KR102142474B1 - composition for identification of Lactobacilus acidophilus YT1 strain and method of determination thereof - Google Patents

Abstract

The present invention relates to a composition for determining a Lactobacillus acidophilus YT1 strain and, more particularly, to a composition that can quickly and conveniently identify a corresponding strain, a kit including the same, and a determination method using the same. The composition includes a forward primer represented by SEQ ID NO: 1 and a reverse primer represented by SEQ ID NO: 2, and is deposited under an accession number KCCM11808P.

Description

Composition for identification of Lactobacillus acidophilus YT1 strain and method using same {{composition for identification of Lactobacilus acidophilus YT1 strain and method of determination thereof}

The present invention relates to a composition for discriminating Lactobacillus acidophil us YT1 strain, and more particularly, to a composition for discriminating Lactobacillus acidophilus YT1 strain capable of quickly and easily identifying the strain and a method for discriminating using the same.

Modern society has increased the average life expectancy compared to the past due to the development of medical technology and the improvement of income level. According to the National Statistical Office, the average life expectancy of women who were 65.6 years old in 1970 increased significantly to 85.2 years in 2015, which naturally increased the life expectancy of women after menopause. Women who lose ovarian function by menopause suffer from menopausal symptoms, which include both physical injuries and mental/emotional symptoms. The main symptoms associated with menopause include flushing, night weat, decreased memory, depression, sleep disturbances, obesity, and hypersensitivity to pain, and the risk of developing various diseases such as osteoporosis, liver disease, and cardiovascular disease increases.

To date, hormone replacement therapy (HRT) has been mainly used to relieve menopausal symptoms, but this has a problem of increasing the incidence of diseases such as cardiovascular disease, breast cancer, coronary heart disease, stroke and ovarian cancer when used for a long time. It has been reported.

In order to solve the above problems, a new Lactobacillus acidophilus YT1 strain has been developed, which has a high effect related to menopausal symptoms and prevents, alleviates and cures menopausal symptoms when analyzing microorganisms in an animal model from which ovaries have been extracted. In order to determine the presence or absence of the Lactobacillus acidophilus YT1 strain having the function of relieving menopausal symptoms, 16S rRNA gene sequence information, which is most importantly used for the determination of microbial species, is checked, or each sample is analyzed for full genomic information. There are ways to do it. However, since these methods have not been able to distinguish commercially available or pharmaceutically important Lactobacillus acidophilus strains (ex: L. acidophilus NCFM, L. acidophilus La-14, L. acidophilus FSI4), additional processing after 16S rRNA gene analysis Complete genome information should be analyzed.

That is, in the commercialization of the Lactobacillus acidophilus YT1 strain, the cost or efficiency of the product as a whole is lowered if a skilled technician or expensive equipment is required as well as a long time and a lot of cost in the verification process of the repeated product.

Therefore, there is an urgent need to develop a method that can be used only conveniently and quickly while selectively detecting the strain from a product or various samples.

Patent Literature 1. Korea Registered Patent No. 10-1732676

The present invention was devised to solve the above problems, and an object of the present invention is to provide a composition for discriminating Lactobacillus acidophilus YT1 strain comprising a primer set represented by SEQ ID NOs: 1 and 2.

Another object of the present invention is to provide a kit for discriminating Lactobacillus acidophilus YT1 strain comprising the composition.

Another object of the present invention is to provide a method for determining a Lactobacillus acidophilus YT1 strain using the composition.

In order to achieve the above object, the present invention provides a composition for identifying Lactobacillus acidophilus YT1 strain comprising a forward primer represented by SEQ ID NO: 1 and a reverse primer represented by SEQ ID NO: 2.

The forward primer may further include at least one label selected from the group consisting of fluorophores, chromophores, chemiluminescent groups, magnetic particles and radioactive isotopes, linked to the 5'-end.

The present invention provides a kit for discriminating Lactobacillus acidophilus YT1 strain containing the composition in order to achieve the above other objects.

The kit may include a buffer solution, a DNA polymerase and dNTP.

In order to achieve the other object of the present invention, a) obtaining a PCR product by performing a polymerase chain reaction (PCR) using a DNA separated from a discrimination target sample as a template and using the composition; And

b) analyzing the PCR product; provides a method for determining the Lactobacillus acidophilus YT1 strain comprising a.

The PCR product may be 300 to 350 bp.

The compositions according to the present invention can quickly and easily detect the Lactobacillus acidophilus strain YT1 presence or absence from the target sample, in addition to the Lactobacillus acidophilus strain YT1 among species belonging to the Lactobacillus acidophilus does not work for the other Lactobacillus acidophilus strain, only L. acidophilus YT1 It has the advantage of being able to be accurately identified.

1 is a whole genome configuration diagram of Lactobacillus acidophilus YT1 analyzed through Example 2.
Figure 2a is a schematic diagram using the 16S rRNA gene of 22 types of Lactobacillus acidophilus strains, including Lactobacillus acidophilus YT1, confirmed through Example 3.
Figure 2b is a schematic diagram utilizing the comparison of ANI genome of 10 strains, including Lactobacillus acidophilus YT1 confirmed through Example 3.
FIG. 3 is a CRISPR structure analysis result of reference strains L. acidophilus NCFM and L. acidophilus YT1 among 22 strains including Lactobacillus acidophilus YT1 identified through Example 3.
Figure 4 shows the PCR product size through in silico analysis (in silico) when PCR with a primer set capable of specifically detecting L. acidophilus YT1 and the primer set.
5 is in silico (in silico), L. acidophilus YT1 strain set of the present invention for determining the primer set (CRISPR_YT1_F, CRISPR_YT1_R) is a result of searching by using Primer-BLAST in the database of the NCBI site.
Figure 6 is using the primer set for L. acidophilus YT1 strain of the present invention, each strain ( Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620 , Lactobacillus acidophilus ATCC 4356 , Lactobacillus acidophilus NCFM, Lactobacillus acidophilus LA1, Lactobacillus ) The results are analyzed by PCR.
7 is a PCR amplification product obtained by performing PCR on the YT1 strain using the primer set for L. acidophilus YT1 strain discrimination of the present invention, and analyzed by agarose gel electrophoresis, which is repeated 10 times This is a representative result.

Hereinafter, various aspects and various implementation examples of the present invention will be described in more detail.

In the present invention, a primer is a nucleic acid sequence having a short free 3'hydroxyl group, capable of forming a base pair and a template of a complementary nucleic acid, and for copying a strand of a nucleic acid template. A short nucleic acid sequence that functions as a starting point. The primer can initiate DNA synthesis in the presence of a reagent (i.e., DNA polymerase) for polymerization at an appropriate buffer and temperature.

In the present invention, a primer set refers to a combination of primers for amplifying a specific sequence DNA, and one primer set usually includes two primers, but sometimes exceeds it.

In the present invention, oligonucleotides (oligonucleotides) are deoxyribo-oligonucleotides or ribo-oligonucleotides present in single-stranded or double-stranded form, and include analogs of natural nucleotides, unless otherwise specified.

One aspect of the present invention is a composition comprising a primer set, to detect the Lactobacillus acidophilus YT1 strain specifically, Lactobacillus acidophilus YT1 strain comprising a reverse primer represented by a forward primer and SEQ ID NO: 2 described in SEQ ID NO: 1 It relates to a composition for discrimination.

The Lactobacillus acidophilus YT1 strain has genomic structural properties in which the CRISPR region is divided into two. All known Lactobacillius acidophilus strains except for Lactobacillus acidophilus YT1 have one CRISPR region. Through these differences, sequences of completely different positions with differences from the known Lactobacillus acidophilus strains were identified, and a specific primer set capable of amplifying them was designed, thereby confirming a clear difference in the length of amplification. The present invention has been completed.

The composition of the present invention may include a primer set capable of specifically detecting the Lactobacillus acidophilus YT1 strain, even in samples mixed with Lactobacillus acidophilus YT1 strain or similar strains having the same species and genus.

The compositions of the present invention the, Lactobacillus acidophilus as well as other Lactobacillus strains except YT1 strain does not at all synthesized PCR products even for Lactobacillus acidophilus strain, 'CRISPR' of Lactobacillus acidophilus YT1 strain to be subjected, as confirmed in the experiments described below for example, Since PCR products are synthesized using a template only when a region gene is present, the presence or absence of Lactobacillus acidophilus YT1 strain can be specifically determined from the sample using the composition.

When applying the composition, it is possible to specifically identify the Lactobacillus acidophilus YT1 strain, and the PCR product size is specifically determined whether the Lactobacillus acidophilus YT1 strain is present through detection of 300 to 350 bp, preferably 320 bp. can do. Since PCR products are synthesized as a template only when the'CRISPR' region gene of the Lactobacillus acidophilus YT1 strain to be diagnosed is present, only the Lactobacillus acidophilus YT1 strain is detected at 300 to 350 bp, preferably 320 bp when detecting PCR. Will be.

The Lactobacillus acidophilus YT1 strain (Accession No. KCCM11808P) that is a target of the composition of the present invention is a strain known from Patent Publication No. 10-2018-0052569, the largest among microorganisms with reduced distribution in menopausal animal models with ovaries removed It is a strain that shows a difference, and is a strain that has been confirmed to have a depression prevention or treatment effect in menopausal women when administered to the menopausal animal model.

Exemplary “gene sequences of CRISPR regions” which are targets for amplification according to the present invention are schematically disclosed in FIGS. 3 and 4 below, and exemplary nucleotide sequences of the complete genome of Lactobacillus acidophilus YT1 are Genbank Accession No. CP025200.1. On the other hand, the whole genome nucleotide sequence of the CRISPR region of L. acidophilus NCFM among the strains used as a comparative group for analyzing the specificity of the composition of the present invention was Genbank Accession No. It can be checked in NC_006814.3. Other strains for comparison can also confirm the entire genomic nucleotide sequence through Genbank Accession.

The optimum length of all primers in the primer set included in the composition of the present invention is 20 bp, the melting temperature (Tm) is 60°C, the maximum Tm difference between primers is within 5°C, and GC% is 50%. .

According to a specific embodiment of the present invention, primer sets comprising the forward primer represented by SEQ ID NO: 1 and the reverse primer represented by SEQ ID NO: 2 of the present invention have the same dependency under one condition having the same annealing temperature and time. For Lactobacillus acidophilus strains, PCR products were not synthesized at all, and it was confirmed that PCR products were synthesized at 320 bp only in Lactobacillus acidophilus YT1 strains. Through this, even if a strain of the same genus was present on the sample, it was confirmed that only the Lactobacillus acidophilus YT1 strain of the present invention can be specifically and clearly detected and discriminated, thereby significantly recognizing the time and effort required to determine the presence of the Lactobacillus acidophilus strain in the sample. You can see that it can save.

The forward primer or reverse primer may be further comprising one or more labels selected from the group consisting of fluorophores, chromophores, chemiluminescent groups, magnetic particles and radioactive isotopes connected to the 5'-end or 3'-end of the primer. have.

The "lable" or "detectable label" can mean any chemical moiety bound to a nucleotide, nucleotide polymer, or nucleic acid binding factor, and the binding can be covalent or non-covalent. have. Preferably, the label is detectable and may be the nucleotide or nucleotide polymer that can be detected by an experimenter of the present invention. Detectable labels include luminescent molecules, chemiluminescent molecules, fluorescent dyes, fluorescent quenching agents, color molecules, radioactive isotopes or scintillants. The detectable label can also be any useful linker molecule (e.g. biotin, avidin, streptavidin, HRP, protein A, protein G, antibody or fragment thereof, Grb2, polyhistidine, Ni ²⁺ , FLAG tag, myc Tags), heavy metals, enzymes (e.g. alkaline phosphatase, peroxidase and luciferase), electron donors/acceptors, acridinium esters, dyes and calorimetric substrates It includes. In addition, a detectable label may be considered to indicate a change in mass, as in the case of surface plasmon resonance detection. Those skilled in the art will readily recognize even useful detectable labels not mentioned above, and these may also be used in the practice of the present invention.

Another aspect of the present invention relates to a kit for discriminating Lactobacillus acidophilus YT1 strain comprising the composition.

The kit may further include a buffer solution, DNA polymerase, dNTP, and the like.

It may include a buffer solution, DNA polymerase, dNTP and distilled water, which can be used as a solution, enzyme, etc., which are commonly used in the art. In addition, the kit may be manufactured in a number of separate packaging or compartments containing the reagent component.

The buffer solution is a compound that is added to an amplification reaction to modulate the amplification reaction, thereby modifying stability, activity, and/or lifespan of one or more elements of the amplification reaction. The buffer solution of the present invention is compatible with PCR amplification and RNase H cleavage activity. Specifically, the buffer solution is HEPES (4-(2-hydroxyethyl)-1-piperazinethanesulfonic acid), MOPS (3-(N-morpholino)propanesulfonic acid) (3-(N-morpholino)-propane Sulfonic acid) and acetate or phosphate buffers, and the like. Further, the PCR buffer solution may generally include about 70 mM or less of KCl and about 1.5 mM or more of MgCl ₂ , about 50-200 uM of each dATP, dCTP, dGTP and dTTP. The buffers of the present invention may contain additives to optimize efficient reverse transcriptase-PCR or PCR reactions.

These additives affect inactivation of contaminated enzymes, stabilization of protein folding, and/or reduction of aggregation. Examples of additives that may be included in the amplification reaction are betaine, formamide, KCl, CaCl ₂ , MgOAc, MgCl ₂ , NaCl, NH ₄ OAc, NaI, Na(CO ₃ ) ₂ , LiCl, MnOAc, NMP, trehalose, demi Ethyl sulfoxide (DMSO), glycerol, ethylene glycol, dithiothreitol (DTT), pyrophosphatase (including, but not limited to, thermoplasma acidophilum inorganic pyrophosphatase (TAP)), serum serum albumin (BSA) ), Propylene glycol, Glycineamide, CHES, Percoll, Aurintricarboxylic acid, Tween 20, Tween 21, Tween 40, Tween 60, Tween 85, Brij 30, NP-40, Triton X-100, CHAPS , CHAPSO, Mackernium, LDAO (N-dodecyl-N,N-dimethylamine-N-oxide), Zwittergent 3-10, Xwittergent 3-14, Xwittergent SB 3-16, Empigen, NDSB-20, T4G32, E Coli SSB, RecA, nicking endonucleases, 7-diaza G, dUTP, anionic detergent, cationic detergent, nonionic detergent, zwittergent, sterols, osmolyte, cations, and other compounds, proteins, or cofactors that can alter the efficiency of amplification. In one embodiment, two or more additives are included in the amplification reaction. If the additive does not interfere with the activity of RNase H, the additive can be optionally added to improve the selectivity of primer annealing.

The present inventors developed a primer set (forward primer and reverse primer) targeting the CRISPR region gene of Lactobacillus acidophilus strains among the microorganisms present in the sample, and by comparing and analyzing the lengths of the base sequences of the amplified CRISPR region, A method that can accurately and quickly detect Lactobacillus acidophilus YT1 strain was developed. Specifically, among the chromosomes of the amplified CRISPR region, since only the Lactobacillus acidophilus YT1 strain has 320 bp, as a result, the Lactobacillus acidophilus YT1 strain can be discriminated using this. When using the composition for the actual PCR analysis, it was confirmed that the Lactobacillus acidophilus YT1 strain has a PCR product size of about 320 bp, which is a PCR product 165 bp (150 bp) for the CRISPR section of the Lactobacillus acidophilus YT1 strain amplified with a primer set. + 8 bp primer and 7 bp dicer) and the primer set sequences of SEQ ID NOs: 1 and 2 (40 bp) were measured together, so PCR analysis, if the PCR product size belongs to 320 bp, it can be identified as Lactobacillus acidophilus YT1 strain have. Unlike other Lactobacillus acidophilus strains, Lactobacillus acidophilus YT1 strains are clearly and clearly distinguishable by not generating PCR products.

Another aspect of the present invention relates to a method for determining a Lactobacillus acidophilus YT1 strain using the composition comprising the following steps.

a) separating the DNA from the sample to be discriminated, and performing a polymerase chain reaction (PCR) using the composition to obtain a PCR product; And

b) analyzing the PCR product.

First, a) DNA separated from the sample to be determined is used as a template, and a polymerase chain reaction (PCR) is performed using the composition to obtain a PCR product.

The method of separating DNA from the sample may use a method known in the art, but the DNA extraction method is preferably an alkaline extraction method, a hot water extraction method, a column extraction method, or a phenol/chloroform (Phenol/ Chloroform) extraction method, and more preferably, may be an alkaline extraction method.

The sample to be discriminated may include various samples to detect the presence or absence of the Lactobacillus acidophilus YT1 strain.

When the primer is designed as described above, and DNA is prepared from the sample to be discriminated, its amplification is polymerase chain reaction (PCR), nucleic acid sequence-based amplification (NASBA), ligase chain reaction (LCR), and rolling circle amplification ( RCA), but the polymerase chain reaction (PCR) is the most common and preferred to amplify specific target DNA sequences.

In addition, the PCR may be real-time PCR, qRT-PCR or RT-PCR, but is not limited thereto.

In the present invention, "polymerase chain reaction (polymerase chain reaction)" or "PCR", generally refers to a method for amplifying a desired target sequence in vitro (in vitro), which is a process commonly used in the art It is not particularly limited. For example, the PCR process consists of adding an oligonucleotide primer complementary to the opposite strand of the double-stranded target sequence to a reaction mixture containing the desired target sequence(s) in an excess of 2 times the molar concentration. The reaction mixture is applied to a thermal cycling program in the presence of DNA polymerase to amplify the desired target sequence between the DNA primer sets.

In addition, the PCR product obtained through the above process is also called a "PCR fragment" or "reverse transcriptase-PCR fragment" or "amplicon", and is used for amplification of a specific target nucleic acid. It means a polynucleotide molecule (or collectively a large number of molecules) produced accordingly. PCR fragments generally mean, but are not limited to, DNA PCR fragments. The PCR fragment can be single stranded or double stranded, or a mixture thereof according to any concentration ratio. The PCR fragment or reverse transcriptase-PCR fragment may be 100-500 nucleotides or more.

By analyzing the amplified PCR product, it is possible to confirm and determine the presence of the Lactobacillus acidophilus YT1 strain. As a method for the analysis, the nucleotide sequence of the PCR product may be analyzed, or the size of the amplified product may be confirmed to be performed at 300 to 350 bp, preferably 320 bp.

In the present invention, Lactobacillus acidophilus YT1 strain can be detected or analyzed by analyzing the presence or absence of amplified PCR products. Furthermore, in the present invention, the gene fragment of the amplified PCR product is analyzed to accurately identify the Lactobacillus acidophilus YT1 strain.

That is, Lactobacillus acidophilus YT1 by accumulating information about the PCR products that appear specifically on the strain, and comparing the gene information with strains of the same genus as the Lactobacillus acidophilus YT1 strain based on the accumulated information, specifically Lactobacillus acidophilus YT1 The strain can be accurately and quickly discriminated and analyzed with high reliability.

At this time, that the case be that the 300 to 350 bp and preferably from 320 bp PCR product, a Lactobacillus acidophilus strain YT1 exists among Lactobacillus acidophilus strain in a sample can be clearly discriminated.

Hereinafter, the present invention will be described in more detail through examples and the like, but the scope and content of the present invention may be reduced or limited by the following examples. In addition, if it is based on the disclosure of the present invention including the following examples, it is obvious that a person skilled in the art can easily implement the present invention, in which experimental results are not specifically presented, and patents to which such modifications and corrections are attached Naturally, it is within the scope of the claims.

In addition, the experimental results presented below are only representative of experimental results of the examples and comparative examples, and the effects of various embodiments of the present invention, which are not explicitly presented below, will be described in detail in the corresponding parts.

Example 1 Lactobacillus acidophilus YT1 strain culture

For genome detoxification of Lactobacillus acidophilus YT1 strain, incubation at 37° C. for 18 hours with MRS medium (Difco, 288110) using Lactobacillus acidophilus YT1 strain (Accession No. KCCM11808P) known from Patent Publication No. 10-2018-0052569 Did.

Example 2. Lactobacillus acidophilus Securing genome of YT1 strain

For genome detoxification of the Lactobacillus acidophilus YT1 strain, cells were recovered from the culture medium of Example 1 to extract genomic DNA with QIAamp DNA Mini kit (Qiagen, Germany), and the entire genome was used using the PacBio RS II sequencing platform. The base sequence was secured.

For the genomic results, each sequence read was assembled using HGAP 3.0, and the location of dnaA, a chromosomal replication initiation gene, was confirmed to determine the starting point of the entire genome during the process.

Example 3. Lactobacillus acidophilus Genome comparison of strains

NCBI Prokaryotic Genome Annotation Pipeline (PGAAP) was used to confirm the function of the gene present on the Lactobacillus acidophilus YT1 genome.

Thereafter, the genomes of the Lactobacillus acidophilus YT1 genome and 21 strains belonging to the same species were compared and analyzed. Specifically, the 21 strains are as follows. L. acidophilus NCFM (GCA 000011985.1), L. acidophilus ATCC 4796 (GCA 000159715.1), L. acidophilus La-14 (GCA 000389675.2), L. acidophilus DSM 20242 (GCA 000442825.1), L. acidophilus CIRM-BIA 442 (GCA 000442865.1 ), L. acidophilus CIP 76.13 (GCA 000469705.1), L. acidophilus DSM 9126 (GCA 000469745.1), L. acidophilus CIRM-BIA 445 (GCA 000469765.1), L. acidophilus CFH (GCA 000497795.1), L. acidophilus JCM 1132 (GCA 000615165.1), L. acidophilus ATCC 4356 (GCA 000786395.1), L. acidophilus FSI4 (GCA 000934625.1), L. acidophilus DSM 20079 (GCA 001433895.1), L. acidophilus NBRC 13951 (GCA 001591845.1), L. acidophilus WG-LB-IV (GCA 001639165.1), L. acidophilus KLDS 1.0901 (GCA 001868765.1), L. acidophilus L-55 (GCA 001950045.1), L. acidophilus ATCC 53544 (GCA 002224305.1), L. acidophilus LA1 (GCA 002286215.1), L. acidophilus P2 ( GCA 002406675.1), L. acidophilus LMG P-21904 (GCA 002914945.1). The genome of these 21 strains was obtained, and the whole genome information was analyzed in the same manner as in Example 2.

Using the 16S rRNA gene information of 22 strains of Lactobacillus acidophilus , including Lactobacillus acidophilus YT1, a molecular phylogenetic tree was prepared using the maximum likelihood method based on the Tamura-Nei model. 16S rRNA of Lactobacillus helveticus CAUH18 was used as the out group of the molecular diagram. The range of 18 to 784 was calculated based on the NCFM 16S rRNA sequence considering some genomes that did not have a full length 16S rRNA.

To analyze the similarity of the entire genome, the genome was compared using the program pyani, which implemented the average nucleotide identity (ANI) technology, and then a molecular phylogenetic tree based on the entire genome information was created to determine how relevant Lactobacillus acidophilus- associated microorganisms are.

In addition, in each strain, the CRISPR region where phage infection information is known was analyzed through a CRISPR finder, and the CRISPR configuration of each strain was compared.

Figure 1 is a whole genome composition diagram of Lactobacillus acidophilus YT1 analyzed through Example 2, looking at this, Lactobacillus acidophilus YT1 genomic analysis shows that the total genome of YT1 is 2.09-Mbp circular chromosome (34.7% G+C content), 1,913 It was found to have 83 functional genes and 83 RNA genes and 93 pseudo genes.

Figure 2a is a schematic diagram using the 16S rRNA gene of 23 strains including Lactobacillus acidophilus YT1 identified through Example 3, Figure 2b is utilizing the ANI genome comparison of 22 strains including Lactobacillus acidophilus YT1 confirmed through Example 3 It is a tree.

As shown in FIG. 2, a flexible relationship between 22 strains including Lactobacillus acidophilus YT1 was confirmed through a molecular system using 16S rRNA gene and ANI. Specifically, all of the 21 species except YT1 belonging to Lactobacillus acidophilus were very similar to the extent that the difference between strains was hardly confirmed to have a similarity level of 99.7% or more based on ANI. Since YT1 has a similarity of 99.5% or less based on ANI compared to other species, it was confirmed that there is a slight difference in the whole genome from the known L. acidophilus species.

3 is a CRISPR structure analysis result of L. acidophilus NCFM and L. acidophilus YT1 among 22 strains including Lactobacillus acidophilus YT1 identified through Example 3.

Specifically, FIG. 3 is a result of separately analyzing only the CRISPR region among all genomic information of L. acidophilus NCFM and L. acidophilus YT1 analyzed from Example 3.

Looking at this, in the CRISPR region, it was confirmed that there is a clear difference in the nucleotide sequence of L. acidophilus NCFM and L. acidophilus YT1 strains. In particular, in the L. acidophilus NCFM strain, 32 spacer regions existed, whereas in L. acidophilus YT1, it was confirmed that only two of the CRISPRs were separated and conserved. Specifically, spacers 1 to 5 of NCFM are present in the first CRISPR of YT1, and spacers 22 to 26 of NCFM are present in the second CRISPR of YT1.

Unlike the other strains, the L. acidophilus YT1 strain is composed of two CRISPR regions, and only a part of the CRISPR overlaps with other strains, and a new sequence not reported by the existing strain exists in the CRISPR. Through these characteristics, it was confirmed that the L. acidophilus YT1 strain can be clearly distinguished.

Therefore, by using a difference in the CRISPR structure, it was intended to design a marker capable of specifically detecting the L. acidophilus YT1 strain among the strains, and this is illustrated in FIG. 4. In more detail, FIG. 4 shows the PCR product size of the corresponding strain through in silico analysis when PCR was performed with a primer set capable of specifically detecting L. acidophilus YT1 and the primer set.

To this end, as shown in FIG. 4, by developing primers containing YT1 specific spacers in the first CRISPR region (YT1 CRISPR 1), a marker capable of specifically detecting the L. acidophilu s YT1 strain was prepared. Specifically, a 20 bp left primer from the 6th nucleotide to the 25th nucleotide in the spacer region of L. acidophilus YT1 5 was produced, and a 20 bp right primer from the 1st nucleotide to the 20th nucleotide in the spacer region d was produced. It can be seen that the L. acidophilus YT1 strain of the present invention can be clearly distinguished.

In addition, when the PCR product was obtained by performing PCR using the primer set designed through the present invention, the length of the PCR product was analyzed using in silico modeling, and the results are shown in the lower part of FIG. 4. Did. As a result of analysis, the length of the PCR product of L. acidophilus YT1 was 320 bp (32 bp 4 spacers (spacer a, a, b, c), 28 bp dicer 5 (DP5), and spacer 5 left primer 27 bp, 20 bp) including the right primer of spacer d.

That is, when the primer set according to the present invention is used, the presence or absence of L. acidophilus YT1 strain in a sample can be detected.

In order to prepare a primer set for L. acidophilus YT1 discrimination in the present invention, the most important thing was the length of the entire primer, which was designed to have 18 to 23 (optimum length 20). In addition, the primer was designed to have a melting temperature (Tm) of 57°C to 62°C, preferably 60°C, and the maximum Tm difference between primers was limited to within 5 degrees. In addition, the primer was designed to have a GC% of 35 to 65%, preferably 50%.

Whether the primer set compositions of SEQ ID NOs 1 and 2 thus produced have specificity for L. acidophilus YT1 was analyzed through in silico analysis and sequence match on the existing NCBI DB, and the results are shown (FIG. 5). It was confirmed that the primer set composition designed through the present invention had no amplifiable strain among sequences registered in NCBI.

Figure 5 is in silico (in silico), the L. acidophilus YT1 strain set of the present invention is compared with the database provided from the NCBI site, the results of sequence analysis with the Primer-BLAST sequence search program. Specifically, access to Primer-BLAST web service () and specify CP025200.1 as PCR Template, 557,700 to 557,800 of forward primer, and 558,00 to 558,100 of reverse primer, and then CRISPR_YT1_R in forward primer sequence of Primer Parameters, After entering CRISPR_YT1_F into the reverse primer sequence, the database was designated as "nr". The rest of the settings were executed with the default settings.

As a result, a primer set for L. acidophilus YT1 strain discrimination was obtained by specifically amplifying only the L. acidophilus YT1 (Accession No. CP025200.1) genome from the sequence present in NCBI. Specifically, it was indicated as follows in the “Specificity of primers” section of FIG. 5. "Primer pairs are specific to input template as no other targets were found in selected database: Nucleotide collection (nt)".

Note that when referring to FIG. 5, the reverse primer CRISPR_YT1_R, which is a reverse primer on the genome, was located in front of the forward primer CRISPR_YT1_F because the primer template used the reverse sequence of the genome during the process of preparing the primer. In Primer-BLAST, the primer located in the front of the genome is unconditionally recognized as a forward, so a reverse primer is indicated in "Forward primer" and a forward primer is indicated in "Reverse primer".

Example 4. Lactobacillus acidophilus PCR analysis of the composition for strain identification-1.

The composition for discriminating the Lactobacillus acidophilus strain of the present invention prepared in FIG. 5 was specifically intended to confirm whether the L. acidophilus strain, in particular, the L. acidophilus YT1 strain.

First, Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620 , Lactobacillus acidophilus ATCC 4356, Lactobacillus acidophilus NCFM, Lactobacillus acidophilus LA1 and Lactobacillus acidophilus YT1 strains were incubated with MRS medium (Difco, 288110 for 37 hours at 37 hours, 37 hours at Difco, 288110). After that, the cells were recovered from the culture medium of each strain, and genomic DNA was extracted with a QIAamp DNA Mini kit (Qiagen, Germany).

Thermal cycling (PCR) was performed on the extracted DNA of 30 ng. When PCR reaction, total reaction solution is 20 μl, 2.0 mM dNTP (Fermentas, USA), 1.0 unit of heat-resistant DNA polymerase (e-taq polymerase, Solgent), 20 pmol CRISPR YT1 F (Serial No. 1), 20 pmol CRISPR A solution in which YT1 R primer (SEQ ID NO: 2), 20 ng of each strain DNA and buffer (10 mM Tris-HCl (pH 8.0), 50 mM KCl, 1.5 mM MgCl2, 0.01% gelatin) is completely mixed is prepared.

The PCR reaction was carried out using Dyad (Bio-rad), and the reaction conditions were maintained at 95°C for 300 seconds, then treated at 95°C for 30 seconds to denature DNA, and annealed at 60°C for 30 seconds, 72 It was amplified (DNA polymerization) for 90 seconds at ℃, and repeated 28 times (95 ℃, 30 seconds (denaturation) → 60 ℃, 30 seconds (recombination) → 72 ℃, 90 seconds (DNA polymerization)) , 72 ℃ The final synthesis was carried out for 300 seconds.

PCR reaction solution Content (μl) SP taq. 0.5 10x SP taq buffer 2.5 dNTPs 2.0 Tuning Buffer 5.0 Template (strain DNA) 1.0 Forward primer (5 uM)
CRISPR YT1 F primer (SEQ ID NO: 1) 1.0 Reverse primer (5 uM)
CRISPR YT1 R primer (SEQ ID NO: 2) 1.0 D.W 12

The amplified product (PCR product) amplified by the above process was electrophoresed on a 1.2% agarose gel, stained with Safeview (iNtRON Biotechnology, Korea), and the DNA polymorphic band was detected by irradiation with UV, and the Gel-Doc system (Bio -rad) and printed and shown in FIG. 6.

Figure 6 is using the primer set for L. acidophilus YT1 strain of the present invention, each strain ( Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620 , Lactobacillus acidophilus ATCC 4356 , Lactobacillus acidophilus NCFM, Lactobacillus acidophilus LA1, Lactobacillus ) The results are analyzed by PCR.

In this case, M is a DNA size standard marker (Sizer ^™ 100bp DNA Marker (cat.No,24073), 1 is Lactobacillus helveticus ATCC 13866, 2 is Lactobacillus amylovorus ATCC 33620, 3 is Lactobacillus acidophilus ATCC 4356, and 4 is Lactobacillus acidophilus NCFM strain, 5 is Lactobacillus acidophilus LA1 (also called CB_LA1), and 6 is Lactobacillus acidophilus YT1.

As shown, it was confirmed that the composition for identifying Lactobacillus acidophilus strains comprising the primers represented by SEQ ID NO: 1 and SEQ ID NO: 2 of the present invention amplified a DNA fragment of about 320 bp in size from Lactobacillus acidophilus YT1.

Through the genome analysis, it was confirmed that the Lactobacillus acidophilus YT1 strain has two CRISPRs, and unlike the other strains (same strains, homogeneous strains) having different base sequences in the CRISPR section, the CRISPR region of another strain is partially conserved. Specifically, spacers 1 through 5 of NCFM were present in the first CRISPR of YT1, and spacers 22 through 26 of NCFM were present in the second CRISPR of YT1. The size of the PCR product recovered through the composition for determining the Lactobacillus acidophilus YT1 strain containing 320 bp from the 6th nucleotide of spacer 5 to the 20th nucleotide of spacer d and containing primers represented by SEQ ID NOs: 1 and 2 is also 320. It can be said that it was measured in bp.

Considering a slight difference on gel electrophoresis (electrophoresis does not show precise resolution in 1base units), PCR products for the CRISPR section of the amplified Lactobacillus acidophilus YT1 strain, even if PCR products were detected at 320 bp Since the result was derived based on 320 bp, it will be referred to as a result belonging to the scope of the present invention.

Therefore, it is preferable that the PCR product is exactly 320 bp, but considering the various conditions described above, the Lactobacillus acidophilus YT1 strain if the PCR product derived by actual application corresponds to 250 to 400 bp, preferably 300 to 350 bp It can be determined as being (affected by the area measurable with a marker).

To prove this, the DNA sequence was confirmed only for the PCR product of the L. acidophilus YT1 strain recovered in this example.

In contrast, no amplified DNA fragment was found for Lactobacillus helveticus ATCC 13866, Lactobacillus amylovorus ATCC 33620, Lactobacillus acidophilus ATCC 4356, Lactobacillus acidophilus NCFM, Lactobacillus acidophilus LA1, which is different from the YT1 strain.

Therefore, the primers represented by SEQ ID NO: 1 and SEQ ID NO: 2 according to the present invention can be used as a composition for rapidly and accurately determining Lactobacillus acidophilus YT1 strain to generate an amplicon for Lactobacillus acidophilus YT1 only.

Subsequently, while repeating the experiment for the detection of the YT1 strain, PCR amplification products were purified and sequenced. 7 is a PCR amplification product obtained by performing PCR on the YT1 strain using the primer set for L. acidophilus YT1 strain discrimination of the present invention, and analyzed by agarose gel electrophoresis, which is repeated 10 times This is a representative result.

In Figure 7, M is a Sizer ^TM 100bp DNA Marker (Cat. No. 24073), N is Blank, and YT1-a and b are Lactobacillus acidophilus YT1, which means two experiments.

As shown in Figure 7, Lactobacillus acidophilus YT1 of the present invention It has been confirmed that the composition for discriminating strains has a certain result despite repeated experiments. In addition to being quick and easy, it can be seen that the Lactobacillus acidophil us YT1 strain can be accurately and reproducibly discriminated.

In addition, as a result of analyzing the sequence for the amplification product identified from FIG. 7, the size of the amplification product identified only in the case of the Lactobacillus acidophilus YT1 strain was measured to be 320 bp including a primer in both experiments, and the amplification sequence was As follows.

[SEQ ID NO: 3]

TTGACTTGCGCTAGGTGTTGCATCAATAGGATCACCTCCACATACGTGGAGAAAATGACACCAAAAAGGGCGGTGGAAAACTTTTCAAAGGATCACCTCCACATACGTGGAGAAAATGACACCAAAAAGGGCGGTGGAAAACTTTTCAAAGGATCACCTCCACATACGTGGAGAAAATACTTCAACTAATCCTAATTATCCTGGCAATCCAGGATCACCTCCACATACGTGGAGAAAATGCCTAGTGCCTTACCAGCCTCGGCAAAACTGTGGGATCACCTCCACATACGTGGAGAAAATGGAACAACGCTTTCTGGTGA

As a result of analyzing the nucleotide sequence of the substantially amplified Lactobacillus acidophilus YT1, it was confirmed that the nucleotide sequence predicted in the genome was 100% identical. That is, the electrophoresis seemed to be close to about 300 bp with the naked eye, but the length of the amplified sequence was actually 320 bp, and it can be seen that it perfectly matches the nucleotide sequence predicted on the genome.

Through this, it can be seen that the composition for identifying Lactobacillus acidophilus YT1 strain comprising the primers represented by SEQ ID NO: 1 and SEQ ID NO: 2 according to the present invention is clearly distinguishable from Lactobacillus acidophilus YT1 among strains of the same kind.

Therefore, the primers shown in SEQ ID NO: 1 and SEQ ID NO: 2 according to the present invention was again confirmed the fast, accurate utilized as Lactobacillus acidophilus YT1 strain determined composition is possible to only generate the amplicon (amplicon) Lactobacillus acidophilus YT1 .

<110> KOREA FOOD RESEARCH INSTITUTE <120> composition for identification of Lactobacilus acidophilus YT1 <130> HPC8476 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CRISPR_YT1_F <400> 1 ttgacttgcg ctaggtgttg 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CRISPR_YT1_R <400> 2 tcaccagaaa gcgttgttcc 20 <210> 3 <211> 320 <212> DNA <213> Artificial Sequence <220> <223> amplicon sequence <400> 3 ttgacttgcg ctaggtgttg catcaatagg atcacctcca catacgtgga gaaaatgaca 60 ccaaaaaggg cggtggaaaa cttttcaaag gatcacctcc acatacgtgg agaaaatgac 120 accaaaaagg gcggtggaaa acttttcaaa ggatcacctc cacatacgtg gagaaaatac 180 ttcaactaat cctaattatc ctggcaatcc aggatcacct ccacatacgt ggagaaaatg 240 cctagtgcct taccagcctc ggcaaaactg tgggatcacc tccacatacg tggagaaaat 300 ggaacaacgc tttctggtga 320

Claims (6)

A composition for discriminating Lactobacillus acidophilus YT1 strain, deposited with accession number KCCM11808P, comprising a forward primer represented by SEQ ID NO: 1 and a reverse primer represented by SEQ ID NO: 2. According to claim 1,
The forward primer further comprises at least one label selected from the group consisting of a 5'-terminal, fluorophore, chromophore, chemiluminescent group, magnetic particle and radioactive isotope. Kit for determining Lactobacillus acidophilus YT1 strain (Accession No. KCCM11808P) comprising the composition of claim 1. According to claim 3,
The kit is a kit comprising a buffer solution, DNA polymerase and dNTP. a) using the DNA separated from the sample to be identified as a template, and performing a polymerase chain reaction (PCR) using the composition of claim 1 to obtain a PCR product; And
b) analyzing the PCR product; a method for determining a Lactobacillus acidophilus YT1 strain comprising (Accession No. KCCM11808P). The method of claim 5,
The PCR product is characterized in that 300 to 350 bp.

Images