KR102104478B1 - Composition for enhancing sensitivity to anti-cancer agent comprising of miR-133a-3p as an active ingredient - Google Patents

Abstract

The present invention relates to a composition for enhancing the sensitivity of an anticancer agent containing miR-133a-3p as an active ingredient, specifically, miR-133a-3p expression is reduced in anticancer drug resistant breast cancer, and GSTP is up-regulated to induce anticancer drug resistance. On the other hand, since it was confirmed that anti-cancer drug sensitivity can be enhanced by down-regulating GSTP through miR-133a-3p re-expression, the miR-133a-3p can be used as a target factor in anticancer drug resistance cancer diagnosis and anticancer drug sensitivity enhancement. .

Description

Composition for enhancing sensitivity to anti-cancer agent comprising of miR-133a-3p as an active ingredient}

The present invention relates to a composition for enhancing anti-cancer agent sensitivity containing miR-133a-3p as an active ingredient, and more specifically, using an anti-cancer agent sensitivity enhancing composition containing miR-133a-3p as an active ingredient and miR-133a-3p It relates to a diagnostic method for anticancer drug resistance.

Currently, for the treatment of cancer, surgical therapy, radiation therapy, chemotherapy and biological therapy are used. Among these, anti-cancer chemotherapy refers to a method of treating cancer using an anti-cancer agent and was used in earnest by obtaining a cure effect by using methotrexate in choriocarcinoma.

In the case of drugs used in anticancer chemotherapy, efforts are being made to isolate components having anticancer effects through efficacy evaluation using various types of cancer cell lines and animal tumor models. For example, the DNA alkylating agents Mechlorethamine, Chlorambucil, Busulfan, Metabolic antagonists Metotresate, Fluorouracil, Doxifluridine, Gemsi Gemcitabine, plant-derived Taxol, Vincristine, Etoposide, the hormones tamoxifen, aromatase inhibitor (AI), prednisone, metal complexes Cisplatin is used for anti-cancer treatment, and research on anti-cancer chemotherapy for the prevention of cancer metastasis has been actively conducted to develop angiostatin, which is involved in the prevention and spread of cancer. As such, various anticancer drugs are used today, and recently, as a lot of knowledge about cancer occurrence and characteristics of cancer cells is known, research into new anticancer drugs has been actively conducted.

However, in using chemotherapy, resistance to anticancer agents has become an obstacle to cancer treatment. In order for chemotherapy for cancer patients to succeed, the patient must be able to accept side effects and the cancer cells must be killed at the blood concentration at which normal tissues can survive, and the drug resistance to the anticancer agent depends on the blood concentration at which cancer cells can be killed. It refers to the case where cancer cells do not die despite the administration of an anticancer agent in an amount that can be reached. Anticancer drug resistance can vary from patient to patient and can even be caused by a variety of factors, including genetic differences between tumors from the same tissue.

Breast cancer is a typical cancer that exhibits anticancer drug resistance. Breast cancer is the highest incidence among female cancer in Korea as well as in the West, and has become a major threat to women's health. Among the anticancer drugs of breast cancer, tamoxifen is the most widely used anticancer drug in the world as a therapeutic agent that targets and blocks the action of estrogen, which plays a major role in the development of breast cancer. Tamoxifen is widely used as a main treatment for breast cancer because it has a good effect without accompanied by severe side effects, but it is possible to grow breast cancer cells by expressing resistance that occurs after long-term use of tamoxifen, which is clinically recurred or metastasized. It is known to appear as.

Therefore, in recent years, while maintaining the advantages of chemotherapy, research for overcoming anticancer drug resistance has been actively conducted. For example, the relationship of miRNA has been studied with regard to increasing the sensitivity of anti-cancer agents such as tamoxifen or cisplatin.

On the other hand, micro RNA (microRNA or miRNA) is a small, non-coding single-stranded RNA molecule that regulates protein synthesis through gene-dependent RNA-dependent transcription control and consists of 20 to 22 nucleotides. miRNA is produced through a two-step process. Specifically, the first transcript miRNA (pri-miRNA) is made into a miRNA precursor (pre-miRNA) by Drosha and DGCR8 in the nucleus, and the pre-miRNA is released into the cytoplasm and then made into miRNA by Dicer. Recently, it is known that various cellular activities such as metabolism, apoptosis, and proliferation are regulated by miRNA in many carcinomas, and studies have been conducted to use it for diagnosis or treatment of cancer diseases using the same.

As a result, the present inventors tried to discover miRNAs that can be used for diagnosing anti-cancer drug resistance and enhancing anti-cancer drug sensitivity. As a result, miR-133a-3p expression is reduced in anti-cancer drug-resistant breast cancer against tamoxifen as anti-cancer drug-resistant cancer, and thus GSTP (Glutathione S- While transferase P1-1) is up-regulated to induce anti-cancer drug resistance, miR-133a-3p is added to confirm that GSTP is down-regulated and can enhance anti-cancer drug sensitivity, thereby improving anti-cancer drug-resistant cancer diagnosis and anticancer drug sensitivity. The invention was completed by revealing that miR-133a-3p can be used as a target factor.

Republic of Korea Registered Patent No. 10-1667649

Re-expression of microRNA-375 reverses both tamoxifen resistance and accompanying EMT-like properties in breast cancer. Oncogene 32, 1173-1182, doi: 10.1038 / onc.2012.128 (2013). miR-513a-3p sensitizes human lung adenocarcinoma cells to chemotherapy by targeting GSTP1. Lung cancer 77, 488-494 (2012).

An object of the present invention is to provide a composition for enhancing anti-cancer agent sensitivity, which contains miR-133a-3p or mimic thereof as an active ingredient.

Another object of the present invention is to provide a diagnostic method for anticancer drug resistance using miR-133a-3p.

In order to achieve the object of the present invention, the present invention provides an anti-cancer agent sensitivity enhancing composition containing miR-133a-3p or mimic thereof as an active ingredient.

In addition, the present invention provides an anti-cancer drug-resistant cancer treatment adjuvant containing miR-133a-3p or a mimetic thereof as an active ingredient.

In addition, the present invention

a) miR-133a-3p or mimic thereof; And

b) An anti-cancer composition comprising an anti-cancer agent as an active ingredient is provided.

In addition, the present invention

1) measuring the expression level of miR-133a-3p in a sample isolated from a cancer patient; And

2) providing a method for measuring miR-133a-3p expression level to provide diagnostic information for resistance to anti-cancer agents, comprising the step of analyzing the resistance to anti-cancer agents according to cancer progression by increasing or decreasing the expression level of step 1). do.

The present inventors show that miR-133a-3p expression is reduced in anti-cancer drug-resistant breast cancer against tamoxifen as an anti-cancer drug-resistant cancer, and thus, GTP (Glutathione S-transferase P1-1) is up-regulated to induce anti-cancer drug resistance, whereas miR Since it was confirmed that anti-cancer agent sensitivity can be enhanced by down-regulating GSTP through -133a-3p re-expression, the miR-133a-3p can be used as a target factor in diagnosing anti-cancer drug-resistant cancer and promoting anti-cancer drug sensitivity.

FIG. 1 shows mRNA expression of Glutathione S-transferase P1-1 (GSTP) in tamoxifen sensitive breast cancer cell line MCF7 cells and tamoxifen resistant breast cancer cell line LCC3 cells as anti-cancer agents according to an embodiment of the present invention (FIG. 1, left) ) And protein expression (FIG. 1, right).
2 is a diagram showing miR-133a-3p as a target miRNA that regulates GSTP according to an embodiment of the present invention, and showing its sequence.
3 is a view confirming the expression of miR-133a-3p in each of MCF7 cells and LCC3 cells according to an embodiment of the present invention.
4 is a diagram confirming miR-133a-3p expression and GSTP mRNA expression in MCF7 cells treated with 4-hydroxytamoxifen according to an embodiment of the present invention:
TAM5; 4-hydroxytamoxifen 5 μM treatment; And
TAM7: 4-hydroxytamoxifen 7 μM treatment.
5 is a diagram showing a GSTP mutant sequence mutated 3'UTR according to an embodiment of the present invention.
FIG. 6 shows miR-133a-3p in cells transfected with GSTP 3'UTR or GSTP 3'UTR mutation and negative control miRNA (NC) or miR-133a-3p mimic according to an embodiment of the present invention. It is a diagram confirming the degree of GSTP transcription activity by.
FIG. 7 shows miR-133a-3p expression (FIG. 7, left), GSTP mRNA expression (FIG. 7, left) in LCC3 cells transfected with a negative control miRNA (NC) or miR-133a-3p mimic according to one embodiment of the present invention. 7, middle) and GSTP protein expression (Fig. 7, right).
Figure 8 is a negative control miRNA (NC) or miR-133a-3p mimics transfected with LCC3 cells and MCF7 cells transfected according to an embodiment of the present invention after treatment of 4-hydroxytamoxifen is a diagram confirming the cell viability :
LCC3 NC: 4-hydroxytamoxifen treatment after transfection of negative control miRNA to LCC3 cells;
LCC3 miR133a-3p: 4-hydroxytamoxifen treatment after miR-133a-3p mimetic transfection of LCC3 cells; And
MCF7: MCF7 cells treated with 4-hydroxytamoxifen.

Hereinafter, the present invention will be described in detail.

The present invention provides a composition for enhancing anti-cancer agent sensitivity, which contains miR-133a-3p or its mimetic as an active ingredient.

In addition, the present invention provides an anti-cancer drug-resistant cancer treatment adjuvant containing miR-133a-3p or a mimetic thereof as an active ingredient.

In the present invention, the miR-133a-3p may be derived from animals including humans, for example, monkeys, chimpanzees, pigs, horses, cows, sheep, dogs, cats, mice, rabbits, and the like.

In the present invention, the miR-133a-3p is in the form of a mature miRNA, and the sequence information of the nucleic acid molecule is known from the National Institutes of Health Gene Bank (NIH GenBank) and miRBASE (http://www.mirbase.org/). It can be found in the genetic database. For example, the base sequence of human miR-133a-3p is registered under gene registration number MIMAT0000427 (SEQ ID NO: 1, 5'-UUUGGUCCCCUUCAACCAGCUG-3 ').

In addition, the miR-133a-3p may be in the form of a precursor miRNA having a length of 50 to 120 nt, more specifically 65 to 105 nt. For example, the nucleotide sequence of the miRNA precursor of human miR-133a-3p genes are registered number MI0000450 (SEQ ID NO: 2, 5'-ACAAUGCUUUGCUAGAGCUGGUAAAAUGGAACCAAAUCGCCUCUUCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUAUGCAUUGA-3 ') or MI0000451 (SEQ ID NO: 3, 5'-GGGAGCCAAAUGCUUUGCUAGAGCUGGUAAAAUGGAACCAAAUCGACUGUCCAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUGUGCAUUGAUGGCGCCG-3') with It is registered.

In addition, miR-133a-3p used in the present invention is functional equivalent of a nucleic acid molecule constituting it, for example, even if some of the base sequence of the miRNA nucleic acid molecule is modified by deletion, substitution or insertion, it is functional with the miRNA nucleic acid molecule. It is a concept that includes variants that can act as equivalent. For example, miR-133a-3p of the present invention may exhibit 80% or more homology with the base sequence of each corresponding SEQ ID No., and may specifically include 90% or more specifically 95% or more homology. have. Such homology can be readily determined by comparing the sequence of nucleotides to the corresponding portion of the target gene using computer algorithms well known in the art, such as Align or BLAST algorithms.

In addition, miR-133a-3p used in the present invention may exist in a single-stranded or double-stranded form. The mature miRNA molecule is predominantly single-stranded, but the precursor miRNA molecule can include partial self-complementary structures (eg stem-loop structures) that can form double strands. In addition, the nucleic acid molecule of the present invention may be configured in the form of RNA or peptide nucleic acids (PNA).

In addition, the miR-133a-3p used in the present invention may be separated or prepared using standard molecular biology techniques, for example, chemical synthesis methods or recombinant methods, or commercially available ones.

In the present invention, it may include the miR-133a-3p itself, but it may also include a functionally equivalent fragment, and the fragment of the miRNA may be a polynucleotide comprising a seed sequence of the miRNA, More specifically, it may be a polynucleotide comprising the seed sequence of SEQ ID NO: 4 (5'-UGGUCC-3 '). Seed sequence (seed sequence) refers to the nucleotide sequence of a portion of the miRNA in the miRNA that binds with full complementarity when the miRNA recognizes the target, which is an essential part of miRNA binding to the target.

In addition, the miR-133a-3p can be used in the form of various miRNA mimics that generate their biological equivalent efficacy, and modified miRNAs comprising miRNA sequences containing the same seed region Can be used. The miRNA mimic for the miRNA may partially include a phosphorothiolate structure in which the RNA phosphate backbone structure is substituted with other elements such as sulfur, and instead of RNA, DNA and PNA (petide nucleic acids) can be used in the form of full or partial substitution with a molecule, and also in the form of substitution of 2 'hydroxyl groups of RNA sugars with various functional structures, such as methylation, methoxylation, fluorination, etc. Including but not limited to these variations.

In the present invention, the miR-133a-3p may be included in a vector or provided in a form introduced into cells.

Specifically, the miR-133a-3p may be provided by being included in an expression vector for intracellular delivery. The expression vector can be used for both viral and non-viral vectors. As a viral vector, for example, a lentivirus, a retrovirus, an adenovirus, a herpes virus or an abipox virus vector may be used, It is not limited thereto.

The expression vector may further include a selection marker to facilitate selection of the transduced cells. Markers that confer selectable phenotypes, such as, for example, drug resistance, nutritional demand, resistance to cytotoxic agents, or expression of surface proteins, such as green fluorescent proteins, puromycin, neomycin, hygromycin, Histidinol dihydrogenase (hisD) and guanine phosphoribosyltransferase (Gpt); and the like.

In addition, the miR-133a-3p may be provided in a form introduced into cells. These cells are able to express miR-133a-3p at a high level. As a method for introducing into cells, for example, G-fectin, Mirus TrasIT-TKO lipid affinity reagent, lipofectin, lipofectamine, cellfectin, cationic phospholipid nanoparticles, cationic polymer, cationic micelle , It can be introduced into the cell together with a delivery reagent containing a cationic emulsion or a liposome, or by conjugating a biocompatible polymer such as polyethylene glycol to increase the absorption in the cell.

In the present invention, the anti-cancer agent is, for example, breast cancer, lung cancer, stomach cancer, colon cancer, liver cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, melanoma of the skin or eye, uterine cancer, ovarian cancer, rectal cancer, anal rectal cancer, colon cancer , Fallopian tube carcinoma, endometrial carcinoma, cervical carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, esophageal cancer, small intestine cancer, endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, It can be used for the treatment of chronic or acute leukemia, lymphocytic lymphoma, bladder cancer, kidney or urinary tract cancer, renal cell carcinoma, renal pelvic carcinoma, CNS tumor, primary CNS lymphoma, spinal cord tumor, brainstem glioma or pituitary adenoma, more specifically breast cancer It can be used for treatment, but is not limited thereto.

In the present invention, the anti-cancer agent is, for example, tamoxifen (Tamoxifen), aromatase inhibitor (Aromatase inhibitor; AI), prednisone (Prednisone), raloxifene (Raloxifene), toremifene (Toremifene). Clomiphene, 5-FU, 5-methotrexate, cyclophosphamide, nimustine, gemcitabine, tegafururacil (UFT), doxorubicin (Doxorubin), Epirubicin, Mitomycin, Phleomycin, Paclitaxel, Docetaxel, Cisplatin, Oxaliplatin, Iricancan, Irican For example, it may be Etoposide, Axitinib, or Tarceva, and more specifically, tamoxifen, but is not limited thereto.

In the present invention, the miR-133a-3p can reduce the expression of Glutathione S-transferase P1-1 (GSTP), and more specifically miR-133a-3p binds to GSTP 3'UTR to inhibit the transcriptional activity of GSTP By doing so, GSTP expression can be reduced.

In a specific embodiment of the present invention, the present inventors compared the expression of GSTP, which plays an important role in cancer sensitivity in tamoxifen-resistant breast cancer cell line LCC3 cells and tamoxifen-sensitive breast cancer cell line MCF7 cells as anti-cancer drug-resistant cancer cells, compared to MCF7 cells. It was confirmed that GSTP expression was significantly increased in LCC3 cells (see FIG. 1).

In addition, the present inventors derived miR-133a-3p as a miRNA that regulates GSTP expression, and as a result of comparing the expression of the miRNA in LCC3 cells and MCF7 cells, miR-133a-3p expression in LCC3 cells compared to MCF7 cells It was confirmed that it was significantly reduced (see FIGS. 2 and 3). In addition, when 4-hydroxytamoxifen (4-Hydroxytamoxifen), an active metabolite of tamoxifen, was treated in MCF7 cells, it was confirmed that miR-133a-3p expression decreased and GSTP expression increased (see FIG. 4). Through this, it was confirmed that tamoxifen induces anti-tumor resistance to tamoxifen by inducing miR-133a-3p expression and inducing upregulation of GSTP.

In addition, the present inventors confirmed that miR-133a-3p regulates tamoxifen sensitivity by down-regulating GSTP transcription by directly targeting GSTP 3'UTR (see FIGS. 5 and 6).

In addition, the present inventors confirmed that GSTP is down-regulated and tamoxifen sensitivity is increased by adding miR-133a-3p mimetic to LCC3 cells (see FIGS. 7 and 8).

Therefore, the present inventors have miR-133a-3p expression in tamoxifen-resistant anti-cancer drug-resistant breast cancer, and thus GSTP is up-regulated to induce anti-cancer drug resistance, whereas miR-133a-3p down-regulates GSTP and anti-cancer drug sensitivity. Since it was confirmed that it is enhanced, the miR-133a-3p can be used as a composition for enhancing anti-cancer drug sensitivity and as a cancer treatment adjuvant for enhancing anti-cancer drug sensitivity.

 The anti-cancer agent sensitivity enhancing composition or anti-cancer drug-resistant cancer treatment adjuvant of the present invention may further include a pharmaceutically acceptable carrier, and may be formulated with the carrier.

The pharmaceutically acceptable carrier refers to a carrier or diluent that does not stimulate the organism and does not inhibit the biological activity and properties of the administered compound. For example, as a pharmaceutical carrier acceptable for a composition formulated as a liquid solution, as a sterile and biocompatible, saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, Glycerol, ethanol and one or more of these components can be used in combination, and other conventional additives such as antioxidants, buffers, bacteriostatic agents can be added as necessary. It can also be formulated in solution or suspension (eg, integrated with microparticles, liposomes, or cells).

The anti-cancer agent sensitivity enhancing composition or anti-cancer drug-resistant cancer treatment adjuvant of the present invention is applicable to any formulation containing it as an active ingredient, and can be prepared and administered as an oral or parenteral formulation. Administration means introducing the composition of the present invention to a patient in any suitable way, and includes delivery of nucleic acid molecules by viral or non-viral technology or transplantation of cells expressing nucleic acid molecules. The route of administration of the composition of the present invention can be administered through various routes, oral or parenteral, as long as it can reach the target tissue. For example, oral administration, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, intrapulmonary administration, rectal administration, intraperitoneal administration, intraperitoneal administration, intrathecal administration may be performed, but is not limited thereto. Does not.

The anti-cancer agent sensitivity enhancing composition or anti-cancer drug-resistant cancer treatment adjuvant of the present invention is applicable to any animal in which cancer may occur, and the animal is not only human and primate, but also livestock such as cattle, pigs, sheep, horses, dogs, and cats. It includes.

It is apparent to those skilled in the art that the effective amount range or suitable total daily amount of the effective amount of the anti-cancer agent-sensitive composition or anti-cancer drug-resistant cancer treatment adjuvant of the present invention can be determined by the treating physician within the proper medical judgment. The specific therapeutically effective amount for a particular patient includes the specific composition, patient's age, weight, general health status, gender and diet, time of administration, including the type and extent of response to be achieved and, in some cases, whether other agents are used. It is desirable to apply differently depending on various factors including the route of administration and the secretion rate of the composition, the duration of treatment, and the radiation dose to be irradiated and similar factors well known in the pharmaceutical field. For example, it may be used as 0.001 μg / kg-100 mg / kg (body weight) per day, but is not limited thereto. It is preferable to determine the effective amount of a pharmaceutical composition suitable for the purpose of the present invention in consideration of the foregoing.

In addition, the anti-cancer agent sensitivity enhancing composition or anti-cancer drug-resistant cancer treatment adjuvant of the present invention may be administered simultaneously with the anti-cancer agent (simultaneous), separately (separate) or sequentially.

In addition, the present invention

a) miR-133a-3p or mimic thereof; And

b) An anti-cancer composition comprising an anti-cancer agent as an active ingredient is provided.

In the present invention, the anti-cancer agent is, for example, breast cancer, lung cancer, stomach cancer, colon cancer, liver cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, melanoma of the skin or eye, uterine cancer, ovarian cancer, rectal cancer, anal rectal cancer, colon cancer , Fallopian tube carcinoma, endometrial carcinoma, cervical carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, esophageal cancer, small intestine cancer, endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, It can be used for the treatment of chronic or acute leukemia, lymphocytic lymphoma, bladder cancer, kidney or urinary tract cancer, renal cell carcinoma, renal pelvic carcinoma, CNS tumor, primary CNS lymphoma, spinal cord tumor, brainstem glioma or pituitary adenoma, more specifically breast cancer It can be used for treatment, but is not limited thereto.

In the present invention, the anti-cancer agent is, for example, tamoxifen (Tamoxifen), aromatase inhibitor (Aromatase inhibitor; AI), prednisone (Prednisone), raloxifene (Raloxifene), toremifene (Toremifene). Clomiphene, 5-FU, 5-methotrexate, cyclophosphamide, nimustine, gemcitabine, tegafururacil (UFT), doxorubicin (Doxorubin), Epirubicin, Mitomycin, Phleomycin, Paclitaxel, Docetaxel, Cisplatin, Oxaliplatin, Iricancan, Irican For example, it may be Etoposide, Axitinib, or Tarceva, and more specifically, tamoxifen, but is not limited thereto.

In the present invention, the miR-133a-3p can reduce the expression of Glutathione S-transferase P1-1 (GSTP), and more specifically miR-133a-3p binds to GSTP 3'UTR to inhibit the transcriptional activity of GSTP By doing so, GSTP expression can be reduced.

The present inventors have shown that miR-133a-3p expression is reduced in anti-cancer drug-resistant breast cancer against tamoxifen, and thus GSTP is up-regulated to induce anti-cancer drug resistance, while miR-133a-3p down-regulates GSTP and enhances anti-cancer drug sensitivity. As confirmed, the miR-133a-3p can be used as an anti-cancer composition for cancer treatment together with an anti-cancer agent.

The anti-cancer composition of the present invention only needs to contain miR-133a-3p and an anti-cancer agent as an active ingredient, and any form of drug may be used. For example, a mixture containing two active ingredients may be constituted, or may be constituted as a single agent, respectively. Herein, a mixture means a combination of two or more active ingredients in one formulation, and a single agent means one containing one active ingredient in one formulation, wherein the active ingredients are according to their respective pharmacological and pharmacokinetic properties. They can be prepared and combined in different formulations. In the present invention, the therapeutic agent in the case where the two active ingredients are single agents means a drug used by combining single agents that can be used individually. When the two active ingredients are single agents, they may be in the form of a kit having both ingredients at once.

The anticancer composition of the present invention can be formulated by a known method together with a suitable pharmaceutically acceptable carrier or excipient as described below or alone. As specific examples of such a formulation, oral capsules such as soft capsules, hard capsules, tablets, syrups, injections, or external preparations may be mentioned.

The composition for anticancer of the present invention may be administered daily or intermittently, and the number of administrations per day may be divided into one or several administrations. When the two active ingredients are single agents, the number of administrations may be the same or different. In addition, the composition of the present invention may be administered in a pharmaceutically effective amount for the treatment of cancer.

In addition, the present invention

1) measuring the expression level of miR-133a-3p in a sample isolated from a cancer patient; And

2) providing a method for measuring miR-133a-3p expression level to provide diagnostic information for resistance to anti-cancer agents, comprising the step of analyzing the resistance to anti-cancer agents according to cancer progression by increasing or decreasing the expression level of step 1). do.

In the present invention, the sample may be tissue, cell, plasma, serum, blood, saliva or urine, but is not limited thereto.

In the present invention, the expression level can be measured using RT-PCR (Reverse transcription polymerase chain reaction), quantitative RT-PCR, real-time RT-PCR, Northern blotting or transcriptome analysis method. However, it is not limited thereto.

In the present invention, it can be diagnosed that the lower the expression level of miR-133a-3p in the sample, the higher the resistance to anticancer agents, and the higher the expression level of miR-133a-3p, the lower the resistance to anticancer agents.

In the present invention, the anti-cancer agent is, for example, breast cancer, lung cancer, stomach cancer, colon cancer, liver cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, melanoma of the skin or eye, uterine cancer, ovarian cancer, rectal cancer, anal rectal cancer, colon cancer , Fallopian tube carcinoma, endometrial carcinoma, cervical carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, esophageal cancer, small intestine cancer, endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, It can be used for the treatment of chronic or acute leukemia, lymphocyte lymphoma, bladder cancer, kidney or urinary tract cancer, renal cell carcinoma, renal pelvic carcinoma, CNS tumor, primary CNS lymphoma, spinal cord tumor, brainstem glioma or pituitary adenoma, more specifically breast cancer It can be used for treatment, but is not limited thereto.

In the present invention, the anti-cancer agent is, for example, tamoxifen (Tamoxifen), aromatase inhibitor (Aromatase inhibitor; AI), prednisone (Prednisone), raloxifene (Raloxifene), toremifene (Toremifene). Clomiphene, 5-FU, 5-methotrexate, cyclophosphamide, nimustine, gemcitabine, tegafururacil (UFT), doxorubicin (Doxorubin), Epirubicin, Mitomycin, Phleomycin, Paclitaxel, Docetaxel, Cisplatin, Oxaliplatin, Iricancan, Irican For example, it may be Etoposide, Axitinib, or Tarceva, and more specifically, tamoxifen, but is not limited thereto.

The present inventors have shown that miR-133a-3p expression is reduced in anti-cancer drug-resistant breast cancer against tamoxifen, and thus GSTP is up-regulated to induce anti-cancer drug resistance, while miR-133a-3p down-regulates GSTP and enhances anti-cancer drug sensitivity. As confirmed, the miR-133a-3p can be used for diagnosis of resistance to anticancer agents.

Hereinafter, the present invention will be described in detail by examples.

However, the following examples are only to illustrate the present invention, the content of the present invention is not limited to the following examples.

And to identify breast cancer treatment supplements that can improve the anti-cancer drug sensitivity in the treatment of breast cancer,

< Example  1> breast cancer cell culture

Tamoxifen sensitive breast cancer cell lines and tamoxifen resistant breast cancer cell lines were cultured to investigate the mechanism of resistance to anticancer agents such as tamoxifen, a breast cancer treatment.

Specifically, MCF7 cells (ATCC HTB-22 TM) as a human breast cancer cell line were obtained from the American Type Culture Collection (Manassas, VA). With tamoxifen-resistant human breast cancer cell line LCC3 cells were derived from the treatment with the active metabolite 4-hydroxy-tamok during pen (4-Hydroxytamoxifen) 1 μM of tamoxifen for a period of nine months MCF7 cells. The MCF7 cells were DMEM medium containing 10% fetal bovine serum (FBS), 1 mM L-glutamine, 100 unit antibiotic-antibacterial agent, 1% non-essential amino acid and 10 μg / ml bovine insulin (Invitrogen, Grand Island, NY). It was incubated under 5% CO ₂ and 37 ° C. conditions. LCC3 cells were cultured in the same medium and conditions as above, but cultured using a medium without estrogen.

< Example  2> In tamoxifen resistant breast cancer cells GSTP  Increased expression

Glutathione S-transferase P1-1 (GSTP) is known to play an important role in susceptibility to cancer. Thus, in order to investigate the mechanism of resistance to tamoxifen, the expression of GSTP in tamoxifen sensitive breast cancer cell lines and tamoxifen resistant breast cancer cell lines was confirmed by performing quantitative RT-PCR (qRT-PCR) and western blotting.

Specifically, qRT-PCR was performed to confirm GSTP mRNA expression. MCF7 cells and LCC3 cells cultured in <Example 1> were respectively recovered, and total RNA was isolated according to the manufacturer's procedure using TRIzol Reagent Solution (AM 9738, Ambion). Then, qRT-PCR was performed using the isolated total RNA. The total RNA isolated using the TaqMan microRNA assay and the TaqMan Reverse Transcription Kit (PN: 4366596, Applied Biosystems) was reverse transcribed, and TaqMan universal PCR master mix (PN: 4440040; Applied) in an ABI Real-time PCR 7500 system. Biosystems) to perform quantitative PCR according to the manufacturer's procedure. At this time, GAPDH was used as a control. Primers for GSTP and GAPDH were purchased from Ambion. The experiment was repeated 3 times.

In addition, Western blotting was performed to confirm GSTP protein expression. MCF7 cells and LCC3 cells cultured in <Example 1> were respectively recovered, and proteins were separated using a protein kit (MACHEREY-NAGEL). The isolated protein was separated on an 8% SDS-PAGE gel. SDS-PAGE gel western blotting was performed by standard methods. The primary antibody was diluted 1: 1000 with PBST containing 1% skim milk. As the primary antibody, anti-GSTP antibody (Cell Signaling Technology, US) and anti-β-actin antibody (Sigma, US) were used.

As a result, as shown in Figure 1, in the case of LCC3 cells showing tamoxifen resistance, it was confirmed that the mRNA and protein expression of GSTP was significantly increased compared to MCF7 cells not showing tamoxifen resistance (FIG. 1).

Through the above results, it was confirmed that GSTP is involved in tamoxifen sensitivity in breast cancer.

< Example  3> In tamoxifen resistant breast cancer cells GSTP  Regulating miRNA  And its expression decrease confirmation

miRNA recognizes the seed sequence and binds to the 3'UTR of the target gene, then degrades the target mRNA or inhibits translation. In the above, it was confirmed that GSTP is involved in tamoxifen sensitivity in breast cancer. In order to identify miRNAs involved in the expression of GSTP, miRNA binding to 3'UTR of GSTP was derived using MiRanda and targetscan programs, and expression thereof Was confirmed by performing qRT-PCR.

Specifically, miRNAs having a common base sequence with 3'UTR of GSTP were analyzed using the MiRanda program and TargetScan (http://www.targetscan.org) program.

In addition, the expression change of miRNA identified by the MiRanda and targetscan programs in each of MCF7 cells and LCC3 cells was confirmed by performing qRT-PCR in the same manner as described in <Example 2>. Primers for miRNA were purchased from Ambion. In addition, human RUN48 was used as an endogenous control. Primers for human RUN48 were purchased from Ambion.

As a result, as shown in FIG. 2, it was confirmed that miR-133a-3p targets GSTP 3'UTR through the MiRanda program and TargetScan program (FIG. 2).

In addition, as shown in Figure 3, in the case of LCC3 cells showing tamoxifen resistance, it was confirmed that the expression of miR-133a-3p is significantly reduced compared to MCF7 cells not showing tamoxifen resistance (FIG. 3).

Through the above results, it was confirmed that miR-133a-3p expression was decreased in breast cancer, and accordingly, anti-cancer resistance to tamoxifen appeared when GSTP was up-regulated.

< Example  4> Tamoxifen-sensitive breast cancer cells caused by tamoxifen miR -133a-3p increased expression and GSTP  Decrease in expression

To examine the expression patterns of miR-133a-3p and GSTP by tamoxifen, treatment with 4-hydroxytamoxifen, an active metabolite of tamoxifen, was performed on tamoxifen-sensitive breast cancer cell lines and expression of miR-133a-3p and GSTP Was confirmed by performing qRT-PCR.

Specifically, the MCF7 cells cultured in <Example 1> were treated with 5 or 7 μM 4-hydroxytamoxifen for 72 hours and recovered. Then, qRT-PCR was performed in the same manner as described in <Example 2> using the recovered MCF7 cells.

As a result, as shown in FIG. 4, it was confirmed that the expression of miR-133a-3p decreases and the expression of GSTP increases when MCF7 cells are treated with 4-hydroxytamoxifen (FIG. 4).

Through the above results, it was confirmed that tamoxifen induces anti-tumor resistance to tamoxifen by inducing miR-133a-3p expression and thereby inducing upregulation of GSTP.

< Example  5> miR -133a-3p GSTP  Adjustment check

To see if miR-133a-3p directly targets and modulates GSTP, reporter constructs and miR-133a-3p containing GSTP 3'UTR mutations that mutated sites recognized by the miR-133a-3p seed sequence The mimic was transfected into cells, and the degree of GSTP transcription activity was measured by performing a luciferase assay.

Specifically, 10% FBS, 1 mM L-glutamine, 1% non-essential amino acid, 100 unit antibiotic-antibacterial agent, and HeLa cell (ATCC CCL-2 TM), a human cervical cancer cell line purchased from the American Type Culture Collection (ATCC), and The cells were cultured in MEM medium containing 1% sodium pyruvate at 5% CO ₂ at 37 ° C.

In addition, a reporter construct including a GSTP 3'UTR full-length sequence and a GSTP 3'UTR mutation was prepared as a reporter construct for use in luciferase analysis. GSTP 3'UTR full-length sequence (GSTP-WT) was amplified using genomic DNA as a template for HEK293T cells using the following [Table 1] primers, cloned into a pGL3 vector by an in-fusion cloning method, and then pGL3-GSTP-WT construct Acquired. In addition, the GSTP 3'UTR mutant 1 (GSTP-MT1) was cloned into the pGL3 vector in the same manner as above to obtain the pGL3- GSTP-MT1 construct. In addition, the GSTP 3'UTR mutant 2 (GSTP-MT2) was cloned into the pGL3 vector in the same manner as above to obtain a pGL3-GSTP-MT2 construct. These mutations mutated the seed sequence of miR133a-3p.

primer Sequence (5 '→ 3') GSTP-WT, GSTP-MT1 and GSTP-MT2 Forward GCCGTGTAATTCTAGATGGGGCGCCTCAGTGCCC (SEQ ID NO: 5) GSTP-WT Reverse CCGCCCCGACTCTAGAGCTCTCTTAGAAATTTTATTGG (SEQ ID NO: 6) GSTP-MT1 Reverse CCGCCCCGACTCTAGAGCTCTCTTAGAAATTTTATGATTCCTGG (SEQ ID NO: 7) GSTP-MT2 Reverse CCGCCCCGACTCTAGAGCTCTCTTAGAAATTTTATCGATACTGGAG (SEQ ID NO: 8)

Then, the pGL3-GSTP-WT construct, pGL3-GSTP-MT1 construct or pGL3- GSTP-MT2 construct prepared above with a GSTP 3'UTR reporter construct 1.5 mg / well and miR-133a- 3p mimetic (Ambion) 15 nmol / L was transiently transfected into the cultured HeLa cells using Lipofectamine 2000 (Invitrogen). In addition, 40 ng / well of pCMV-hRL vector (Promega) was co-transfected to normalize the activity of the GSTP 3'UTR reporter construct. After transfection, the cells were cultured for 48 hours, cells were lysed with 1x passive lysis buffer (Promega), and the degree of GSTP transcription activity was measured according to the manufacturer's procedure using a double-luciferase assay kit (Promega).

As a result, as shown in FIG. 6, in the case of GSTP 3'UTR WT transfected cell group, miR-133a compared to GSTP 3'UTR MT1 or GSTP 3'UTR MT2 transfected cell group in which the seed sequence recognition site of 3'UTR is mutated. It was confirmed that the GSTP 3'UTR WT transcription activity was significantly reduced by the -3p mimetic (FIG. 6).

Through the above results, it was confirmed that miR-133a-3p directly targets GSTP and binds to GSTP 3'UTR to down regulate the transcription of GSTP.

< Example  6> In tamoxifen resistant breast cancer cells miR -133a-3p GSTP  Decrease in expression

To determine whether GSTP is down-regulated by miR-133a-3p re-expression, the expression of GST is confirmed by qRT-PCR and Western blotting after transfection of the miR-133a-3p mimetic to the tamoxifen-resistant breast cancer cell line. Did.

Specifically, the LCC3 cells cultured in <Example 1> were temporarily transfected with 15 nmol / L of miRNA or miR-133a-3p mimics using Lipofectamine 2000 (Invitrogen), and cultured for 48 hours. It was then recovered. Then, qRT-PCR and Western blotting were performed in the same manner as described in <Example 2>.

As a result, as shown in FIG. 7, it was confirmed that GSTP mRNA and protein expression were significantly reduced in the LCC3 cell group transfected with miR-133a-3p mimetic (FIG. 7).

Through the above results, it was confirmed that the expression of miR-133a-3p was increased to induce GSTP down-regulated state.

< Example  7> In tamoxifen resistant breast cancer cells miR Sensitivity recovery confirmation by -133a-3p

To determine if the anti-cancer agent sensitivity can be increased by down-regulating GSTP through miR-133a-3p re-expression, cell viability after transfection of miR-133a-3p mimics in tamoxifen-resistant breast cancer cell lines and treatment with 4-hydroxytamoxifen Was measured.

Specifically, in the same manner as described in <Example 5>, the negative control miRNA or miR-133a-3p mimic was transfected into LCC3 cells, and cultured by treating 5 μM of 4-hydroxytamoxifen for 3 days. . In addition, MTT analysis was performed every 24 hours to measure cell viability. On the other hand, 4-hydroxytamoxifen was treated in the same manner as above using MCF7 cells as a positive control and MTT analysis was performed.

As a result, as shown in FIG. 8, unlike the LCC3 cell group transfected with the negative control group, the LCC3 cell group transfected with the miR-133a-3p mimetic body induced cell death due to 4-hydroxytamoxifen treatment, resulting in cell survival rate. It was confirmed to decrease (Fig. 8).

Through the above results, it was confirmed that miR-133a-3p or its mimetics down-regulate GSTP to enhance tamoxifen sensitivity, thereby improving the therapeutic effect by anticancer agents.

Through the results of <Example 1> to <Example 7>, miR-133a-3p expression is reduced in anti-cancer drug-resistant breast cancer, and thus GSTP is up-regulated to induce anti-cancer drug resistance, whereas miR-133a-3p is re-expressed. It was confirmed that anti-cancer agent sensitivity can be enhanced by down-regulating GSTP. Therefore, miR-133a-3p can be used as a target factor in diagnosing anti-cancer drug-resistant cancer and promoting anti-cancer drug sensitivity.

<110> INDUSTRY ACADEMIC COOPERATION FOUNDATION SOOKMYUNG WOMEN'S UNIVERSITY <120> Composition for enhancing sensitivity to anti-cancer agent          comprising of miR-133a-3p as an active ingredient <130> PB2018-079 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> RNA <213> Homo sapiens <400> 1 uuuggucccc uucaaccagc ug 22 <210> 2 <211> 88 <212> RNA <213> Homo sapiens <400> 2 acaaugcuuu gcuagagcug guaaaaugga accaaaucgc cucuucaaug gauuuggucc 60 ccuucaacca gcuguagcua ugcauuga 88 <210> 3 <211> 102 <212> RNA <213> Homo sapiens <400> 3 gggagccaaa ugcuuugcua gagcugguaa aauggaacca aaucgacugu ccaauggauu 60 ugguccccuu caaccagcug uagcugugca uugauggcgc cg 102 <210> 4 <211> 6 <212> RNA <213> Homo sapiens <400> 4 uggucc 6 <210> 5 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> GSTP forward primer <400> 5 gccgtgtaat tctagatggg gcgcctcagt gccc 34 <210> 6 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> GSTP-WT reverse primer <400> 6 ccgccccgac tctagagctc tcttagaaat tttattgg 38 <210> 7 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> GSTP-MT1 reverse primer <400> 7 ccgccccgac tctagagctc tcttagaaat tttatgattc ctgg 44 <210> 8 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> GSTP-MT2 reverse primer <400> 8 ccgccccgac tctagagctc tcttagaaat tttatcgata ctggag 46

Claims (18)

MiR-133a-3p or miRNA mimic mimic (mimic) containing as an active ingredient, anti-cancer agent sensitivity enhancement composition,
The anti-cancer agent is Tamoxifen, the composition.
According to claim 1, wherein the miR-133a-3p is characterized in that consisting of a nucleotide sequence represented by SEQ ID NO: 1, anti-cancer agent sensitivity enhancing composition.
According to claim 1, wherein the miR-133a-3p is characterized in that provided in the form contained in the vector or introduced into the cell, anti-cancer agent sensitivity enhancing composition.
delete According to claim 1, The anti-cancer agent is characterized in that it is used for the treatment of breast cancer, anti-cancer agent sensitivity enhancing composition.
delete delete According to claim 1, wherein the miR-133a-3p is characterized in that to reduce the expression of GSTP (Glutathione S-transferase P1-1), anti-cancer agent sensitivity enhancement composition.
According to claim 1, The composition is characterized in that it can be administered simultaneously (simultaneous), separately (separate) or sequentially (sequential) with the anti-cancer agent, anti-cancer agent sensitivity enhancing composition.
Tamoxifen-resistant breast cancer treatment adjuvant as an anti-cancer agent containing miR-133a-3p or miRNA mimetics thereof as an active ingredient.
a) miR-133a-3p or miRNA mimic thereof; And
b) A composition for the treatment of Tamoxifen resistant breast cancer, which contains Tamoxifen as an active agent.
delete delete 1) measuring the expression level of miR-133a-3p in a sample isolated from a breast cancer patient; And
2) A method of measuring miR-133a-3p expression level to provide diagnostic information about resistance to anticancer agents, comprising the step of analyzing resistance to anticancer agents according to breast cancer progression through increasing or decreasing the expression level of step 1).
The anticancer agent is Tamoxifen.
15. The method of claim 14, The sample is tissue, cells, plasma, serum, blood, saliva and urine, characterized in that at least one selected from the group consisting of, miR-133a- for providing diagnostic information about resistance to anticancer drugs 3p expression level measurement method.
15. The method of claim 14, wherein the expression level is selected from the group consisting of RT-PCR (Reverse transcription polymerase chain reaction), quantitative RT-PCR, real-time RT-PCR, Northern blotting and transcriptome analysis Characterized in that measured by any one or more methods, miR-133a-3p expression level measurement method for providing diagnostic information for resistance to anticancer agents.
delete delete

Images