KR102134947B1 - METHOD FOR QUICK-DETECTING HLA ALLELES ASSOCIATED WITH ADVERSE DRUG REACTION USING tSNP - Google Patents

Abstract

The present invention relates to a method for detecting specific HLA alleles associated with adverse drug reactions (ADR), and more specifically HLA-A*3101, HLA-A*3303, HLA-B*1502 related to drug side effects , HLA-B*57, HLA-B*58, HLA-DQA1*02 and HLA-DRB1*07, the presence or absence of specific HLA alleles is quickly determined using a labeled SNP (tagging SNP, tSNP) and It relates to the use of these methods to assess the risk of developing adverse drug side effects such as Stevens-Johnson syndrome, toxic epidermal necrolysis, irritability syndrome, and severe liver damage.

Description

METHOD FOR QUICK-DETECTING HLA ALLELES ASSOCIATED WITH ADVERSE DRUG REACTION USING tSNP}

The present invention relates to a method for detecting a specific human leukocyte antigen (HLA) allele associated with adverse drug reaction (ADR), and more specifically HLA-A*3101, HLA-A* related to drug side effects Method to quickly determine the presence of specific HLA alleles of 3303, HLA-B*1502, HLA-B*57, HLA-B*58, HLA-DQA1*02 and HLA-DRB1*07 using tSNP and It relates to the use of these methods to evaluate the risk of developing adverse drug reactions.

Various drug hypersensitivity reactions (HSRs) or adverse drug reactions (ADRs) occur in drug selection and dosage used for treatment or diagnosis.

According to a widely cited meta-analysis, ADR accounts for 4 to 6 of the most common causes of death (Lazarou et al., JMA, 279(15):1200-1205, 1998), of which Skin ADR accounts for about 2-3% of all hospital admissions (see Bigby et al., JAMA, 256(24):3358-3363, 1986). This is a mild maculopapular (MPE) that adds to its severity, hypersensitivity syndrome (HSS), Steven-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). ; Lyells syndrome) and other life-threatening ADRs. The latter mortality rate can reach 40%.

HSS is characterized by multicenter involvement (eg, liver or kidney) with systemic findings (eg, fever, arthritis, eosinophilia and lymphadenopathy) in addition to skin rash (Roujeau et al., N. Engl. J. Med., 331:1272-1285, 1994). SJS and TEN, an immune complex mediated hypersensitivity disorder characterized by blistering rashes of purpura, and target-like lesions accompanied by spotting and skin detachment (Roujeau et al. , J Invest Dermatol, 1994, 102:28S-30S). These are mostly attributed to drugs such as sulfonamides, anticonvulsants, allopurinol, nonsteroidal anti-inflammatory agents and antimalarial agents (Roujeau et al., N. Engl. J. Med., 333(24):1600- 1607, 1995). Anticonvulsants (eg carbamazepine, phenytoin and phenobarbital) and allopurinol are the most common drugs that cause SJS/TEN.

With recent developments in pharmacological genomics, it has been suggested that susceptibility to various drug hypersensitivity reactions (HSRs) or drug side effects (ADRs) is associated with specific alleles. For example, it has been found that the genomic polymorphism of the thiopurine methyltransferase gene is closely related to ADR caused by azathioprine, a drug for rheumatoid disease or cancer (Yates et al., Ann.Intern. Med., 126(8):608-614, 1997).

It has also been suggested that the susceptibility to SJS/TEN/HSS caused by certain drugs is genetically determined (Gennis MA. Am. J. Med., 91(6):631-634, 1991); and [Edwards] SG, Postgrad.Med. J., 75(889):680-681, 1999). In particular, it has been revealed through many studies in recent years that it is associated with human leukocyte antigen (HLA).

Currently, the most commonly used method for genetic testing such as HLA is full sequencing, and identifying each subtype using this is time-consuming and initiates clinical treatment. It wasn't timely appropriate to use it before. In addition, expensive specific software was required to select each subtype, which required a high cost to determine the final HLA type. Currently, RT-PCR (real time PCR) method and allele specific PCR method are used, but this also has a risk of producing a false positive result.

Therefore, there is a need for a method of identifying a specific HLA subtype that exhibits drug hypersensitivity faster and cheaper.

Accordingly, the present inventors have quickly and effectively diagnosed subtypes of the HLA-A, B, DRB1 and DQA1 genes showing drug hypersensitivity in Asians, including Koreans, in order to quickly and effectively diagnose specific HLA-A, B, DRB1 and DQA1 labeled SNPs ( tagging SNP, tSNP), HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58, HLA-DQA1*02 and HLA -The present invention was completed after confirming that the DRB1*07 type can be detected quickly and accurately.

1. Gennis MA, Am. J. Med., 91(6):631-634, 1991; Edwards SG, Postgrad. Med. J., 75(889):680-681, 1999

The object of the present invention is HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58, using specific tSNPs of HLA-A, B, DRB1 and DQA1, It is to provide a method for quickly detecting subtypes of HLA-DQA1*02 and HLA-DRB1*07 and a kit for the same.

Another object of the present invention is to provide risk prediction and diagnostic information for drug side effects using the above method.

Another object of the present invention is to provide a method for identifying a drug causing drug side effects using the above method.

The present invention is based on the fact that various drug hypersensitivity reactions (HSRs) or adverse drug reactions (ADR) are associated with human leukocyte antigens (HLA), HLA-A, HLA-B, A method for quickly and accurately analyzing the presence of specific alleles of HLA-DQA1 and HLA-DRB1, i.e., HLA-A, HLA-B, HLA-DQA1 and HLA-DRB1, and thus a method for evaluating the risk of drug side effects Gives

In particular, important sequences identifying HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58, HLA-DQA1*02 and HLA-DRB1*07 (labels) In order to find the tagging sequence and re-determine the detailed types, tSNP is selected and used using an SNP marker.

In one embodiment, the present invention is HLA-A gene (NCBI Reference Sequence: NG_029217.2) 368 th nucleotide, 536 th nucleotide, 593 th nucleotide and 954 th nucleotide, HLA-B gene (NCBI Reference Sequence: NG_023187.1 ) 384 nucleotides, 667 nucleotides and 2156 nucleotides, HLA-DQA1 gene (NCBI Reference Sequence: NG_032876.1) 91 nucleotides and HLA-DRB1 gene (NCBI Reference Sequence: NG_029921.1) to 8240 nucleotides Characterized by identifying one or more nucleotides selected from the group consisting of, drug side effects (ADR) related genes HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B A method for detecting SNP of one or more HLA alleles selected from the group consisting of *58, HLA-DQA1*02 and HLA-DRB1*07 is provided.

In particular, for fast and accurate detection, HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58, HLA-DQA1*02 and HLA-DRB1*07 Characterized in that using a label sequence and tSNP for polymorphism detection of one or more HLA alleles selected from the group consisting of.

Preferably, tSNP for identification of 368th nucleotide, 536th nucleotide, 593th nucleotide, and 954th nucleotide of HLA-A gene (NCBI Reference Sequence: NG_029217.2) is HLA-A*3001.4, HLA-A*3101 , HLA-A*3303, HLA-A*3001.7, and any other combination selected from the group consisting of other haplotypes.

TSNPs for identification of 384 nucleotides, 667 nucleotides, and 2156 nucleotides of the HLA-B gene (NCBI Reference Sequence: NG_023187.1) are HLA-B*1502, HLA-B*57, HLA-B*58 haplotype It may be any one combination selected from the group consisting of.

The tSNP for identification of the 91st nucleotide of the HLA-DQA1 gene (NCBI Reference Sequence: NG_032876.1) may be any combination selected from the group consisting of a combination of HLA-DQA1*02 haplotypes.

The tSNP for identification of the 8240 nucleotide of the HLA-DRB1 gene (NCBI Reference Sequence: NG_029921.1) may be any combination selected from the group consisting of a combination of HLA-DRB1*07 haplotypes. The tSNP of the HLA-DRB1 gene can be used together with the 473 th nucleotide of the HGF gene (NCBI Reference Sequence: NC_000017.11) as an amplification control tSNP using an allele specific amplification primer.

The method of the present invention may be performed by a SNAPshot analysis method. In this case, when using the snapshot analysis method, one or more primer pairs selected from the group consisting of primers of SEQ ID NOs: 13 to 22 may be used.

Each subtype of HLA-A, HLA-B, HLA-DQA1 and HLA-DRB1 can be detected separately or together.

In addition, the present invention is another embodiment, for performing the above method, characterized in that it comprises at least one primer pair selected from the group consisting of SEQ ID NO: 1 to 12, drug side effects (ADR) related gene HLA-A* SNP detection of one or more HLA alleles selected from the group consisting of 3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58, HLA-DQA1*02 and HLA-DRB1*07 Kit.

The kit may further contain a labeling material such as a DNA polymerase and dNTP (dATP, dCTP, dGTP and dTTP), fluorescent material.

In addition, the present invention, as another embodiment, provides a method for providing information for predicting the risk of drug side effects.

These are the drug side effects (ADR) related genes HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58, HLA-DQA1*02 and Identifying the presence of one or more HLA alleles selected from the group consisting of HLA-DRB1*07; And determining that there is a risk of drug side effects when the HLA allele is present.

In this case, the drug may be one selected from the group consisting of abacavir, allopurinol, carbamazepine, lapatinib, and similar drugs, and side effects of the drug include Steven-Jhonson syndrome and toxic epidermal necrosis ( Toxic epidermal necrolysis) and severe liver damage are typical examples.

In addition, in a similar aspect, the present invention provides HLA-A*3101, HLA-*3303, HLA-B1502, HLA-B*57, by the SNP detection method from a sample of a patient holding an HLA allele associated with drug side effects. A method for identifying a drug causing adverse drug reaction, comprising the step of confirming the presence of one or more HLA alleles selected from the group consisting of HLA-B*58, HLA-DQA1*02 and HLA-DRB1*07 Can provide.

As such, the present invention provides rapid and accurate HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58, HLA-DQA1*02 and HLA-DRB1*07. Includes all uses including detection methods and drug side effects assessment, drug identification, etc. that can utilize these results.

Determining alleles of HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58, HLA-DQA1*02 and HLA-DRB1*07 according to the present invention This diagnostic method is particularly accurate for Asians, including Koreans, and can be quickly and easily diagnosed to prevent drug hypersensitivity reactions in advance and to be used to increase the effectiveness and success rate of treatment with alternative drug administration. Can.

Figure 1 shows the combination of the results of HLA-A*3101 and HLA-A*3303 detection according to the method of the present invention and tSNP therefor.
2 shows the results of HLA-B*1502, HLA-B*57 and HLA-B*58 detection and a combination of tSNP for this.
3 shows the HLA-DQA1*02 detection result and the combination of tSNP for this.
Figure 4 shows the combination of HLA-DRB1*07 detection results and tSNP for this.
5 shows the results of simultaneously detecting HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57 and HLA-B*58 and a combination of tSNPs therefor.
6 shows the result of simultaneously detecting HLA-DQA1*02 and HLA-DRB1*07 and the combination of tSNP for this.
7 to 10 show the combination of HLA-A*3101 and HLA-A*3303 detection information and tSNP for this according to the method of the present invention, and the position of each SNP is shown in dark red.
11 to 13 show HLA-B*1502, HLA-B*57 and HLA-B*58 detection information according to the method of the present invention, and a combination of tSNPs therefor.
14 to 15 show the combination of HLA-DQA1*02 and HLA-DRB1*07 detection information and tSNP for this.

Definitions of terms used in the present invention are as follows.

'Genetic polymorphism' refers to a case where a genetic variation occurs at a frequency of at least 1% or more in a population. The insertion, loss, or substitution of a single nucleotide in DNA is called single nucleotide polymorphism (SNP).

The term'polymorphism' refers to the arrangement in the sequence of genes that change within a cluster. Polymorphism is made up of different “alleles”. The placement of this polymorphism can be confirmed by its position in the gene and the different amino acids or bases found therein. This amino acid variation is the result of two different alleles, two possible variant bases, C and T. Since the genotype consists of two different distinct alleles, any of several possible variants can be observed in any one individual (e.g., CC, CT or TT in this example), individual polymorphisms Also designated unique identifiers, which are known to those skilled in the art and are used, for example, in the Single Nucleotide Polymorphism Database (dbSNP) of Nucleotide Sequence Variation of nucleotide base variants available on the NCBI website. SNP”, “refSNP” or “rs#).

The term “genotype” refers to a specific allele of a specific gene in a cell or tissue sample. 'Phenotype' refers to the morphological, physiological, or biochemical characteristics of an individual determined by a genotype. The genotype is distinct from the phenotype, and refers to the individual's genetic makeup. In a narrower sense, it refers to alleles present on one gene.

“Allele” or “allele” means one or more alternative forms of a gene that occupy the same chromosomal locus. The equivalent genetic marker of an allele is a genetic marker associated with the allele of interest, ie, it exhibits a linkage disequilibrium with the allele of interest.

'Allele frequency' refers to the frequency (percentage or percentage) in which an allele exists in an individual, within a lineage, or within a population of lineages. It can be estimated by averaging the allele frequency within a lineage or population or the allele frequency of a sample of individuals from a lineage or population.

'Risk' indicates that the incidence of a disease or condition in an individual with a specific polymorphic allele is statistically high compared to the frequency of occurrence of a disease or condition in a member of an individual without a specific polymorphic allele.

“Nucleic acid” refers to a polynucleotide or oligonucleotide such as deoxyribonucleic acid (DNA), and ribonucleic acid (RNA), if appropriate. The term also equally refers to analogs of either RNA or DNA prepared from nucleotide analogs (eg, peptide nucleic acids), and single (sense or antisense) and double helix polynucleotides, as applied to the described embodiments. Includes. In the present invention, the term'nucleic acid' and'nucleotide' are used in combination.

'Primers' are oligonucleotide sequences that hybridize to complementary RNA or DNA target polynucleotides and serve as a starting point for the stepwise synthesis of polynucleotides from mononucleotides, for example by the action of nucleotidyltransferases that occur in polymerase chain reactions. Means

The term “functional equivalent” refers to, for example, one or more substitutions, deletions or additions from a reference sequence, a net effect that does not result in various functional dissimilarities between the reference sequence and the subject sequence. Etc. It means both the nucleotide and nucleic acid sequences of the changed mutant sequence. Preferably, the nucleotide sequence has at least about 65% identity, more preferably at least about 75% identity, and most preferably about 95% identity. For the purposes of the present invention, sequences having shout characteristics that are substantially equivalent to biologically equivalent biological activity are treated as substantial equivalents.

“Subject” or “patient” refers to any single individual in need of treatment, including humans, cattle, dogs, guinea pigs, rabbits, chickens, and insects. In addition, the subject includes any subject who participated in a clinical study trial that did not show any disease clinical findings, or who participated in epidemiological studies or used as a control. In one embodiment of the present invention, a human was targeted.

“Tissue or cell sample” means a collection of similar cells obtained from a subject or patient's tissue. Sources of tissue or cell samples may include fresh, frozen and/or preserved organ or tissue samples or solid tissue from biopsies or aspirates; Blood or any blood component; It can be a cell at any time in the subject's pregnancy or development. The tissue sample can also be primary or cultured cells or cell lines.

All technical terms used in the present invention, unless defined otherwise, are used in the sense as commonly understood by those skilled in the art in the relevant field of the present invention. In addition, although a preferred method or sample is described herein, similar or equivalent ones are included in the scope of the present invention. The contents of all publications described by reference herein are incorporated into the present invention.

Hereinafter, the present invention will be described in detail.

HLA-ADR relevance

With recent advances in pharmacogenomics, it has been found that susceptibility to adverse drug reactions (ADRs) is associated with specific alleles, whereby the detection of ADR-related alleles in patients assesses their risk of developing ADR. Suggests that this is a useful approach to ships.

The present invention is based on the fact that various drug hypersensitivity reactions (HsRs) or drug side effects (ADR) are associated with human leukocyte antigens (HLA), in particular HLA-A, HLA-B, HLA-DQA1 and HLA-DRB1 It relates to a method for rapidly and accurately analyzing the presence of a specific allele of a specific subtype, HLA-A, HLA-B, HLA-DQA1 and HLA-DRB1, and thus a method for evaluating the risk of drug side effects.

Due to the genetic properties of HLA, there are over 3900 HLA-A, 4800 HLA-B, over 90 HLA-DQA1, and over 2100 HLA-DRB1 subtypes, and these changes in one or more different HLA sequences To determine the type (see http://hla.alleles.org/nomenclature/stats.html).

(i) HLA-A*3101 acts as a marker for carbamazepine (CBZ)-induced Steven Johnson-induced Stevens-Jhonson syndrome/toxic epidermal necrolysis (SJS/TEN).

(ii) HLA-A*3303 is a haploid equivalent genetic marker of HLA-B*58, in the group having HLA-A*3303 subtype in patients who do not have HLA-B*58 when taking allopurinol Drug hypersensitivity is observed.

(iii) HLA-B*1502 serves as a marker for carbamazepine (CBZ)-induced Steven Johnson-induced Stevens-Jhonson syndrome/toxic epidermal necrolysis (SJS/TEN).

(iv) HLA-B*57 causes hypersensitivity to abacavir.

(v) HLA-B*58 is a type closely related to allopurinol-induced Steven Johnson syndrome/allopurinol induced SJS/TEN. In particular, HLA-B*58 is a gene with a high expression rate of about 6.5% in Koreans, and HLA-B*58 is one of the important predictors of the clinically immunophenotype, hyperuricemia. It is associated with the hypersensitivity of allopurinol used in the treatment of recurrent gout. People who are positive for HLA-B*58 are significantly more likely to cause side effects of severe skin medications, such as Stephen Johnson syndrome or toxic epidermal necrosis, when administered allopurinol compared to negative patients.

(vi) HLA-DQA*02 is associated with inducing Lapatinib-induced hepatotoxicity, a drug prescribed for breast cancer patients overexpressing HER2 (ERBB2). People who are positive for HLA-DQA1*02 are significantly more likely to cause drug side effects such as severe liver damage when administered lapatinib than patients who are negative.

(vii) HLA-DRB1*07 is associated with inducing lapatinib-induced hepatotoxicity, a drug prescribed for patients with breast cancer who overexpress ER2 (ERBB2). People who are HLA-DRB1*07 positive are significantly more likely to cause drug side effects such as severe liver damage when administered lapatinib than patients who are negative.

As such, the types of HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58, HLA-DQA1*02 and HLA-DRB1*07 are abacavir, HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B, since it functions as a marker that is closely related to drug-related side effects such as allopurinol, carbamazepine, and lapatinib *58, through analysis of HLA-DQA1*02 and HLA-DRB1*07, it can be used as an index to evaluate the risk of side effects of the drugs. For example, the presence of HLA-B*58 is an indicator of the risk of SJS/TEN or HSS caused by allopurinol compounds, other compounds structurally similar to allohulinol, or their metabolites.

Method of analysis

The present invention provides the specific alleles HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA- of the human leukocyte antigen (HLA) associated with drug side effects (ADR) in one aspect. A method for quickly and accurately detecting B*58, HLA-DQA1*02 and HLA-DRB1*07 and uses thereof.

Alleles can be detected, for example, by directly detecting regions/nucleotides in alleles using genomic DNA prepared from biological samples such as blood, saliva, urine, or hair. Alleles can also be detected by, for example, serological methods or microcytotoxicity.

It can also be determined by the detection of the equivalent genetic marker of the allele, the equivalent genetic marker being, for example, a single base polymorphism (SNP), a microsatellite marker or other type of It is a genetic polymorphism. In the present invention, the use of SNP is preferred. The equivalent genetic marker of an allele is a genetic marker associated with the allele of interest, ie, it exhibits a linkage disequilibrium with the allele of interest. That is, the presence of the allele itself as well as the HLA-B*58 or HLA-B*57 haplotype may be an indicator of drug side effects. For example, examples of equivalent genetic labels of HLA-B*58 include HLA-A*3303, HLA-Cw*0302, and MICA*00201.

The presence of genetic markers, such as the HLA allele, can be determined by direct detection of a marker or specific region therein. For example, SNP analysis may be performed using a real-time PCR system, or may be performed through determination of a nucleotide sequence of a direct nucleic acid by a dideoxy method, or a probe comprising a sequence of an SNP site, or The nucleotide sequence of the polymorphic site is determined by hybridizing a probe complementary thereto with the DNA and measuring the degree of hybridization obtained therefrom, or an allele-specific probe hybridization method, an allele-specific amplification method (allele- specific amplification, sequencing, 5'nuclease digestion, molecular becon assay, oligonucleotide ligation assay, size analysis And single-strand conformation polymorphism.

DNA products obtained from PCR can be detected using sequence specific probes such as, for example, hydrolysis probes (Taqman, Becons, Scorpions), conformation probes. These probes are designed to bind to the region of interest, for example HLA-B*58. The PCR product can also be detected by a DNA-binding agent.

The presence of the allele of interest can also be determined by detection of the equivalent genetic marker of the allele. Genetic markers close to the allele of interest tend to co-segregate with the allele or show linkage imbalance. Therefore, the presence of these markers (equivalent genetic markers) is an indicator of the presence of the allele of interest, and thus an indicator of the risk of developing ADR.

Useful equivalent genetic markers are usually about 200 kb or less from the allele of interest (eg, 100 kb, 80 kb, 60 kb, 40 kb or 20 kb). The presence or absence of equivalent genetic labels can be detected using the methods described above or methods known in the art.

In addition, RNA, cDNA, or protein products of alleles of interest can be detected to determine the presence or absence of the allele.

Use tSNP

As described above, the presence of the HLA allele of interest can be detected by sequence-based genotyping (SBT) or allele-specific PCR in various well-known methods, but the SBT method takes a long time to read. , Requires a special program for reading, and implies the possibility of errors by allele-specific PCR. However, certain alleles to be detected in the present invention HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58, HLA-DQA1*02 and HLA-DRB1 The sub-type of *07 is analyzed using tSNP, and is a method of reducing SBT, so it is efficient in accuracy and time reduction.

It is used to analyze the structure of haplotypes in genes and SNPs representing each haplotype, and to analyze effective genome-side related structures.

Therefore, the present invention uses the tSNP of HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58, HLA-DQA1*02 and HLA-DRB1*07. Characterized by, it provides a method for quickly analyzing the HLA allele.

The high-speed analysis methods of the present invention are genotypes of HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58, HLA-DQA1*02 and HLA-DRB1*07 Using a tagging sequence capable of specifically detecting (polymorphism), the 368th nucleotide, 536th nucleotide, 593th nucleotide and 954th nucleotide of the HLA-A gene (NCBI Reference Sequence: NG_029217.2) , HLA-B gene (NCBI Reference Sequence: NG_023187.1) 384 nucleotides, 667 nucleotides and 2156 nucleotides, HLA-DQA1 gene (NCBI Reference Sequence: NG_032876.1) 91 nucleotides and HLA-DRB1 gene ( The genotype of nucleotides at one or more positions selected from the group consisting of 8240 nucleotides of NCBI Reference Sequence: NG_029921.1) is confirmed to HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B *57, HLA-B*58, HLA-DQA1*02 and HLA-DRB1*07.

At this time, a single HLA-A*3101, HLA-A*3303 was identified by genotyping of the 368th nucleotide, 536th nucleotide, 593th nucleotide, and 954th nucleotide of the HLA-A gene (NCBI Reference Sequence: NG_029217.2). Whether the polymorphism (SNP) is retained, and the nucleotide at one or more positions selected from the group consisting of 384 nucleotides, 667 nucleotides, and 2156 nucleotides of the HLA-B gene (NCBI Reference Sequence: NG_023187.1) By genotyping, it is possible to determine whether HLA-B*1502, HLA-B*57, HLA-B*58 possess single base polymorphism (SNP). In addition, the HLA-DQA1 gene (NCBI Reference Sequence: NG_032876.1) of the single base polymorphism (SNP) of HLA-DQA1*02 is confirmed by confirming the genotype of a nucleotide at one or more positions selected from the group consisting of 91 nucleotides Single base polymorphism of HLA-DRB1*07 by confirming the genotype of a nucleotide at one or more positions selected from the group consisting of 8240 nucleotides of the HLA-DRB1 gene (NCBI Reference Sequence: NG_029921.1) SNP). The tSNP of the HLA-DRB1 gene can be used together with the 473 th nucleotide of the HGF gene (NCBI Reference Sequence: NC_000017.11) as an amplification control tSNP using an allele specific amplification primer.

The HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58, HLA-DQA1*02 and HLA-DRB1*07 are detected separately or together. can do.

Therefore, the present invention is a method for detecting the SNP (single base polymorphism) of the HLA allele, (a) HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA- Determining SNPs capable of specifically detecting the genotypes B*58, HLA-DQA1*02 and HLA-DRB1*07; (b) performing multiple polymerase chain reactions to amplify HLA-A, HLA-B, HLA-DQA1 and HLA-DRB1; (c) performing a Snapshot (SNaPshot) analysis method using multiple single-base primers to analyze the SNP for the product to identify a genotype, wherein the multiple polymerase chain reaction in step (b) is the HLA-A is specifically amplified using primer pairs of SEQ ID NOs: 1 and 2, HLA-B is specifically amplified using primer pairs of SEQ ID NOs: 3 to 6, and primer pairs of SEQ ID NOS: 7 and 8 are used. HLA-DQA1 is specifically amplified by using a primer pair of SEQ ID NOs: 9 and 10, and HLA-DRB1 is specifically amplified, in step (c), the multiple single-base primers are SEQ ID NOs: 13 to 22 Using any one primer selected from the group consisting of, in step (c), genotyping is confirmed, the allele of *3101 at 368th nucleotide of the HLA-A gene (NCBI Reference Sequence: NG_029217.2) is G or A, alleles of *3101, *3301, *3303 at 536th nucleotide G or A, alleles of *3001, *3002, *3004 at 593th nucleotide T, C or A, and 954th nucleotide * Alleles of 3301, *3307 are T or C; Alleles of *57, *58 at the 384th nucleotide of the HLA-B gene (NCBI Reference Sequence: NG_023187.1) are C or G, *57 at the 667th nucleotide, and the allele of *58 is G or A, and 2156 *1502 allele at the nucleotide A or T; The allele of *02 at the 91 nucleotide of the HLA-DQA1 gene (NCBI Reference Sequence: NG_032876.1) is A or G; And identifying whether the allele of *07 is G or A at 8240 nucleotides of the HLA-DRB1 gene (NCBI Reference Sequence: NG_029921.1).

In one embodiment, the method may be performed as follows.

(a) The label sequence is confirmed.

Refer to known genomic DNA sequences such as http://hla.alleles.org/alleles/index.html HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA- The label sequences capable of specifically detecting the genotypes of B*58, HLA-DQA1*02 and HLA-DRB1*07 are determined.

(b) Then, specific regions of desired HLA-A, HLA-B, HLA-DQA1 and HLA-DRB1 are amplified.

In one embodiment of the present invention, exon 2 to 4 of HLA-A, exon 2 to 4 and 6 to 7 of HLA-B, exon 1 of HLA-DQA1, exon 2 of HLA-DRB1, and HGF Only axon 2 was amplified. At this time, a suitable known method can be selected and used. For example, a method such as multiplex polymerase chain reaction (multix PCR) can be used.

In the examples of the present invention, primer sets of SEQ ID NOs: 1 to 12 as described below were used for the amplification.

HLA-A_F: 5'- CGCCGAGGATGGCCGTC -3' (Forward: SEQ ID NO: 1)

HLA-A_R: 5'- GGAGAACYAGGCCAGCAATGATGCCC 3'(reverse direction: SEQ ID NO: 2)

HLA-B_E2F: 5'- GGGCGCACGACCYGRGGA 3'(Forward: SEQ ID NO: 3)

HLA-B_E4R: 5'- GAAAGGAGGGGAAGATGAGG 3'(reverse: SEQ ID NO: 4)

HLA-B_E6F: 5'- TCCCTGCCTCATTACTGGGAAGCAG 3'(Forward: SEQ ID NO: 5)

HLA-B_E7R: 5'- TGGTTAGTCATGGTAAGCGATG 3'(reverse direction: SEQ ID NO: 6)

HLA-DQA1_F: 5'- GCAGGGTTTGGTTTGGGTG 3'(Forward: SEQ ID NO: 7)

HLA-DQA1_R: 5'- TCTGGTTTCCTGAAGGAGRAACA 3'(reverse direction: SEQ ID NO: 8)

HLA-DRB1_F: 5'- CCTGTGGCAGGGTAAGTATA 3'(Forward: SEQ ID NO: 9)

HLA-DRB1_R: 5'- CCCGTAGTTGTGTCTGCACAC-3' (reverse direction: SEQ ID NO: 10)

HGF_F: 5'- CAGTGCCTTCCCAACCATTCCCTTA 3'(Forward: SEQ ID NO: 11)

HGF_R: 5'- ATCCACTCACGGATTTCTGTTGTGTTTC 3'(reverse direction: SEQ ID NO: 12)

The primer pairs of SEQ ID NOs: 1 and 2 are HLA-A specific primers, and the primer pairs of SEQ ID NOs: 3 to 6 are HLA-B specific primers. In addition, primer pairs of SEQ ID NOs: 7 and 8 are HLA-DQA1 specific primers, primer pairs of SEQ ID NOs: 9 and 10 are HLA-DRB1 specific primers, and primer pairs of SEQ ID NOs: 11 and 12 are HGF specific primers.

The present invention includes such primer sets and uses thereof.

(c) SNP is analyzed by performing a snapshot analysis method through multiple single-base primer extension.

HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58, HLA-DQA1*02 and HLA-DRB1*07 can be distinguished from the primers to be used in this step. It is designed to be aligned in front of tSNP, and an expansion reaction is performed using the primer at multiple single-base polymorphism (SNP) sites.

The multiple single base primers used in one embodiment of the present invention are SEQ ID NOs: 13 to 22, and their sequence and use are also included in the scope of the present invention.

HLA-A_368F: 5'- GTGGATAGAGCAGGAG 3'(Forward: SEQ ID NO: 13)

HLA-A_5376R: 5'- TTTTTTTTTGGATCTCGGACCCGGAGACTGTGGG 3'(reverse direction: SEQ ID NO: 14)

HLA-A_593R: 5'- TTTTTTTTTTTTTTTTTTAAAGGCGCCTGGGCCTCTCCCGGG 3'(reverse direction: SEQ ID NO: 15)

HLA-A_954R: 5'- TTTTGCAGCGTCTCCTTCCCGTTCTCCAGGT 3'(Reverse: SEQ ID NO: 16)

HLA-B_384F: 5'- TTTTTTTTTTTTTTTTTTTTTTTCAGGAGGGGCCGGAGTATTGGGAC 3'(Forward: SEQ ID NO: 17)

HLA-B_667F: 5'- TTTTTTTTTTTTTTTTTTTTTTTAGTTGAGGCCAAAATCCCCGCGGGTTGGTC -3' (Forward: SEQ ID NO: 18)

HLA-B_2156F: 5'- TTTTTTTTTTTTTTTTTTTTTTTTTTTAGGGTCCCAGGCTGCGTTAGCCCCTGTG 3'(Forward: SEQ ID NO: 19)

HLA-DQA1_91F:5'- GGCATTGTGGGTGAGTGC 3'(Forward: SEQ ID NO: 20)

HLA-DRB1_8240F:5'- GAGTACCGGGCGGTGACGGAGCT 3'(Forward: SEQ ID NO: 21)

HGF_473F:5'-TTTTTTTTGCTGGGAAATAAGAGGAGGAGAC-3' (Forward: SEQ ID NO: 22)

And by analyzing peaks for single base polymorphism (SNP) for the product, HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58 , It is determined whether each allele of HLA-DQA1*02 and HLA-DRB1*07.

In one embodiment of the present invention, the following results were obtained.

Allele G or A of *3101 at 368th nucleotide of the HLA-A gene (NCBI Reference Sequence: NG_029217.2); Alleles T or G or A of *3101, *3301, *3303 at 536th nucleotide; Alleles T, C or A of *3001, *3002, *3004 at 593 nucleotides; Alleles T or C of *3301 and *3307 were identified at 954th nucleotide.

Of the HLA-B gene (NCBI Reference Sequence: NG_023187.1), the 384th nucleotide allele C or G at *57, *58, and the 667th nucleotide allele G or A were identified, and the *1502 allele at the 2156th nucleotide A or T was identified.

Allele A or G of *02 was identified in the 91st nucleotide of the HLA-DQA1 gene (NCBI Reference Sequence: NG_032876.1).

HLA-DRB1 gene (NCBI Reference Sequence: NG_029921.1) at 8240 nucleotides allele G or A of *07 was identified, and at 473 nucleotides of the internal control gene HGF gene (NCBI Reference Sequence: NC_000017.11) Factor T was confirmed.

As such, HLA-A gene (NCBI Reference Sequence: NG_029217.2), HLA-B gene (NCBI Reference Sequence: NG_023187.1), HLA-DQA1 gene (NCBI Reference Sequence: NG_032876.1), HLA-DRB1 gene (NCBI HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B by identifying the genotype at the specific position in the Reference Sequence: NG_029921.1) and the HGF gene (NCBI Reference Sequence: NC_000017.11) *57, HLA-B*58, HLA-DQA1*02 and HLA-DRB1*07 can be determined to be retained or not.

In addition, the presence of the specific allele (polymorphic marker) present in each specific exon region of HLA-A, HLA-B, HLA-DQA1 and HLA-DRB1 may serve as a criterion for determining a corresponding drug side effect.

Thus, detection of such tSNP markers by any available method can be used to aid diagnostic purposes, such as early detection of susceptibility to drug side effects, prognosis for patients, diagnosis and treatment.

Another aspect of the invention by the above method is the method of pharmacogenomic profiling. “Pharmacogenomic profiling” refers to the determination of a genetic factor present in a subject, which is associated with a disease or medical condition, particularly adverse effects on the drug. The method is at least selected from the group consisting of HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58, HLA-DQA1*02 and HLA-DRB1*07. And determining the presence of one HLA allele. The method may include determination of other genetic factors as needed. Such other genetic factors may be associated with predisposition to any disease or medical condition, including ADR.

Kit

On the other hand, the present invention in another aspect, the HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58, HLA-DQA1*02 and HLA-DRB1 It relates to a kit for performing a specific HLA allele analysis method of *07 and a method for determining the presence of them.

The kit comprises one or more from the group consisting of HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58, HLA-DQA1*02 and HLA-DRB1*07 Includes probes for HLA allele detection.

Probe means "any substance useful for detecting other substances" herein. Thus, the probe can be an oligonucleotide or a conjugated oligonucleotide that specifically hybridizes to a specific region within the allele of interest. Conjugated oligonucleotides refer to oligonucleotides that covalently bind chromophores or ligand-containing molecules (eg, antigens), which are highly specific to receptor molecules (eg, antigen-specific antibodies). The probe can be a PCR primer to amplify a specific region in the allele of interest, along with other primers. Furthermore, the probe may be an antibody that recognizes the allele of interest or the protein product of the allele.

The kit may further include tools and/or reagents for collecting a biological sample from a patient, as well as tools and/or reagents for preparing genomic DNA, RNA, cDNA or protein from the sample. For example, PCR primers for amplifying a region of interest in genomic DNA may be included. The kit can include probes for genetic factors useful for pharmacogenomic profiling. In addition, in the use of such kits, labeled oligonucleotides can be readily identified during analysis. Examples of labels that can be used include radioactive labels, enzymes, fluorescent compounds, streptavidin, avidin, biotin, magnetic moieties, metal binding moieties, antigen or antibody moieties, and the like.

In particular, in the present invention, in the group consisting of HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58, HLA-DQA1*02 and HLA-DRB1*07 It is preferred to include a set of primers for amplification of tSNP and labeled single base polymorphic regions of one or more HLA alleles, for example primer sets represented by SEQ ID NOS: 1-12.

ADR evaluation

In addition, in another aspect, the present invention relates to a method for evaluating the risk of causing drug side effects in a patient in response to a drug, including HLA type typing using a biological sample from a patient by the above method.

That is, the presence of the genetic markers, HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58, HLA-DQA1*02 and HLA-DRB1*07, or Provides a method for evaluating whether a patient has a risk of developing adverse drug reactions (eg, Stevens-Johnson syndrome, toxic epidermal necrolysis, or irritability syndrome) based on absence. The presence of alleles is an indicator of the risk of side effects.

The drug is preferably selected from the group consisting of abacavir, allopurinol, carbamazepine, lapatinib and these similar drugs.

The drug compound herein, the drug compound itself, or at least one hydrogen in the drug, halo, hydroxy, acylamino, alkyl, alkenyl, alkynyl, alkoxy, aryloxy, aryl, aryloxyaryl, carboxy, Carboxyalkyl, carboxy-substituted alkyl, carboxy-cycloalkyl, carboxy substituted cycloalkyl, carboxyaryl, carboxy-substituted aryl, carboxyheteroaryl, carboxy-substituted heteroaryl, carboxyheterocyclic, carboxy-substituted hetero Between cyclic, cycloalkyl, substituted alkyl, substituted alkoxy, substituted aryl, substituted aryloxy, substituted aryloxyaryl, substituted cycloalkyl, heteroaryl, substituted heteroaryl, heterocyclic or substituted hetero It means the same compound as the drug except that it is substituted with a click group. The number of carbon atoms contained in the substituent may be 0 to 10, 0 to 6, 0 to 4, or 0 to 2.

If the probability of developing ADR for the drug is higher than that of the general population, the patient is at risk of ADR.

The patient's probability of developing ADR is at least about 1.5 times, more preferably at least about 2 times, even more preferably at least about 3, 4, 5, 6, 7, 8 or 9 times the probability of developing ADR in the general population, And most preferably at least about 10 times. The probability may be determined using any method known in the art, such as using the incidence of risk factors.

ADR's “risk” factor is ADR-related. The sensitivity of the risk factor is preferably at least about 40%, more preferably at least about 50%, 60%, 70%, 80%, 85% or 90%. Most preferably, the sensitivity is at least 95%. The “sensitivity” of a risk factor to predict ADR is the percentage of ADR patients who have that risk factor. For example, if all SJS patients have allele A, the sensitivity of the allele A to predict SJS is 100%. If 20 of the 40 SJS patients have allele B, then the sensitivity of allele B to predict SJS at that time is 50%.

HLA alleles associated with ADR, HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58, HLA-DQA1*02 and with a sensitivity of at least about 40% HLA-DRB1*07 can be used as a risk factor in the present invention. Preferably, the sensitivity of the risk factor is at least about 50%, 60%, 70%, 80%, 85% or 90%. More preferably, the sensitivity is at least 95%.

The present invention also relates to HLA alleles associated with ADR HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58, HLA-DQA1*02 and HLA-DRB1 Includes methods for identifying similar compounds that cause ADR (eg, SJS/TEN, HSS, severe liver damage, etc.) in patients with *07.

It is suggested that the drug can be presented by any HLA complex that activates T lymphocytes and as a result induces ADR. It has been suggested that T cells responsive to these drugs are involved in the development of ADRs caused by these drugs. Thus, compounds capable of activating these T cells are one or more HLA alleles associated with these ADRs HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B* 58, a candidate compound that causes ADR in patients with HLA-DQA1*02 and HLA-DRB1*07. Consequently, this method can be used as a screening method in the development of new drugs to find drug compounds capable of causing such ADR.

As such, the present invention provides rapid and accurate HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58, HLA-DQA1*02 and HLA-DRB1*07. Includes all uses including detection methods and drug side effects assessment, drug identification, etc. that can utilize these results.

<Example>

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as limited by these examples.

Unless otherwise indicated, nucleic acids are recorded in a 5'->3' orientation from left to right. Numeric ranges listed within the specification include numbers defining the ranges, and include each integer or any non-integer fraction within the defined ranges.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in practice to test the present invention, preferred materials and methods are described herein.

Example 1: Confirmation of the label sequence

HLA-A, HLA-B, HLA-DQA1 and HLA-DRB1 sequences identified in Korean using http://hla.alleles.org/alleles/index.html (HLA-A: Release 3.11.0, 18 ^th Alignment (January 2013, HLA-B: Release 3.7.0, 12 ^th January 2012, HLA-DQA1: Release 3.26.0, 14 ^th October 2016, and HLA-DRB1: Release 3.20.0, 17 ^th April 2017) ) To specifically detect genotypes of HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58, HLA-DQA1*02 and HLA-DRB1*07 The label sequence that can be determined was determined, and the results are shown in dark red letters in FIGS. 7 to 15.

Example 2: multiplex polymerase chain reaction (multiplex polymerase chain reaction, multiplex PCR)

Various HLA-A exons 2 to 4, HLA-B exons 2 to 4, 6 to 7, HLA-DQA1 exons 1 and HLA-DRB1 exons 2 and HGF exons 2 Use HLA-A_F primer (5'- CGCCGAGGATGGCCGTC 3', SEQ ID NO: 1) and HLA-A_R primer (5'- GGAGAACYAGGCCAGCAATGATGCCC 3', SEQ ID NO: 2), which are HLA-A specific primers that can be distinguished from HLA classes. And HLA-B specific primer HLA-B_E2F primer (5'-GGGCGCACGACCYGRGGA 3', SEQ ID NO: 3), HLA-B_E4R primer (5'- GAAAGGAGGGGAAGATGAGG 3', SEQ ID NO: 4), HLA-B_E6F primer (5' -TCCCTGCCTCATTACTGGGAAGCAG 3', SEQ ID NO: 5), HLA-B_E7R primer 5'-TGGTTAGTCATGGTAAGCGATG 3', SEQ ID NO: 6) were used. In addition, HLA-DQA1 specific primers HLA-DQA1_F primer (5'-GCAGGGTTTGGTTTGGGTG 3', SEQ ID NO: 7) and HLA-DQA1_R primer (5'- TCTGGTTTCCTGAAGGAGRAACA 3', SEQ ID NO: 8) were used, and HLA-DRB1 The specific primer HLA-DRB1_F primer (5'-CCTGTGGCAGGGTAAGTATA 3', SEQ ID NO: 9) and the HLA-DRB1_R primer (5'- CCCGTAGTTGTGTCTGCACAC-3', SEQ ID NO: 10) were used, HGF_F, a specific primer of HGF Primers (5'- CAGTGCCTTCCCAACCATTCCCTTA 3', SEQ ID NO: 11) and HGF_R primers (5'- ATCCACTCACGGATTTCTGTTGTGTTT1C 3', SEQ ID NO: 12) were used. The polymerase chain reaction was performed using ABI 9700 (Applied Biosystems, Foster, USA).

For the HLA-A gene, a total of 50 ul of the reaction solution is 100 ng of the request sample, 5 ul of the 10X EF tag reaction buffer, 0.5 ul of 5 pmol/ul of primers 1 and 2, 0.5 ul each, 5X Band Doctor 1 ul, 2.5 mM dNTP mixture (2.5 m</each) 2 ul, 2.5 U/ul of EF-tag DNA polymerase 0.2 ul, nuclease-free water (Nucelase free water) was constructed to fit the final 50 ul . After treating at 95°C for 2 minutes, the reaction was performed 35 times at 95°C for 20 seconds, 62°C for 40 seconds, and 72°C for 1 minute and 40 seconds, and the final extension reaction was performed at 72°C for 5 minutes.

For the HLA-B gene, a total of 30 ul of the reaction solution is 100 ng of the request sample, 3 ul of the 10X EF tag reaction buffer, 3 and 4 of 5 pmol/ul and 4 primers of 0.4 ul and 5 pmol/ul of 5, respectively. Primer 6 each, 0.6 ul, 5X Band Doctor 2 ul, 2.5 mM dNTP mixture (2.5 m</each) 2 ul, 2.5 U/ul of EF-tag DNA polymerase 0.2 ul, nuclease-removed water, final 30 It was configured according to ul. After treatment at 94°C for 5 minutes, reaction was performed 35 times at 98°C for 20 seconds, 63°C for 30 seconds, and 72°C for 1 minute and 30 seconds, and the final extension reaction was performed at 72°C for 5 minutes.

For HLA-DQA1, HLA-DRB1, and HGF genes, a total of 30 ul of the reaction solution is 100 ng of the request sample, 3 ul of the 10X EF tag reaction buffer, and 7 and 8 primers of 0.4 pul/5 pmol, respectively /ul 9 and 10 primers 0.6 ul each, 5 pmol/ul 11 and 12 primers 0.3 ul each, 5X Band Doctor 2 ul, 2.5 mM dNTP mixture (2.5 m</each) 2 ul, 2.5 U/ul of EF-tag DNA polymerase 0.2 ul, nuclease was removed and configured to fit the final 30 ul of water. After treating at 94°C for 5 minutes, the reaction was performed 35 times at 98°C for 20 seconds, 58°C for 30 seconds, and 72°C for 25 seconds, and the final extension reaction was performed at 72°C for 5 minutes.

Next, after transferring the polymerase chain reaction finished product to an ice bath, mix 2 ul of PCR product and 1 ul of 6X loading buffer on parafilm, and mix 100 bp and 1 kb on a 1% agarose gel. 2 ul of the DNA ladder (Mixed DNA ladder) was mixed with 0.5X TBE buffer and subjected to electrophoresis for 100V for 30 minutes.

Thereafter, a 1% agarose gel was stained with gel red containing a fluorescent material to confirm DNA size. ExoSAP- to remove primers and dNTPs in samples to identify HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57 and HLA-B*58 after confirming PCR product size IT (USB corp., Cleveland, USA) 2.2 ul and 1.9 ul of HLA-A PCR products and 1.4 ul of HLA-B PCR products were mixed and reacted at 37°C for 30 minutes and 80°C for 15 minutes. In addition, 2.2 ul of ExoSAP-IT and 1.5 ul of HLA-DQA1 PCR products, 1.5 ul of HLA-DRB1 PCR products, and 1.5 ul of HLA-DRB1 PCR products and HGF PCR to remove primers and dTNPs from samples to identify HLA-DQA1*02 and HLA-DRB1*07 1.5 ul of the product was mixed and reacted for 30 minutes at 37°C and 15 minutes at 80°C.

Example 3: Multiple single base primer Extension reaction (multiplex single based primer extension, SNaPshot assay)

3-1. Primer design by type

Primers of SEQ ID NOs: 13 to 22 were used as primers for each type for multiplex single based primer extension (SNaPshot assay).

The 3'ends of the primers are HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58, HLA-DQA1*02 and HLA-DRB1 in each HLA gene. It was designed to align with the nucleotide immediately before the tSNPs capable of distinguishing *07.

3-2. Snapshot method

For HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57 and HLA-B*58 using the polymerase chain reaction product as a template for snapshot analysis, SEQ ID NOs: 13 to Using the primers of 19, multiple single-base primer extension reactions were carried out using 7 types of primers of different lengths designed for 7 single-base polymorphic sites.

In addition, in the case of HLA-DQA1*02 and HLA-DRB1*07, multiple single-base primers using three types of primers designed differently in length for three single-base polymorphic sites using primers of SEQ ID NOs: 20 to 22 An expansion reaction was performed.

Multiple single-base primer extension reactions are SNaPshot multiplex ready reaction mix 1 ul, 1/ for HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57 and HLA-B*58 2 term buffer, 5.5 ul of ExoSAP-IT product, 2X premix (mixing of primers of SEQ ID NOs: 13 to 19: e.g. 100 ul of 2X primer mix, 100 pmol/ul of HLA-A 368G >A seqF(T0) 25 ul, 100 pmol/ul HLA-A 954T>C seqR(T4) 0.4 ul, 100 pmol/ul HLA-A 536G>A seqR(T9) 1.5 ul, 100 pmol/ul HLA-A 593T>C/A seqR(T18) 1.5 ul, 100 pmol/ul HLA-B 384C>G seqF(T23) 0.8 ul, 100 pmol/ul HLA-B 667G>A seqF(T23) 1.3 ul And 100 pmol/ul of HLA-B 2156A>T seqR(T27) 15 ul, and sterilized tertiary distilled water 54.5 ul to make the final 100 ul.) 0.5 ul.

In addition, for HLA-DQA1*02 and HLA-DRB1*07, Snapshot Multiplex Ready Reaciotn Mix 1ul, 1/2 term buffer, ExoSAP-IT product 6.7 ul, 2X primer mix (SEQ ID NO: Mixing of 20 to 22 primers: For example, to make 100 ul of 2X Primer mix, 100 pmol/ul of HLA-DQA1 91A>G seqF(T0) 3 ul, 100 pmol/ul of HLA-DRB1 8240G>A 3 ul of seqF(T0) and 4 ul of 100 pmol/ul HGF 473T seqF(T4) were mixed, and 90 ul of sterilized tertiary distilled water was added to make final 100 ul.) 0.5 ul.

The prepared products were reacted 40 times at 96°C for 10 seconds, 50°C for 5 seconds, and 60°C for 30 seconds, followed by adding 1.2 ul (1 U/ul) of SAP to react at 37°C for 60 minutes and for 65 minutes for 15 minutes ddNTP was removed.

In the reaction product 1 ul, GeneScan-120 LIZ size standard 0.3 ul and Hi-Di formamide 8.7 ul were added and analyzed using an ABI 3130 gene analyzer (Applied biosystems, Foster, USA).

3-3. Single base polymorphism (SNP) analysis

DdNTP with complementary fluorescence at each single-base polymorphic site was combined to come to the end of each 3′ primer to obtain an extended reaction product, and each peak for each SNP was analyzed. The software used GeneMapper v4.0 (Applied Biosystems, Foster, USA). HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58 , HLA-DQA1*02 and the presence of HLA-DRB1*07 were confirmed.

And the results obtained through the experiment were compared with the genetic sequence information (sequencing data) obtained by the standard test (gold standard, sequencing).

The results of HLA-A*3101 and HLA-A*3303 are shown in FIG. 1, and HLA-B*1502, HLA-B*57 and HLA-B*58 results are shown in FIG. 2, and HLA-DQA1*02 3 and HLA-DRB1*07 are respectively shown in FIG. 4. The results of simultaneously examining HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57 and HLA-B*58 are shown in FIG. 5, and HLA-DQA1*02 and HLA-DRB1 The results of simultaneously inspecting *07 are shown in FIG. 6.

7 to 10 are HLA-A*3101 and HLA-A*3303 detection information in sequence, and FIGS. 11 to 13 are HLA-B*1502, HLA-B*57 and HLA-B*58 detection information in sequence, 14 to 15 show HLA-DQA1*02 and HLA-DRB1*07 detection information on the sequence, and the positions of each SNP are shown in dark red.

Through these results, the drug side effects (ADR) related genes HLA-A*3101, HLA-A*3303, HLA-B*1502, HLA-B*57, HLA-B*58, HLA-DQA1*02 and HLA- It can be seen that the presence or absence of one or more HLA alleles selected from the group consisting of DRB1*07 can be confirmed quickly and accurately. Therefore, by using the present invention, the type of the specific HLA allele can be detected at a high speed to effectively utilize the risk-related risk prediction and diagnosis method.

So far, the present invention has been focused on the preferred embodiments. Those skilled in the art to which the present invention pertains will understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered in terms of explanation, not limitation. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the equivalent range should be construed as being included in the present invention.

<110> SPMED Co., Ltd. <120> METHOD FOR QUICK-DETECTING HLA ALLELES ASSOCIATED WITH ADVERSE DRUG REACTION USING tSNP <130> DPP170165KR <160> 22 <170> KoPatentIn 3.0 <210> 1 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_F primer <400> 1 cgccgaggat ggccgtc 17 <210> 2 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_R primer <400> 2 ggagaacyag gccagcaatg atgccc 26 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> HLA-B_E2F primer <400> 3 gggcgcacga ccygrgga 18 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-B_E4R primer <400> 4 gaaaggaggg gaagatgagg 20 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HLA-B_E6F primer <400> 5 tccctgcctc attactggga agcag 25 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> HLA-B_E7R primer <400> 6 tggttagtca tggtaagcga tg 22 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_F primer <400> 7 gcagggtttg gtttgggtg 19 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_R primer <400> 8 tctggtttcc tgaaggagra aca 23 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_F primer <400> 9 cctgtggcag ggtaagtata 20 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_R primer <400> 10 cccgtagttg tgtctgcaca c 21 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HGF_F primer <400> 11 cagtgccttc ccaaccattc cctta 25 <210> 12 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> HGF_R primer <400> 12 atccactcac ggatttctgt tgtgtttc 28 <210> 13 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_368F primer <400> 13 gtggatagag caggag 16 <210> 14 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_536R primer <400> 14 tttttttttg gatctcggac ccggagactg tggg 34 <210> 15 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_593R primer <400> 15 tttttttttt ttttttttaa aggcgcctgg gcctctcccg gg 42 <210> 16 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> HLA-A_954R primer <400> 16 ttttgcagcg tctccttccc gttctccagg t 31 <210> 17 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> HLA-B_384F primer <400> 17 tttttttttt tttttttttt tttcaggagg ggccggagta ttgggac 47 <210> 18 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> HLA-B_667F primer <400> 18 tttttttttt tttttttttt tttagttgag gccaaaatcc ccgcgggttg gtc 53 <210> 19 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> HLA-B_2156F primer <400> 19 tttttttttt tttttttttt tttttttagg gtcccaggct gcgttagccc ctgtg 55 <210> 20 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> HLA-DQA1_91F primer <400> 20 ggcattgtgg gtgagtgc 18 <210> 21 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HLA-DRB1_8240F primer <400> 21 gagtaccggg cggtgacgga gct 23 <210> 22 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> HGF_473F primer <400> 22 ttttttttgc tgggaaataa gaggaggaga c 31

Claims (13)

91st nucleotide A>G of the HLA-DQA1 gene (NCBI Reference Sequence: NG_032876.1); 8240 nucleotide G>A of HLA-DRB1 gene (NCBI Reference Sequence: NG_029921.1); And HGF gene (NCBI Reference Sequence: NC_000017.11) characterized in that at least one nucleotide selected from the group consisting of 513 nucleotide T, drug side effects (ADR) related genes HLA-DQA1*02 and HLA- SNP detection method of one or more HLA alleles selected from the group consisting of DRB1*07. According to claim 1,
The method is characterized by using a tagging sequence for detecting polymorphism of one or more HLA alleles selected from the group consisting of HLA-DQA1*02 and HLA-DRB1*07. delete delete According to claim 1,
A method characterized in that tSNP for identification of the 91st nucleotide of the HLA-DQA1 gene (NCBI Reference Sequence: NG_032876.1) is a HLA-DQA1*02 haplotype. According to claim 1,
The tSNP for identifying the 8240 nucleotide of the HLA-DRB1 gene (NCBI Reference Sequence: NG_029921.1) and the 473 nucleotide of the HGF gene (NCBI Reference Sequence: NC_000017.11) is characterized by a HLA-DRB1*07 haplotype. Way. The method of claim 1, wherein the method is performed by a SNAPshot analysis method. The method of claim 7,
Method using at least one primer pair selected from the group consisting of the primers of SEQ ID NO: 20 to 22 when using the snapshot analysis method. Drug side effects, characterized in that it comprises at least one primer pair selected from the group consisting of SEQ ID NOs: 7 to 12 for performing the method of any one of claims 1, 2 and 5 to 8. (ADR) Kit for detecting SNPs of one or more HLA alleles selected from the group consisting of the related genes HLA-DQA1*02 and HLA-DRB1*07. Confirming the presence of at least one HLA allele selected from the group consisting of drug side effects (ADR) related genes HLA-DQA1*02 and HLA-DRB1*07 using the method of claim 1; And determining that there is a risk of drug side effects when the HLA allele is present, a method of providing information for predicting the risk of drug side effects. The method of claim 10,
The method of claim 1, wherein the drug is lapatinib. The method of claim 10,
The method of claim 1, wherein the drug side effect is severe liver damage. A group consisting of HLA-DQA1*02 and HLA-DRB1*07 by a method according to any one of claims 1, 2 and 5 to 8 from a sample of a patient having an HLA allele associated with drug side effects. A method for identifying a drug causing a drug side effect, comprising the step of confirming the presence of one or more HLA alleles selected from.

Images