KR102121945B1 - Entomopathogenic fungi and insecticide comprising same - Google Patents

Abstract

The present invention relates to an entomopathogenic fungus and an insecticide comprising the same, and more specifically, to an entomopathogenic fungus Beauveria pseudobassiana having significant insecticidal effects against thrips of all stages including imagoes, nymphs, and pupae, and to an insecticide composition comprising the same. Thrips spp. belong to the order Thysanoptera and are minute insects that cause a significant damage all year around to all flowering-crops in horticulture, floriculture, and the like. According to the present invention, the entomopathogenic fungus Beauveria pseudobassiana, which is a new phylogeny never previously reported worldwide, exhibits significant insecticide effects against thrips of all stages including imagoes, nymphs, and pupae, and thus is expected to be usefully utilized in the agriculture, forest industry, and horticulture.

Description

Insect pathogenic fungi and insecticides containing the same {ENTOMOPATHOGENIC FUNGI AND INSECTICIDE COMPRISING SAME}

The present invention relates to insect pathogenic fungi and insecticides containing the same, specifically, insecticidal pathogenic fungi Boberia pseudobassiana (Beauveria pseudobassiana) having a remarkable insecticidal effect on thrips adults, nymphs, and pupae, and pesticide compositions comprising the same It is about.

Thrips spp. is an insect belonging to the thrips family and is a micro-pest that occurs all year round and causes enormous damage to all flowering crops such as horticulture and flowers. In particular, the yellow flower thrips (Frankliniella occidentalis) and the cucumber thrips (ThripspalmiKarny) are foreign infested pests that have recently spread nationwide and cause serious damage to various crops and mediate viruses such as tomato spot forgery virus (TSWV). Is particularly required. On the other hand, thrips are highly proliferative and develop resistance to chemical pesticides faster than other pests. In addition, thrips are considered to be relatively difficult to control by insecticides, because after a month after invasion into the facility, a generation passes and various ages such as eggs, larvae, pupae, and adult insects occur.

To control thrips, about 220 chemical pesticides such as pyriproxyfen and pinetoram have been used. However, thrips are resistant to most of these chemical pesticides, and are also resistant to recently developed chemical pesticides such as spinosad, acetamiprid, and denotefuran. Carbamite-based insecticides (bendiocarb, carbosulfane, methiocarb, etc.), organic phosphate-based insecticides (methomil, clopyriphos, diazino, etc.), synthetic pyrethroid-based insecticides (acrinathrin, benpetrin, ci Halotrine, etc.), neonicotinoid-based insecticides (imidacloprid, acetaprid, dinotefuran, etc.), microbial-derived biochemicals (spinosad), mectin pesticides (abamectin, milbamectin, etc.) It has been reported as a resistant chemical pesticide.

Recently, as the interest in side effects such as the emergence of resistant pests and environmental pollution due to the use and abuse of chemical pesticides has increased, the use of chemical pesticides is gradually limited, and these chemical pesticides can be replaced and biologically safe. Control methods are actively being studied. For example, it is a method of controlling by using natural enemies such as asteraceae (Orius sp.) and predatory mites, or by using insect pathogenic fungi that infect pests. To date, more than 750 insect pathogenic fungi have been known, among which Boberia basiana, Metarhizium anisopliae, Nomuraea riley, and others are developed as microbial insecticides. It has been used to control various pests.

With regard to the Boberian bassiana strain, Korean Patent Publication No. 10-2016-0000537 discloses the control activity against the Boberian bassiana FG274 strain and its papam moth larvae, and Korean Patent Publication No. 10-2016-0139521 Control activity against Boberia Bassiana SD15 strain and its spotted mite or peach aphid, Korean Patent Publication No. 10-2016-0084968 has a control activity against Boberia Bassiana JEF007 strain and its saw-leg ant herring bug, domestic patent Publication No. 10-2011-0011239 is a Boberian Basiana MaW1 strain and its brackish celestial celestial or hairy toad celestial tract control activity, domestic patent publication No. 10-2011-0094749 is a Boberian Bassiana MsW1 strain and a northern beard celestial tract control activity , Korean Patent Publication No. 10-2015-0113255 discloses a control activity against water pests such as the strain of Boberia bassiana ERL 836 and aphid or weevil. However, there is still a need for new highly active microbial pesticides that are capable of controlling thrips as strongly as chemical pesticides, and are environmentally friendly and easy to handle and use.

Accordingly, the present inventor completed the present invention to develop a natural insecticide having a remarkable insecticidal effect in all thrips, nymphs, and pupae.

Domestic Patent Publication No. 10-2016-0000537 Domestic Patent Publication No. 10-2016-0139521 Domestic Patent Publication No. 10-2016-0084968 Domestic Patent Publication No. 10-2011-0011239 Domestic Patent Publication No. 10-2011-0094749 Domestic Patent Publication No. 10-2015-0113255

Thrips spp. is an insect belonging to the thrips family and is a micro-pest that occurs all year round and causes enormous damage to all flowering crops such as horticulture and flowers.

Therefore, the main object of the present invention is to provide a natural insecticide having a remarkable insecticidal effect in thrips adults, nymphs, and pupae.

According to one aspect of the present invention, the present invention provides an insect pathogenic Boberia pseudobassiana strain, more specifically an insect pathogenic Boberia pseudobaciana 18-102 (microbial accession number KACC 93313P) strain. The strain of the present invention includes flower yellow thrips, cucumber thrips, green onion beetles, Taiwan thrips, convex thrips, sardine thrips, thrips, hawaiian thrips, buttercup thrips, and cockerel thrips It has a remarkable control effect on the insects of the genus Coleoptera.

The thrips above are microscopic insects with wings. The body size is very small, about 0.6~12mm, and the shape of the goji is asymmetric in left and right, and it has the characteristic of sucking and sucking the prey. In addition, thrips are insects that suffer from pupae periods among insects that are incompletely metamorphose. From 4th, the first pupa, and the 5th, the second pupa. Unlike the previous stages, the 4-5th order has incomplete wings. Hibernate as an adult or nymph. Except for some species that eat aphids, most of them are pests that parasitic or inhabit within plant tissues. The thrips are distributed around 5000 in the world, especially in the tropics. More than 60 species are distributed in 2 subspecies in Korea.

Thrips are highly proliferative and develop resistant to chemical pesticides faster than other pests. In addition, thrips are considered to be relatively difficult to control by insecticides, because after a month after invasion into the facility, a generation passes and various ages such as eggs, larvae, pupae, and adult insects occur.

Since the insect pathogenic Boberia pseudobaciana 18-102 (microbial accession number KACC 93313P) strain of the present invention is a fungus, it has the effect of directly infecting thrips of the thrips and infecting it by secondary spores, thereby causing infection. , It can be used permanently.

In addition, the insect pathogenic Boberian pseudobaciana 18-102 (microbial accession number KACC 93313P) strain of the present invention is an environment-friendly insecticide, and it is possible to simultaneously control not only adults and medicinal insects that live on the ground, but also pupae that live on the underground.

In addition, the insect pathogenic Boberia pseudobaciana 18-102 (microbial accession number KACC 93313P) strain of the present invention can be used as an eco-friendly control technology for micro-pests that are difficult to control, such as aphids and mites, in addition to thrips.

According to another embodiment of the present invention, the insect pathogenic Boberia pseudobassiana strain, more specifically, the Boberia pseudobaciana strain 18-102 (microorganism accession number KACC 93313P) strain, the spore of the strain, the strain It provides a microbial pesticide comprising any one selected from the group consisting of cultures, concentrates of the strain, dried products of the cultures, and combinations thereof.

The microbial insecticides of the present invention include flower yellow thrips, cucumber thrips, green onion beetles, Taiwan thrips, convex thrips, sardine thrips, thrips, hawaiian thrips, buttercup thrips, and thrips thrips. It has a remarkable control effect on the insects of the genus Coleoptera, and has excellent control effects on insect eggs, larvae, larvae, nymphs, adults, or pupae.

According to another aspect of the invention, (a) culturing the insect pathogenic Boberia pseudobassiana (Beauveria pseudobassiana) strain in a medium; And (b) harvesting the culture; to provide a method for producing a microbial pesticide, and more specifically, the strain is Boberia pseudobaciana 18-102 (microbial accession number KACC 93313P). Provided by the method, the insecticide is flower yellow thrips, cucumber thrips, green onion beetles, Taiwan thrips, convex thrips, sardine thrips, thrips, hawaiian thrips, buttercup thrips, and thrips thrips It provides a method for producing a microbial pesticide that has a remarkable control effect on the entire Coleoptera insect, wherein the insecticide is a microbial pesticide having an insecticidal effect on eggs, larvae, larvae, nymphs, adults, or pupae of insects It provides a method of manufacturing.

According to another aspect of the present invention, applying the microbial insecticide to insect repellent, land above the ground, or applying to the ground below; provides an insect control method comprising a.

Insect pathogenic fungus Boberia pseudobassiana according to the present invention is a new strain reported for the first time worldwide, since it has a remarkable insecticidal effect on thrips, nymphs, and pupae, in agriculture, forestry, and horticulture. It is expected to be useful.

Figure 1 shows the form of a symbiotic pathogenic fungus isolated from a thrips carcass according to an embodiment of the present invention.
Figure 2 shows the form of a symbiotic pathogenic fungus isolated and cultured from the thrips body according to an embodiment of the present invention.
Figure 3 shows the molecular biological relationship of the newly isolated Boberia pseudobaciana line in the present invention according to an embodiment of the present invention.
Figure 4 shows the form of a whole flower thrips (A) and a flower yellow thrips (B, C) infected with Boberia pseudobaciana newly isolated in the present invention according to an embodiment of the present invention.
5 is a result showing the insecticidal effect of the newly isolated Boberia pseudobaciana in the present invention for the flower thrips adult according to an embodiment of the present invention.
Figure 6 is a result showing the insecticidal effect of the newly isolated Boberia pseudobaciana in the present invention against the yellow beetle nymphs according to an embodiment of the present invention.
7 is a result showing the insecticidal effect of the newly isolated Boberia pseudobaciana in the present invention for the flower yellow thrips pupae according to an embodiment of the present invention.

Hereinafter, embodiments and embodiments of the present invention will be described in detail with reference to the accompanying drawings so that those skilled in the art to which the present application pertains may easily practice.

However, the present invention can be implemented in many different forms and is not limited to the embodiments and examples described herein. In addition, in order to clearly describe the present invention, parts not related to the description are omitted. Throughout the specification of the present invention, when a part “includes” a certain component, it means that the component may further include other components, not to exclude other components, unless specifically stated to the contrary.

The present invention is characterized by providing a strain of Boberia pseudobassiana, more specifically, an insect pathogenic Boberia pseudobassiana 18-102 strain.

The insect pathogenic Boberia pseudobaciana 18-102 strain of the present invention is a culture obtained by separating fungi from the thrips of the thrips, and as a result of testing by the present inventors with mycological and molecular biological properties, a new strain reported for the first time worldwide Was confirmed, and the microorganism was deposited (accession number KACC 93313P).

Insect pathogenic Boberia pseudobaciana 18-102 strain of the present invention is preferably used for the control of microinsects, more preferably used for the control of thrips, flower yellow thrips, cucumber thrips, green onions It is more preferably used for controlling thrips, Taiwan thrips, convex thrips, sardine thrips, thrips, hawaiian thrips, buttercup thrips, or cockerel thrips, but is not limited thereto.

In the present specification, the above-mentioned control means preventing a disaster, and controlling insects or controlling pests means preventing a disaster caused by an infestation of pests. Pest control using chemical pesticides emerges resistant pests and causes side effects such as environmental pollution, and thus, the use of chemical pesticides is gradually being restricted, and chemical pesticides that can replace chemical pesticides and require environmentally safe biological control methods are required. have. The insect pathogenic Boberia pseudobaciana strain 18-102 (Accession No. KACC 93313P) of the present invention can be used as a natural pesticide as an antagonistic fungus for biological control.

The present invention is the Boberia pseudobassiana (Beauveria pseudobassiana) strain, more specifically, the insect pathogenic Boberia pseudobaciana 18-102 strain (Accession No. KACC 93313P), the spore of the strain, the culture of the strain, the strain It characterized in that to provide a microbial pesticide comprising any one selected from the group consisting of a concentrate, a dried product of the culture and a combination thereof.

According to the present invention, the insect-pathogenic Boberian pseudobaciana 18-102 strain (Accession No. KACC 93313P) has a remarkable control effect on the insects of the whole Coleoptera, and controls the eggs, larvae, larvae, nymphs, adults, and pupae of insects. The effect is excellent. Therefore, the above-mentioned microbial insecticide can be effectively controlled by applying insect repellent, land above the ground, or land below the ground.

Hereinafter, the present invention will be described in more detail through examples. Since these examples are only for illustrating the present invention, the scope of the present invention is not to be construed as being limited by these examples.

<Example>

Identification of insect pathogenic fungi derived from thrips

The fungus was isolated from the thrips and cultured. 1 and 2 show the forms of the symbiotic pathogenic fungi infected with the thrips and the cultures of the fungi separated and cultured.

The isolated fungi were tested for mycological and molecular biological properties for the identification of fungi. First, as a result of the identification of fungi by mycological characteristics, it was found that the fungus isolated from thrips was the Boberia pseudobassiana. Boberia pseudobaciana was an insect-pathogenic fungus, Beauveria, and their elongation factor (EF-1) region gene sequences were analyzed for accurate molecular systems. Table 1 shows the gene sequence of the extension factor (EF-1) of the Boberian pseudobaciana.

The extension factor of Boberian Pseudo-Basiana EF-1 (768 bp) SEQ ID NO: 1 AGACAAGACTCACATCAACGTCGTCGTTATCGGGTGCGTTCCATCGCCCAACGATTTCGATTTCGATGAGCATCAATGAATACTGACTACTCAAACAGCCACGTCGATTCCGGCAAGTCTACCACCGTAAGTTTACTCACACTCAACGGCTGAGCGGCGCTTCCGCTTCTGCAAAGCTTACCCCGCCTTGCCCGCGACCACAATGAGTGCAATCGCTAACCCGCATACAGACTGGTCACTTGATCTACCAGTGCGGTGGTATTGACAAGCGTACCATCGAGAAGTTCGAGAAGGTAAGAATCTCAGTTCTTGTTTTTTTGTCGTCTTTGTCGCTCTCGATCGCCTGCTATGCAAATTTTTTTTCTCAGCAGCGATCGCCGCCGTCACTGTGGCCACTGGCCGCTACCCCTCCTTGCTGCGGCAAAAATTTTCAAGGTGCCTCATCGTTTCCGGTGGGGCTGGTCATGGATACCCCGCCGCGTTGTTGCAAGCCTGCCCCTCATCGAACTCATCGCTTGTTGAGCGGCCAACCAAGAATCATATGCAATCAGTTGTGCCAATTATTTGCTAACCATGATCTCTCACACAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTATGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCCCTCTGGAAGTTCGAGACTCCCAAGTTCCACGTCACCGTCATTGATGCTCCCGGTCACCGTGATTTCATCAAGAACATGATGAT

As a result of the experiment, it was confirmed that the fungus isolated from thrips was a new strain reported for the first time in the world among Boberian pseudobacianas, and was deposited with the Korea Agricultural Genetic Resources Service System (Microorganism Accession Number KACC 93313P).

The results of the identification of fungi showing the molecular biological relationship are shown in FIG. 3.

Pathogenicity test for micro-pests using thrips-derived insect pathogenic fungi

The pathogenicity of healthy flower yellow thrips adults, nymphs, and pupae were raised indoors using the new strain of Boberian pseudobacianas identified in the present invention. Fig. 4 shows the form of a whole flower thrips (A) and a flower thrips (B, C) infected with the Boberian pseudobaciana of the present invention.

Experiments, 10 ⁵ to 10 ⁸ adult is 97 to 100% at all levels three days after spraying, nymphs are showed a mortality of 91-100% pupa more than 82% at 10 ^5, the mortality of 10 to ^8100% It was confirmed that it has an excellent insecticidal effect at all stages of development. The results are shown in FIGS. 5 to 7.

Since the specific parts of the present invention have been described in detail above, it is clear that for those skilled in the art, these specific technologies are only preferred embodiments, and the scope of the present invention is not limited thereto. Therefore, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

Agricultural Biotechnology Research Institute KACC93313 20180806

<110> REPUBLIC OF KOREA(MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> ENTOMOPATHOGENIC FUNGI AND INSECTICIDE COMPRISING SAME <130> 1 <160> 1 <170> KoPatentIn 3.0 <210> 1 <211> 768 <212> DNA <213> Beauveria sp. <400> 1 agacaagact cacatcaacg tcgtcgttat cgggtgcgtt ccatcgccca acgatttcga 60 tttcgatgag catcaatgaa tactgactac tcaaacagcc acgtcgattc cggcaagtct 120 accaccgtaa gtttactcac actcaacggc tgagcggcgc ttccgcttct gcaaagctta 180 ccccgccttg cccgcgacca caatgagtgc aatcgctaac ccgcatacag actggtcact 240 tgatctacca gtgcggtggt attgacaagc gtaccatcga gaagttcgag aaggtaagaa 300 tctcagttct tgtttttttg tcgtctttgt cgctctcgat cgcctgctat gcaaattttt 360 tttctcagca gcgatcgccg ccgtcactgt ggccactggc cgctacccct ccttgctgcg 420 gcaaaaattt tcaaggtgcc tcatcgtttc cggtggggct ggtcatggat accccgccgc 480 gttgttgcaa gcctgcccct catcgaactc atcgcttgtt gagcggccaa ccaagaatca 540 tatgcaatca gttgtgccaa ttatttgcta accatgatct ctcacacagg aagccgctga 600 actcggcaag ggttccttca agtatgcctg ggttcttgac aagctcaagg ccgagcgtga 660 gcgtggtatc accatcgata tcgccctctg gaagttcgag actcccaagt tccacgtcac 720 cgtcattgat gctcccggtc accgtgattt catcaagaac atgatgat 768

Claims (15)

As an insect pathogenic Boberia pseudobassiana 18-102 (microorganism accession number KACC 93313P) strain,
The insect is a thrips, strain.
delete delete According to claim 1,
The thrips insect is composed of flower yellow thrips, cucumber thrips, green onion beetles, Taiwan thrips, convex thrips, sardine thrips, thrips, hawaiian thrips, buttercup thrips, and cockerel thrips Any one selected from the group, strain.
Insect pathogenic Boberia pseudobassiana 18-102 (microbial accession number KACC 93313P) strain, spores of the strain, culture of the strain, concentrate of the strain, dry matter of the culture and combinations thereof Microbial insecticide for thrips insects comprising any one selected from the group.
delete delete The method of claim 5,
The thrips insect is composed of flower yellow thrips, cucumber thrips, green onion beetles, Taiwan thrips, convex thrips, sardine thrips, thrips, hawaiian thrips, buttercup thrips, and cockerel thrips Microbial pesticide, which is any one selected from the group.
The method of claim 5,
The insecticide is an insect egg, larvae, larvae, nymphs, adults, or having a pesticidal effect on pupa, microbial pesticides.
(a) culturing an insect pathogenic Boberia pseudobassiana 18-102 (microorganism accession number KACC 93313P) strain in a medium; And
(B) harvesting the culture; Method for producing a microbial insecticide for thrips insect comprising a.
delete delete The method of claim 10,
The thrips insect is composed of flower yellow thrips, cucumber thrips, green onion beetles, Taiwan thrips, convex thrips, sardine thrips, thrips, hawaiian thrips, buttercup thrips, and cockerel thrips Any one selected from the group, the method for producing a microbial pesticide.
The method of claim 10,
The insecticide is an insect egg, larvae, larvae, nymphs, adults, or pupae having a pesticidal effect, a method for producing a microbial insecticide.
Claim 5, 8 or claim 9, wherein the step of applying the microbial pesticide; comprising, thrips control method.

Images