로 지방 알데히드 디하이드로게나아제 유전자가 제거되며, 또한 β-산화 대사 경로 관련 유전자가 제거된 재조합 미생물을 제공한다.In order to achieve the above technical problem, the present invention removes one or more genes selected from the group consisting of fatty alcohol dehydrogenase and fatty alcohol oxidase in the ω-oxidation metabolic pathway, and optionally the fatty aldehyde dehydrogenase gene It also provides a recombinant microorganism that has been removed, and in which genes related to β-oxidation metabolic pathways have been removed.
본 발명의 한 구현예에 따르면, 상기 상기 지방 알코올 디하이드로게나아제, 지방 알코올 옥시다아제, 지방 알데히드 디하이드로게나아제 및 β-산화 대사 경로 관련 유전자는 미생물 내에 존재하는 모든 상동형 유전자가 제거된 것이 바람직하지만 이에 한정되는 것은 아니다. 본 발명의 다른 구현예에 따르면, 상기 지방 알코올 디하이드로게나아제, 지방 알코올 옥시다아제, 지방 알데히드 디하이드로게나아제 및 β-산화 대사 경로 관련 유전자는 해당 미생물 내에 존재하는 일부 상동형 유전자가 제거된 것이 바람직하지만 이에 한정되는 것은 아니다.According to an embodiment of the present invention, the fatty alcohol dehydrogenase, fatty alcohol oxidase, fatty aldehyde dehydrogenase and β-oxidation pathway related genes are preferably all homologous genes present in the microorganism are removed. But it is not limited thereto. According to another embodiment of the present invention, the fatty alcohol dehydrogenase, fatty alcohol oxidase, fatty aldehyde dehydrogenase and β-oxidation metabolic pathway related genes are preferably removed from some homologous genes present in the microorganism. But it is not limited thereto.
본 발명의 한 구현예에 따르면, 상기 지방 알코올 디하이드로게나아제 유전자는 ADH1, ADH2, ADH3, ADH4, ADH5, ADH6, ADH7, ADH8 및 FADH 유전자로 이루어진 군으로부터 선택될 수 있으나 이에 한정되는 것은 아니다. 본 발명의 다른 구현예에 따르면, 상기 지방 알코올 옥시다아제 유전자는 FAO 유전자일 수 있으나 이에 한정되는 것은 아니다. 본 발명의 다른 구현예에 따르면, 상기 지방 알데히드 디하이드로게나아제 유전자는 FALDH1, FALDH2, FALDH3 및 FALDH4 유전자로 이루어진 군으로부터 선택되는 유전자일 수 있으나 이에 한정되는 것은 아니다.According to one embodiment of the invention, the fatty alcohol dehydrogenase gene may be selected from the group consisting of ADH1, ADH2, ADH3, ADH4, ADH5, ADH6, ADH7, ADH8 and FADH gene, but is not limited thereto. According to another embodiment of the present invention, the fatty alcohol oxidase gene may be a FAO gene, but is not limited thereto. According to another embodiment of the present invention, the fatty aldehyde dehydrogenase gene may be a gene selected from the group consisting of FALDH1, FALDH2, FALDH3 and FALDH4 genes, but is not limited thereto.
본 발명의 한 구현예에 따르면, 상기 β-산화 대사 경로 관련 유전자는 아실-CoA 옥시다아제 유전자일 수 있으나 이에 한정되는 것은 아니다. 본 발명의 바람직한 구현예에 따르면, 상기 아실-CoA 옥시다아제 유전자는 ACO1, ACO2, ACO3, ACO4, ACO5 및 ACO6 유전자로 이루어진 군으로부터 선택될 수 있으나 이에 한정되는 것은 아니다.According to one embodiment of the invention, the β-oxidation pathway related gene may be an acyl-CoA oxidase gene, but is not limited thereto. According to a preferred embodiment of the present invention, the acyl-CoA oxidase gene may be selected from the group consisting of ACO1, ACO2, ACO3, ACO4, ACO5 and ACO6 genes, but is not limited thereto.
본 발명의 한 구현예에 따르면, 상기 미생물은 효모 또는 대장균일 수 있으나 이에 한정되는 것은 아니다. 본 발명의 바람직한 구현예에 따르면, 상기 효모는 야로위아 속, 사카로마이세스 속, 피키아 속 및 캔디다 속으로 이루어진 군으로부터 선택되는 효모일 수 있으나 이에 한정되는 것은 아니다. 본 발명의 다른 바람직한 구현예에 따르면, 상기 상기 야로위아 속의 효모는 야로위아 리폴리티카일 수 있으나 이에 한정되는 것은 아니다.According to one embodiment of the invention, the microorganism may be yeast or E. coli, but is not limited thereto. According to a preferred embodiment of the present invention, the yeast may be a yeast selected from the group consisting of genus Yarrowia, genus Saccharomyces, Pichia and Candida, but is not limited thereto. According to another preferred embodiment of the present invention, the yeast of the genus Yarrowia may be, but is not limited to Yarrowia repolitica.
또한, 본 발명은 (1) ω-산화 대사 경로 중의 지방 알코올 디하이드로게나아제 및 지방 알코올 옥시다아제로 이루어진 군으로부터 선택되는 하나 이상의 유전자가 제거되고, 선택적으로 지방 알데히드 디하이드로게나아제 유전자가 제거되며, 또한 β-산화 대사 경로 관련 유전자가 제거된 재조합 미생물을 제조하는 단계; 및 (2) 상기 재조합 미생물에 기질을 처리하여 배양하는 단계를 포함하는 중쇄 디올의 생산 방법을 제공한다.In addition, the present invention (1) at least one gene selected from the group consisting of fatty alcohol dehydrogenase and fatty alcohol oxidase in the ω-oxidation metabolic pathway is removed, optionally the fatty aldehyde dehydrogenase gene is removed, In addition, preparing a recombinant microorganism from which the gene related to the β-oxidation metabolic pathway has been removed; And (2) provides a method for producing a heavy chain diol comprising the step of culturing the substrate to the recombinant microorganism.
본 발명의 한 구현예에 따르면, 상기 기질은 지방산 유래의 알코올 및 알칸으로 이루어지는 군으로부터 선택될 수 있으나 이에 한정되는 것은 아니다. 본 발명의 바람직한 구현예에 따르면, 상기 지방산 유래의 알코올, 알칸 및 중쇄 디올은 각각 탄소수 5 내지 30, 바람직하게는 탄소수 6 내지 20, 보다 바람직하게는 탄소수 8 내지 16을 가질 수 있으나 이에 한정되는 것은 아니다. 본 발명의 다른 바람직한 구현예에 따르면, 상기 알칸은 도데칸일 수 있으나 이에 한정되는 것은 아니다. 본 발명의 다른 바람직한 구현예에 따르면, 상기 중쇄 디올은 1,12-도데칸디올일 수 있으나 이에 한정되는 것은 아니다.According to one embodiment of the invention, the substrate may be selected from the group consisting of alcohols and alkanes derived from fatty acids, but is not limited thereto. According to a preferred embodiment of the present invention, the alcohol, alkanes and heavy chain diols derived from fatty acids may each have 5 to 30 carbon atoms, preferably 6 to 20 carbon atoms, more preferably 8 to 16 carbon atoms, but are not limited thereto. no. According to another preferred embodiment of the present invention, the alkanes may be dodecane, but is not limited thereto. According to another preferred embodiment of the present invention, the heavy chain diol may be 1,12-dodecanediol, but is not limited thereto.
본 발명의 재조합 미생물은 ω-산화 대사 경로 중의 지방 알코올 디하이드로게나아제 및/또는 지방 알코올 옥시다아제 유전자가 제거되고, 선택적으로 지방 알데히드 디하이드로게나아제 유전자가 제거되며, 또한 β-산화 대사 경로 관련 유전자가 제거되어 지방 알코올의 추가적인 산화 및 β-산화 대사를 방지함으로써 중쇄 디올을 높은 수율로 생산할 수 있다.The recombinant microorganism of the present invention removes the fatty alcohol dehydrogenase and / or fatty alcohol oxidase genes in the ω-oxidative metabolic pathway, optionally the fatty aldehyde dehydrogenase gene, and also the β-oxidative metabolic pathway related genes. Can be removed to prevent further oxidation of the fatty alcohol and β-oxidation metabolism to produce heavy chain diols in high yield.
도 1은 ω-산화 및 β-산화 대사 반응과 관련된 생성물 및 관련 효소의 종류를 보여주는 것이다.1 shows the types of products and related enzymes involved in ω-oxidation and β-oxidation metabolic reactions.
도 2는 ω-산화와 관련된 지방 알코올 디하이드로게나아제, 지방 알코올 옥시다아제 유전자 및 지방 알데히드 디하이드로게나아제 유전자와, β-산화와 관련된 아실-CoA 옥시다아제 유전자가 제거된 본 발명의 재조합 미생물의 제조 과정을 개략적으로 나타낸 것이다.2 is a process for preparing a recombinant microorganism of the present invention in which the fatty alcohol dehydrogenase, fatty alcohol oxidase gene and fatty aldehyde dehydrogenase gene related to ω-oxidation and the acyl-CoA oxidase gene associated with β-oxidation are removed. It is shown schematically.
도 3은 균주 개량을 위한 유전자 낙-아웃을 위해 선별 마커로 사용될 ura3 유전자와 낙-아웃 카세트 삽입 후 ura3 유전자를 제거하기 위한 팝-아웃(pop-out)을 갖는 벡터를 개략적으로 나타낸 것이다.Figure 3 schematically shows a vector having a ura3 gene to be used as a selection marker for gene knockout for strain improvement and a pop-out for removing the ura3 gene after the knockout cassette insertion.
도 4는 본 발명의 형질전환 미생물의 제조에 사용된 낙-아웃 카세트의 제작 과정을 보여주는 개략도이다.Figure 4 is a schematic diagram showing the manufacturing process of the knock-out cassette used in the production of the transformed microorganism of the present invention.
도 5는 본 발명의 형질전환 미생물에서 낙-아웃된 유전자의 종류를 보여주는 그래프이다.5 is a graph showing the types of genes knocked out in the transformed microorganism of the present invention.
도 6는 본 발명의 형질전환 미생물이 기질인 알칸으로부터 생성한 중쇄 디올의 양을 보여주는 그래프이다.6 is a graph showing the amount of heavy chain diols produced from alkanes as substrates of the transformed microorganism of the present invention.
도 7은 본 발명의 Y4-20 균주를 플라스크에서 배양시 기질인 알칸으로부터 생성한 중쇄 디올의 양을 보여주는 그래프이다.7 is a graph showing the amount of heavy chain diols produced from alkanes as substrates when the Y4-20 strain of the present invention is cultured in a flask.
도 8은 본 발명의 Y4-20 균주에서 기질인 알칸으로부터 중쇄 디올이 생성되었음을 보여주는 GC/MS 데이터이다.8 is GC / MS data showing that heavy chain diols were generated from alkanes as substrates in the Y4-20 strain of the present invention.
본 발명은 ω-산화 대사 경로 중의 지방 알코올 디하이드로게나아제 및 지방 알코올 옥시다아제로 이루어진 군으로부터 선택되는 하나 이상의 유전자가 제거되고, 선택적으로 지방 알데히드 디하이드로게나아제 유전자가 제거되며, 또한 β-산화 대사 경로 관련 유전자가 제거된 재조합 미생물을 제공한다.The present invention removes one or more genes selected from the group consisting of fatty alcohol dehydrogenases and fatty alcohol oxidases in the ω-oxidation metabolic pathway, optionally removes fatty aldehyde dehydrogenase genes, and also β-oxidation metabolism. Provided are recombinant microorganisms from which pathway related genes have been removed.
본 발명에 있어서, 상기 "ω-산화"란 용어는 지방산의 메틸기 말단이 산화되어 디카르복시산이 형성되는 대사 과정을 의미하고, "β-산화"란 용어는 카르복시기에서 β-자리의 탄소원자가 산화되어 아세틸 CoA를 방출하면서 그때마다 탄소 원자수가 2개 적은 지방산이 되면서 점차 분해되어 가는 대사 과정을 의미한다. 상기 ω-산화 및 β-산화의 개념과 이러한 대사 과정에 관여하고 있는 효소들에 대해서는 생화학 분야의 통상의 기술자에게 있어서 널리 알려져 있다. 예컨대, ω-산화에 있어서, 지방산이 기질로 이용될 경우에는 먼저 시토크롬 P450 및 NADPH-시토크롬 P450 리덕타아제(reductase)의 작용에 의해 ω-히드록시 지방산이 생성되고, 상기 ω-히드록시 지방산은 지방 알코올 디하이드로게나아제 및 지방 알코올 옥시다아제의 작용에 의해 ω-알데히드 지방산이 생성되며, 상기 ω-알데히드 지방산은 지방 알데히드 디하이드로게나아제의 작용에 의해 디카르복시산이 제조된다. 또한, β-산화에 있어서는 아실-CoA 옥시다아제에 의해 탄소 원자수가 2개 적은 지방산이 생성된다(도 1 참조).In the present invention, the term "ω-oxidation" refers to a metabolic process in which a methyl group terminal of a fatty acid is oxidized to form a dicarboxylic acid, and the term "β-oxidation" means that a β-site carbon atom is oxidized in a carboxy group. It is a metabolic process that releases acetyl CoA and gradually breaks down into fatty acids with two carbon atoms each time. The concepts of ω-oxidation and β-oxidation and the enzymes involved in this metabolic process are well known to those skilled in the biochemistry art. For example, in ω-oxidation, when fatty acid is used as a substrate, ω-hydroxy fatty acid is first produced by the action of cytochrome P450 and NADPH-cytochrome P450 reductase, and the ω-hydroxy fatty acid is Ω-aldehyde fatty acid is produced by the action of fatty alcohol dehydrogenase and fatty alcohol oxidase, and the ω-aldehyde fatty acid is produced by the action of fatty aldehyde dehydrogenase. In addition, in β-oxidation, acyl-CoA oxidase produces fatty acids having two carbon atoms (see FIG. 1).
본 발명의 한 구현예에 따르면, 상기 지방 알코올 디하이드로게나아제 및 지방 알코올 옥시다아제 유전자, 및 선택적으로 제거될 수 있는 지방 알데히드 디하이드로게나아제 유전자는 해당 미생물 내에 존재하는 모든 상동형 유전자가 제거된 것이 바람직하지만, 경우에 따라 이들 중 일부 유전자가 제거된 재조합 미생물도 본 발명에 있어서 적용될 수 있다.According to one embodiment of the invention, the fatty alcohol dehydrogenase and fatty alcohol oxidase gene, and the fatty aldehyde dehydrogenase gene that can be selectively removed is that all homologous genes present in the microorganism are removed Preferably, however, recombinant microorganisms in which some of these genes have been removed may also be applied in the present invention.
본 발명의 한 구현예에 따르면, 상기 지방 알코올 디하이드로게나아제 유전자는 ADH1, ADH2, ADH3, ADH4, ADH5, ADH6, ADH7, ADH8 및 FADH 유전자로 이루어진 군으로부터 선택될 수 있으나 이에 한정되는 것은 아니다. 본 발명의 바람직한 구현예에 따르면, 상기 ADH1, ADH2, ADH3, ADH4, ADH5, ADH6, ADH7, ADH8 및 FADH 유전자는 각각 서열번호 1 및 서열번호 9로 이루어지는 염기서열을 포함할 수 있으나 이에 한정되는 것은 아니다.According to one embodiment of the invention, the fatty alcohol dehydrogenase gene may be selected from the group consisting of ADH1, ADH2, ADH3, ADH4, ADH5, ADH6, ADH7, ADH8 and FADH gene, but is not limited thereto. According to a preferred embodiment of the present invention, the ADH1, ADH2, ADH3, ADH4, ADH5, ADH6, ADH7, ADH8 and FADH gene may include a base sequence consisting of SEQ ID NO: 1 and SEQ ID NO: 9, but is not limited thereto. no.
본 발명의 다른 구현예에 따르면, 상기 지방 알코올 옥시다아제 유전자는 FAO 유전자일 수 있으나 이에 한정되는 것은 아니다. 본 발명의 바람직한 구현예에 따르면, 상기 FAO 유전자는 서열번호 10으로 이루어지는 염기서열을 포함할 수 있으나 이에 한정되는 것은 아니다.According to another embodiment of the present invention, the fatty alcohol oxidase gene may be a FAO gene, but is not limited thereto. According to a preferred embodiment of the present invention, the FAO gene may include a nucleotide sequence consisting of SEQ ID NO: 10, but is not limited thereto.
본 발명의 다른 구현예에 따르면, 상기 지방 알데히드 디하이드로게나아제 유전자는 FALDH1, FALDH2, FALDH3 및 FALDH4 유전자로 이루어진 군으로부터 선택될 수 있으나 이에 한정되는 것은 아니다. 상기 FALDH1, FALDH2, FALDH3 및 FALDH4 유전자는 각각 서열번호 11 및 서열번호 14로 이루어지는 염기서열을 포함할 수 있으나 이에 한정되는 것은 아니다.According to another embodiment of the present invention, the fatty aldehyde dehydrogenase gene may be selected from the group consisting of FALDH1, FALDH2, FALDH3 and FALDH4 genes, but is not limited thereto. The FALDH1, FALDH2, FALDH3 and FALDH4 genes may include, but are not limited to, nucleotide sequences consisting of SEQ ID NO: 11 and SEQ ID NO: 14, respectively.
본 발명의 한 구현예에 따르면, 상기 β-산화 대사 경로 관련 유전자는 해당 미생물 내에 존재하는 모든 상동형 유전자가 제거된 것이 바람직하지만, 경우에 따라 이들 중 일부 유전자가 제거된 재조합 미생물도 본 발명에 있어서 적용될 수 있다. 상기 β-산화 대사 경로 관련 유전자는 아실-CoA 옥시다아제 유전자인 것이 바람직하고, 상기 아실-CoA 옥시다아제 유전자는 ACO1, ACO2, ACO3, ACO4, ACO5 및 ACO6 유전자로 이루어진 군으로부터 선택될 수 있으나 이에 한정되는 것은 아니다(도 2 참조). 본 발명의 다른 바람직한 구현예에 따르면, 상기 ACO1, ACO2, ACO3, ACO4, ACO5 및 ACO6 유전자는 각각 서열번호 15 및 서열번호 20으로 이루어지는 염기서열을 포함할 수 있으나 이에 한정되는 것은 아니다.According to one embodiment of the present invention, the β-oxidation metabolic pathway related gene is preferably all homologous genes present in the microorganism is removed, but in some cases, the recombinant microorganism from which some of the genes are removed Can be applied. Preferably, the β-oxidation pathway related gene is an acyl-CoA oxidase gene, and the acyl-CoA oxidase gene may be selected from the group consisting of ACO1, ACO2, ACO3, ACO4, ACO5 and ACO6 genes, but is not limited thereto. No (see Figure 2). According to another preferred embodiment of the present invention, the ACO1, ACO2, ACO3, ACO4, ACO5 and ACO6 gene may include a base sequence consisting of SEQ ID NO: 15 and SEQ ID NO: 20, but is not limited thereto.
본 발명에 있어서, 본 기술분야에 공지된 통상의 유전자 재조합 기술을 이용하여 상기 지방 알코올 디하이드로게나아제, 지방 알코올 옥시다아제 유전자, 지방 알데히드 디하이드로게나아제 및 아실-CoA 옥시다아제로부터 선택되는 유전자가 제거된 재조합 미생물을 제조할 수 있다. 본 발명에 있어서, 상기 "제거"란 용어는 해당 유전자의 일부 또는 전부가 물리적으로 제거된 것뿐만 아니라, 해당 유전자로부터 전사된 mRNA로부터 단백질이 만들어지지 않는 상태 및 해당 유전자로부터 발현된 단백질이 기능을 하지 못하는 상태 등도 포괄적으로 포함하는 의미로 사용된다. 사용될 수 있는 유전자 재조합 기술로는 형질전환(transformation), 형질도입(transduction), 형질주입(transfection), 미세주입(microinjection), 전기천공(electroporation) 등의 방법을 예시할 수 있으나 이에 한정되는 것은 아니다.In the present invention, genes selected from the fatty alcohol dehydrogenase gene, fatty alcohol oxidase gene, fatty aldehyde dehydrogenase and acyl-CoA oxidase are removed using conventional genetic recombination techniques known in the art. Recombinant microorganisms can be prepared. In the present invention, the term "removal" is not only a part or all of the gene is physically removed, but also a state in which a protein is not made from mRNA transcribed from the gene and the protein expressed from the gene function The state of not being able to be used is also used in the sense of comprehensive inclusion. Genetic recombination techniques that can be used include, but are not limited to, methods such as transformation, transduction, transfection, microinjection, electroporation, and the like. .
본 발명에 있어서, 사용될 수 있는 미생물은 ω-산화 및 β-산화 대사 과정을 모두 갖고 있는 임의의 미생물이 제한없이 사용될 수 있으며, 예컨대 효모를 포함하는 진핵생물 및 대장균을 포함하는 원핵생물 등이 사용될 수 있다. 본 발명의 구현예에 따르면, 상기 미생물은 효모를 사용하는 것이 바람직하며, 상기 효모로는 야로위아 속(Yarrowia sp.), 사카로마이세스 속(Saccharomyces sp.), 피키아 속(Pichia sp.), 캔디다 속(Candida sp.) 등의 효모가 제한없이 사용될 수 있고, 이 중에서도 야로위아 리폴리티카(Yarrowia lipolytica), 캔디다 트로피칼리스(Candida tropicalis), 캔디다 인판티콜라(Candida infanticola), 사카로마이세스 세레비지애(Saccharomyces cerevisiae), 피키아 알코홀로피아(Pichia alcoholophia) 또는 캔디다 마이코더마(Candida mycoderma)를 사용하는 것이 바람직하며, 야로위아 리폴리티카를 사용하는 것이 더욱 바람직하다.In the present invention, any microorganism that can be used may be used without limitation any microorganism having both ω-oxidation and β-oxidation metabolic processes, for example, eukaryotes including yeast and prokaryotes including E. coli are used. Can be. According to an embodiment of the present invention, the microorganism is preferably using yeast, and as the yeast Yarrowia sp., Saccharomyces sp., Pichia sp. Yeasts such as Candida sp. Can be used without limitation, among them Yarrowia lipolytica, Candida tropicalis, Candida infanticola, saccharo Preference is given to using Saccharomyces cerevisiae, Pichia alcoholophia or Candida mycoderma, more preferably to Yarrowia repolitica.
상기와 같이, 지방 알코올 디하이드로게나아제, 지방 알코올 옥시다아제 유전자 및 β-산화 대사 경로 관련 유전자와, 선택적으로 지방 알데히드 디하이드로게나아제 유전자가 제거된 미생물의 경우, 알칸이 기질로 공급되면 시토크롬 P450 및 NADPH-시토크롬 P450 리덕타아제의 작용에 의해 두 말단 중 어느 한 쪽이 산화되어 1차 알코올이 형성되지만, 지방 알코올 디하이드로게나아제 유전자 및 지방 알코올 옥시다아제 유전자가 제거되어 있기 때문에 더 이상의 산화가 일어나지 못하게 된다. 그리고, 상기와 같이 형성된 1차 알코올은 다시 기질이 되어 시토크롬 P450 및 NADPH-시토크롬 P450 리덕타아제의 작용에 의해 다른 쪽 말단이 산화됨으로써 2차 알코올인 디올이 형성되게 된다. 상기와 같이 알칸을 기질로 이용하게 되면 2차례에 걸친 산화 반응을 통해 디올이 형성되지만, 기질로 알칸이 아닌 알코올을 이용하게 되면 1차례의 산화만으로 디올이 형성된다.As described above, in the case of microorganisms in which the fatty alcohol dehydrogenase, fatty alcohol oxidase gene and β-oxidation pathway related gene, and optionally the fatty aldehyde dehydrogenase gene are removed, cytochrome P450 and The action of NADPH-cytochrome P450 reductase oxidizes either end to form a primary alcohol, but prevents further oxidation because the fatty alcohol dehydrogenase gene and fatty alcohol oxidase gene are removed. do. Then, the primary alcohol formed as described above becomes a substrate again, and the other end is oxidized by the action of cytochrome P450 and NADPH-cytochrome P450 reductase to form a diol, which is a secondary alcohol. When the alkan is used as a substrate as described above, a diol is formed through two oxidation reactions, but when an alcohol other than an alkane is used as the substrate, a diol is formed by only one oxidation.
또한, 본 발명은In addition, the present invention
(1) ω-산화 대사 경로 중의 지방 알코올 디하이드로게나아제 및 지방 알코올 옥시다아제로 이루어진 군으로부터 선택되는 하나 이상의 유전자가 제거되고, 선택적으로 지방 알데히드 디하이드로게나아제 유전자가 제거되며, 또한 β-산화 대사 경로 관련 유전자가 제거된 재조합 미생물을 제조하는 단계; 및(1) one or more genes selected from the group consisting of fatty alcohol dehydrogenase and fatty alcohol oxidase in the ω-oxidation metabolic pathway are removed, optionally the fatty aldehyde dehydrogenase gene is removed, and also β-oxidation metabolism Preparing a recombinant microorganism from which pathway related genes have been removed; And
(2) 상기 재조합 미생물에 기질을 처리하여 배양하는 단계를 포함하는 중쇄 디올의 생산 방법을 제공한다.(2) it provides a method for producing a heavy chain diol comprising the step of culturing the substrate to the recombinant microorganism.
본 발명에 있어서, 상기 ω-산화 대사 경로 중의 지방 알코올 디하이드로게나아제 및/또는 지방 알코올 옥시다아제 유전자가 제거되고, 선택적으로 지방 알데히드 디하이드로게나아제 유전자가 제거되며, 또한 β-산화 대사 경로 관련 유전자가 제거된 재조합 미생물을 이용하여 지방 알코올의 추가적인 산화 및 β-산화 대사를 방지함으로써 중쇄 디올을 높은 수율로 생산할 수 있다. 상기 지방 알코올 디하이드로게나아제, 지방 알코올 옥시다아제, 지방 알데히드 디하이드로게나아제 및 β-산화 대사 경로 관련 유전자는 해당 미생물 내에 존재하는 모든 상동형 유전자가 제거된 것이 바람직하지만, 경우에 따라 이들 중 일부 유전자가 제거된 재조합 미생물도 본 발명에 있어서 적용될 수 있다.In the present invention, the fatty alcohol dehydrogenase and / or fatty alcohol oxidase genes in the ω-oxidative metabolic pathway are removed, optionally the fatty aldehyde dehydrogenase gene is removed, and the β-oxidative metabolic pathway related genes are also removed. The recombinant microorganisms from which the polysaccharides have been removed can be used to prevent heavy oxidation and β-oxidation metabolism of fatty alcohols to produce heavy chain diols in high yield. The fatty alcohol dehydrogenase, fatty alcohol oxidase, fatty aldehyde dehydrogenase and β-oxidation pathway related genes are preferably all homologous genes present in the microorganism, but in some cases some of them Recombinant microorganisms having been removed can also be applied in the present invention.
본 발명에 있어서, 사용될 수 있는 미생물은 ω-산화 및 β-산화 대사 과정을 모두 갖고 있는 임의의 미생물이 제한없이 사용될 수 있으며, 예컨대 효모를 포함하는 진핵생물 및 대장균을 포함하는 원핵생물 등이 사용될 수 있다. 본 발명의 구현예에 따르면, 상기 미생물은 효모를 사용하는 것이 바람직하며, 상기 효모로는 야로위아 속, 사카로마이세스 속, 피키아 속, 캔디다 속 등의 효모가 제한없이 사용될 수 있고, 이 중에서도 야로위아 리폴리티카, 사카로마이세스 세레비지애, 캔디다 트로피칼리스, 캔디다 인판티콜라, 피키아 알코홀로피아 또는 캔디다 마이코더마를 사용하는 것이 바람직하며, 야로위아 리폴리티카를 사용하는 것이 더욱 바람직하다.In the present invention, any microorganism that can be used may be used without limitation any microorganism having both ω-oxidation and β-oxidation metabolic processes, for example, eukaryotes including yeast and prokaryotes including E. coli are used. Can be. According to an embodiment of the present invention, the microorganism is preferably using yeast, and yeasts such as Yarrowia genus, Saccharomyces genus, Pichia genus, Candida genus and the like may be used without limitation. Among them, it is preferable to use Yarrowia Lipolitica, Saccharomyces cerevisiae, Candida Tropicalis, Candida Infanticola, Pichia Alcoholopia or Candida Mycoderma, and more preferably Yarrowia Lipolitica. desirable.
본 발명에 있어서, 본 기술분야에 공지된 통상의 유전자 재조합 기술을 이용하여 상기 지방 알코올 디하이드로게나아제, 지방 알코올 옥시다아제 유전자, 지방 알데히드 디하이드로게나아제 및 아실-CoA 옥시다아제로부터 선택되는 유전자가 제거된 재조합 미생물을 제조할 수 있다. 본 발명에 있어서, 상기 "제거"란 용어는 해당 유전자의 일부 또는 전부가 물리적으로 제거된 것뿐만 아니라, 해당 유전자로부터 전사된 mRNA로부터 단백질이 만들어지지 않는 상태 및 해당 유전자로부터 발현된 단백질이 기능을 하지 못하는 상태 등도 포괄적으로 포함하는 의미로 사용된다.In the present invention, genes selected from the fatty alcohol dehydrogenase gene, fatty alcohol oxidase gene, fatty aldehyde dehydrogenase and acyl-CoA oxidase are removed using conventional genetic recombination techniques known in the art. Recombinant microorganisms can be prepared. In the present invention, the term "removal" is not only a part or all of the gene is physically removed, but also a state in which a protein is not made from mRNA transcribed from the gene and the protein expressed from the gene function The state of not being able to be used is also used in the sense of comprehensive inclusion.
본 발명에 있어서, "디올"은 두 개의 히드록시기(-OH 기)를 포함하고 있는 화합물을 총칭하는 것으로서, "중쇄 디올"은 탄소수 5 내지 30, 바람직하게는 탄소수 6 내지 20, 보다 바람직하게는 탄소수 8 내지 16을 갖는 디올 화합물을 모두 포함하는 의미로 사용된다.In the present invention, "diol" refers to a compound containing two hydroxyl groups (-OH group), "heavy chain diol" is 5 to 30 carbon atoms, preferably 6 to 20 carbon atoms, more preferably carbon atoms It is used with the meaning including all the diol compounds which have 8-16.
본 발명에 있어서, 단계 (2)의 기질은 지방산 유래의 알코올 및 알칸으로 이루어지는 군으로부터 선택될 수 있으나 이에 한정되는 것은 아니다. 본 발명의 구현예에 따르면, 상기 지방산 유래의 알코올로는 탄소수 5 내지 30, 바람직하게는 탄소수 6 내지 20, 보다 바람직하게는 탄소수 8 내지 16을 갖는 알코올이 사용될 수 있으나 이에 한정되는 것은 아니다. 본 발명의 다른 구현예에 따르면, 상기 알칸은 탄소수 5 내지 30, 바람직하게는 탄소수 6 내지 20, 보다 바람직하게는 탄소수 8 내지 16을 갖는 알칸이 사용될 수 있으나 이에 한정되는 것은 아니다. 본 발명의 바람직한 구현예에 따르면, 상기 알칸은 도데칸일 수 있으나 이에 한정되는 것은 아니다. 본 발명의 다른 바람직한 구현예에 따르면, 상기 중쇄 디올은 1,12-도데칸디올일 수 있으나 이에 한정되는 것은 아니다.In the present invention, the substrate of step (2) may be selected from the group consisting of alcohols and alkanes derived from fatty acids, but is not limited thereto. According to an embodiment of the present invention, the alcohol derived from the fatty acid may be an alcohol having 5 to 30 carbon atoms, preferably 6 to 20 carbon atoms, more preferably 8 to 16 carbon atoms, but is not limited thereto. According to another embodiment of the present invention, the alkanes may be used alkanes having 5 to 30 carbon atoms, preferably 6 to 20 carbon atoms, more preferably 8 to 16 carbon atoms, but are not limited thereto. According to a preferred embodiment of the present invention, the alkanes may be dodecane, but is not limited thereto. According to another preferred embodiment of the present invention, the heavy chain diol may be 1,12-dodecanediol, but is not limited thereto.
이하, 실시예에 의해 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail by way of examples.
단, 하기 실시예는 본 발명을 예시하기 위한 것일 뿐, 본 발명의 내용이 하기 실시예에 의해 한정되는 것은 아니다.However, the following examples are only for illustrating the present invention, and the content of the present invention is not limited by the following examples.
실시예 1. 낙-아웃 카세트의 제작Example 1 Fabrication of a Fall-Out Cassette
균주 개량을 위한 유전자 낙-아웃을 위해 선별 마커로 사용될 ura3 유전자와 낙-아웃 카세트 삽입 후 ura3 유전자를 제거하기 위한 팝-아웃을 갖는 벡터를 제작하였다(도 3). 상기 Ura3 유전자는 야로위아 유래의 유전자를 사용하였고, 균주 개량에 사용된 팝-아웃 영역은 총 4가지 서열로 2종의 유전자에서 참조하였으며, 하나는 바실러스 유래의 글루타메이트 생산 유전자, 다른 하나는 살모넬라 또는 클로닝 벡터 pHUKH 유래의 his 오페론에 관여된 유전자를 사용하였다. 상기 팝-아웃 벡터의 제작을 위해 사용된 프라이머와 서열은 아래 표 1에 나타내었다.A vector having a ura3 gene to be used as a selection marker for gene knock-out for strain improvement and a pop-out for removing the ura3 gene after insertion of the knock-out cassette was constructed (FIG. 3). The Ura3 gene used a gene derived from Yarrowia, and the pop-out region used for strain improvement was referred to two genes with a total of four sequences, one of which was a bacterium-producing glutamate gene, and the other was a salmonella or A gene involved in his operon derived from the cloning vector pHUKH was used. Primers and sequences used for the preparation of the pop-out vectors are shown in Table 1 below.
팝-아웃 벡터Pop-out vector
이름name 염기서열Sequence 서열번호SEQ ID NO:
HisG1 HisG1 BglII FBglII F aattgggcccagatctcagaccggttcagacaggataattgggcccagatctcagaccggttcagacaggat 2222
EcoRI REcoRI R tctctgggcggaattcggaggtgcggatatgaggtatctctgggcggaattcggaggtgcggatatgaggta 2323
NotI FNotI F tgTTTCTCGgcggccgccagaccggttcagacaggattgTTTCTCGgcggccgccagaccggttcagacaggat 2424
BamHI RBamHI R TCCAACGCGTGGATCCggaggtgcggatatgaggtaTCCAACGCGTGGATCCggaggtgcggatatgaggta 2525
HisG2HisG2 BglII FBglII F aattgggcccagatctaacgctacctcgaccagaaaaattgggcccagatctaacgctacctcgaccagaaa 2626
EcoRI REcoRI R tctctgggcggaattctcttctcgatcggcagtacctctctgggcggaattctcttctcgatcggcagtacc 2727
NotI FNotI F tgTTTCTCGgcggccgcaacgctacctcgaccagaaatgTTTCTCGgcggccgcaacgctacctcgaccagaaa 2828
BamHI RBamHI R TCCAACGCGTGGATCCtcttctcgatcggcagtaccTCCAACGCGTGGATCCtcttctcgatcggcagtacc 2929
glt2glt2 BglII FBglII F aattgggcccagatctTCAGAACTTGCGCCGATAAAaattgggcccagatctTCAGAACTTGCGCCGATAAA 3030
EcoRI REcoRI R tctctgggcggaattcCTTTGCCAGCTAGACCATAGAGtctctgggcggaattcCTTTGCCAGCTAGACCATAGAG 3131
NotI FNotI F tgTTTCTCGgcggccgcTCAGAACTTGCGCCGATAAAtgTTTCTCGgcggccgcTCAGAACTTGCGCCGATAAA 3232
BamHI RBamHI R TCCAACGCGTGGATCCCTTTGCCAGCTAGACCATAGAGTCCAACGCGTGGATCCCTTTGCCAGCTAGACCATAGAG 3333
glt3glt3 BglII FBglII F aattgggcccagatctATTGGCGGGTTCGTTACTTaattgggcccagatctATTGGCGGGTTCGTTACTT 3434
EcoRI REcoRI R tctctgggcggaattcCCTGGAAGAAGGCCGTATTATCtctctgggcggaattcCCTGGAAGAAGGCCGTATTATC 3535
NotI FNotI F tgTTTCTCGgcggccgcATTGGCGGGTTCGTTACTTtgTTTCTCGgcggccgcATTGGCGGGTTCGTTACTT 3636
BamHI RBamHI R TCCAACGCGTGGATCCCCTGGAAGAAGGCCGTATTATCTCCAACGCGTGGATCCCCTGGAAGAAGGCCGTATTATC 3737
낙-아웃 카세트의 제작은 도 4와 같이 진행하였다. 우선 야로위아의 게놈 DNA로부터 낙-아웃시킬 상동성 영역(homologous region, HR)의 PCR과 팝-아웃 벡터로부터 5'과 3'의 두 조각 PCR을 각각 진행하였다. 이후, 5' HR과 3' HR 각각을 PO-ura3 부위와 정렬(align) PCR(2nd PCR)을 진행하여 낙-아웃 카세트를 제작하였다. 각각의 상동성 영역을 증폭하기 위해 사용한 프라이머와 서열은 표 2에 나타내었다.Fabrication of the knock-out cassette was performed as shown in FIG. 4. First, PCR of the homologous region (HR) to be knocked out from the genomic DNA of Yarrowia and two piece PCR of 5 'and 3' were performed from the pop-out vector, respectively. Thereafter, 5 'HR and 3' HR were each subjected to alignment PCR (2 nd PCR) with PO-ura3 sites to prepare a knock-out cassette. The primers and sequences used to amplify each homology region are shown in Table 2.
유전자 결실Gene deletion
이름name 염기서열Sequence 서열번호SEQ ID NO:
ACO1ACO1 F1F1 TTCCTCAATGGTGGAGAAGATTCCTCAATGGTGGAGAAGA 3838
R1R1 TCTTTATCCTGTCTGAACCGGTCTG GTACCATAGTCCTTGCCATGCTCTTTATCCTGTCTGAACCGGTCTG GTACCATAGTCCTTGCCATGC 3939
F2F2 ATCGCTACCTCATATCCGCACCTCC CTTCTGTCCCCCGAGTTTCTATCGCTACCTCATATCCGCACCTCC CTTCTGTCCCCCGAGTTTCT 4040
R2R2 AAGAAGGGCTTGAGAGTCGAAGAAGGGCTTGAGAGTCG 4141
ACO2ACO2 F1F1 CCCAACAACACTGGCACCCCAACAACACTGGCAC 4242
R1R1 TCTTTATCCTGTCTGAACCGGTCTG CTCCTCATCGTAGATGGCTCTTTATCCTGTCTGAACCGGTCTG CTCCTCATCGTAGATGGC 4343
F2F2 ATCGCTACCTCATATCCGCACCTCC gacaagacccgacaggcATCGCTACCTCATATCCGCACCTCC gacaagacccgacaggc 4444
R2R2 AGACCAGAGTCCTCTTCGAGACCAGAGTCCTCTTCG 4545
ACO3ACO3 F1F1 AccttcacagagccacccaAccttcacagagccaccca 4646
R1R1 ATGGCTCTCTGGGCGgtgttgggggtgttgatgatgATGGCTCTCTGGGCGgtgttgggggtgttgatgatg 4747
F2F2 TTGTTGTGTTTCTCGcaaggttctcatcgaggcctgTTGTTGTGTTTCTCGcaaggttctcatcgaggcctg 4848
R2R2 AggaaaggtcgaagagtgctctAggaaaggtcgaagagtgctct 4949
ACO4ACO4 F1F1 ActgcgagagcgatctgActgcgagagcgatctg 5050
R1R1 TCTTTATCCTGTCTGAACCGGTCTG TTCATGAGCATGTAGTTTCGTCTTTATCCTGTCTGAACCGGTCTG TTCATGAGCATGTAGTTTCG 5151
F2F2 ATCGCTACCTCATATCCGCACCTCC gaggacgacaaagccggagATCGCTACCTCATATCCGCACCTCC gaggacgacaaagccggag 5252
R2R2 AGAGCAGAGTCCTCCTCAAAGAGCAGAGTCCTCCTCAA 5353
ACO5ACO5 F1F1 AACTTCCTCACAGGCAGCGAGCAACTTCCTCACAGGCAGCGAGC 5454
R1R1 ATGGCTCTCTGGGCG GAGTAGAGAGTGGGAGTTGAGGTCATGGCTCTCTGGGCG GAGTAGAGAGTGGGAGTTGAGGTC 5555
F2F2 ttgttgtgtttctcg ccccgtcaaggacgctgagttgttgtgtttctcg ccccgtcaaggacgctgag 5656
R2R2 ACAGTAAGGTGGGGCTTGACTCACAGTAAGGTGGGGCTTGACTC 5757
ACO6ACO6 F1F1 AGTCCCTCAACACGTTTACCG AGTCCCTCAACACGTTTACCG 5858
R1R1 TCTTTATCCTGTCTGAACCGGTCTG CCATTTAGTGGCAGCAACGTTTCTTTATCCTGTCTGAACCGGTCTG CCATTTAGTGGCAGCAACGTT 5959
F2F2 ATCGCTACCTCATATCCGCACCTCC GAGCTCTGATCAACCGAACCATCGCTACCTCATATCCGCACCTCC GAGCTCTGATCAACCGAACC 6060
R2R2 AGGAAGGGTCTAATGACAGAAGGAAGGGTCTAATGACAGA 6161
FALDH1FALDH1 F1F1 AATCACTCCTCCTACGCAATCACTCCTCCTACGC 6262
R1R1 TCTTTATCCTGTCTGAACCGGTCTG TGGTCTCGGGGACACCTC TCTTTATCCTGTCTGAACCGGTCTG TGGTCTCGGGGACACCTC 6363
F2F2 ATCGCTACCTCATATCCGCACCTCC CCATCATCAAGCCCCGAAATCGCTACCTCATATCCGCACCTCC CCATCATCAAGCCCCGAA 6464
R2R2 ACCGACATAATCTGAGCAATACCGACATAATCTGAGCAAT 6565
FALDH2FALDH2 F1F1 AccactaggtgagatcgagAccactaggtgagatcgag 6666
R1R1 TCTTTATCCTGTCTGAACCGGTCTG CTCCGACACTACCGGAACGC TCTTTATCCTGTCTGAACCGGTCTG CTCCGACACTACCGGAACGC 6767
F2F2 ATCGCTACCTCATATCCGCACCTCC CTTGCTCCCACAGTTGTTATCGCTACCTCATATCCGCACCTCC CTTGCTCCCACAGTTGTT 6868
R2R2 GATCACCCAGAACCATAGC GATCACCCAGAACCATAGC 6969
FALDH3FALDH3 F1F1 GTGACCCCCACCACGTCACGTGACCCCCACCACGTCAC 7070
R1R1 TCTTTATCCTGTCTGAACCGGTCTG TTCTGACATTTTCAGCGCCACTCTTTATCCTGTCTGAACCGGTCTG TTCTGACATTTTCAGCGCCAC 7171
F2F2 ATCGCTACCTCATATCCGCACCTCC CCATTACGAGCGTTTGACGGATCGCTACCTCATATCCGCACCTCC CCATTACGAGCGTTTGACGG 7272
R2R2 CAGGGCTGGGGACCACC CAGGGCTGGGGACCACC 7373
FALDH4FALDH4 F1F1 TACCGACTGGACCAGATTCTACCGACTGGACCAGATTC 7474
R1R1 TCTTTATCCTGTCTGAACCGGTCTG CGGCAGTGGCAATGATCTTAC TCTTTATCCTGTCTGAACCGGTCTG CGGCAGTGGCAATGATCTTAC 7575
F2F2 ATCGCTACCTCATATCCGCACCTCC GACTCGATTCATCGCTCCTAC ATCGCTACCTCATATCCGCACCTCC GACTCGATTCATCGCTCCTAC 7676
R2R2 CAAATCTTTCGGAAGATTCGGCAAATCTTTCGGAAGATTCGG 7777
FAO1FAO1 F1F1 atcattgtcggtggaggaacatcattgtcggtggaggaac 7878
R1R1 ACGCCTTTCTGGTCGAGGTAGCGTTgcgtagtcgtaaggctggacACGCCTTTCTGGTCGAGGTAGCGTTgcgtagtcgtaaggctggac 7979
F2F2 attctggtactgccgatcgagaaga ccgtcatcggtgagattcttattctggtactgccgatcgagaaga ccgtcatcggtgagattctt 8080
R2R2 attcgaggtcggagatccttattcgaggtcggagatcctt 8181
ADH1ADH1 F1F1 cccagaaggctgtcattttccccagaaggctgtcattttc 8282
R1R1 ACGCCTTTCTGGTCGAGGTAGCGTTtcgcagttcttggggatatgACGCCTTTCTGGTCGAGGTAGCGTTtcgcagttcttggggatatg 8383
F2F2 attctggtactgccgatcgagaaga gccgacaaggagaagatgtgattctggtactgccgatcgagaaga gccgacaaggagaagatgtg 8484
R2R2 caatcttgccctcctccatcaatcttgccctcctccat 8585
ADH2ADH2 F1F1 ccagaagggtgtcatcttcgccagaagggtgtcatcttcg 8686
R1R1 ACGCCTTTCTGGTCGAGGTAGCGTTatcgcagttcttgggaatgtACGCCTTTCTGGTCGAGGTAGCGTTatcgcagttcttgggaatgt 8787
F2F2 attctggtactgccgatcgagaaga ccgacaaggagaagatgtgcattctggtactgccgatcgagaaga ccgacaaggagaagatgtgc 8888
R2R2 caatcttgccctcctccatacaatcttgccctcctccata 8989
ADH3ADH3 F1F1 agaaagccgtcatcttcgagagaaagccgtcatcttcgag 9090
R1R1 ttgcacaagtaacgaacccgccaat tcacagttcttggggatgtgttgcacaagtaacgaacccgccaat tcacagttcttggggatgtg 9191
F2F2 ggagataatacggccttcttccagg gctgacaaggagaagatgtgcggagataatacggccttcttccagg gctgacaaggagaagatgtgc 9292
R2R2 acttggagcagtccagaacgacttggagcagtccagaacg 9393
ADH4ADH4 F1F1 gtcaaaacgtcgacgaacctgtcaaaacgtcgacgaacct 9494
R1R1 AGGTATTTATCGGCGCAAGTTCTGA ggcttgaggtcaatgtcgatAGGTATTTATCGGCGCAAGTTCTGA ggcttgaggtcaatgtcgat 9595
F2F2 ctcctctatggtctagctggcaaag gacatggaggcccactctaactcctctatggtctagctggcaaag gacatggaggcccactctaa 9696
R2R2 agtactcccaagcgtcctcaagtactcccaagcgtcctca 9797
ADH5ADH5 F1F1 gagagccgctttcaccacgagagccgctttcaccac 9898
R1R1 AGGTATTTATCGGCGCAAGTTCTGA agagcctggtaggcagtgagAGGTATTTATCGGCGCAAGTTCTGA agagcctggtaggcagtgag 9999
F2F2 ctcctctatggtctagctggcaaag ttccaggacgtgatcaaggactcctctatggtctagctggcaaag ttccaggacgtgatcaagga 100100
R2R2 taaggatgatcttgccggtagtaaggatgatcttgccggtag 101101
ADH6ADH6 F1F1 gacccagaaagccattgtgtgacccagaaagccattgtgt 102102
R1R1 AGGTATTTATCGGCGCAAGTTCTGA agccacctgagaaaggtctgAGGTATTTATCGGCGCAAGTTCTGA agccacctgagaaaggtctg 103103
F2F2 ctcctctatggtctagctggcaaag caccgaggagaaggagaagactcctctatggtctagctggcaaag caccgaggagaaggagaaga 104104
R2R2 tccctcctccatcaaggtaatccctcctccatcaaggtaa 105105
ADH7ADH7 F1F1 gacgttcccaagacacaaaaggacgttcccaagacacaaaag 106106
R1R1 AGGTATTTATCGGCGCAAGTTCTGA aggcgtactgctggaaagagAGGTATTTATCGGCGCAAGTTCTGA aggcgtactgctggaaagag 107107
F2F2 ctcctctatggtctagctggcaaag acccacaccaaggagctgctcctctatggtctagctggcaaag acccacaccaaggagctg 108108
R2R2 caacgacacgaccaacaatccaacgacacgaccaacaatc 109109
ADH8ADH8 F1F1 atcgcgccaacttgtttaatatcgcgccaacttgtttaat 110110
R1R1 AGGTATTTATCGGCGCAAGTTCTGA caccttctctcgtgggatgtAGGTATTTATCGGCGCAAGTTCTGA caccttctctcgtgggatgt 111111
F2F2 ctcctctatggtctagctggcaaag tgtgttgagtctggcaaagcctcctctatggtctagctggcaaag tgtgttgagtctggcaaagc 112112
R2R2 tcaagtccatggcatcaaactcaagtccatggcatcaaac 113113
FADHFADH F1F1 ccgaaggaaagaccatcactccgaaggaaagaccatcact 114114
R1R1 ttgcacaagtaacgaacccgccaat agaaggaagagcagcccatattgcacaagtaacgaacccgccaat agaaggaagagcagcccata 115115
F2F2 ggagataatacggccttcttccagg gcttgggcttacaagtttggggagataatacggccttcttccagg gcttgggcttacaagtttgg 116116
R2R2 tcggtgaaggcagagttgattcggtgaaggcagagttgat 117117
팝-아웃 영역과 ura3를 두 조각으로 PCR하기 위해 사용한 프라이머는 표 3에 나타내었다.The primers used to PCR the pop-out region and ura3 in two pieces are shown in Table 3.
팝-아웃 카세트Pop-out cassette
이름name 염기서열Sequence 서열번호SEQ ID NO:
HISG1HISG1 FF cagaccggttcagacaggatcagaccggttcagacaggat 118118
RR ggaggtgcggatatgaggtaggaggtgcggatatgaggta 119119
HISG2HISG2 FF aacgctacctcgaccagaaaaacgctacctcgaccagaaa 120120
RR tcttctcgatcggcagtacctcttctcgatcggcagtacc 121121
glt2glt2 FF TCAGAACTTGCGCCGATAAATCAGAACTTGCGCCGATAAA 122122
RR CTTTGCCAGCTAGACCATAGAGCTTTGCCAGCTAGACCATAGAG 123123
glt3glt3 FF ATTGGCGGGTTCGTTACTTATTGGCGGGTTCGTTACTT 124124
RR CCTGGAAGAAGGCCGTATTATCCCTGGAAGAAGGCCGTATTATC 125125
BipartiteBipartite Ulura3 cs 2BUlura3 cs 2B atgccctcctacgaagctcgagcatgccctcctacgaagctcgagc 126126
Ylura3FYlura3F ctcccaacgagaagctggccctcccaacgagaagctggcc 127127
본 발명의 재조합 미생물 균주의 개량을 위해 사용한 유전자 서열들은 각각 서열목록에 기재하였으며, 표 4에 요약하였다.Gene sequences used for the improvement of the recombinant microbial strain of the present invention are listed in the sequence list, respectively, and summarized in Table 4.
유전자gene 서열번호SEQ ID NO: 유전자gene 서열번호SEQ ID NO:
ADH1ADH1 1One FALDH2FALDH2 1212
ADH2 ADH2 22 FALDH3FALDH3 1313
ADH3 ADH3 33 FALDH4FALDH4 1414
ADH4 ADH4 44 ACO1 ACO1 1515
ADH5 ADH5 55 ACO2ACO2 1616
ADH6 ADH6 66 ACO3ACO3 1717
ADH7 ADH7 77 ACO4ACO4 1818
ADH8ADH8 88 ACO5ACO5 1919
FADH FADH 99 ACO6 ACO6 2020
FAO1 FAO1 1010 Ura3Ura3 2121
FALDH1FALDH1 1111
실시예Example 2. 낙-아웃 균주의 제작 2. Construction of the Fall-Out Strain
상기 실시예 1에서 제조된 낙-아웃 카세트를 이용하여 야생형 야로위아 균주에 존재하는 지방 알코올 디하이드로게나아제, 지방 알코올 옥시다아제, 지방 알데히드 디하이드로게나아제 및 β-산화 대사 경로 관련 유전자의 일부 또는 전부가 제거된 총 6종의 낙-아웃 균주를 제작하였다(도 5). 구체적으로, 낙-아웃할 균주를 YPD 플레이트에 도말하여 30℃에서 16-24시간동안 배양하였다. 배양된 세포를 루프로 긁어서 원-스텝 버퍼(45% PEG4000, 100mM DTT, 0.1L LiAc, 25㎍ single-strand carrier DNA) 100㎕에 넣고 볼텍싱한 후, 낙-아웃 카세트(1ng 이상)를 첨가하여 다시 볼텍싱하였고, 39℃에서 1시간 동안 배양하였다. 배양이 끝난 샘플을 선택 배지(YNB w/o 아미노산 6.7g/L, Glucose 20g/L)에 로딩한 뒤 30℃에서 48시간 동안 배양하여 제작된 카세트가 삽입된 균주를 선택하였다. 이후, 선택된 균주의 게놈 상에 카세트들이 정확히 삽입되었는지 확인하기 위해 표 2의 유전자 결실에 포함된 프라이들을 이용하여 PCR을 통해 확인하였다.Some or all of the genes related to fatty alcohol dehydrogenase, fatty alcohol oxidase, fatty aldehyde dehydrogenase and β-oxidation metabolic pathway present in wild type Yarrowia strain using the Nak-Out cassette prepared in Example 1 A total of six knock-out strains were removed (Figure 5). Specifically, the strains to be knocked out were plated on YPD plates and incubated at 30 ° C. for 16-24 hours. The cultured cells were scraped with a loop and vortexed in 100 μl of one-step buffer (45% PEG4000, 100 mM DTT, 0.1 L LiAc, 25 μg single-strand carrier DNA), followed by addition of a knock-out cassette (1 ng or more). Was vortexed again and incubated at 39 ° C. for 1 h. The cultured samples were loaded into selection medium (YNB w / o amino acid 6.7g / L, Glucose 20g / L) and incubated at 30 ° C. for 48 hours to select the inserted strain. Then, it was confirmed by PCR using the fries included in the gene deletion of Table 2 to confirm that the cassettes are correctly inserted on the genome of the selected strain.
카세트가 삽입된 균주는 다른 카세트의 삽입을 진행하기 위해 팝-아웃 과정을 진행하였다. 선택 배지에서 선택된 균주를 YPD 배지 2㎖에 접종하여 30℃에서 16시간 이상 배양한 후, 배양액 200㎕를 5' FOA 배지(YNB w/o 아미노산 6.7g/L, Glucose 20g/L, 5' FOA 0.8g/L, uracil 0.1g/L, uridine 0.1g/L)에 도말하여 30℃에서 48시간 동안 배양하였다. 5' FOA 배지에서 자란 균주들은 YPD 플레이트와 UD 플레이트에 피킹(picking)하여 YPD 플레이트에서 자란 균주들을 선별하였고, 다시 표 2의 프라이머들을 이용하여 PCR 과정을 통해 ura3 유전자가 제거되었는지 여부를 확인하였다. Ura3가 제거된 균주들은 다른 유전자의 낙-아웃을 진행하였다.The strain into which the cassette was inserted went through a pop-out process to proceed with the insertion of another cassette. After inoculating 2 ml of YPD medium in selective medium and incubating at 30 ° C. for 16 hours or more, 200 μl of the culture medium was mixed with 5 ′ FOA medium (YNB w / o amino acid 6.7g / L, Glucose 20g / L, 5 'FOA). 0.8g / L, uracil 0.1g / L, uridine 0.1g / L) and incubated for 48 hours at 30 ℃. Strains grown in 5 'FOA medium were picked on YPD plates and UD plates, and the strains grown on YPD plates were selected, and again, the primers of Table 2 were used to determine whether the ura3 gene was removed by PCR. Strains depleted of Ura3 proceeded knockout of other genes.
위의 과정을 반복적으로 진행하여 본 발명의 재조합 미생물 균주를 제작하였다(Chen DC, Beckerich JM, Gaillardin C (1997) Appl Microbiol Biotechnol 48: 232-235).By repeating the above process to produce a recombinant microbial strain of the present invention (Chen DC, Beckerich JM, Gaillardin C (1997) Appl Microbiol Biotechnol 48: 232-235).
실시예 3. 낙-아웃 균주의 배양Example 3. Cultivation of Drop-Out Strains
배양 테스트할 균주를 전날 2 ㎖ YPD 배지(Bacto Laboratories, Yeast extract 10g/L, peptone 20g/L, glucose 20g/L)에 접종하여 30℃, 200rpm에서 하루 동안 키웠다. 24-웰 플레이트에 표 5에 기재된 조성을 갖는 성장기 배지(pH 6.0) 2 ㎖을 넣고, 전배양한 배양액 1%를 접종한 후, 플레이트 교반기에서 30℃, 450 rpm으로 하루 동안 배양하였다. 하루 배양한 균주들을 표 6에 기재된 전환기 배지(pH 7.6) 900 ㎕가 분주된 새로운 플레이트에 900 ㎕씩 접종하면서 기질 200 ㎕를 함께 첨가하였고, 30℃, 450 rpm으로 하루 동안 배양하였다. 이때, 기질로는 DMSO에 용해된 도데칸 10 g/L를 사용하였다.Culture The strain to be tested was inoculated in 2 ml of YPD medium (Bacto Laboratories, Yeast extract 10g / L, peptone 20g / L, glucose 20g / L) the day before at 30 ℃, 200rpm. 2 ml of growth stage medium (pH 6.0) having the composition shown in Table 5 was placed in a 24-well plate, and then inoculated with 1% of the pre-cultured culture, followed by incubation at 30 ° C. and 450 rpm for one day in a plate stirrer. Strains cultured daily were added together with 200 µl of the substrate while inoculating 900 µl into a new plate dispensed with 900 µl of the converter medium (pH 7.6) described in Table 6 and incubated at 30 ° C. and 450 rpm for one day. At this time, 10 g / L of dodecane dissolved in DMSO was used as the substrate.
성장기 배지 pH 6.0Growth phase pH 6.0
성분ingredient 농도(g/L)Concentration (g / L)
글루코오스Glucose 5050
YNB w/o 아미노산YNB w / o amino acids 6.76.7
효모 추출물Yeast extract 1010
(NH4)2SO4 (NH 4 ) 2 SO 4 55
우라실Uracil 0.050.05
0.1M 포스페이트 버퍼0.1M phosphate buffer
25℃에서 0.1M 칼륨 포스페이트 버퍼의 제조Preparation of 0.1M Potassium Phosphate Buffer at 25 ° C
pHpH 1M K2HPO4의 부피(㎖)Volume of 1M K 2 HPO 4 (ml) 1M KH2PO4의 부피(㎖)Volume of 1M KH 2 PO 4 (ml)
6.06.0 13.213.2 86.886.8
전환기 배지 pH 7.6Diverter Medium pH 7.6
성분ingredient 농도(g/L)Concentration (g / L)
글루코오스Glucose 3030
YNB w/o 아미노산YNB w / o amino acids 6.76.7
효모 추출물Yeast extract 33
(NH4)2SO4 (NH 4 ) 2 SO 4 1515
우라실Uracil 0.050.05
L-알라닌L-alanine 1010
0.1M 포스페이트 버퍼0.1M phosphate buffer
25℃에서 0.1M 칼륨 포스페이트 버퍼의 제조Preparation of 0.1M Potassium Phosphate Buffer at 25 ° C
pHpH 1M K2HPO4의 부피(㎖)Volume of 1M K 2 HPO 4 (ml) 1M KH2PO4의 부피(㎖)Volume of 1M KH 2 PO 4 (ml)
7.67.6 86.686.6 13.413.4
그 결과, β-산화 대사 관련 유전자 및 지방 알데히드 디하이드로게나아제 유전자만 낙-아웃된 Y1-28 및 Y1-36 균주의 경우 기질인 도데칸으로부터 1,12-도데칸디올을 생산할 수 없었지만, 지방 알코올 옥시다아제 유전자가 추가로 낙-아웃된 Y1-36 균주, 및 지방 알코올 옥시다아제 유전자와 지방 알코올 디하이드로게나아제 유전자가 추가로 낙-아웃된 Y4-2, Y4-20 및 Y4-30 균주는 모두 뛰어난 1,12-도데칸디올 합성 능력을 보여주었다(도 6). 또한, 상기 Y4-20 균주는 플라스크에서 배양시에 18 ㎎/L 정도의 1,12-도데칸디올 합성 능력을 보여주었다(도 7). 이하의 실험에서는 Y4-20 균주를 이용한 시료 분석 실험을 수행하였다.As a result, the Y1-28 and Y1-36 strains that only knocked out the β-oxidation metabolism related gene and the fatty aldehyde dehydrogenase gene could not produce 1,12-dodecanediol from the substrate dodecane, but the fat The Y1-36 strain additionally knocked out the alcohol oxidase gene and the Y4-2, Y4-20 and Y4-30 strains additionally knocked out the fatty alcohol oxidase gene and the fatty alcohol dehydrogenase gene were all excellent. It showed the ability to synthesize 1,12-dodecanediol (FIG. 6). In addition, the Y4-20 strain showed a 1,12-dodecanediol synthesis capacity of about 18 mg / L when cultured in the flask (Fig. 7). In the following experiment, a sample analysis experiment using the Y4-20 strain was performed.
실시예 4. 시료의 분석Example 4. Analysis of Samples
실시예 3에서 1,12-도데칸디올 합성 능력이 가장 뛰어난 것으로 나타난 Y4-20 균주의 배양액 10 mL에 1N 수산화나트륨 1 mL 및 클로로포름 10 mL을 가한 다음 충분히 볼텍싱(vortexing) 하여 추출한 뒤 10,000rpm에서 10분간 원심분리 하였다. 이후, 클로로포름 층 만을 분리하여 10배 농축을 진행한 후 하기의 분석 조건에서 GC/MS 분석을 수행하였다.1 mL of 1N sodium hydroxide and 10 mL of chloroform were added to 10 mL of the culture medium of the Y4-20 strain which showed the highest 1,12-dodecanediol synthesis ability in Example 3, followed by sufficient vortexing extraction, and then 10,000 rpm. Centrifuge for 10 minutes at. Thereafter, only the chloroform layer was separated, and then concentrated 10 times, and GC / MS analysis was performed under the following analysis conditions.
분석 조건Analysis conditions
① 기기: Agilent 5975 MSD① Instrument: Agilent 5975 MSD
② 컬럼: HP-5MS② column: HP-5MS
③ 온도: 오븐(150℃ 내지 230℃)③ Temperature: Oven (150 ° C. to 230 ° C.)
④ 캐리어 가스: He④ Carrier Gas: He
⑤ 유속: 1 ㎖/분⑤ flow rate: 1 ml / min
그 결과, 본 발명의 재조합 Y4-20 균주는 기질인 도데칸으로부터 1,12-도데칸디올을 합성할 수 있음을 확인하였다(도 8).As a result, it was confirmed that the recombinant Y4-20 strain of the present invention can synthesize 1,12-dodecanediol from the substrate dodecane (FIG. 8).

Claims (20)

  1. ω-산화 대사 경로 중의 지방 알코올 디하이드로게나아제 및 지방 알코올 옥시다아제로 이루어진 군으로부터 선택되는 하나 이상의 유전자가 제거되고, 선택적으로 지방 알데히드 디하이드로게나아제 유전자가 제거되며, 또한 β-산화 대사 경로 관련 유전자가 제거된 재조합 미생물.One or more genes selected from the group consisting of fatty alcohol dehydrogenase and fatty alcohol oxidase in the ω-oxidation metabolic pathway are removed, optionally the fatty aldehyde dehydrogenase gene is removed, and also the β-oxidation metabolic pathway related genes Recombinant microorganisms removed.
  2. 청구항 1에 있어서,The method according to claim 1,
    상기 지방 알코올 디하이드로게나아제, 지방 알코올 옥시다아제, 지방 알데히드 디하이드로게나아제 및 β-산화 대사 경로 관련 유전자는 미생물 내에 존재하는 모든 상동형 유전자가 제거된 재조합 미생물.The fatty alcohol dehydrogenase, fatty alcohol oxidase, fatty aldehyde dehydrogenase and β-oxidation metabolic pathway related genes are removed from all the homologous genes present in the microorganism.
  3. 청구항 1에 있어서,The method according to claim 1,
    상기 지방 알코올 디하이드로게나아제, 지방 알코올 옥시다아제, 지방 알데히드 디하이드로게나아제 및 β-산화 대사 경로 관련 유전자는 해당 미생물 내에 존재하는 일부 상동형 유전자가 제거된 재조합 미생물.The fatty alcohol dehydrogenase, fatty alcohol oxidase, fatty aldehyde dehydrogenase and β-oxidation pathway-related genes are removed from the recombinant microorganism, some homologous genes present in the microorganism.
  4. 청구항 1에 있어서,The method according to claim 1,
    상기 지방 알코올 디하이드로게나아제 유전자는 ADH1, ADH2, ADH3, ADH4, ADH5, ADH6, ADH7, ADH8 및 FADH 유전자로 이루어진 군으로부터 선택되는 재조합 미생물.The fatty alcohol dehydrogenase gene is selected from the group consisting of ADH1, ADH2, ADH3, ADH4, ADH5, ADH6, ADH7, ADH8 and FADH gene.
  5. 청구항 4에 있어서,The method according to claim 4,
    상기 ADH1, ADH2, ADH3, ADH4, ADH5, ADH6, ADH7, ADH8 및 FADH 유전자는 각각 서열번호 1 및 서열번호 9로 이루어지는 염기서열을 포함하는 재조합 미생물.The recombinant microorganism of ADH1, ADH2, ADH3, ADH4, ADH5, ADH6, ADH7, ADH8 and FADH gene comprises a base sequence consisting of SEQ ID NO: 1 and SEQ ID NO: 9, respectively.
  6. 청구항 1에 있어서,The method according to claim 1,
    상기 지방 알코올 옥시다아제 유전자는 FAO 유전자인 재조합 미생물.The fatty alcohol oxidase gene is a FAO gene recombinant microorganism.
  7. 청구항 6에 있어서,The method according to claim 6,
    상기 FAO 유전자는 서열번호 10으로 이루어지는 염기서열을 포함하는 재조합 미생물.The FAO gene is a recombinant microorganism comprising a nucleotide sequence consisting of SEQ ID NO: 10.
  8. 청구항 1에 있어서,The method according to claim 1,
    상기 지방 알데히드 디하이드로게나아제 유전자는 FALDH1, FALDH2, FALDH3 및 FALDH4 유전자로 이루어진 군으로부터 선택되는 재조합 미생물.The fatty aldehyde dehydrogenase gene is selected from the group consisting of FALDH1, FALDH2, FALDH3 and FALDH4 gene.
  9. 청구항 8에 있어서,The method according to claim 8,
    상기 FALDH1, FALDH2, FALDH3 및 FALDH4 유전자는 각각 서열번호 11 및 서열번호 14로 이루어지는 염기서열을 포함하는 재조합 미생물.The FALDH1, FALDH2, FALDH3 and FALDH4 gene is a recombinant microorganism comprising a nucleotide sequence consisting of SEQ ID NO: 11 and SEQ ID NO: 14, respectively.
  10. 청구항 1에 있어서,The method according to claim 1,
    상기 β-산화 대사 경로 관련 유전자는 아실-CoA 옥시다아제 유전자인 재조합 미생물.The β-oxidation metabolic pathway related gene is an acyl-CoA oxidase gene.
  11. 청구항 10에 있어서,The method according to claim 10,
    상기 아실-CoA 옥시다아제 유전자는 ACO1, ACO2, ACO3, ACO4, ACO5 및 ACO6 유전자로 이루어진 군으로부터 선택되는 재조합 미생물.The acyl-CoA oxidase gene is a recombinant microorganism selected from the group consisting of ACO1, ACO2, ACO3, ACO4, ACO5 and ACO6 genes.
  12. 청구항 11에 있어서,The method according to claim 11,
    상기 ACO1, ACO2, ACO3, ACO4, ACO5 및 ACO6 유전자는 각각 서열번호 15 및 서열번호 20으로 이루어지는 염기서열을 포함하는 재조합 미생물.The ACO1, ACO2, ACO3, ACO4, ACO5 and ACO6 gene is a recombinant microorganism comprising a nucleotide sequence consisting of SEQ ID NO: 15 and SEQ ID NO: 20, respectively.
  13. 청구항 1에 있어서,The method according to claim 1,
    상기 미생물은 효모 또는 대장균인 재조합 미생물.The microorganism is a recombinant microorganism is yeast or E. coli.
  14. 청구항 13에 있어서,The method according to claim 13,
    상기 효모는 야로위아 속, 사카로마이세스 속, 피키아 속 및 캔디다 속으로 이루어진 군으로부터 선택되는 효모인 재조합 미생물.The yeast is a recombinant microorganism which is a yeast selected from the group consisting of genus Yarrowia, genus Saccharomyces, Pichia and Candida.
  15. 청구항 14에 있어서,The method according to claim 14,
    상기 야로위아 속의 효모는 야로위아 리폴리티카인 재조합 미생물.The yeast of the genus Yarrowia is a recombinant microorganism that is Yarrowia repolitica.
  16. (1) 청구항 1 내지 청구항 15 중 어느 한 항의 재조합 미생물을 제조하는 단계; 및(1) preparing a recombinant microorganism of any one of claims 1 to 15; And
    (2) 상기 재조합 미생물에 기질을 처리하여 배양하는 단계를 포함하는 중쇄 디올의 생산 방법.(2) a method of producing a heavy chain diol comprising the step of culturing the substrate to the recombinant microorganism.
  17. 청구항 16에 있어서,The method according to claim 16,
    상기 기질은 지방산 유래의 알코올 및 알칸으로 이루어지는 군으로부터 선택되는 중쇄 디올의 생산 방법.Wherein said substrate is selected from the group consisting of alcohols and alkanes derived from fatty acids.
  18. 청구항 17에 있어서,The method according to claim 17,
    상기 지방산 유래의 알코올은 탄소수 5 내지 30을 갖는 알코올인 중쇄 디올의 생산 방법.The fatty acid-derived alcohol is a method for producing a heavy chain diol having 5 to 30 carbon atoms.
  19. 청구항 17에 있어서,The method according to claim 17,
    상기 알칸은 탄소수 5 내지 30을 갖는 알칸인 중쇄 디올의 생산 방법.The alkanes are alkanes having 5 to 30 carbon atoms.
  20. 청구항 18에 있어서,The method according to claim 18,
    상기 중쇄 디올은 탄소수 5 내지 30을 갖는 디올 화합물인 중쇄 디올의 생산 방법.The heavy chain diol is a method for producing a heavy chain diol is a diol compound having 5 to 30 carbon atoms.
PCT/KR2016/012170 2015-10-27 2016-10-27 Method for producing heavy chain diol WO2017074061A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP16860244.9A EP3378940B1 (en) 2015-10-27 2016-10-27 Method for producing heavy chain diol
US15/771,799 US11091741B2 (en) 2015-10-27 2016-10-27 Method for producing medium chain diol

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2015-0149251 2015-10-27
KR20150149251 2015-10-27
KR1020160141017A KR101903551B1 (en) 2015-10-27 2016-10-27 Method for production of medium chain diol
KR10-2016-0141017 2016-10-27

Publications (1)

Publication Number Publication Date
WO2017074061A1 true WO2017074061A1 (en) 2017-05-04

Family

ID=58631851

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/012170 WO2017074061A1 (en) 2015-10-27 2016-10-27 Method for producing heavy chain diol

Country Status (1)

Country Link
WO (1) WO2017074061A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101145405B1 (en) * 2008-12-03 2012-05-16 한국생명공학연구원 Mutant Blocked in Glycerol Oxidaion Pathway for Producing 1,3-Propanediol
US8530206B2 (en) * 2008-05-21 2013-09-10 Ecover Coordination Center N.V. Method for the production of medium-chain sophorolipids
KR20140142518A (en) * 2013-06-04 2014-12-12 서강대학교산학협력단 Recombinant Strain for Manufacturing 2,3-Butanediol comprising Inactivated wabG and Overexpressed budR
KR20150039055A (en) * 2013-10-01 2015-04-09 삼성전자주식회사 Enzyme used in synthesis of 1,4-BDO, variant thereof and method for 1,4-butanediol using the same

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8530206B2 (en) * 2008-05-21 2013-09-10 Ecover Coordination Center N.V. Method for the production of medium-chain sophorolipids
KR101145405B1 (en) * 2008-12-03 2012-05-16 한국생명공학연구원 Mutant Blocked in Glycerol Oxidaion Pathway for Producing 1,3-Propanediol
KR20140142518A (en) * 2013-06-04 2014-12-12 서강대학교산학협력단 Recombinant Strain for Manufacturing 2,3-Butanediol comprising Inactivated wabG and Overexpressed budR
KR20150039055A (en) * 2013-10-01 2015-04-09 삼성전자주식회사 Enzyme used in synthesis of 1,4-BDO, variant thereof and method for 1,4-butanediol using the same

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
PARK ET AL.: "Metabolic Engineering of Escherichia Coli for the Production of Medium-chain-length Polyhydroxyalkanoates Rich in Specific Monomers", FEMS MICROBIOLOGY LETTERS, vol. 214, 2002, pages 217 - 222, XP055227754 *

Similar Documents

Publication Publication Date Title
Cernak et al. Engineering Kluyveromyces marxianus as a robust synthetic biology platform host
KR101149566B1 (en) Optimised micro-organism strains for nadph-consuming biosynthetic pathways
US8236994B2 (en) Process for the biological production of 1,3-propanediol from glycerol with high yield
US8158391B2 (en) Production of an α-carboxyl-ω-hydroxy fatty acid using a genetically modified Candida strain
Kim et al. Combinatorial design of a highly efficient xylose-utilizing pathway in Saccharomyces cerevisiae for the production of cellulosic biofuels
US8445243B2 (en) Hexose-pentose cofermenting yeast having excellent xylose fermentability and method for highly efficiently producing ethanol using the same
UA76690C2 (en) Yeast which ferments xylose to ethanol (variants), plasmid vector and method for fermentation of xylose to ethanol
WO2019203436A1 (en) Acid-resistant yeast with supressed ethanol production pathway and method for producing lactic acid using same
TWI450963B (en) An isolated yeast strain having high xylose consumption rate and process for production of ethanol using the strain
WO2017074061A1 (en) Method for producing heavy chain diol
KR20170049436A (en) Method for production of medium chain aminocarboxylic acid
Qiu et al. Kluyveromyces as promising yeast cell factories for industrial bioproduction: From bio-functional design to applications
US11091741B2 (en) Method for producing medium chain diol
US20190338256A1 (en) Redox balancing in yeast
TW201249992A (en) A method for preparing a xylose-utilizing strain of Saccharomyces cerevisiae and the Saccharomyces cerevisiae
WO2017074063A1 (en) Method for producing heavy chain aminocarboxylic acid
US9127323B2 (en) Isolated yeast strain having high xylose consumption rate and process for production of ethanol using the strain
US20200131538A1 (en) Microorganism with stabilized copy number of functional dna sequence and associated methods
WO2017074065A1 (en) Method for producing heavy chain diamine
CN102268431B (en) Orotidine-5'-phosphate decarboxylase promoter (pRtura3), application thereof, construct thereof and vector thereof
KR101903552B1 (en) Method for production of medium chain diamine
WO2019233853A1 (en) Microorganisms and the production of fine chemicals
US20230227861A1 (en) Gene duplications for crabtree-warburg-like aerobic xylose fermentation
WO2021112641A1 (en) Recombinant strain for producing heavy chain diols and method for producing heavy chain diols by using same
Kelso Foundational Tools for Synthetic Methylotrophy in Saccharomyces cerevisiae

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16860244

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 15771799

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2016860244

Country of ref document: EP