KR102143840B1 - A method for treating damaged astrocytes - Google Patents

A method for treating damaged astrocytes Download PDF

Info

Publication number
KR102143840B1
KR102143840B1 KR1020190021309A KR20190021309A KR102143840B1 KR 102143840 B1 KR102143840 B1 KR 102143840B1 KR 1020190021309 A KR1020190021309 A KR 1020190021309A KR 20190021309 A KR20190021309 A KR 20190021309A KR 102143840 B1 KR102143840 B1 KR 102143840B1
Authority
KR
South Korea
Prior art keywords
human
stem cells
astrocytes
human stem
present
Prior art date
Application number
KR1020190021309A
Other languages
Korean (ko)
Inventor
송미연
Original Assignee
송미연
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 송미연 filed Critical 송미연
Priority to KR1020190021309A priority Critical patent/KR102143840B1/en
Application granted granted Critical
Publication of KR102143840B1 publication Critical patent/KR102143840B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0618—Cells of the nervous system
    • C12N5/0622—Glial cells, e.g. astrocytes, oligodendrocytes; Schwann cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/70—Undefined extracts
    • C12N2500/80—Undefined extracts from animals
    • C12N2500/84—Undefined extracts from animals from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
    • C12N2502/1352—Mesenchymal stem cells
    • C12N2502/1364—Dental pulp stem cells, dental follicle stem cells

Abstract

One embodiment of the present invention provides a method for treating astrocytes damaged by cerebral ischemia. More specifically, the present invention provides the method for treating the astrocytes damaged by cerebral ischemia using human stem cells cultured in a medium containing a human placenta extract and subjected to ischemia treatment. The method for providing information on improving astrocyte viability comprises the following steps of: culturing human stem cells in the medium containing the human placenta extract; conducting ischemic treatment of the cultured human stem cells in a medium deficient in fetal calf serum; and treating the damaged astrocytes with the ischemic-treated human stem cells.

Description

손상된 성상교세포 치료방법{A METHOD FOR TREATING DAMAGED ASTROCYTES}A method for treating damaged astrocytes {A METHOD FOR TREATING DAMAGED ASTROCYTES}

본 발명은 손상된 성상교세포 치료방법에 관한 것으로서, 구체적으로 뇌허혈에 의해 손상된 성상교세포 치료방법에 관한 것이다. 특히, 인간 태반 추출물 배양한 인간줄기세포 기반 손상된 성상교세포 치료방법에 관한 것이다.The present invention relates to a method for treating damaged astrocytes, and specifically, to a method for treating astrocytes damaged by cerebral ischemia. In particular, it relates to a method for treating damaged astrocytes based on human stem cells cultured with human placenta extract.

뇌졸중(stroke)은 뇌혈류 이상으로 인해 갑작스레 유발된 국소적인 신경학적 결손 증상을 통칭하는 말이다. 뇌졸중은 증상에 대한 용어로서, 의학적인 질병으로 칭할 때에는 뇌혈관 질환(cerebrovascular accident; CVA)이라고 한다. 뇌졸중은 세계적으로 사망요인 두 번째로 많은 원인 질병이며, 또한, 국내에서도 역시 두 번째로 높은 사망원인 질병이다. 연구기관 및 조사 방법에 따라 조금씩 차이가 있으나 미국에서는 매년 약 50만 명의 새로운 뇌졸중 환자가 발생되며, 45-84세로 나이를 조정한 연간발생률(annual incidence rate)은 10만 명당 100-300명으로 보고되어 있다. 뇌졸중의 발생률은 나이가 들면서 증가되어서 10년마다 두 배씩 증가된다. 현재 미국에는 약 300만 명의 뇌졸중 환자가 고통을 받고 있으며 이는 인구 10만 명당 500-600명 정도인 것으로 알려져 있다. 이미 언급한 것처럼 뇌졸중 발생률 및 유병률은 나이들수록 더욱 증가되어 환자의 대부분은 65세 이상의 노인이며 1.3: 1로 남자가 여자보다 많다.Stroke is a collective term for local neurological deficits that are suddenly caused by abnormal blood flow in the brain. Stroke is a term for symptoms, and when referred to as a medical disease, it is called cerebrovascular accident (CVA). Stroke is the second-most cause of death in the world, and is also the second-highest cause of death in Korea. Although there are slight differences depending on the research institute and the research method, about 500,000 new stroke patients occur every year in the United States, and the annual incidence rate adjusted to the age of 45-84 is reported as 100-300 per 100,000. Has been. The incidence of stroke increases with age, doubling every 10 years. Currently, about 3 million stroke patients are suffering in the United States, which is known to be between 500 and 600 per 100,000 population. As already mentioned, the incidence and prevalence of stroke increases with age, and most of the patients are older than 65 years of age, with 1.3:1, more men than women.

뇌졸중은 크게 허혈성뇌졸중(ischemic stroke)과 뇌출혈(cerebral hemorrhage)로 대별되고 그 원인 및 기전에 따라서 허혈성 뇌졸중은 죽상동맥경화성뇌졸중(atherosclerotic ischemic stroke), 소공뇌경색(lacunar stroke)과 심인성색전(cardiogenic embolism)으로 나누며, 뇌출혈은 뇌실질내출혈(intracerebral hemorrhage)과 지주막하출혈(subarachnoid)로 나뉘어진다. 이들 뇌졸중의 종류 및 분포는 보고자나 연구 방법에 따라 서로 다른데, 일반적으로 서구사회에서는 허혈성 뇌졸중이 전체뇌졸중의 약 80%를 차지하고 나머지 20%가 뇌출혈로 보고되고 있지만 일본에서의 역학적 연구에서는 허혈성 뇌졸중이 55%, 뇌출혈이 45%로 보고되었으며 국내에서는 허혈성 뇌졸중과 뇌출혈의 빈도가 거의 비슷한 것으로 보고되어 일본의 통계와 비슷하다.Stroke is largely divided into ischemic stroke and cerebral hemorrhage. Depending on the cause and mechanism, ischemic stroke is atherosclerotic ischemic stroke, lacunar stroke, and cardiogenic embolism. Cerebral hemorrhage is divided into intracerebral hemorrhage and subarachnoid hemorrhage. The type and distribution of these strokes differ according to the reporter or research method. In general, ischemic stroke accounts for about 80% of all strokes in Western society and the remaining 20% is reported as cerebral hemorrhage. 55% and 45% of cerebral hemorrhage were reported, and in Korea, the frequency of ischemic stroke and cerebral hemorrhage was reported to be almost the same, which is similar to that of Japan.

특히 뇌졸중 발병 환자 중 약 3% 만이 시간 내에 혈전용해제 주입을 받아 치료 되고 있는 정도로 치료가 어려운 질병이다. 또한, 발병 후 빠른 처치와 최상의 보살핌, 그리고 건강회복을 위한 치료를 받고도, 뇌졸중으로 인해 자주 신체적 장애를 얻게 된다. 최근 연구에서는 뇌졸중의 새로운 치료법으로 줄기세포 이식의 가능성에 각광 받고 있는데, 이는 줄기세포에서 신경세포 보호물질 분비되거나 신경세포로 분화 가능성이 있기 때문이다. 따라서 신경 줄기세포 이식이 이로운 치료 방법으로 각광받고 있고, 이 때문에 이전에 인간 신경 줄기세포 (human neural stem cells)를 뇌졸중 모델의 쥐에 이식하였더니, 기능적 장애가 놀랄 만큼 개선되는 것을 확인하였다. 따라서 최근까지 인간 줄기세포 이식을 통해 뇌졸중 치료 방법의 개발 연구가 계속되고 있는 상황이다. 하지만, 뇌졸중 발병 후에 생기는 장애를 치료하는 획기적인 치료법은 아직 없는 실정이다.In particular, it is a disease that is difficult to treat, as only about 3% of stroke patients are treated by receiving a thrombolytic drug injection within an hour. In addition, even after receiving rapid treatment, best care, and treatment for health recovery after onset, people often get physical disabilities due to stroke. In recent studies, the possibility of stem cell transplantation as a new treatment for stroke is in the spotlight because it is possible to secrete neuroprotective substances from stem cells or to differentiate into neurons. Therefore, neural stem cell transplantation is in the spotlight as a beneficial treatment method, and for this reason, when human neural stem cells were previously transplanted into mice in a stroke model, it was confirmed that functional disorders were surprisingly improved. Therefore, until recently, research on the development of a stroke treatment method through human stem cell transplantation continues. However, there is no groundbreaking treatment for the disorder that occurs after the onset of stroke.

본 발명이 이루고자 하는 기술적 과제는 인간 태반추출물로 배양하고 허혈처리된 인간줄기세포를 활용하여 뇌허혈로 손상된 성상교세포의 생존율을 높이는 방법을 제공하는 것이다.The technical task of the present invention is to provide a method for increasing the survival rate of astrocytes damaged by cerebral ischemia by using human stem cells cultured with human placenta extract and treated with ischemia.

본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 기술적 과제로 제한되지 않으며, 언급되지 않은 또 다른 기술적 과제들은 아래의 기재로부터 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.The technical problem to be achieved by the present invention is not limited to the technical problems mentioned above, and other technical problems that are not mentioned can be clearly understood by those of ordinary skill in the technical field to which the present invention belongs from the following description. There will be.

본 발명의 일측면에 따른 손상된 성상교세포 치료방법은A method for treating damaged astrocytes according to one aspect of the present invention

인간 줄기세포를 인간 태반 추출물을 포함하는 배지에서 배양하는 단계;Culturing human stem cells in a medium containing human placenta extract;

상기 배양된 인간 줄기세포를 우태아혈청이 결핍된 배지에서 허혈 처리하는 단계; 및Ischemia treatment of the cultured human stem cells in a medium deficient in fetal bovine serum; And

손상된 성상교세포를 상기 허혈 처리된 인간 줄기세포로 처리하는 단계;를 포함할 수 있다.It may include; treating the damaged astrocytes with the ischemic-treated human stem cells.

본 발명의 일실시예에 따르면, 상기 인간 줄기세포를 배양하는 단계 이전에,According to an embodiment of the present invention, before the step of culturing the human stem cells,

인간 줄기세포를 준비하는 단계를 더 포함하고,Further comprising the step of preparing human stem cells,

상기 인간 줄기세포를 준비하는 단계에서 사용되는 인간 줄기세포는 계대배양 passage 3 내지 5 상태일 수 있다. The human stem cells used in the step of preparing the human stem cells may be in passage 3 to 5 passages.

본 발명의 일실시예에 따르면, 상기 허혈 처리하는 단계 이후에,According to an embodiment of the present invention, after the ischemic treatment step,

허혈 처리된 인간 줄기세포를 무혈청 배지에서 배양하는 단계를 더 포함할 수 있다. It may further include the step of culturing the ischemia-treated human stem cells in a serum-free medium.

본 발명의 일실시예에 따르면, 상기 손상된 성상교세포는 허혈로 인해 손상된 것일 수 있다. According to an embodiment of the present invention, the damaged astrocytes may be damaged due to ischemia.

본 발명의 일실시예에 따르면, 상기 인간 줄기세포는 인간 치수 줄기세포일 수 있다.According to an embodiment of the present invention, the human stem cells may be human pulp stem cells.

본 발명의 일실시예에 따르면, 상기 인간 태반추출물은 인간 줄기세포의 IL-8분비를 증가시킬 수 있다.According to an embodiment of the present invention, the human placenta extract may increase IL-8 secretion of human stem cells.

본 발명의 실시예에 따르면, 인간 태반 추출물로 배양한 후 허혈 환경에서 추가 배양된 인간 줄기세포는 뇌허혈로 손상된 인간 성상교세포 생존율을 증가 시킬 수 있다.According to an embodiment of the present invention, human stem cells cultured with a human placenta extract and then further cultured in an ischemic environment can increase the survival rate of human astrocytes damaged by cerebral ischemia.

본 발명의 효과는 상기한 효과로 한정되는 것은 아니며, 본 발명의 상세한 설명 또는 특허청구범위에 기재된 발명의 구성으로부터 추론 가능한 모든 효과를 포함하는 것으로 이해되어야 한다.The effects of the present invention are not limited to the above effects, and should be understood to include all effects that can be inferred from the configuration of the invention described in the detailed description or claims of the present invention.

도 1은 a) 인간 줄기세포를 인간 태반추출물을 포함하는 배지에서 배양한 후 세포 생존율; b) 인간 줄기세포의 허혈 손상 시간에 따른 세포 생존율; c) 인간줄기세포를 인간 태반추출물을 포함하는 배지에서 배양한 후 허혈 손상 받은 세포 생존율을 나타내고 있다.
도 2는 a) 인간 줄기세포를 인간 태반추출물을 포함하는 배지에서 배양하여 24시간 후 인간 줄기세포내 IL-8의 분비량; b) 인간 태반추출물 처리 시간에 따라 인간줄기세포에서 IL-8의 분비량; c) 및 d) 인간 태반추출물 농도에 따라 배양한 인간줄기세포의 IL-8 발현량을 나타내고 있다.
도 3은 본 발명의 일실시예에 따른 방법으로 처리된, 손상된 인간 성상교세포의 생존율이 증가한 것을 보여주고 있다.
도 4는 인간 태반추출물로 배양한 인간 줄기세포로 처리된 인간 성상교세포가 인간 태반추출물만 처리된 인간 성상교세포 생존율 또는 인간 줄기세포만 처리된 인간 성상교세포 생존율 보다 통계적으로 유의하게 높음을 보여주고 있다. 1 is a) cell viability after culturing human stem cells in a medium containing human placenta extract; b) cell viability according to the ischemic injury time of human stem cells; c) It shows the survival rate of cells subjected to ischemia damage after culturing human stem cells in a medium containing human placenta extract.
2 is a) the amount of secretion of IL-8 in human stem cells 24 hours after culturing human stem cells in a medium containing human placenta extract; b) the amount of IL-8 secreted by human stem cells according to the treatment time of human placenta extract; c) and d) The expression levels of IL-8 in human stem cells cultured according to the concentration of human placenta extract are shown.
3 shows that the survival rate of damaged human astrocytes treated by the method according to an embodiment of the present invention is increased.
Figure 4 shows that the human astrocytes treated with human stem cells cultured with human placenta extract were statistically significantly higher than the survival rate of human astrocytes treated with only human placenta extract or the survival rate of human astrocytes treated with only human stem cells. .

이하에서는 첨부한 도면을 참조하여 본 발명을 설명하기로 한다. 그러나 본 발명은 여러 가지 상이한 형태로 구현될 수 있으며, 따라서 여기에서 설명하는 실시예로 한정되는 것은 아니다. 그리고 도면에서 본 발명을 명확하게 설명하기 위해서 설명과 관계없는 부분은 생략하였으며, 명세서 전체를 통하여 유사한 부분에 대해서는 유사한 도면 부호를 붙였다.Hereinafter, the present invention will be described with reference to the accompanying drawings. However, the present invention may be implemented in a number of different forms, and therefore is not limited to the embodiments described herein. In the drawings, parts irrelevant to the description are omitted in order to clearly describe the present invention, and similar reference numerals are attached to similar parts throughout the specification.

명세서 전체에서, 어떤 부분이 다른 부분과 "연결(접속, 접촉, 결합)"되어 있다고 할 때, 이는 "직접적으로 연결"되어 있는 경우뿐 아니라, 그 중간에 다른 부재를 사이에 두고 "간접적으로 연결"되어 있는 경우도 포함한다. 또한 어떤 부분이 어떤 구성요소를 "포함"한다고 할 때, 이는 특별히 반대되는 기재가 없는 한 다른 구성요소를 제외하는 것이 아니라 다른 구성요소를 더 구비할 수 있다는 것을 의미한다.Throughout the specification, when a part is said to be "connected (connected, contacted, coupled)" with another part, it is not only "directly connected", but also "indirectly connected" with another member in the middle. "Including the case. In addition, when a part "includes" a certain component, it means that other components may be further provided, not excluding other components unless otherwise specified.

본 명세서에서 사용한 용어는 단지 특정한 실시예를 설명하기 위해 사용된 것으로, 본 발명을 한정하려는 의도가 아니다. 단수의 표현은 문맥상 명백하게 다르게 뜻하지 않는 한, 복수의 표현을 포함한다. 본 명세서에서, "포함하다" 또는 "가지다" 등의 용어는 명세서상에 기재된 특징, 숫자, 단계, 동작, 구성요소, 부품 또는 이들을 조합한 것이 존재함을 지정하려는 것이지, 하나 또는 그 이상의 다른 특징들이나 숫자, 단계, 동작, 구성요소, 부품 또는 이들을 조합한 것들의 존재 또는 부가 가능성을 미리 배제하지 않는 것으로 이해되어야 한다.The terms used in the present specification are only used to describe specific embodiments, and are not intended to limit the present invention. Singular expressions include plural expressions unless the context clearly indicates otherwise. In the present specification, terms such as "comprise" or "have" are intended to designate the presence of features, numbers, steps, actions, components, parts, or combinations thereof described in the specification, but one or more other features. It is to be understood that the presence or addition of elements or numbers, steps, actions, components, parts, or combinations thereof does not preclude in advance.

이하 첨부된 도면을 참고하여 본 발명의 실시예를 상세히 설명하기로 한다.Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings.

본 발명의 일측면에 따른 손상된 성상교세포 치료방법은 a) 인간 줄기세포를 인간 태반 추출물을 포함하는 배지에서 배양하는 단계; b) 상기 배양된 인간 줄기세포를 우태아혈청이 결핍된 배지에서 허혈 처리하는 단계; c) 손상된 성상교세포를 상기 허혈 처리된 인간 줄기세포로 처리하는 단계;를 포함할 수 있다. A method for treating damaged astrocytes according to an aspect of the present invention includes: a) culturing human stem cells in a medium containing human placenta extract; b) treating the cultured human stem cells with ischemia in a medium deficient in fetal calf serum; c) treating the damaged astrocytes with the ischemic-treated human stem cells; may include.

본 발명의 일실시예에 따르면, 상기 인간 줄기세포를 배양하는 단계 이전에, 인간 줄기세포를 준비하는 단계를 더 포함할 수 있다. 상기 인간 줄기세포를 준비하는 단계는 본 발명에 따른 손상된 성상교세포 치료방법을 위해 사용될 인간 줄기세포를 준비하는 단계로서, 인간 유래 줄기세포를 인간 조직으로부터 분리하고 배양하는 단계를 포함할 수 있다. 즉, 인간 조직을 배양하여 필터링을 통해 인간 줄기세포를 분리해내고, 이렇게 분리해낸 줄기세포를 다시 배양하는 단계를 포함할 수 있다. 본 발명의 일실시예에 따르면, 상기 인간 조직은 인간 치주 조직일 수 있으며, 상기 인간 줄기세포는 인간 치수 줄기세포일 수 있다. 본 발명의 다른 일실시예에 따르면, 상기 인간 줄기세포는 계대배양 passage 3 내지 5인 상태로 배양시킨 후 사용할 수 있으며, 바람직하게는 계대배양 passage 3내지 4인 상태로 배양시킨 후 사용할 수 있다. According to an embodiment of the present invention, prior to the step of culturing the human stem cells, the step of preparing human stem cells may be further included. Preparing the human stem cells is a step of preparing human stem cells to be used for the method for treating damaged astrocytes according to the present invention, and may include separating and culturing human stem cells from human tissues. That is, the step of culturing human tissue to isolate human stem cells through filtering, and culturing the separated stem cells again may be included. According to an embodiment of the present invention, the human tissue may be a human periodontal tissue, and the human stem cell may be a human pulp stem cell. According to another embodiment of the present invention, the human stem cells can be used after culturing in a state of passage 3 to 5, and preferably, after culturing in a state of passage 3 to 4 passages.

상기 성상교세포(astrocyte)는 뻗어 있는 많은 돌기 때문에 별처럼 보이는 신경 아교 세포로 뇌와 척수에 존재한다. 혈뇌장벽(혈액-뇌 장벽)의 안쪽 세포들을 생화학적으로 도와주는 역할을 하며 혈관벽에 돌기가 붙어있어 신경세포에 영양분을 공급하는 역할을 할 수 있다. 또한 신경세포의 이온농도 조절, 신경세포의 지지, 노페물의 제거, 식세포작용등의 다양한 역할을 수행할 수 있으며 신경조직이 손상되면 신경교종이라는 돌기로 증식하여 그 부분을 채우기도 하며 손상된 조직을 복구하거나 파괴할 수 있다. 구체적으로, 상기 성상교세포(astrocytes)는 뇌졸중 후에 흉터 형성 (scar formation)과 회복 기전인 새로운 시냅스 형성과 새로운 혈관을 생성하는데 역할을 하는 것으로 알려졌다. 본 발명의 일실시예에 따르면 상기 성상교세포는 뇌에서 허혈로 인해 손상받을 수 있으며 이는 뇌졸중을 일으키는 하나의 원인일 수 있다. 따라서, 성상교세포의 보호와 생존률이 뇌질환 치료에 있어서 중요할 수 있다. The astrocytes are glial cells that look like stars because of the many protruding protrusions that are present in the brain and spinal cord. The blood-brain barrier (blood-brain barrier) plays a role in biochemically helping the inner cells of the blood-brain barrier, and the protrusions are attached to the blood vessel wall to provide nutrients to nerve cells. In addition, it can play various roles such as regulating the ion concentration of nerve cells, supporting nerve cells, removing waste products, and phagocytosis. When nerve tissue is damaged, it proliferates into a protrusion called glioma and fills the area to repair damaged tissue. Or destroy. Specifically, the astrocytes are known to play a role in the formation of new synapses and new blood vessels, a mechanism of scar formation and recovery after stroke. According to an embodiment of the present invention, the astrocytes may be damaged due to ischemia in the brain, which may be one cause of stroke. Therefore, the protection and survival rate of astrocytes may be important in the treatment of brain diseases.

상기 인간 태반 추출물은 인간에서 유래한 태반으로부터 추출될 수 있다. 상기 태반(Placenta)은 모체와 태아 사이에 영양물질을 운반하거나 임신을 유지시키기 위한 중요한 내분비물질을 공급하는 중요한 기관이다. 또한 태아의 탄생 이후에는 줄기세포를 얻을 수 있는 잠재적 원천 뿐만 아니라 상처 치료의 목적으로 각광 받고 있다. 태반은 줄기세포의 마커 유전자인 c-Kit, Thy-1, Oct-4, Sox-2, hTERT, SSEA-1, SSEA-3, SSEA-4, TRA1-60, 그리고 TRA1-81 이 발현되는 세포군을 포함하고 있으며 배아줄기세포의 일부 특성을 가진다고 알려져 있다. 그리고 인간 태반 추출물 처리가 말초 혈액 대식세포(peripheral blood macrophage)에서 조직 재생의 중요한 매개자인 NO(nitric oxide)의 합성을 유도한다고 알려져 있다. 본 발명의 일실시예에 따르면, 상기 인간 태반추출물은 항산화와 항염증 활성 효과를 가질 수 있고, 또한 세포내의 인터루킨-8 (Interleukin-8)을 촉진할 수 있다. 상기 IL-8은 염증 반응을 유도하고, STAT3의 활성화를 통해 생존 신호 전달 경로를 촉진 할 수 있다고 알려져 있다. 본 발명의 일실시예에 따르면, 상기 인간 줄기세포를 인간 태반 추출물을 포함하는 배지에서 배양하는 단계는 상기 인간 줄기세포의 IL-8의 분비를 증가시킬수 있다.The human placenta extract may be extracted from placenta derived from humans. The placenta (Placenta) is an important organ that transports nutrients between the mother and the fetus or supplies important endocrine substances for maintaining pregnancy. In addition, after the birth of the fetus, it has been spotlighted not only as a potential source of stem cells, but also for wound healing purposes. The placenta is a group of cells that express stem cell marker genes c-Kit, Thy-1, Oct-4, Sox-2, hTERT, SSEA-1, SSEA-3, SSEA-4, TRA1-60, and TRA1-81. It is known to contain some characteristics of embryonic stem cells. In addition, it is known that treatment with human placenta extract induces the synthesis of NO (nitric oxide), an important mediator of tissue regeneration, in peripheral blood macrophages. According to one embodiment of the present invention, the human placenta extract may have antioxidant and anti-inflammatory activity effects, and may also promote intracellular interleukin-8. It is known that IL-8 can induce an inflammatory response and promote a survival signaling pathway through activation of STAT3. According to an embodiment of the present invention, the step of culturing the human stem cells in a medium containing human placenta extract may increase the secretion of IL-8 by the human stem cells.

본 발명의 다른 일실시예에 따르면, 상기 인간 태반추출물은 바람직하게는 양막과 탯줄을 제거한 태반을 분쇄하고 이 분쇄물에 적합한 추출용매를 처리하여 얻을 수 있다. 본 발명에서 사용되는 인간 태반추출물을 수득하기 위하여 사용되는 추출용매는 (a) 물, (b) 탄소수 1-4의 무수 또는 함수 저급 알코올 (메탄올, 에탄올, 프로판올, 부탄올, 노말-프로판올, 이소-프로판올 및 노말-부탄올 등), (c) 상기 저급 알코올과 물과의 혼합용매, (d) 아세톤, (e) 에틸 아세테이트, (f) 클로로포름, (g) 1,3-부틸렌글리콜, (h) 헥산 및 (i) 디에틸에테르를 포함할 수 있다. 추출용매를 사용하여 인간 태반추출물을 얻는 경우, 10-1000 w(태반의 무게)/v(추출용매의 부피)%의 비율로 하여 추출용매를 사용하는 것이 바람직하며, 보다 바람직하게는 80-120 (w/v)%로 추출용매를 사용할 수 있다. According to another embodiment of the present invention, the human placenta extract may preferably be obtained by pulverizing the placenta from which the amnion and umbilical cord are removed, and treating the pulverized product with an appropriate extraction solvent. The extraction solvent used to obtain the human placenta extract used in the present invention is (a) water, (b) anhydrous or hydrated lower alcohol having 1-4 carbon atoms (methanol, ethanol, propanol, butanol, normal-propanol, iso- Propanol and normal-butanol), (c) a mixed solvent of the lower alcohol and water, (d) acetone, (e) ethyl acetate, (f) chloroform, (g) 1,3-butylene glycol, (h ) Hexane and (i) diethyl ether. When obtaining human placenta extract using an extraction solvent, it is preferable to use an extraction solvent in a ratio of 10-1000 w (placenta weight)/v (volume of extraction solvent)%, and more preferably 80-120 (w/v)% can be used as an extraction solvent.

상기 인간 줄기세포를 우태아혈청(Fetal Bovine Serum, FBS)이 결핍된 배지에서 허혈 처리하는 단계는 본 발명에 따른 손상된 성상교세포 치료 효능을 높이고 동시에 인간 줄기세포의 생존율을 높이기 위해 처리하는 단계를 의미한다. 본 발명에서 상기 허혈(ischemia)이란, 산소 및 포도당이 결핍된 환경을 의미하며, 따라서 상기 허혈 처리는 인간 줄기세포를 산소 및 포도당 결핍 환경에서 배양하는 것을 의미할 수 있다. 상기 허혈 처리된 인간 줄기세포는 산소와 포도당의 결핍 자극으로 인해서 허혈 환경에서 생존할 수 있는 생존능을 확보할 수 있다. 하지만, 본 발명에 따른 손상된 성상교세포를 치료하기 위해서는, 우태아혈청을 포함하는 줄기세포 배지를 사용할 수 없다. 이는 우태아혈청이 포함된 배지에서 배양된 인간 줄기세포내에는 혈청이 여전히 잔류하게 되어, 이후 단계에서 손상된 성상교세포에 인간 줄기세포를 처리할때 이종항원으로 작용하게 되어 오히려 성상교세포 치료 효과를 감소시킬 수 있기 때문이다. 따라서, 우태아혈청이 결핍된 배지에서 인간 줄기세포를 배양하고 허혈 처리함으로써 본 발명의 목적인, 손상된 성상교세포를 치료할 수 있다. 도1을 참조해보면, 인간 태반추출물을 포함하는 배지에서 배양한 인간 줄기세포의 생존율은 변화가 없지만, 인간태반추출물을 포함한 배지에서 배양 후 허혈 처리된 인간 줄기세포의 생존율은 높아졌음을 알 수 있다. The step of treating the human stem cells with ischemia in a medium deficient in fetal bovine serum (FBS) refers to a step of treating damaged astrocytes according to the present invention to increase the treatment efficacy and at the same time increase the survival rate of human stem cells do. In the present invention, the ischemia refers to an environment deficient in oxygen and glucose, and therefore, the ischemia treatment may mean culturing human stem cells in an oxygen and glucose deficient environment. The ischemic-treated human stem cells can secure viability to survive in an ischemic environment due to stimulation of deficiency of oxygen and glucose. However, in order to treat damaged astrocytes according to the present invention, a stem cell medium containing fetal calf serum cannot be used. This is because serum remains in human stem cells cultured in a medium containing fetal bovine serum, and acts as a xenoantigen when treating human stem cells to damaged astrocytes at a later stage, reducing the therapeutic effect of astrocytes. Because you can. Therefore, by culturing human stem cells in a medium deficient in fetal calf serum and treating with ischemia, it is possible to treat damaged astrocytes, which is the object of the present invention. Referring to FIG. 1, it can be seen that the survival rate of human stem cells cultured in a medium containing human placenta extract is not changed, but the survival rate of human stem cells treated with ischemia after culture in a medium containing human placenta extract is increased. .

본 발명의 일실시예에 따르면, 상기 배양된 인간 줄기세포를 허혈 처리하는 단계 이후에, 상기 허혈 처리된 인간 줄기세포를 무혈청 배지에서 배양하는 단계를 더 포함할 수 있다. 상기 무혈청 배지에서 배양하는 단계는 상기 허혈 처리된 인간 줄기세포가 가지는, 본 발명에 따른 손상된 성상교세포 치료효능 강화 및 인간 줄기세포 생존율을 더욱 증대시키는 단계이다. 한편, 당업계에서 인간 유래 세포를 포함해서 동물세포를 배양할 때 혈청이 포함된 배지를 사용할 수 있는데 이는 혈청이 호르몬, 생장인자, 비타민을 공급해 줌으로써 동물세포의 생장과 활성을 촉진시킬 수 있기 때문이다. 그러나 혈청을 멸균하기 위하여 가열법을 사용하지 못하고 여과 (filtration)해야 하기 때문에 마이코플라즈마 (mycoplasma) 또는 바이러스 등에 의한 오염의 가능성을 증가시킬 수 있고, 또한 혈청을 함유한 배지는 거품이 잘 생길 수 있다. 그러나 혈청 사용의 가장 큰 문제점은 배치 (batch) 마다 혈청의 조성이 달라지기 때문에 혈청을 사용한 실험은 재현성을 얻기 어렵다는 점이다. 동일한 세포를 같은 성분의 배지에서 배양한다 하더라도 그 배양의 결과가 항상 다르게 나타날 수 있다. 따라서, 본 발명의 일실시예에서는 상기 허혈 처리된 인간 줄기세포를 혈청이 없는 무혈청 배지에서 배양시킬 수 있다.According to an embodiment of the present invention, after the ischemic treatment of the cultured human stem cells, it may further include culturing the ischemia-treated human stem cells in a serum-free medium. The step of culturing in the serum-free medium is a step of enhancing the therapeutic efficacy of damaged astrocytes according to the present invention and further increasing the survival rate of human stem cells of the ischemic-treated human stem cells. Meanwhile, in the art, when culturing animal cells including human-derived cells, a medium containing serum can be used, because serum can promote the growth and activity of animal cells by supplying hormones, growth factors, and vitamins. to be. However, since the heating method cannot be used to sterilize the serum and must be filtered, the possibility of contamination by mycoplasma or virus may be increased, and the medium containing serum may well foam. . However, the biggest problem with using serum is that it is difficult to obtain reproducibility in experiments using serum because the composition of serum varies from batch to batch. Even if the same cells are cultured in a medium of the same composition, the results of the culture may always be different. Accordingly, in an embodiment of the present invention, the ischemic-treated human stem cells may be cultured in a serum-free medium without serum.

본 발명의 다른 일실시예에 따르면, 상기 무혈청 배지에서 배양된 인간 줄기세포를 배양액과 분리하는 단계를 추가로 더 포함할 수 있다. 상기 분리하는 단계는 인간 줄기세포를 일정시간 배양시킨 후 수득할 수 있는 배양액과 인간 줄기세포를 분리하는 단계를 의미한다. 본 발명의 일실시예에 따르면, 상기 분리하는 단계는 분리된 배양액을 다시 원심분리하여 상층액만을 분리하는 단계를 더 포함할 수 있다. According to another embodiment of the present invention, the step of separating the human stem cells cultured in the serum-free medium from the culture medium may be further included. The separating step refers to a step of separating the human stem cells from the culture medium obtained after culturing the human stem cells for a certain period of time. According to an embodiment of the present invention, the separating step may further include separating only the supernatant by centrifuging the separated culture medium again.

손상된 성상교세포를 상기 허혈 처리된 인간 줄기세포로 처리하는 단계는 본 발명에 따른 손상된 성상교세포를 치료하기 위한 것으로서 상기 허혈 처리된 인간 줄기세포 및 손상된 성상교세포를 하나의 플레이트에서 함께 배양하는 것을 의미할 수 있다. 본 발명의 다른 일실시예에 따르면, 인간 중간엽 줄기세포가 더 추가되어 함께 처리될 수 있다. 상기 인간 중간엽 줄기세포는 다분화능을 가진 기질세포(가슴샘이나 골수 등의 기관에서 그 기능을 담당하는 세포나 조직(유조직)에 둘러싸고 지탱하는 세포)로 조골세포(뼈 세포), 연골세포, 근육세포, 지방세포(골수 지방 조직을 만드는 지방세포)를 포함한 다양한 세포로 분화할 수 있다. 그리고, 상기 인간 중간엽 줄기세포는 연골, 골조직, 인대, 골수기질 등 다양한 결합조직으로 분화할 수 있는 능력을 가질 수 있으며 이러한 구조적 지지 기능 이외에도 면역조절, 억제 기능을 가지고 있어서 염증 반응을 저해하고 조직 재생에 기여할 수 있다. 본 발명의 일실시예에 따르면, 상기 인간 중간엽 줄기세포는 인간 탯줄 유래일 수 있다.The step of treating damaged astrocytes with the ischemic-treated human stem cells is to treat the damaged astrocytes according to the present invention, and means culturing the ischemic-treated human stem cells and the damaged astrocytes together in one plate. I can. According to another embodiment of the present invention, human mesenchymal stem cells may be further added and processed together. The human mesenchymal stem cells are stromal cells with multipotency (cells surrounding and supporting cells or tissues (papillary tissue) responsible for their function in organs such as the breast gland or bone marrow), and osteoblasts (bone cells), cartilage cells, and muscles It can differentiate into various cells, including cells and adipocytes (adipocytes that make bone marrow adipose tissue). In addition, the human mesenchymal stem cells may have the ability to differentiate into various connective tissues such as cartilage, bone tissue, ligaments, and bone marrow matrix. In addition to these structural support functions, the human mesenchymal stem cells inhibit inflammatory reactions and inhibit tissue Can contribute to regeneration. According to an embodiment of the present invention, the human mesenchymal stem cells may be derived from human umbilical cord.

즉, 상기 공배양하는 단계를 통해 손상된 성상교세포가 죽지 않고 생존률을 증대시킬 수 있으며 이는 함께 배양된 상기 인간 줄기세포의 성상교세포 치료효능에 기인한 것일 수 있다.That is, through the co-culture step, the damaged astrocytes do not die, and the survival rate can be increased, and this may be due to the therapeutic efficacy of the human stem cells cultured with the astrocytes.

이하, 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있도록 본 발명의 실시예에 대하여 상세히 설명한다. 그러나 본 발명은 여러 가지 상이한 형태로 구현될 수 있으며 여기에서 설명하는 실시예에 한정되지 않는다.Hereinafter, embodiments of the present invention will be described in detail so that those skilled in the art can easily implement the present invention. However, the present invention may be implemented in various different forms and is not limited to the embodiments described herein.

실시예1. 인간 성상교세포 배양Example 1. Human astrocyte culture

인간 성상교세포 (primary human astrocytes)는 Gibco BRL (Grand Island, NY, USA)에서 구입하고, human astrocyte medium (Gibco)는 Dulbecco's Modified Eagle Medium (DMEM; GIBCO, Rockville, MD, USA), N-2 supplement (Gibco), 10% FBS를 혼합한 배양액을 사용하여 37ºC, 5% CO2 배양기에 넣어 배양하였다. 인간 성상교세포를 배양하기 전에 배양 접시는 Gibco사의 GeltrexTM를 사용하여 1시간 동안 배양 접시를 코팅한 후 세포를 배양하였다. 3일마다 배양액을 바꿔주고, 계대배양 7, 8 및 9 passages의 세포를 실험에 사용하였다. 각 passages 마다 성상 교세포의 바이오 마커인 glial fibrillary acidic protein (GFAP)로 염색하여 확인하였다. Human astrocytes (primary human astrocytes) are purchased from Gibco BRL (Grand Island, NY, USA), and human astrocyte medium (Gibco) is Dulbecco's Modified Eagle Medium (DMEM; GIBCO, Rockville, MD, USA), N-2 supplement (Gibco), using a culture medium mixed with 10% FBS, was incubated in a 37ºC, 5% CO 2 incubator. Before culturing human astrocytes, the culture dish was coated with a culture dish for 1 hour using Geltrex TM of Gibco, and the cells were cultured. The culture solution was changed every 3 days, and cells of passages 7, 8 and 9 passages were used in the experiment. Each passage was confirmed by staining with glial fibrillary acidic protein (GFAP), a biomarker of astrocytes.

실시예2. 인간 탯줄유래 중간엽 줄기세포 배양Example 2. Human umbilical cord-derived mesenchymal stem cell culture

계대배양 passage 4인 상태의 인간탯줄(umbilical cord blood) 유래 중간엽 줄기세포를 CFBIO(한국)으로부터 수득하였다. 수득한 인간 탯줄 유래 중간엽 줄기세포를 5일동안 confluence가 70%가 될 때까지 10 % FBS, 1% 페니실린(penicillin) 및 스트렙토마이신(streptomycin)을 포함하는 인간 탯줄 유래 중간엽 줄기세포 배지 (Human Umbilical Cord derived MSC Growth Medium, CB-UCMSC-GM; 세포바이오)에서 배양하였다.Human umbilical cord blood-derived mesenchymal stem cells in passage 4 passage were obtained from CFBIO (Korea). The obtained human umbilical cord-derived mesenchymal stem cells were cultured in a human umbilical cord-derived mesenchymal stem cell medium containing 10% FBS, 1% penicillin and streptomycin until the confluence reached 70% for 5 days (Human Umbilical Cord derived MSC Growth Medium, CB-UCMSC-GM; Cell Bio).

실시예3. 인간 치수 줄기세포 분리와 배양Example 3. Isolation and culture of human pulp stem cells

환자로부터 수득한 인간 치주 조직에서 인간 치수 줄기세포를 분리하기 위해 3 mg/mL 콜라겐 분해효소 type I(collagenase type I) 과 4 mg/mL 디파제(dispase)용액에 넣어 1시간 동안 배양하여 분리하고, 이후에 70-mm cell strainers (Falcon; BD Labware, Franklin Lakes, NJ, USA)를 사용하여 필터링하였다. 필터링 후 얻은 세포는 DMEM 배양액에 10% FBS(fetal bovine serum; Sigma)과 항생제인, 100 U/mL 페니실린(penicillin), 100 μg/mL 스트렙토마이신(streptomycin), 및 0.25 μg/mL 암포테리신 B(amphotericin B; GIBCO)를 넣어 37°C, 5% CO2 배양기에 넣어 배양하였고, 세포는 계대배양 4번 passage에서 실험하였다. In order to isolate human pulp stem cells from human periodontal tissue obtained from a patient, 3 mg/mL collagenase type I (collagenase type I) and 4 mg/mL dipase were added and cultured for 1 hour to isolate. , And then filtered using 70-mm cell strainers (Falcon; BD Labware, Franklin Lakes, NJ, USA). The cells obtained after filtering were in DMEM culture medium with 10% FBS (fetal bovine serum; Sigma) and antibiotics, 100 U/mL penicillin, 100 μg/mL streptomycin, and 0.25 μg/mL amphotericin B. (amphotericin B; GIBCO) was added and cultured in an incubator at 37°C and 5% CO 2 , and the cells were tested in passage 4 of the subculture.

실시예4. 인간 태반 추출물을 포함하는 배지에서 인간 치수 줄기세포 배양Example 4. Human pulp stem cell culture in medium containing human placenta extract

인간 태반 추출물은 Laennec Inj. (인간 태반추출물; 1㎖/㎖ 2㎖ X 10, 50 Amp) 를 사용하였다. 실시예3에서 기재된 구성성분과 동일한 인간 치수 줄기세포 배양액에 인간 태반 줄기세포 추출물 투입용량 0, 1, 10, 100, 10000 μg/㎖ 을 넣어, 실시예3에서 배양된 인간 치수 줄기세포를 0, 3, 6, 24시간동안 37°C, 5% CO2 배양기에서 배양하였다.Human placenta extract was obtained from Laennec Inj. (Human placenta extract; 1 ml/ml 2 ml X 10, 50 Amp) was used. In the same human pulp stem cell culture medium as the constituents described in Example 3, human placental stem cell extract input volumes of 0, 1, 10, 100, and 10000 μg/ml were added, and the human pulp stem cells cultured in Example 3 were 0, Incubated in an incubator at 37°C and 5% CO 2 for 3, 6, and 24 hours.

실시예5. 인간 치수 줄기세포의 인공적 허혈(Example 5. Artificial ischemia of human pulp stem cells ( in vitroin vitro ischemia) 및 포도당 결핍(glucose deprivation) 처리 ischemia) and glucose deprivation treatment

실시예4에서 배양된 인간 치수 줄기세포를 5% CO2, 95% 공기가 공급되는 37°C 배양기에서 24시간동안 추가로 배양한 후, 포도당과 우태아혈청(FBS)가 결핍된 DMEM 배지에서 94% N2, 5% CO2, 1% 공기가 공급되는 인공적 허혈 환경의 배양기에서 1, 2, 3 및 24 시간 배양하였다. The human pulp stem cells cultured in Example 4 were further cultured for 24 hours in a 37°C incubator supplied with 5% CO 2 and 95% air, and then in DMEM medium lacking glucose and fetal bovine serum (FBS). Incubated for 1, 2, 3 and 24 hours in an incubator in an artificial ischemic environment supplied with 94% N 2 , 5% CO 2 , and 1% air.

실시예6. 인간 치수 줄기세포 및 배양액 분리Example 6. Human pulp stem cells and culture medium separation

실시예5에서 배양된 인간 치수 줄기세포를 4 × 105 cells씩 무혈청(serum-free) DMEM배지에 배양하여 48시간 후에 인간 치수줄기세포를 수득하였다. 그리고 동시에 배양액만을 따로 분리한 뒤, 원심분리기에서 5000rpm 5분동안 원심분리를 하여 상층액에서 배양액 성분을 얻었다. The human pulp stem cells cultured in Example 5 were cultured in serum-free DMEM medium by 4 × 10 5 cells to obtain human pulp stem cells after 48 hours. And at the same time, after separately separating only the culture medium, centrifugation was performed at 5000 rpm for 5 minutes in a centrifuge to obtain a culture medium component from the supernatant.

실시예7. 인간 성상교세포를 인간 치수 줄기세포로 처리Example 7. Treatment of human astrocytes into human pulp stem cells

실시예1에서 수득한 인간 성상교세포를 24 well plates를 이용하여 4 × 104/well에서 배양하였다. 그리고 실시예 5의 인간 치수 줄기세포 또는 실시예6에서 분리된 인간 치수 줄기세포를 인간 성상교세포와 함께 각각 104/well을 함께 넣어준 뒤 (또는 실시예6에서 분리된 인간 치주 줄기세포, 실시예2에서 배양된 인간 탯줄유래 중간엽 줄기세포 및 인간 성상교세포 를 각각 104/well을 함께 넣어준 뒤), trans-well cell inserts (0.4 um pore size, transparent PET membrane, BD Falcon, Franklin Lakes, NJ, USA)에서 24시간동안 37°C, 5% CO2 배양기에서 공배양하였다. The human astrocytes obtained in Example 1 were cultured at 4 × 10 4 /well using 24 well plates. And after putting the human pulp stem cells of Example 5 or the human pulp stem cells isolated in Example 6 together with human astrocytes and 10 4 /well, respectively (or the human periodontal stem cells isolated in Example 6, Human umbilical cord-derived mesenchymal stem cells and human astrocytes cultured in Example 2 were put together at 10 4 /well respectively), trans-well cell inserts (0.4 um pore size, transparent PET membrane, BD Falcon, Franklin Lakes, NJ, USA) for 24 hours at 37 °C, 5% CO 2 was co-cultured in an incubator.

시험예1. 인간 성상교세포 생존력(MTT Assay)Test Example 1. Human Astrocyte Viability (MTT Assay)

본 발명에 방법에 따른 치료방법으로 처리된 인간 성상교세포의 세포 생존력을 검증하기 위해, 실시예 7에서 공배양된 인간 성상교세포를 96 well plates에 각각 배양 후 MTT (3-[4,5-dimethylthialzol-2-yl]-2,5-diphenyltetrazolium bromide) assay (Sigma, St Louis, MO, USA)를 이용하여 세포 생존율을 측정하여 분석하였다. 그 결과는 도3e와 도4에 나타내었다. 세포 사망률 (Dead cell apotosis)을 측정하기 위해 Annexin V Alexa Fluor™488 & Propidium Iodide (PI) (V13241, ThermoFisher Scientific, USA)를 사용하여 제조사 표준방법에 의해 진행 한 후에 유세포 분석기(flow cytometer; Beckman Coulter Quanta SC 5.2)로 분석하였다. 그 결과는 도3a,b에 나타내었다.In order to verify the cell viability of human astrocytes treated with the treatment method according to the present invention, the human astrocytes co-cultured in Example 7 were cultured in 96 well plates, respectively, and then MTT (3-[4,5-dimethylthialzol). Cell viability was measured and analyzed using -2-yl]-2,5-diphenyltetrazolium bromide) assay (Sigma, St Louis, MO, USA). The results are shown in FIGS. 3E and 4. To measure dead cell apotosis, Annexin V Alexa Fluor™ 488 & Propidium Iodide (PI) (V13241, ThermoFisher Scientific, USA) was used to follow the manufacturer's standard method, followed by flow cytometer (Beckman Coulter). Quanta SC 5.2). The results are shown in Figs. 3a and b.

시험예2. IL-8 발현 확인 (RT-PCR 및 RT-qPCR)Test Example 2. Confirmation of IL-8 expression (RT-PCR and RT-qPCR)

인간 태반추출물을 포함한 배지에서 배양된 인간 치수 줄기세포의 IL-8발현여부를 확인하기 위해서 RT-PCR을 수행하였다. Total RNA는 TRIzol®Reagent (Invitrogen)를 사용해서 얻었고, cDNA는 AccuPower RT pre-mix (Bioneer, Daejeon, Korea)를 사용해 얻었다. PCR은 GeneAmp PCR system 2400 thermal cycler (PerkinElmer, Wellesley, MA, USA)을 사용하여 시행하였다. 사용된 유전자 및 관련 PCR 프라이머 서열은 [표1]에 나타내었다. RT-PCR was performed to confirm the expression of IL-8 in human pulp stem cells cultured in a medium containing human placenta extract. Total RNA was obtained using TRIzol®Reagent (Invitrogen), and cDNA was obtained using AccuPower RT pre-mix (Bioneer, Daejeon, Korea). PCR was performed using the GeneAmp PCR system 2400 thermal cycler (PerkinElmer, Wellesley, MA, USA). The used genes and related PCR primer sequences are shown in [Table 1].

유전자gene 정방향 프라이머(5'->3')Forward primer (5'->3') 역방향 프라이머(5'->3')Reverse primer (5'->3') IL-8IL-8 GTGAAGGTGCAGTTTTGCCAGTGAAGGTGCAGTTTTGCCA TCTCCACAACCCTCTGCACTCTCCACAACCCTCTGCAC GAPDHGAPDH GTGGTGGACCTGACCTGCGTGGTGGACCTGACCTGC TGAGCTTGACAAAGTGGTCGTGAGCTTGACAAAGTGGTCG

PCR products 는 1.5% agarose gels 에 ethidium bromide 염색된 것을 확인하였고, 이후 SYBR Premix Ex Taq (Takara Bio Inc., Otsu, Shiga, Japan) 및 ABI Prism 7500 Sequence Detection System (Applied biosystems, Foster City, CA, USA) 을 이용하여 RT-qPCR(Real-time quantitative PCR) 을 실시하였다. 실험조건은 다음과 같다: Denaturation: 1분, 94 °C; Amplification: 각 40 번의 사이클, 94 °C 에서 15초, 60 °C 에서 15초, 72 °C에서 33초). IL-8 copy numbers 를 정규화시키기 위해, Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)를 코딩하는 유전자를 IL-8 cDNA와 함께 증폭시켰다. Real-time RT-qPCR 은 각 RNA샘플마다 3회 반복실시되었고 결과는 도2d에 나타내었다.PCR products were confirmed to be stained with ethidium bromide on 1.5% agarose gels, then SYBR Premix Ex Taq (Takara Bio Inc., Otsu, Shiga, Japan) and ABI Prism 7500 Sequence Detection System (Applied biosystems, Foster City, CA, USA) ) Was used to perform RT-qPCR (Real-time quantitative PCR). The experimental conditions were as follows: Denaturation: 1 min, 94 °C; Amplification: 40 cycles each, 15 seconds at 94 °C, 15 seconds at 60 °C, 33 seconds at 72 °C). To normalize IL-8 copy numbers, the gene encoding Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was amplified together with IL-8 cDNA. Real-time RT-qPCR was repeated three times for each RNA sample, and the results are shown in FIG. 2D.

시험예3. IL-8 발현량 확인(Enzyme-linked immunosorbent assay; ELISA)Test Example 3. Confirmation of IL-8 expression level (Enzyme-linked immunosorbent assay; ELISA)

인간 태반추출물을 포함한 배지에서 배양된 인간 치수 줄기세포의 IL-8발현량을 측정하기 위해서, 실시예4에서 얻은 배양액을 수집하여 ELISA를 기반으로 분석하였다. 즉, IL-8 발현량은 ELISA kit(R&D, Minneapolis, MN, USA)을 이용하여 제조사의 매뉴얼에 따라서 분석되었고 그 결과는 도2a,b에 나타내었다. In order to measure the amount of IL-8 expression of human pulp stem cells cultured in a medium containing human placenta extract, the culture medium obtained in Example 4 was collected and analyzed based on ELISA. That is, the amount of IL-8 expression was analyzed according to the manufacturer's manual using an ELISA kit (R&D, Minneapolis, MN, USA), and the results are shown in Figs. 2a and b.

시험예4. 독성 평가(ROS 측정)Test Example 4. Toxicity assessment (ROS measurement)

본 발명에 방법에 따른 치료방법으로 처리된 인간 성상교세포의 독성평가를 위해 DCFH-DA (2’, 7’-dichlorodihydro-fluorescein diacetate; Molecular Probes, USA)를 사용하여 ROS(Reactive oxygen species)를 측정하였다. 이를 위해 세포를 먼저 10 μg/ml DCFH-DA를 포함하는 무혈청 배지로 세포를 1시간 동안starvation 한 후, 10 μg/ml DCFH-DA가 포함된 무혈청 배지로 30분간 배양하여 염색하였다. 그런 다음 다시 무혈청 배지로 3번 washing 한 후에 유세포 분석기(flow cytometer; Beckman Coulter Quanta SC 5.2)로 분석하였다. 그 결과는 도3c,d에 나타내었다. (ROS 결과값은 Control: 2.8 ± 0.5%; OGD: 32.0 ± 1.4%; HPE (10μg/ml)+OGD: 16.8 ± 1.9 % 이었다.) 소수성 물질인 DCFH-DA는 세포막을 투과한 후, 세포내 에스테라제에 의해 아세틸화되어 형광을 띠지 않는 DCFH로 분해된다. 이때 DCFH가 ROS에 의해 산화되면 녹색 형광을 띠는 DCF로 변환되게 된다. 이 형광 세기를 측정하여 세포내 ROS 농도를 평가할 수 있다. Reactive oxygen species (ROS) was measured using DCFH-DA (2', 7'-dichlorodihydro-fluorescein diacetate; Molecular Probes, USA) for the toxicity evaluation of human astrocytes treated with the treatment method according to the present invention. I did. To this end, the cells were first starvated with a serum-free medium containing 10 μg/ml DCFH-DA for 1 hour, and then cultured and stained with a serum-free medium containing 10 μg/ml DCFH-DA for 30 minutes. Then, after washing again with serum-free medium three times, it was analyzed with a flow cytometer (Beckman Coulter Quanta SC 5.2). The results are shown in Figs. 3c and d. (The ROS result was Control: 2.8 ± 0.5%; OGD: 32.0 ± 1.4%; HPE (10 μg/ml) + OGD: 16.8 ± 1.9%.) DCFH-DA, a hydrophobic substance, penetrated the cell membrane and then intracellularly It is acetylated by esterase and decomposed into non-fluorescent DCFH. At this time, when DCFH is oxidized by ROS, it is converted into DCF with green fluorescence. This fluorescence intensity can be measured to evaluate the intracellular ROS concentration.

전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다. 예를 들어, 단일형으로 설명되어 있는 각 구성 요소는 분산되어 실시될 수도 있으며, 마찬가지로 분산된 것으로 설명되어 있는 구성 요소들도 결합된 형태로 실시될 수 있다.The above description of the present invention is for illustrative purposes only, and those of ordinary skill in the art to which the present invention pertains will be able to understand that other specific forms can be easily modified without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative and non-limiting in all respects. For example, each component described as a single type may be implemented in a distributed manner, and similarly, components described as being distributed may also be implemented in a combined form.

본 발명의 범위는 후술하는 특허청구범위에 의하여 나타내어지며, 특허청구범위의 의미 및 범위 그리고 그 균등 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.The scope of the present invention is indicated by the claims to be described later, and all changes or modified forms derived from the meaning and scope of the claims and their equivalent concepts should be interpreted as being included in the scope of the present invention.

Claims (6)

인간 줄기세포를 인간 태반 추출물을 포함하는 배지에서 배양하는 단계;
상기 배양된 인간 줄기세포를 우태아혈청이 결핍된 배지에서 허혈 처리하는 단계; 및
손상된 성상교세포를 상기 허혈 처리된 인간 줄기세포로 처리하는 단계;
를 포함하고,
상기 인간 줄기세포는 계대배양 passage 3 내지 5 상태인 것을 특징으로 하며,
상기 인간 줄기세포는 인간 치수 줄기세포인 것을 특징으로 하는,
성상교세포 생존력 향상에 대한 정보를 제공하는 방법.Culturing human stem cells in a medium containing human placenta extract;
Ischemia treatment of the cultured human stem cells in a medium deficient in fetal bovine serum; And
Treating the damaged astrocytes with the ischemic-treated human stem cells;
Including,
The human stem cells are characterized in that the passage 3 to 5 state,
The human stem cell is characterized in that the human pulp stem cell,
A method of providing information on improving astrocyte viability. 삭제delete 제1항에 있어서,
상기 허혈 처리하는 단계 이후에,
허혈 처리된 인간 줄기세포를 무혈청 배지에서 배양하는 단계를 더 포함하는 것을 특징으로 하는 성상교세포 생존력 향상에 대한 정보를 제공하는 방법.The method of claim 1,
After the ischemic treatment step,
A method for providing information on improving the viability of astrocytes, characterized in that it further comprises the step of culturing the ischemia-treated human stem cells in a serum-free medium. 제1항에 있어서,
상기 손상된 성상교세포는 허혈로 인해 손상된 것을 특징으로 하는 성상교세포 생존력 향상에 대한 정보를 제공하는 방법.The method of claim 1,
The method for providing information on improving the viability of astrocytes, characterized in that the damaged astrocytes are damaged due to ischemia. 삭제delete 제1항에 있어서,
상기 인간 태반추출물은 인간 줄기세포의 IL-8분비를 증가시키는 것을 특징으로 하는 성상교세포 생존력 향상에 대한 정보를 제공하는 방법.
The method of claim 1,
The human placenta extract is a method for providing information on improving the viability of astrocytes, characterized in that increasing the secretion of IL-8 of human stem cells.
KR1020190021309A 2019-02-22 2019-02-22 A method for treating damaged astrocytes KR102143840B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020190021309A KR102143840B1 (en) 2019-02-22 2019-02-22 A method for treating damaged astrocytes

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020190021309A KR102143840B1 (en) 2019-02-22 2019-02-22 A method for treating damaged astrocytes

Publications (1)

Publication Number Publication Date
KR102143840B1 true KR102143840B1 (en) 2020-08-12

Family

ID=72039053

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020190021309A KR102143840B1 (en) 2019-02-22 2019-02-22 A method for treating damaged astrocytes

Country Status (1)

Country Link
KR (1) KR102143840B1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20100067789A (en) * 2008-12-12 2010-06-22 (주) 차바이오텍 Process for preparing placenta-derived serum replacements and process for cultivation of adult stem cells using the same
KR20120040571A (en) * 2010-10-19 2012-04-27 서강대학교산학협력단 Media for culturing stem cells comprising placenta extract
KR20140107677A (en) * 2007-09-19 2014-09-04 플루리스템 리미티드 Adherent cells from adipose or placenta tissues and use thereof in therapy

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20140107677A (en) * 2007-09-19 2014-09-04 플루리스템 리미티드 Adherent cells from adipose or placenta tissues and use thereof in therapy
KR20100067789A (en) * 2008-12-12 2010-06-22 (주) 차바이오텍 Process for preparing placenta-derived serum replacements and process for cultivation of adult stem cells using the same
KR20120040571A (en) * 2010-10-19 2012-04-27 서강대학교산학협력단 Media for culturing stem cells comprising placenta extract

Similar Documents

Publication Publication Date Title
Gonmanee et al. Differentiation of stem cells from human deciduous and permanent teeth into spiral ganglion neuron-like cells
Teixeira et al. Secretome of mesenchymal progenitors from the umbilical cord acts as modulator of neural/glial proliferation and differentiation
Xiao et al. Neurotrophic factor GDNF promotes survival of salivary stem cells
Jing et al. Rat bone marrow mesenchymal stem cells improve regeneration of thin endometrium in rat
Badyra et al. Mesenchymal stem cells as a multimodal treatment for nervous system diseases
Verina et al. Pluripotent possibilities: human umbilical cord blood cell treatment after neonatal brain injury
TW200523368A (en) Multipotent placental stem cell and methods thereof
Jin et al. Rat mesenchymal stem cells increase tyrosine hydroxylase expression and dopamine content in ventral mesencephalic cells in vitro
Calzarossa et al. Neurorescue effects and stem properties of chorionic villi and amniotic progenitor cells
ES2914692T3 (en) Improved umbilical cord-derived adhesive stem cells, preparation method therefor, and use thereof
Kil et al. Regenerative efficacy of mesenchymal stromal cells from human placenta in sensorineural hearing loss
Omar et al. The effects of Centella asiatica (L.) Urban on neural differentiation of human mesenchymal stem cells in vitro
Li et al. Migration and differentiation of human mesenchymal stem cells in the normal rat brain
KR102053868B1 (en) Pharmaceutical composition for preventing or treating neurodegenerative disease, comprising turbinate mesenchymal stem cell as an active ingredient
Han et al. The neuroprotective effects of muscle-derived stem cells via brain-derived neurotrophic factor in spinal cord injury model
TW201922276A (en) Mesenchymal-stem-cell induction agent
Li et al. Muse cells: ushering in a new era of stem cell-based therapy for stroke
KR20130063483A (en) Canine amniotic membrane-derived multipotent stem cells
Lu et al. Retrovirus delivered neurotrophin-3 promotes survival, proliferation and neuronal differentiation of human fetal neural stem cells in vitro
KR20120140197A (en) Testicular somatic cell-derived multipotent stem cells, process for the preparation thereof, and pharmaceutical composition for treating erectile dysfunction comprising the same
Takeda et al. Osteogenic potential of human bone marrow–derived mesenchymal stromal cells cultured in autologous serum: A preliminary study
KR20150088374A (en) Stem cell medium containing cell growth factors from human adipose derived stem cells and cosmetic composition for improvement atopic syndrom prepared therefrom
Chung et al. Effect of hypoxia on generation of neurospheres from adipose tissue-derived canine mesenchymal stromal cells
KR102143840B1 (en) A method for treating damaged astrocytes
KR20220034799A (en) Composition for skin whitening comprising exosomes derived from skeletal muscle stem cells as an active ingredient

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant