KR102130833B1 - Compositions for identification of exposure to diesel exhaust particle at nasal cavity - Google Patents

Abstract

VEGFA, which is a gene showing specific transcript expression changes, was selected by confirming the gene expression change in nasal cells exposed to DEP and confirming the signaling network through big data analysis based on actual pre-research results. When exposed to DEP, it was confirmed that the expression level of the VEGFA is down-regulated. Therefore, the composition for confirming whether intranasal DEP is exposed in the present invention can be diagnosed and predicted more quickly and accurately than the conventional method for confirming DEP exposure, and since VEGFA is a gene involved in an inflammatory response, diagnosis of intranasal inflammatory disease caused by DEP Can also be used for

Description

Composition for identifying whether or not environmentally hazardous diesel exhaust particulates are exposed in the nasal cavity{Compositions for identification of exposure to diesel exhaust particles at nasal cavity}

The present invention relates to a composition for confirming whether or not environmentally hazardous substances, diesel exhaust particulates (DEP), are exposed in the nasal cavity, and more specifically, exposure to diesel exhaust particulates using genes related to inflammatory reactions in which intranasal expression changes upon exposure to DEP. How to check whether it is.

Diesel exhaust particles (DEP) are mainly focused on incomplete combustion product particles of fuel, and oxides or nitro compounds such as engine oil, unburned fuel, and formaldehyde that stimulate the living body. It is a fine particle to which an organic component and sulfate and nitrate are attached. The particle distribution of DEP is mostly present as nanoparticles having a particle diameter of 100 mm or less. The particle group of the same weight has a larger particle number and a larger total surface area. When the particle surface itself is toxic or adsorbs a toxic substance on the surface, the larger the surface area, the stronger the toxicity may be. Studies have shown that allergic reactions are exacerbated by exposure to DEP, and it has been found that this is due to increased histamine production due to enhanced T cell communication and excessive release of highly toxic substances produced by eosinophils. Accordingly, in 2012, the IARC under WHO designated diesel exhaust particles as a first-class carcinogen.

Nanoparticles of less than 100 mm increase in deposition in the lungs as the particles get smaller, and peak in 20 mm, reaching about 50% in the alveoli. DEP nanoparticles of 20 mm or less are more likely to enter the bloodstream than large particles and have a large surface area, which is deeply related to toxicity, so it is likely to cause inflammation, blood clots, and affect organs such as the heart and liver. Toxicity studies of diesel exhaust particulates, which also serve as the main part of the microparticles, are actively being conducted, and research on the mechanisms causing allergic rhinitis or allergic conjunctivitis has been mainly conducted. In addition, cardiac dysfunction appeared in experimental animal models exposed to DEP, and it was suggested that there is a possibility of aging. It has been reported that long-term administration of DEP with allergen into the respiratory tract of a laboratory animal causes asthma with eosinophilic inflammation in the airways (Ris C, 2007; Sagai et al., 1996). In addition, when DEP is administered to mice with antigens, three bronchi, which are symptoms of bronchial asthma, are broadly narrowed, and even small irritation has been reported to promote hypersensitivity to airways and hypersecretion of mucus components (Lim & Lee, 2002; Lim et al., 1998 Sagai et al., 1996).

Although many studies on the risk of microparticles containing DEP have been conducted, there have been few reports of studies using a human cell line system that can predict exposure and toxicity in a more convenient way.

In addition, detection methods for exposure to harmful substances are still limited to classical methods such as Gas Chromatography-Mass Spectrometer (GCMS) or High Performance Liquid Chromatography (HPLC). Quantification is possible by using GC-MS or HPLC method, but it is necessary to set appropriate conditions for analysis and requires expensive equipment. Therefore, faster and simpler screening methods such as real-time reverse transcript polymerase chainreaction (PCR) using primers, Western blot or DNA microarray chip It is an important task to discover and utilize molecular indicators that can explore toxic effects and gene expression in the human body through risk assessment and to take appropriate measures and management for exposure to DEP.

As a result, the present inventors studied a simpler method of confirming whether DEP was exposed. As a result, by confirming a signaling network by text-based big data analysis of actual research papers, epithelial cells in the nasal cavity exposed to DEP Genes showing specific transcriptomic expression changes were selected to develop biomarkers for DEP exposure.

Accordingly, an object of the present invention is to provide a composition for confirming whether or not diesel exhaust particulates are exposed in the nasal cavity.

In addition, another object of the present invention is to provide a kit for confirming whether or not diesel exhaust particulates are exposed in the nasal cavity, comprising the composition according to the present invention.

Another object of the present invention is to provide a method for evaluating whether or not diesel exhaust particulates are exposed in the nasal cavity.

In order to achieve the above object, the present invention provides a composition for confirming whether or not exposure to diesel exhaust particles in a nasal cavity including a VEGFA protein or an agent for measuring the expression level of mRNA encoding the same.

In order to achieve another object of the present invention, the present invention provides a kit comprising the composition.

In order to achieve another object of the present invention, the present invention provides a method for evaluating exposure of diesel exhaust particles in the nasal cavity by confirming the expression level of VEGFA protein or mRNA encoding the same.

Hereinafter, the present invention will be described in detail.

The present invention provides a composition for confirming whether or not exposure to diesel exhaust particles (DEP) in a nasal cavity including an agent for measuring the expression level of VEGFA protein or mRNA encoding the same.

The VEGFA protein or mRNA encoding it shows an increase or decrease in expression over 1.5-fold, and is characterized by a change in expression by diesel exhaust particulates in the nasal cavity.

Thus, the VEGFA protein or mRNA encoding it can be used as a specific “biomarker” for the upper respiratory tract, especially the nasal cavity. The “biomarker” refers to a polypeptide or nucleic acid that increases or decreases in the nasal cavity when exposed to DEP (eg, mRNA, etc.), lipids, glycolipids, glycoproteins, sugars (monosaccharides, disaccharides, oligosaccharides, etc.), etc. And organic biomolecules.

In a specific embodiment of the present invention, the present inventors used DEP standards purchased from the National Institute of Standards and Technology (NIST) as primary human nasal mucosal epithelial cells (Primary) in order to discover biomarkers for confirming whether diesel exhaust particles are exposed. After processing on human nasal epithelial cells (PHNECs), genes showing significant expression changes were selected using a microarray.

As a result, in the group treated with 50 μg/ml DEP, 112 genes were up-regulated 1.5 times or more, and 272 genes were down-regulated 1.5 times or more (p-value <0.01). In addition, in the group treated with 200 μg/ml DEP, 1117 and 1079 genes were regulated up or down, respectively (see Table 2).

For the genes identified above, as a result of constructing a signal transmission network based on text-based big data analysis of actual research papers, a meaningful association mechanism was confirmed (see FIG. 1 ).

In addition, based on this, as a result of performing gene enrichment analysis by function, it was confirmed that the vascular endothelial growth factor A (VEGFA) gene is involved in almost all signal transmission (see Tables 3 and 4).

Based on the results of gene enrichment analysis by function, as a result of forming a simple signal transmission network (see FIG. 2 ), genes related to inflammation and chemotaxis (chemotzxis) were selected as potential markers for DEP.

As confirmed above, since VEGFA is a gene directly or indirectly related to all adjacent genes, the gene was selected as a potential marker for DEP.

The VEGFA protein or an agent that measures the expression level of mRNA encoding the same may be an antibody, a primer or a probe, but is not limited thereto.

The “antibody” refers to a specific protein molecule directed against an antigenic site, and for the purposes of the present invention, an antibody refers to an antibody capable of specifically binding to proteins expressed from the VEGFA marker genes. , Polyclonal antibodies, monoclonal antibodies, and recombinant antibodies. Any such antibody can be used as long as it is prepared using techniques known to those skilled in the art.

The “primer” in the present invention is a single-strand capable of acting as a starting point for template-directed DNA synthesis under suitable conditions (ie, four different nucleoside triphosphates and polymerases) in a suitable temperature and a suitable buffer. Means oligonucleotide. The suitable length of the primer may vary depending on various factors, such as temperature and the use of the primer. In addition, the sequence of the primer does not need to have a sequence completely complementary to some of the sequence of the template, it is sufficient to have sufficient complementarity within a range capable of hybridizing with the template and working with the primer. Therefore, the primer in the present invention does not need to have a sequence perfectly complementary to the nucleotide sequence of the template gene, and it is sufficient to have sufficient complementarity within a range capable of hybridizing to this gene sequence and acting as a primer. In addition, it is preferable that the primer according to the present invention can be used for a gene amplification reaction.

The amplification reaction refers to a reaction for amplifying a nucleic acid molecule, and the amplification reactions of these genes are well known in the art, for example, polymerase chain reaction (PCR), reverse transcriptase chain reaction (RT-PCR), and Riga Aze chain reaction (LCR), electron-mediated amplification (TMA), nucleic acid sequence substrate amplification (NASBA), and the like may be included.

In addition, the "probe" refers to a linear oligomer of natural or modified monomers or linkages, includes deoxyribonucleotides and ribonucleotides and can specifically hybridize to the target nucleotide sequence, exists naturally or artificially It is synthesized as. The probe according to the present invention may be a single chain, preferably an oligodioxyribonucleotide. Probes of the present invention may include natural dNMPs (ie, dAMP, dGMP, dCMP and dTMP), nucleotide analogues or derivatives. In addition, the probe of the present invention may also include ribonucleotides.

In a specific embodiment of the present invention, it was confirmed that the expression level of VEGFA was significantly down-regulated in PHNECs exposed to DEP (see FIG. 3 ).

Therefore, in the composition according to the present invention, when exposed to DEP, the expression level of VEGFA protein or mRNA encoding it is down-regulated compared to the normal control.

In addition, the present invention provides a kit for confirming whether or not diesel exhaust particulates are exposed in the nasal cavity containing the composition according to the present invention.

The kit for confirming whether the diesel exhaust particles in the nasal cavity of the present invention are exposed may include primers, probes or antibodies capable of measuring the expression level of the marker gene or the amount of protein, and their definitions are as described above.

If the kit for confirming exposure of diesel exhaust particles in the nasal cavity of the present invention is applied to the PCR amplification process, the kit of the present invention is optionally a reagent required for PCR amplification, such as a buffer solution, a DNA polymerase (for example, Thermus aquaticus ( Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis or thermostable DNA polymerase obtained from Pyrococcus furiosus (Pfu)), DNA polymerase joiner and dNTPs, the kit of the present invention Optionally, a secondary antibody and a substrate of the label may be included. Furthermore, the kit according to the present invention can be manufactured in a number of separate packaging or compartments containing the above-described reagent components.

In addition, the present invention can provide a microarray for evaluating whether or not diesel exhaust particulates are exposed in a nasal cavity including a marker for evaluating VEGFA.

In the microarray of the present invention, a primer, probe or antibody capable of measuring the expression level of the marker protein or gene encoding the marker protein is used as a hybridizable array element and immobilized on a substrate. . Preferred substrates are suitable rigid or semi-rigid supports, such as membranes, filters, chips, slides, wafers, fibers, magnetic beads or non-magnetic beads, gels, tubing, plates, polymers, microparticles and capillaries. have. The hybridization array elements are arranged and immobilized on the substrate, and such immobilization can be performed by a chemical bonding method or a covalent bonding method such as UV. For example, the hybridization array element can be bonded to a glass surface modified to include an epoxy compound or an aldehyde group, and can also be bonded by UV at a polylysine coated surface. In addition, the hybridizing array elements can be bound to a substrate via linkers (eg, ethylene glycol oligomers and diamines).

On the other hand, when the sample applied to the microarray of the present invention is a nucleic acid, it can be labeled and hybridized with an array element on the microarray. Hybridization conditions may be varied, and detection and analysis of the degree of hybridization may be variously performed depending on the labeling substance.

In addition, the present invention provides a method for evaluating whether or not exposure to diesel exhaust particles in the nasal cavity is confirmed by confirming the expression level of VEGFA protein or mRNA encoding the same.

More specifically, (a) measuring the expression level of VEGFA protein or mRNA encoding it from a biological sample suspected of being exposed to diesel exhaust particulates; And

(b) measuring the expression level of the protein or mRNA encoding it from a normal control sample, and comparing with the measurement result of step (a) to provide a method for evaluating whether diesel exhaust particles are exposed.

In the present invention, the "evaluation" means to confirm the pathological condition, and for the purpose of the present invention, the evaluation means to confirm the presence or absence of expression of the biomarker and the degree of expression to confirm the exposure and risk of DEP. do.

The increase or decrease of the expression level of a specific gene in a biological sample can be known by confirming the amount of mRNA, and the increase or decrease of the expression level of a protein expressed from a specific gene can be known by confirming the amount of protein. The process of separating mRNA or protein from a biological sample can be performed using a known process, and the amount can be measured by various methods known to those skilled in the art.

In the present invention, the "measurement of the level of protein" is a process of confirming the expression level of the biomarker protein whose expression is increased or decreased by exposure of DEP in a biological sample, preferably specifically binding to the biomarker protein. Check the amount of protein using the antibody.

The “biological sample” refers to a sample taken from a living body whose expression level or protein level is different from a normal control according to exposure to DEP, and is preferably a tissue or cell derived from the nasal cavity.

The method for evaluating whether or not exposure to diesel exhaust particulates in the nasal cavity of the present invention can be evaluated as exposed to diesel exhaust particulates when the expression of VEGF-A is down-regulated compared to the normal control sample in step (b). .

The method of measuring the expression level of the gene or the amount of protein in the above may be performed by including a known process for separating mRNA or protein from a biological sample using a known technique.

Measurement of the expression level of the gene is preferably to measure the level of mRNA, and the method of measuring the level of mRNA can be performed through various methods known in the art, for example, reverse transcriptase chain reaction. (reverse transcriptase-polymerase chain reaction), real-time polymerase chain reaction, Northern blot, RNase protection assay, DNA chip, etc., but are not limited thereto.

For the measurement of the protein level, an antibody may be used. In this case, the marker protein in the biological sample and the antibody specific to this form a binding agent, that is, an antigen-antibody complex, and the amount of formation of the antigen-antibody complex is a detection label. It can be quantitatively measured through the signal level of (detection label). The detection label may be selected from the group consisting of enzymes, fluorescent substances, ligands, luminescent substances, microparticles, redox molecules, and radioactive isotopes, but is not limited thereto. As an analysis method for measuring protein levels, for example, Western blot, ELISA (enzyme linked immunosorbent assay), radioimmunoassay (RIA), radioimmunodiffusion, immunoprecipitation assay, Oukteroni immune diffusion method, rocket immunoelectrophoresis, tissue immunostaining, complement fixation analysis, FACS, protein chip, etc., but are not limited thereto.

Therefore, the present invention can confirm the amount of mRNA expression amount or protein of the control group and the amount of mRNA expression or protein when exposed to DEP through the detection methods described above, and compare the level of the expression level with the control DEP. The risk of exposure can be predicted and diagnosed.

In addition, in the present invention, it was confirmed that VEGFA markers are involved in molecular pathways related to inflammation, and these molecular pathways are Vascular Endothelial Cell Permeability Activation, IL1B Expression Targets, and Interleukin-17 Signaling. in Psoriasis (IL-17 signal in psoriasis) and the like (see Table 3 and Table 4).

These results suggest that the composition, kit, and method for evaluating diesel exhaust particulate exposure according to the present invention can be used for diagnosis of intranasal inflammatory disease induced by DEP.

In the method for evaluating whether or not exposure to diesel exhaust particles in the nasal cavity of the present invention is performed, in the step (b), when the expression of VEGFA is down-regulated compared to the normal control sample, intranasal inflammatory disease is caused by the diesel exhaust particles. It can be evaluated as having a high probability.

Therefore, the present invention confirms the gene expression change in nasal cells exposed to DEP, and VEGFA, which is a gene showing a specific transcriptional expression change, through a signaling network through big data analysis based on actual pre-research results. As selected, the composition for confirming whether or not the intranasal DEP is exposed in the present invention including the same has an effect capable of being diagnosed and predicted more quickly and accurately than the conventional method for confirming DEP exposure. It can also be used to diagnose intranasal inflammatory diseases caused by DEP.

FIG. 1 is an image showing signaling networks in primary human nasal epithelial cells (PHNECs) induced by DEP exposure.(A) of FIG. 1 is a general cell process and disease 1B is an image of a signaling network related to detailed cellular processes and diseases related to up- and down-regulation of genes caused by DEP exposure.
2 is an image of a signal transduction network of major genes involved in the inflammatory response.
3 is a result of confirming the expression level of the two types of genes showing significant expression changes when exposed to DEP using qRT-PCR.

Hereinafter, the present invention will be described in detail.

However, the following examples are only to illustrate the present invention, the content of the present invention is not limited to the following examples.

<Experiment method>

Cell culture

Primary human nasal epithelial cells (PHNECs) were cultured according to the procedure described in the following literature (American Journal of Respiratory Cell and Molecular Biology 20(4):595-604). First, normal nasal tissue was obtained from patients undergoing selective nasal surgery procedures according to the protocol (H-1607-127-777) approved by the Institutional Review Board (IRB).

PHNEC cells obtained from nasal tissue were cultured in a cell culture dish using bronchial epithelial growth medium (BEGM, Lonza, Switzerland), followed by 24-mm collagen-coated Transwell at the second or third passage. The cells were re-seeded in inserts (Corning, 0.4 μm pore size) and incubated until a density of 1 × 10 ⁵ /cm ² in all mediums was reached.

After reaching the target density (3 to 5 days), the apical surface was washed with phosphate-buffered saline (PBS), and only the lower section of the medium was ALI medium (BEGM and Dulbecco's modified Eagle's) medium-H was mixed with 50:50 volume ratio). PHNEC cells were cultured using ALI medium for at least 12 days, and then used in the experiment.

Diesel exhaust particle (DEP) treatment

DEP (National Institute of Standards and Technology (NIST), Gaithersburg, MD, USA) was prepared as described in our previous paper (International journal of pediatric otorhinolaryngology 76.3 (2012): 334- 338.) Differentiated PHNECs were exposed to 50 or 200 μg/ml DEP for 24 hours, after which cells were obtained to perform microarray and qRT-PCR experiments.

RNA analysis

Harvested controls (PHNEC cells without DEP treatment) and PHNEC cell pellets treated with DEP were washed with PBS (Thermo Fisher Scientific, USA). Total RNA was extracted using the RNeasy Mini kit (Qiagen, Germany) according to the manufacturer's protocol. The extracted total RNA was tested for quality using Agilent 2100 Bioanalyzer (Agilent Genomics, USA). RNA integrity number (RIN) showed a value of 8.4 or higher.

Gene expression microarray analysis

Microarrays were performed using Agilent Low-Input Quick Amp Labeling Kit (Agilent Genomics, USA) according to the manufacturer's instructions. cDNA was synthesized from labeled RNA, and cRNA was synthesized and amplified. The purified cRNA was hybridized to Agilent SurePrint G3 Human Gene Expression v2 8×60K microarray (G4858A-072363). A two-color microarray-based gene expression system was used, and microarrays for 50 or 200 μg/ml DEP-treated groups were each repeated 4 times. Array chips were scanned using a SureScan MicroArray scanner (Agilent Genomics, USA), and signals were quantified using Feature Extraction software (version 12.0; Agilent Genomics, USA). Data normalization and visualization were performed using GeneSpring GX (Agilent Genomics, USA).

Analysis of signaling networks

Differentially expressed genes (DEG) signaling networks were analyzed using Pathway Studio version 11.4 (Elsevier, USA). DEP treatment at 50 or 200 μg/ml A signaling network was generated for DEGs induced by the first experimental group.

These routes were combined and rearranged, and finally simplified.

Quantitative RT-PCR

To verify the microarray results, as shown in Table 1 below, primers were designed using PrimerQuest Tool (Integrated DNA Technologies, USA).

The extracted total RNA was reverse transcribed into cDNA using ImProm-II Reverse Transcription System (Promega, USA). cDNA was mixed with SYBR Premix Ex Taq (Takara Bio, Japan), and then quantitative PCR was performed using Rotor-Gene Q (Corbett Robotics, Australia) under the following thermal cycling conditions: 95°C. At 10 min initial denaturation, 15 cycles at 95°C, 40 cycles of 30 seconds at 60°C, followed by final steps at 72°C for 20 seconds. At this time, the expression of housekeeping gene GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) was used as a control.

gene Forward (5'→3') Sequence number Reverse (5’→3’) Sequence number MMP1 CATATATGGACGTTCCCAAAATCC One GTGCGCATGTAGAATCTGTCTTTAA 2 CXCL8 AGACAGCAGAGCACACAAGC 3 ATGGTTCCTTCCGGTGGT 4 CSF3 CACCCAGAGCCCCATGAAGCT 5 GCACAGCTTGTAGGTGGCACACTC 6 NCK2 ATAGCCAAGTGGGACTAC 7 TGTGTCCTTCAGGTTCTT 8 CXCL14 ATGAAGCCAAAGTACCCGCAC 9 TTCCAGGCGTTGTACCACTTG 10 VEGFA ATCACCATGCAGATTATGCGG 11 GGCTCCAGGGCATTAGACAG 12 GAPDH ATGGGGAAGGTGAAGGTCG 13 GGGGTCATTGATGGCAACAA 14

<Example 1> Identification of DEGs by DEP exposure of PHNECs

To confirm gene expression modified by DEP, microarrays were performed using PHNEC treated with DEP, and the results are shown in Table 2 below.

In the group treated with 50 μg/ml DEP, 112 genes were up-regulated 1.5 times or more, and 272 genes were down-regulated 1.5 times or more (p-value <0.01) compared to the control group. In addition, in the group treated with 200 μg/ml DEP, 1117 and 1079 genes were regulated up or down, respectively (fold change> 1.5, p-value <0.01). In particular, when a total of 29 and 128 genes were treated with 50 μg/ml and 200 μg/ml, they tended to be regulated up and down. All gene expression results were deposited with NCBI's Gene Expression Omnibus under the accession number: GSE 102304.

Gene name Fold change DEP 50μg/ml DEP 200μg/ml ACPP 1.582 1.527 AGPAT9 1.655 1.859 CD58 1.688 1.702 CRCT1 1.523 2.009 CYP1A1 2.413 6.354 CYP1B1 1.817 2.066 DSCR10 1.820 1.691 EPGN 1.894 1.911 FAM25A 1.523 1.717 FCF1 1.522 1.822 GATA6 1.599 1.803 HNRNPH2 1.506 2.148 ISLR 1.627 1.544 KDELR3 1.646 1.932 LBH 1.618 1.793 LCE3D 2.245 4.326 MMP1 1.949 2.148 MMP10 1.867 1.739 NANOS1 1.646 3.154 NMT2 1.825 1.625 OCA2 1.881 2.553 PATE3 1.595 1.504 PHLDB2 1.908 1.897 PLD5 1.991 2.285 PTPLB 1.753 1.720 SLC13A5 1.541 1.579 ST13 3.898 1.559 TM4SF19 1.587 1.697 TRIM63 2.252 2.269 AFG3L1P 0.610 0.660 AGAP9 0.556 0.548 AGPAT4-IT1 0.648 0.648 AHSA2 0.659 0.580 AMZ1 0.632 0.475 ANKRD36 0.657 0.495 ANKRD36B 0.651 0.498 ARHGEF10 0.594 0.658 AS3MT 0.660 0.558 ASAP1-IT1 0.588 0.361 ASMTL-AS1 0.618 0.595 ATAD3B 0.506 0.654 BCAR1 0.548 0.615 BMS1 0.626 0.473 BNIP3L 0.629 0.412 CAPN13 0.634 0.584 CBFA2T2 0.647 0.532 CCDC84 0.666 0.510 CDK5RAP3 0.661 0.663 CFLAR 0.665 0.578 CIRBP 0.623 0.527 COL16A1 0.659 0.548 COL27A1 0.498 0.589 COL7A1 0.561 0.530 CROCCP2 0.636 0.608 CTNNAL1 0.629 0.501 CYP2B6 0.629 0.626 DENND3 0.605 0.549 DGKZ 0.537 0.609 DUOX2 0.614 0.549 EPS15 0.592 0.394 FAM74A4 0.649 0.580 FHL2 0.636 0.544 FLJ13773 0.660 0.543 FLJ45482 0.508 0.432 FRMD4A 0.531 0.413 GABRE 0.631 0.394 GAS6-AS1 0.494 0.353 GNPTAB 0.657 0.598 GOLGA2P5 0.577 0.551 GPR155 0.648 0.584 GSDMB 0.665 0.595 GSG1 0.580 0.441 HELZ2 0.648 0.578 HERC2P2 0.632 0.556 HNRNPU-AS1 0.620 0.398 HSCB 0.659 0.495 IFNE 0.602 0.480 ILDR1 0.645 0.558 JAG2 0.658 0.645 KCNQ5-IT1 0.551 0.392 LAMA5 0.634 0.550 LEPR 0.625 0.528 LINC00504 0.633 0.409 LINC00999 0.656 0.587 LINC01000 0.624 0.611 LINC01004 0.516 0.414 lnc-INADL-2 0.624 0.379 lnc-RP11-195B21.3.1-2 0.584 0.346 lnc-THNSL1-2 0.552 0.348 lnc-ZNF674-3 0.590 0.621 LOC100127909 0.592 0.301 LOC100128563 0.600 0.448 LOC100129940 0.474 0.492 LOC100132356 0.536 0.389 LOC100132495 0.506 0.289 LOC100133299 0.605 0.470 LOC100190986 0.479 0.363 LOC100288069 0.585 0.487 LOC100506282 0.525 0.479 LOC100996724 0.639 0.577 LOC142937 0.538 0.455 LOC158863 0.556 0.322 LOC442132 0.663 0.611 LOC494150 0.643 0.483 LOC644656 0.647 0.424 LOC728061 0.609 0.403 LOC729218 0.662 0.649 LPIN3 0.620 0.517 MALAT1 0.628 0.477 MCM7 0.635 0.658 MICALL2 0.636 0.557 MIR4435-1HG 0.641 0.498 MST1R 0.608 0.628 MYO1C 0.627 0.570 NBPF9 0.644 0.498 NCK2 0.582 0.425 NPIPB5 0.586 0.605 NPL 0.648 0.549 NPLOC4 0.635 0.596 ODF2L 0.550 0.361 PCNXL4 0.650 0.482 PDE7A 0.534 0.510 PDXDC2P 0.661 0.660 PFN1P2 0.635 0.535 PHF20L1 0.644 0.566 POGZ 0.570 0.648 POU5F1 0.594 0.471 PRO0628 0.649 0.522 PRO2852 0.643 0.498 PTPRK 0.666 0.606 RABGAP1L 0.658 0.431 RNA18S5 0.560 0.328 RNA28S5 0.643 0.564 RNA5-8S5 0.647 0.461 SCARNA13 0.616 0.657 SLC35E4 0.635 0.561 SMA4 0.651 0.555 SMCR6 0.665 0.642 SMG1 0.608 0.590 SND1-IT1 0.561 0.421 SUN1 0.639 0.595 SYT8 0.649 0.597 SZT2 0.615 0.523 THBS1 0.592 0.581 THUMPD3-AS1 0.630 0.524 TNFAIP8L1 0.661 0.519 TNFRSF25 0.662 0.591 TRIM11 0.666 0.574 TRIP12 0.539 0.341 UVSSA 0.646 0.531 WDR90 0.660 0.627 XIST 0.631 0.380 XRCC3 0.652 0.488 ZMYM2 0.617 0.418 ZMYND8 0.624 0.513 ZNF526 0.653 0.566 ZNF692 0.664 0.617

<Example 2> Signaling network between DEGs for DEP exposure of PHNEC

A signaling network of genes related to DEP exposure was constructed using Pathway Studio (Elsevier, USA). As shown in Fig. 1, two types of signaling pathways related to DEP exposure were identified. The individuals highlighted in red and blue in FIG. 1 are up- and down-regulated genes induced by 50 μg/ml DEP. In addition, individuals highlighted in orange and green are up and down regulatory genes induced by 200 μg/ml DEP.

First, it identified a pathway comprising a number of linked entities ((A) in FIG. 1 ). Numerous connections between gene or cellular processes have supported the relationship between entities.

Pathway Studio operates by text mining using research results such as scientific papers. Therefore, the field studied accurately will have numerous connections. In order to solve this problem, another route was prepared ((B) in FIG. 1 ). In this route, poor areas of investigation were considered by selecting entities with high frequency of relevant studies. These entities do not have many connections between entities, but they do have an important meaning.

As shown in (A) of FIG. 1, the up-regulated genes such as CSF3 and RHOA and the down-regulated genes such as VEGFA, CXCL14, NCK2 and NRG1 have several cell processes (cell motility, auto-digestion). Autophagy, neutrophil chemotaxis, neutrophil migration and SMC proliferation) and disease response (atherosclerosis, oncogenesis, lung metastasis) , And pulmonary infection.

As shown in (B) in Figure 1, apoptosis, cell migration, cell death, cell proliferation, inflammation, toxicity, new cells (cancer) Cell processes and disease responses such as cells, neoplasm, neoplasm metastasis, atherosclerosis and infection are DEGs, CSF3, CXCL8, RHOA, S100A7, S100A9, STYXL1, VEGFA, IGBP3, NAMPT And CXCL14.

<Example 3> DEGs concentration analysis for DEP exposure of PHNECs

Gene enrichment analysis was performed based on the signaling network described in FIG. 1 of <Example 2>, and the results are shown in Table 3. In the field of biological pathways, genes induced by DEP exposure have been associated with signal transduction associated with nociception expression targets, IL-1B expression targets, platelet activation, and CXC chemokine receptors. .

HPV E6/ induces interleukin-17 signaling in psoriasis, keratinocyte activation in psoriatic arthritis, and TNFR/NF-kB signaling in keratinocytes The signals associated with some diseases, including E7, are listed in Table 4. The results of the enrichment analysis suggested that the VEGFA gene is involved in almost all signal transduction. In addition, it was confirmed that CXCL8 and MMP1 are also included in various signal transduction pathways as shown in Tables 3 and 4 ([Table 3] Nociception Expression Targets Overview Signaling: Perceptual Expression Targets Overview Signaling, Persisted DNA Repair Triggers Genomic Instability: Continuous DNA Repair Induces Genomic Instability, Vascular Endothelial Cell Permeability Activation: Vascular Endothelial Cell Infiltration Activation, IL1B Expression Targets: 　IL1B Expression Target, Platelet Activation via Adhesion Molecules: Platelet Activation Through Adhesion Molecules, CXC Chemokine Receptor Signaling: CXC Chemokine Receptor Signaling Delivery, Plasmin Effects in Inflammation: Plasmin Effects on Inflammation, Osteoarthritis Overview: Eosinophil Activation in Myeloid Cells in Inflammation: Eosinophil Activation of Bone Marrow Cells in Inflammation, Mast-Cells De Novo Synthesized Mediators via IgE Independent Signaling: Mast Cells Newly synthesizes mediators through IgE independent signals, CCR1 Expression Targets: CCR1 (CC chemokine receptor type 1) expression target.)

(Table 4) Interleukin-17 Signaling in Psoriasis: IL-17 signaling in psoriasis, Keratinocyte Activation in Psoriatic Arthritis: Keratin cell activation of psoriatic arthritis, HPV E6 and E7 Induced Disruption of TNFR/NF-kB Signaling in Keratinocytes: Keratin HPV E6/E7, Interleukin-22 Induced Keratinocyte Proliferation: IL-22 Induces Proliferation of Keratinocytes, TLR2 Induced Synovial Fibroblast Activation in Rheumatoid Arthritis: Rheumatoid Arthritis TLR2 induces synovial fibroblast activation, Dendritic Cells Function in Psoriasis: Dendritic cell function in psoriasis, Synovial Fibroblast Activation in Psoriatic Arthritis: Activation of synovial fibroblasts in psoriatic arthritis, Synovial Fibroblast Activation by Cytokines in Rheumatoid Arthritis: Rheumatoid Activation of synovial fibroblasts by cytokines in arthritis.).

designation Overlapping gene
(Overlapping Genes) p-value Nociception Expression Targets Overview Signaling RHOA;CXCL8;VEGFA;MMP1 0.023107 Persisted DNA Repair Triggers Genomic Instability RAD52;TERF2;XRCC3 0.002499 Vascular Endothelial Cell Permeability Activation VEGFA;RHOA;BCAR1 0.004669 IL1B Expression Targets CSF3;VEGFA;CXCL8 0.004669 Platelet Activation via Adhesion Molecules RHOA;CXCL8;BCAR1 0.01723 CXC Chemokine Receptor Signaling RHOA;CXCL8;BCAR1 0.021019 Plasmin Effects in Inflammation RHOA;BCAR1;MMP1 0.021019 Osteoarthritis Overview TGFBR2;VEGFA;MMP1 0.021595 Eosinophil Activation in Myeloid Cells in Inflammation RHOA;CXCL8;VEGFA 0.034948 Mast-Cells De Novo Synthesized Mediators via IgE Independent Signaling RHOA;CXCL8;P2RY1 0.049018 CCR1 Expression Targets VEGFA;MMP1 0.012583

designation Overlapping gene
(Overlapping Genes) p-value Interleukin-17 Signaling in Psoriasis CSF3;VEGFA;S100A7;MMP1;CXCL8 1.20274E-05 Keratinocyte Activation in Psoriatic Arthritis VEGFA;S100A7;MMP1;CXCL8 0.000452614 HPV E6 and E7 Induced Disruption of TNFR/NF-kB Signaling in Keratinocytes TAB2;CFLAR;CXCL8;VEGFA 0.000830343 Interleukin-22 Induced Keratinocyte Proliferation S100A9; S100A7; MMP1 0.002263067 TLR2 Induced Synovial Fibroblast Activation in Rheumatoid Arthritis VEGFA;MMP1;CXCL8 0.002422228 Dendritic Cells Function in Psoriasis VEGFA;S100A9;S100A7 0.004402245 Synovial Fibroblast Activation in Psoriatic Arthritis VEGFA;MMP1;CXCL8 0.005403867 Synovial Fibroblast Activation by Cytokines in Rheumatoid Arthritis VEGFA;MMP1;CXCL8 0.005952003

<Example 4> Identification of potential biomarkers induced by DEP in PHNECs

Based on the results of the route analysis, a simple signal transmission network was formed (Fig. 2). Genes described in FIG. 2 were selected as potential markers through gene interaction studies. Referring to FIG. 2, almost all genes are associated with inflammation and chemotaxis, and mostly encode secreted proteins. In particular, VEGFA was directly or indirectly related to all adjacent genes. In addition, CXCL8, CSF3 and MMP1 also had many relationships between genes. Moreover, since VEGFA, CXCL8, CSF3 and MMP1 are genes associated with inflammation, they may be major biomarkers of intranasal inflammatory diseases caused by DEP. In PHNEC exposed to 200 μg/ml DEP, the expression levels of CSF3 and MMP1 genes were confirmed through qRT-PCR, and the results are shown in Table 5 and FIG. 3.

Gene Symbol Genbank Accession # Gene Name 200㎍/ml Fold change P-value VEGFA NM_001025370 vascular endothelial growth factor A 0.46904266 0.000650704 CSF3 NM_000759 colony stimulating factor 3 (granulocyte) 2.0943685 0.000934208

As a result, when exposed to 200 μg/ml of DEP, the expression level of VEGFA was down-regulated, and it was confirmed that the expression level of CSF3 was significantly up-regulated. Therefore, the specific expression change of VEGFA and CSF3 by DEP exposure suggested that the gene can be usefully used as a biomarker to confirm whether DEP is exposed. In addition, since it was confirmed that VEGFA and CSF3 are genes involved in the inflammatory response in the previous results, it was confirmed that they can also be used to diagnose intranasal inflammatory diseases induced by DEP exposure.

The above description of the present invention is for illustration only, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified to other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.

As described above, the present invention confirms a change in gene expression in nasal cells exposed to DEP, and shows a specific transcript expression change through signal transmission network verification through big data analysis based on actual pre-research results. The gene VEGFA was selected, and when exposed to DEP, it was confirmed that the expression level of the VEGFA is down-regulated. Therefore, the composition for confirming whether intranasal DEP is exposed in the present invention can be diagnosed and predicted more quickly and accurately than the conventional method for confirming DEP exposure, and since VEGFA is a gene involved in an inflammatory response, diagnosis of intranasal inflammatory disease caused by DEP Can also be used for

<110> Dongguk University Industry-Academic Cooperation Foundation Seoul National University R&DB Foundation <120> Compositions for identification of exposure to diesel exhaust particle at nasal cavity <130> NP18-0018D <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> MMP1 forward primer <400> 1 catatatgga cgttcccaaa atcc 24 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MMP1 reverse primer <400> 2 gtgcgcatgt agaatctgtc tttaa 25 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CXCL8 forward primer <400> 3 agacagcaga gcacacaagc 20 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CXCL8 reverse primer <400> 4 atggttcctt ccggtggt 18 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CSF3 forward primer <400> 5 cacccagagc cccatgaagc t 21 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CSF3 reverse primer <400> 6 gcacagcttg taggtggcac actc 24 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> NCK2 forward primer <400> 7 atagccaagt gggactac 18 <210> 8 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> NCK2 reverse primer <400> 8 tgtgtccttc aggttctt 18 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CXCL14 forward primer <400> 9 atgaagccaa agtacccgca c 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CXCL14 reverse primer <400> 10 ttccaggcgt tgtaccactt g 21 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> VEGFA forward primer <400> 11 atcaccatgc agattatgcg g 21 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> VEGFA reverse primer <400> 12 ggctccaggg cattagacag 20 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GAPDH forward primer <400> 13 atggggaagg tgaaggtcg 19 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH reverse primer <400> 14 ggggtcattg atggcaacaa 20

Claims (12)

It includes an agent that measures the expression level of VEGFA protein or mRNA encoding it, and when exposed to diesel exhaust particles in the nasal cavity, the expression level of the VEGFA protein or mRNA encoding it is down-regulated compared to the normal control A composition for confirming whether or not diesel exhaust particulates are exposed in the nasal cavity.
According to claim 1,
A composition in which the agent is an antibody.
According to claim 1,
A composition in which the agent is a primer or probe.
delete A kit for confirming whether diesel exhaust particulates are exposed in the nasal cavity, comprising the composition of claim 1.
A method for evaluating exposure to diesel exhaust particulates in the nasal cavity by confirming a decrease in the expression level of VEGFA protein or mRNA encoding the same.
The method of claim 6,
(a) measuring the expression level of VEGFA protein or mRNA encoding it from a biological sample suspected of being exposed to diesel exhaust particulates; And
(b) measuring the expression level of the protein or mRNA encoding it from the normal control sample and comparing it with the measurement result of step (a), but when the expression of VEGFA is down-regulated compared to the normal control sample, diesel A method for evaluating exposure to diesel exhaust particulate, comprising the step of evaluating exposure to exhaust particulate.
The method of claim 7,
The biological sample is a method characterized in that the tissue or cells derived from the nasal cavity.
delete The method of claim 7,
The measurements include microarray, reverse transcriptase-polymerase chain reaction, real time-polymerase chain reaction, Western blot, Northern blot, ELISA (enzyme linked immunosorbent assay) , Radioimmunoassay (RIA), radioimmunodiffusion, and immunoprecipitation assay.
The method of claim 7,
The method for evaluating whether the diesel exhaust particles are exposed is used for diagnosing an intranasal inflammatory disease induced by diesel exhaust particles.
The method of claim 6,
(a) measuring the expression level of VEGFA protein or mRNA encoding it from a biological sample suspected of being exposed to diesel exhaust particulates; And
(b) measuring the expression level of the protein or mRNA encoding it from the normal control sample and comparing it with the measurement result of step (a), but when the expression of VEGFA is down-regulated compared to the normal control sample, diesel A method for evaluating exposure to diesel exhaust particulates, comprising evaluating the likelihood that inflammatory diseases in the nasal cavity will be caused by the exhaust particulates.

Images