KR102099051B1 - Composition for detection of strain producing aflatoxin and detection method using the same - Google Patents

Abstract

The present invention relates to a composition capable of detecting an aflatoxin-producing strain or a method for detecting an aflatoxin-producing strain using the same. The composition for detecting an aflatoxin-producing strain of the present invention can selectively amplify a portion having a difference between a strain producing aflatoxin and a strain not producing aflatoxin, which is present in an aflatoxin biosynthetic gene cluster, confirmed by a number of repeated experiments or trial and error, and thus can ultimately confirm whether there is a strain that produces aflatoxin in food, etc., with high sensitivity.

Description

Composition for detection of aflatoxin and detection method using same {Composition for detection of strain producing aflatoxin and detection method using the same}

The present invention relates to a composition capable of detecting aflatoxin-producing strain or a method for detecting aflatoxin-producing strain using the same.

Yeast is a fermentation agent used to make alcohol in a traditional way. It is mainly made by fermenting grains to proliferate yeast fungi ( Aspergillus oryzae, A. oryzae ).

A. oryzae is a fungus that shows high glycosylation ability to secrete and produce α-amylase, and is one of the most important fungi for the saccharification and liquefaction function of yeast as a representative dominant bacterium in yeast. However, A. oryzae is an aflatoxin-producing bacterium, Aspergillus flavus , and it is essential to verify the presence or absence of aflatoxin production as a bacterium with a close relationship that cannot be distinguished by traditional taxonomic criteria.

Aflatoxin is a secondary metabolite of the Aspergillus fungus type that causes physiological disorders in humans, livestock, and fish, and in particular, in the aflatoxin isomer, aflatoxin B1 is a strong carcinogen. The first discovery of aflatoxin was first known in 1960 as the cause of the death of turkeys in the UK, and it can be contaminated with a variety of agricultural products, and must be confirmed through prompt and accurate inspection methods.

To date, the aflatoxin test method has been developed and applied through culture, LC / MS, and immunological analysis. In the case of cultivation, specificity is high, but it takes a lot of time to confirm the results through cultivation, and there are disadvantages in that accurate identification of species and the presence or absence of aflatoxin must be performed through additional analysis. In the case of the analysis using LC / MS, it is difficult to detect a very small amount of toxin, and the immunological assay has advantages such as a fast test time and a low test cost, but shows a relatively low sensitivity when compared to a molecular diagnostic test.

 Recently, a method was developed to analyze the presence or absence of major genes involved in aflatoxin production in aflatoxin-producing fungi by PCR or real-time PCR, and these are molds in asparagus that have the potential to produce aflatoxin, such as food. As a method for testing in an environment that should not be done, it is highly likely that malt fungi, which do not produce aflatoxin, but which have almost all genes involved in aflatoxin production, are misdetected.

Republic of Korea Patent No. 10-1798478 relates to a rapid detection method and detection kit for aflatoxin-producing Aspergillus flabus strains, and provides primers and probe sets produced using ribosomal RNA derived from Aspergillus flabus.

However, studies or descriptions of primer sets that can be used for various strains related to aflatoxin have not been disclosed.

Accordingly, the present inventors, as a result of diligent efforts to provide a composition having a high sensitivity while being able to detect aflatoxin-producing strains, confirm that some differences exist in the aflatoxin biosynthetic gene between aflatoxin-producing strains and strains that do not produce aflatoxins And completed the present invention.

Accordingly, the present invention provides a composition capable of detecting aflatoxin-producing strain or a method for detecting aflatoxin-producing strain using the same.

The present invention provides a composition for detecting an aflatoxin-producing strain comprising a third primer set consisting of a primer pair comprising a nucleotide sequence of SEQ ID NO: 5 and a nucleotide sequence of SEQ ID NO: 6.

According to a preferred embodiment of the present invention, the primer set is used for PCR (polymerase chain reaction).

According to a preferred embodiment of the present invention, the aflatoxin-producing strain is a strain present in food.

According to a preferred embodiment of the present invention, the aflatoxin-producing strain is Aspergillus flavus , Aspergillus oryzae , Aspergillus parasiticus , Aspargillus bovine To ( Aspergillus sojae ) and aspergillus fumigatus ( Aspergillus fumigatus ).

According to a preferred embodiment of the present invention, the composition for detection,

A first primer set consisting of a primer pair comprising the nucleotide sequence of SEQ ID NO: 1 and a nucleotide sequence of SEQ ID NO: 2;

A second primer set consisting of a primer pair comprising the nucleotide sequence of SEQ ID NO: 3 and a nucleotide sequence of SEQ ID NO: 4; And

A fourth primer set consisting of a primer pair comprising the base sequence of SEQ ID NO: 7 and the base sequence of SEQ ID NO: 8;

It is to further include any one or more primer sets selected from the group consisting of.

The present invention also, a) separating the strain from the food;

b) extracting the gene of the strain isolated in step a);

c) amplifying the gene extracted in step b) using a third primer set consisting of a primer pair comprising the base sequence of SEQ ID NO: 5 and the base sequence of SEQ ID NO: 6; And

d) checking the size of the product amplified in step c);

It provides a method for detecting aflatoxin-producing strain comprising a.

According to a preferred embodiment of the present invention, the food in step a) is yeast.

According to a preferred embodiment of the present invention, the amplification of step c) is performed by polymerase chain reaction (PCR).

According to a preferred embodiment of the present invention, the strain is generated aflatoxin aspartate across spline booth (Aspergillus flavus), aspartate across the duck's (Aspergillus oryzae ), Aspergillus parasiticus , Aspergillus sojae ) and aspergillus fumigatus ( Aspergillus fumigatus ).

According to a preferred embodiment of the present invention, the detection method is as step e),

Determining the aflatoxin-producing strain when the size of the amplified product of step d) is 1.6 to 2.2 kb;

It is to include additionally.

According to a preferred embodiment of the present invention, in step c), the gene

A first primer set consisting of a primer pair comprising the nucleotide sequence of SEQ ID NO: 1 and a nucleotide sequence of SEQ ID NO: 2;

A second primer set consisting of a primer pair comprising the nucleotide sequence of SEQ ID NO: 3 and a nucleotide sequence of SEQ ID NO: 4; And

A fourth primer set consisting of a primer pair comprising the base sequence of SEQ ID NO: 7 and the base sequence of SEQ ID NO: 8;

It is amplified by additionally using any one or more primer sets selected from the group consisting of.

According to a preferred embodiment of the invention, step e) is,

The size of the amplified product in step d) is

0.3 kb when amplified with the first primer set;

Amplified with the second primer set 1.7 kb;

Amplified with a third primer set 2.2 kb; And

0.3 kb when amplified with the fourth primer set;

In the case of determining the strain to produce aflatoxin;

It is to include additional.

The composition for detecting an aflatoxin-producing strain of the present invention selectively amplifies a portion having a difference between a strain generating aflatoxin and a strain not generating aflatoxin, which is present in the aflatoxin biosynthetic gene cluster, confirmed by a number of repeated experiments or trial and error. As a result, it is possible to confirm whether a strain that produces aflatoxin in food or the like exists as a high sensitivity.

1 shows an aflatoxin gene cluster and a gene cluster region targeted by primers of the present invention.
Figure 2 shows the results of electrophoresis for the PCR products of the strains identified by the primer sets of the present invention.
3 shows an HPLC chromatogram analyzing the aflatoxin production of the strains. AF B1, AF B2, AF G1 and AF G2 are aflatoxin B1, aflatoxin B2, aflatoxin G1 and aflatoxin G2, respectively.

Hereinafter, the present invention will be described in more detail.

The 'primer' of the present invention is a nucleic acid sequence having a short free 3 'hydroxyl group, capable of forming complementary templates and base pairs, and acting as a starting point for template strand copying. Nucleic acid sequence. In other words, the primer is a single strand capable of initiating template-directed DNA synthesis under appropriate conditions (e.g., four different nucleoside triphosphates and DNA, a polymerizing agent such as DNA polymerase enzyme) in a suitable buffer. Oligonucleotide.

The 'first primer set' of the present invention refers to a primer set consisting of a primer pair comprising the nucleotide sequence of SEQ ID NO: 1 and the nucleotide sequence of SEQ ID NO: 2, and the 'second primer set' refers to the nucleotide sequence of SEQ ID NO: 3 and Refers to a primer set consisting of a primer pair comprising the nucleotide sequence of SEQ ID NO: 4, and a 'third primer set' refers to a primer set consisting of a primer pair comprising the nucleotide sequence of SEQ ID NO: 5 and a nucleotide sequence of SEQ ID NO: 6 And, the 'fourth primer set' means a primer set consisting of a primer pair comprising the base sequence of SEQ ID NO: 7 and the base sequence of SEQ ID NO: 8.

As described above, the methods conventionally used to detect aflatoxin-producing strains incorrectly detect aspergillus oryzae , A. oryzae , which do not produce aflatoxin due to high cost or low sensitivity. There was a problem that it is likely to do.

The inventors of Aspergillus ( Aspergillus) to produce aflatoxin flavus ; A. flavus ) There is a gene cluster involved in aflatoxin biosynthesis in a size of about 70 kbp, A. oryzae that cannot produce aflatoxin As a result of comparative analysis of the region in the genome of, it was confirmed that the genes in this gene cluster were not only massively lost, but also the gene cluster was completely present, but some sequences were deleted. Accordingly, by developing PCR primer pairs that can identify differences between aflatoxin-producing strains and non-producing strains in aflatoxin biosynthetic gene clusters, a method to confirm the presence or absence of aflatoxin-producing strains with high sensitivity was developed.

Accordingly, the present invention can provide a composition for detecting aflatoxin-producing strains comprising a third primer set consisting of a primer pair comprising a base sequence of SEQ ID NO: 5 and a base sequence of SEQ ID NO: 6.

According to a preferred embodiment of the present invention, the primer set may be used for polymerase chain reaction (PCR). The PCR is a quantitative PCR (quantitative PCR, qPCR), real-time PCR (real-time PCR), reverse transcription PCR (Reverse Transcription PCR, RT-PCR), solid phase PCR (Solid Phase PCR), competitive PCR (Competitive PCR) , Overlap PCR (Overlap-extension PCR), Multiplex PCR, Nested PCR, Inverse PCR, Ligation-mediated PCR, ISSR (Intersequence-specific) PCR), methylation-specific PCR (MSP), colony PCR, miniprimer PCR, nano PCR (Nanoparticle-Assisted PCR, nanoPCR), TAIL-PCR (Thermal asymmetric interlaced PCR) ), Touchdown (Step-down) PCR, Hot start PCR, In silico PCR, Allele-specific PCR, Assembly PCR ), Asymmetric PCR, dial-out PCR, digital PCR (dPCR) and helicase-dependent amplification technology ) May be any one or more selected from the group consisting of.

According to a preferred embodiment of the present invention, the aflatoxin-producing strain may be a strain present in food.

The aflatoxin-producing strain is Aspergillus flavus ), aspergillus oryzae , aspergillus parasicus parasiticus ), Aspergillus sojae and Aspergillus fumigatus fumigatus ) may be any one or more selected from the group consisting of, but preferably Aspergillus ( Aspergillus) flavus ) or aspergillus orize oryzae ), and more preferably Aspergillus flavus .

According to a preferred embodiment of the present invention, the composition for detection,

A first primer set consisting of a primer pair comprising the nucleotide sequence of SEQ ID NO: 1 and a nucleotide sequence of SEQ ID NO: 2;

A second primer set consisting of a primer pair comprising the nucleotide sequence of SEQ ID NO: 3 and a nucleotide sequence of SEQ ID NO: 4; And

A fourth primer set consisting of a primer pair comprising the base sequence of SEQ ID NO: 7 and the base sequence of SEQ ID NO: 8;

It may be to further include any one or more primer sets selected from the group consisting of.

The composition for detecting the aflatoxin-producing strain of the present invention is necessary for strain detection, and may further include components that are self-evident at the level of a person skilled in the art.

The present invention also, a) separating the strain from the food;

b) extracting the gene of the strain isolated in step a);

c) amplifying the gene extracted in step b) using a third primer set consisting of a primer pair comprising the base sequence of SEQ ID NO: 5 and the base sequence of SEQ ID NO: 6; And

d) checking the size of the product amplified in step c);

It may provide a method for detecting aflatoxin-producing strain comprising a.

According to a preferred embodiment of the present invention, the food of step a) may be yeast.

According to a preferred embodiment of the present invention, the gene in step b) may be DNA.

According to a preferred embodiment of the present invention, the amplification of step c) may be performed by polymerase chain reaction (PCR). The PCR is a quantitative PCR (quantitative PCR, qPCR), real-time PCR (real-time PCR), reverse transcription PCR (Reverse Transcription PCR, RT-PCR), solid phase PCR (Solid Phase PCR), competitive PCR (Competitive PCR) , Overlap PCR (Overlap-extension PCR), Multiplex PCR, Nested PCR, Inverse PCR, Ligation-mediated PCR, ISSR (Intersequence-specific) PCR), methylation-specific PCR (MSP), colony PCR, miniprimer PCR, nano PCR (Nanoparticle-Assisted PCR, nanoPCR), TAIL-PCR (Thermal asymmetric interlaced PCR) ), Touchdown (Step-down) PCR, Hot start PCR, In silico PCR, Allele-specific PCR, Assembly PCR ), Asymmetric PCR, dial-out PCR, digital PCR (dPCR) and helicase-dependent amplification technology ) May be any one or more selected from the group consisting of.

According to a preferred embodiment of the present invention, the strain is generated aflatoxin aspartate across spline booth (Aspergillus flavus), aspartate across the duck's (Aspergillus oryzae ), Aspergillus parasiticus , Aspergillus sojae ) and aspergillus fumigatus ( Aspergillus fumigatus ) may be any one or more selected from the group consisting of, but preferably Aspergillus flabus ( Aspergillus) flavus ) or aspergillus orize oryzae ), and more preferably Aspergillus flavus .

According to a preferred embodiment of the present invention, the detection method is as step e),

Determining the aflatoxin-producing strain when the size of the amplified product of step d) is 1.6 to 2.2 kb; It may be to include additionally.

According to a preferred embodiment of the present invention, in step c), the gene

A first primer set consisting of a primer pair comprising the nucleotide sequence of SEQ ID NO: 1 and a nucleotide sequence of SEQ ID NO: 2;

A second primer set consisting of a primer pair comprising the nucleotide sequence of SEQ ID NO: 3 and a nucleotide sequence of SEQ ID NO: 4; And

A fourth primer set consisting of a primer pair comprising the base sequence of SEQ ID NO: 7 and the base sequence of SEQ ID NO: 8;

It may be to amplify by additionally using any one or more primer sets selected from the group consisting of.

The 'additional amplification by use' means all ranges for amplifying the gene using the first primer set to the fourth primer set, but preferably, the genes are first used by using the first primer set to the fourth primer set, respectively. It is preferable that the amplification means a total of four amplification products.

According to a preferred embodiment of the invention, step e) is,

The size of the amplified product in step d) is

0.3 kb when amplified with the first primer set;

Amplified with the second primer set 1.7 kb;

Amplified with a third primer set 2.2 kb; And

0.3 kb when amplified with the fourth primer set;

In the case of determining the strain to produce aflatoxin;

It may be to include additionally.

When the first primer set, the second primer set, or the fourth primer set is additionally included, a strain that does not produce aflatoxin, in particular, Aspergillus oryzae , can be distinguished in more detail. When amplifying with the second primer set, it may be AO1 when the amplification product is 1.7 kb, AO2 when it is 1.4 kb, or AO3 when it is not amplified.

The aflatoxin-producing strain may correspond without limitation as long as it is an aflatoxin-producing strain among the strains of Aspergillus , but is preferably aspergillus flavus .

The strain that does not produce aflatoxin may be without limitation if it is a strain that does not produce aflatoxin among the strains of the genus Aspergillus , but is preferably aspergillus oryzae .

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it is obvious to those skilled in the art that the scope of the present invention is not interpreted to be limited by these examples.

Asparagus  Strain fungal strain, DNA extraction and sequencing

<1-1> Asparagus strain separation

89 yeast samples were ground into fine powder and stored at 4 ° C. until used to isolate the strain. The crushed yeast samples were suspended in 45 ml of sterilized distilled water, 5 g each, and serially diluted 10 times (10 ^-2 to 10 ^-5 ). Each diluent was plated on Dichloran Rose Bengal agar (BD Biosciences) or Dichloran Glycerol agar (Merck) medium each containing 100 μg / ml of chloramphenicol (Sigma-Aldrich), which was performed three times each. After incubation at 25 ° C. for 5 to 7 days, the colony-forming units (CFU / g of the sample) were calculated by calculating the strain colonies of the medium, and then a single in potato dextrose agar (PDA; BD Biosciences) for each strain. Spores were isolated. All isolates were stored at -70 ° C in 20% glycerol. Each isolate was characterized by colony size, color, and mycelial growth rate in solid medium, with the shape and size of spores using an optical microscope (Primo Star FOV18, Carl Zeiss). Micrographs were taken with Zeiss Axiocam 105 (Carl Zeiss). Aspergillus flavus and aspergillus orize The shape of oryzae ) is similar, so the species was determined by molecular biological methods and aflatoxin production.

As a result, 107 A. oryzae and 7 A. flavus strains including A. oryzae KSS2, KBP3, KYI32, KJJ4b, KDG21, and KSW16 were obtained. A. oryzae NRRL1989 and A. flavus ATCC22546 were obtained from the Korea Microbiological Center (KCCM; Seoul, Korea).

<1-2> DNA extraction of Asparagus strain

The DNA of the asparagus strains obtained in Example <1-1> was extracted with a cetyltrimethyl-ammomium-bromide (CTAB) method. Two genomes, A. oryzae KSS2 and KBP3, were sequenced at the National Environmental Management Center (NICEM; Seoul National University, Korea) and TheragenEtex Ltd. (Suwon, Korea), respectively. The genomes of six A. oryzae strains KYI32, KJJ4b, KDG21 KSW16, NRRL1989 and ATCC22546 were sequenced using TheragenEtex Ltd.'s Illumina HiSeq 2500 platform.

Genome assembly, chromosome composition and annotation

2 species of A. oryzae The PacBio long-read values of strains KSS2 and KBP3 were assembled by HGAP 3 (Hierarchical Genome Assembly Process) and Celera Assembler's PBcR pipeline. Contigs obtained from the assembler were referenced using the BlastN genome A. oryzae It was mapped to the chromosome of RIB40. Consed program was used for chromosome numbering and linkage. The final consensus sequence of the chromosome was polished by Quiver in SMRT portal 2.3 of Pacific Biosciences. The genomic sequence of A. oryzae BCC7051 was obtained from the National Institute of Biotechnology and Information (NCBI). A chromosome was constructed by obtaining the contig of BCC7051 in the same manner as above, and mapping the assembled contig to A. oryzae to the reference genome of KBP3.

The lumina-based contigs of the other six asparagus strains were assembled by the SPAdes assembler. For these six genomes sequenced with short length reads, chromosomal drafts of each genome were constructed by mapping the assembled contigs to the reference genomes, KSS2 and KBP3. The overlapping contigs were merged from the consed, and the fallen contigs were connected by an additional 30 × N. All draft chromosomes were divided into left (-L) and right (-R) arms based on the location of the centromere, because the contigs assembled from the short leads were incorrectly mapped to the AT-rich isomer region. The 20 fungal genomic sequences of A. oryzae (7 species), A. flavus (9 species), A. sojae (1 species), and A. parasiticus (3 species) were obtained from NCBI. 20 genome contigs were obtained in the same manner as above. Draft chromosomal structures of A. sojae and A. parasiticus were created by mapping the longest assembly scaffold, genome A. sojae NBRC4239, among the strains in both species.

Synteny analysis between two reference genomes and other asparagus genomes was performed by MUMmer software. The funannotate pipeline was used to annotate the 8 newly sequenced genomes and annotate the 22 previously sequenced genomes.

Comparison of aflatoxin biosynthetic gene clusters

The aflatoxin biosynthetic gene cluster of each strain was obtained by BlastN using the annotation information of the aflatoxin gene cluster in A. flavus NRRL3357 for reference. When the aflatoxin gene cluster was divided into multiple contigs, the clusters were joined to one cluster by adding N based on criteria, yielding one cluster for each strain. The aflatoxin gene clusters of all strains were multi-aligned by the Dialign program, and MACSE was used to obtain information about frame-shift.

As a result, it was confirmed that aflatoxin-producing strains and non-producing strains can be distinguished by aflYe , aflC to aflT , aflU to aflF, or AFLA_13945 regions among aflatoxin gene clusters. AFLA_13945 is a conserved hypothetical protein.

primer  Making a set and utilizing it PCR  analysis

Based on the results of <Example 3>, four primer sets were designed as shown in Table 1 below. YE1-YE2 and END1-END2 two primers is amplified and respectively the aflYe AFLA_13945 gene and genes located at each end of the aflatoxin gene cluster, the two primers CT1 and CT2-using-UF1 UF2 aflT It can be amplified in two regions of the 3'-end of the gene and a region between the aflU - aflF ( cypA - norB ) genes. 20 μl of the Maxime PCR premix kit (iNtRON Biotechnology, South Korea) containing the 20-50 ng genomic DNA template and 20 pmol of each primer of the 114 asparagus strains obtained from the <Example 1> of the primer set. PCR reaction was performed using. The TP350 Thermal Cycler Dice Touch (TAKARA BIO INC., Australia) conditions used were 4 min at 94 ° C, 1 min at 94 ° C, 1 min at 60 ° C, 1 min at 72 ° C, then 72 ° C for 10 min. The final extension. The amplified PCR product was confirmed by electrophoresis on a 1.0% agarose gel.

Target area Primer name Primer sequence (5 '→ 3') Tm (℃) GC% Sequence number aflYe
( orf )  YE_F  CATGTGCATCACGGCATGAG 60 55 One  YE_R  ATAACCAGCGGTTCTGCCAA 60 50 2 aflC-aflT
( pksA-aflT )  CT_F  TGTGTCGGGGACCTCTATGT 60 55 3  CT_R  CCCTCCCTGTGTGATGTGTC 60 60 4 aflU-aflF
( cypA - norB )  UF_F  CAACTGCTCGACTGTCGTCT 60 55 5  UF_R  GAATTGGCTTCGCTCCCTCT 60 55 6 AFLA_13945  End_F  AGGCTCTGGGATCAAAGCTC 60 55 7  End_R  TAGCGCTGGCATTGAAACAG 60 50 8

As a result, it was possible to confirm the PCT products as shown in [Table 2] and [Table 3], and the results of electrophoresis are shown in [Figure 2].

Strain type Target region PCR product expected size (bp) Aflatoxin-producing strains Aflatoxin
Non-producing strains aflYe aflC-aflT aflU-aflF End AF 300 1700 2200 300 7 One AO1 300 1700 1600 300 0 9 AO2 300 1400 1600 300 0 33 AO3 300 ND ND ND 0 64 system 7 107

Target area Target area PCR product size (bp) Aflatoxin
Production strain (AF) Aflatoxin
Non-producing strain (AO1) Aflatoxin
Non-producing strain (AO2) Aflatoxin
Non-producing strain (AO3) aflYe
( orf ) 318 318 318 318 aflC - aflT
( pksA - aflT ) 1727 1727 1406 ND aflU - aflF
( cypA - norB ) 2172 1605 1605 ND AFLA_13945 322 322 322 ND

HPLC  Analysis of Aflatoxin Production

The yeast sample of <Example 1> to 1 milliliter spore suspension (10 ⁶ spore / ml) of each of the strains obtained here was inoculated 3 times in Vietnam Indica rice medium. Cultures were grown for 14 days at 25 ° C. in the dark. Aflatoxin was extracted from the sample by 70% methanol (Merck, Darmstadt, Germany) in 25 g of homogenized ground sample. The extract was loaded on an immunoaffinity column (AflaTest VICAM, A Waters Business, USA) and aflatoxin in the extract was eluted according to the VICAM method. The aflatoxin of the eluent was analyzed via HPLC on a ZORBAX Eclipse Plus C18 column (4.6 × 150 mm, 3.5 μm) at 70 ° C. in a 1200 Infinity series (Agilent Technologies, USA). The column was hung using a constant solvent transfer mixture containing 20:20:60 (v / v / v) acetonitrile, methanol and water at a flow rate of 1.0 ml / min. To measure the aflatoxin concentration, the aflatoxin mixture standard (Aflatoxin Mix Kit; Supelco, Bellefonte, PA, USA) was used as a reference for peak area. Aflatoxin was detected by a fluorescence detector at an excitation wavelength of 360 nm and an emission wavelength of 440 nm as shown in Tables 4, 5 and 3 below.

PCR HPLC ID Bell Lstart1 Lmid1 norB-
CypA Lend1 type Aflatoxin (ppb) One S
t
a
n
d
a
r
d
NRRL3357 A.flavus + ++ ++ + 310 2 ATCC22546 A.flavus + ++ ++ + 297 3 SU-1 A. parasiticus + ++ - + 199 4 ATCC22789 A. parasiticus + ++ +++ + 275 5 RIB 40 A. oryzae + + + + 0.55 6 RIB 128 A. oryzae + + + + ND 7 NBRC4239 A. sojae + ++ +++ + 1.11 8 NRRL1989 A. sojae + ++ +++ - ND 9 ATCC 96918 A. fumigatus - -  - - NT One I
s
o
l
a
t
e
s
YI1-5 A. flavus + ++ ++ + AF 280 2 YI2-2 A. flavus + ++ ++ + AF 274 3 SW1-3 A. flavus + ++ ++ + AF 70.7 4 SW1-7 A. flavus + ++ ++ + AF 22.8 5 SW2-8 A. flavus + ++ ++ + AF 207 6 SW1-6 A. oryzae + ++ + + AO1 195 7 SW2-2 A. flavus + ++ ++ + AF 201 8 DG2-14 A. flavus + ++ ++ + AF 123 9 YI3-2 A. oryzae + ++ ++ + AF ND 10 JJ4R B A. oryzae + ++ + + AO1 ND 11 JJ4 b A. oryzae + ++ + + AO1 ND 12 JJ4 7 A. oryzae + ++ + + AO1 ND 13 JJ4 10 A. oryzae + ++ + + AO1 ND 14 CN4-3 A. oryzae + ++ + + AO1 ND 15 YI2-1 A. oryzae + ++ + + AO1 ND 16 SW1-8 A. oryzae + ++ + + AO1 ND 17 SW1-11Y A. oryzae + ++ + + AO1 ND 18 DG2-11 A. oryzae + + + + AO2 ND 19 JJSP b1 A. oryzae + + + + AO2 ND 20 JJ1s-BD A. oryzae + + + + AO2 ND 21 JJDM C A. oryzae + + + + AO2 ND 22 JJDM F A. oryzae + + + + AO2 ND 23 JJIM B A. oryzae + + + + AO2 ND 24 JJSP E1 A. oryzae + + + + AO2 ND 25 BSSS F2 A. oryzae + + + + AO2 ND 26 HS1-1 A. oryzae + + + + AO2 ND 27 HS1-9 A. oryzae + + + + AO2 ND 28 CN5-2 A. oryzae + + + + AO2 ND 29 CN5-3 A. oryzae + + + + AO2 ND 30 CN5-15 A. oryzae + + + + AO2 ND 31 CN13-7 A. oryzae + + + + AO2 ND 32 JS2-7 A. oryzae + + + + AO2 ND 33 HS1-7 A. oryzae + + + + AO2 ND 34 JC1-6 A. oryzae + + + + AO2 ND 35 YI1-3 A. oryzae + + + + AO2 ND 36 YI3-1 A. oryzae + + + + AO2 ND 37 CN5-5 A. oryzae + + + + AO2 ND 38 SW1-1 A. oryzae + + + + AO2 ND 39 SW1-11G A. oryzae + + + + AO2 ND 40 SW1-12 A. oryzae + + + + AO2 ND 41 SW2-1 A. oryzae + + + + AO2 ND 42 SW7-5 A. oryzae + + + + AO2 ND 43 SW7-6 A. oryzae + + + + AO2 ND 44 SW8-10 A. oryzae + + + + AO2 ND 45 SW9-4 A. oryzae + + + + AO2 ND 46 JS2-8 A. oryzae + + + + AO2 ND 47 JJIM A A. oryzae + + + + AO2 ND 48 SW6-6 A. oryzae + + + + AO2 ND 49 SW7-7 A. oryzae + + + + AO2 ND 50 SW10-2 A. oryzae + + + + AO2 ND 51 JJ4 9 A. oryzae + - - - AO3 ND 52 JJ4 11 A. oryzae + - - - AO3 ND 53 SHSC H3 A. oryzae + - - - AO3 ND 54 JJDM B A. oryzae + - - - AO3 ND 55 JJIM C1,2 A. oryzae + - - - AO3 ND 56 JJIM b1,2 A. oryzae + - - - AO3 ND 57 JJ4 C A. oryzae + - - - AO3 ND 58 JJ4 F A. oryzae + - - - AO3 ND 59 JJ4 G A. oryzae + - - - AO3 ND 60 JJ4R E A. oryzae + - - - AO3 ND 61 JJ4R b A. oryzae + - - - AO3 ND 62 YH B A. oryzae + - - - AO3 ND 63 JJBP E3 A. oryzae + - - - AO3 ND 64 JJBP G3-1 A. oryzae + - - - AO3 ND 65 JJ2-2 A. oryzae + - - - AO3 ND 66 JJ2-3 A. oryzae + - - - AO3 ND 67 JJ2-12 A. oryzae + - - - AO3 ND 68 JJ2-13 A. oryzae + - - - AO3 ND 69 JJ2-15 A. oryzae + - - - AO3 ND 70 JJ3-8 A. oryzae + - - - AO3 ND 71 JJ4 1 A. oryzae + - - - AO3 ND 72 JJ4 2 A. oryzae + - - - AO3 ND 73 JJ4 6 A. oryzae + - - - AO3 ND 74 PH1-12 A. oryzae + - - - AO3 ND 75 JJ2-13 A. oryzae + - - - AO3 ND 76 JJ13-1 A. oryzae + - - - AO3 ND 77 JJ14-1 A. oryzae + - - - AO3 ND 78 CN2-1 A. oryzae + - - - AO3 ND 79 CN6-4 A. oryzae + - - - AO3 ND 80 CN16-8 A. oryzae + - - - AO3 ND 81 HS1-6 A. oryzae + - - - AO3 ND 82 YI1-2 A. oryzae + - - - AO3 ND 83 YI1-8 A. oryzae + - - - AO3 ND 84 YI2-8 A. oryzae + - - - AO3 ND 85 YI3-5 A. oryzae + - - - AO3 ND 86 JJ14-4 A. oryzae + - - - AO3 ND 87 JJ14-7 A. oryzae + - - - AO3 ND 88 YI2-3 A. oryzae + - - - AO3 ND 89 YI3-7 A. oryzae + - - - AO3 ND 90 CN5-1 A. oryzae + - - - AO3 ND 91 CN14-3 A. oryzae + - - - AO3 ND 92 JJ12-5 A. oryzae + - - - AO3 ND 93 YI3-4 A. oryzae + - - - AO3 ND 94 SW2-5 A. oryzae + - - - AO3 ND 95 SW3-3 A. oryzae + - - - AO3 ND 96 SW6-2 A. oryzae + - - - AO3 ND 97 SW6-3 A. oryzae + - - - AO3 ND 98 SW6-4 A. oryzae + - - - AO3 ND 99 SW7-9 A. oryzae + - - - AO3 ND 100 SW8-2 A. oryzae + - - - AO3 ND 101 SW8-4 A. oryzae + - - - AO3 ND 102 SW9-6 A. oryzae + - - - AO3 ND 103 SW10-5 A. oryzae + - - - AO3 ND 104 SW11-2 A. oryzae + - - - AO3 ND 105 SW11-6 A. oryzae + - - - AO3 ND 106 SW11-7 A. oryzae + - - - AO3 ND 107 DG2-5 A. oryzae + - - - AO3 ND 108 DG2-8 A. oryzae + - - - AO3 ND 109 DG2-12 A. oryzae + - - - AO3 ND 110 YY1-4 A. oryzae + - - - AO3 ND 111 JJ14-6 A. oryzae + - - - AO3 ND 112 SW9-1 A. oryzae + - - - AO3 ND 113 SW11-5 A. oryzae + - - - AO3 ND 114 DG2-7 A. oryzae + - - - AO3 ND

NO. Code Sample name Lstart1 Lmid1 LnorB1 Lend type Aspergillus
Presence or absence One LNJJ16 Dosun-dong barley yeast + - - - AO3 O 2 LNJJ17 Andeok Farmhouse Barley + - - - AO3 O 3 LNJJ18 Jeju Mill Jeju Inhwa-dong + - - - AO3 O 4 LNJJ19 Jeju Jocheon Barley + - - - AO3 O 5 CN271 American yeast + - - - AO3 O 6 CN112 acid + - - - AO3 O 7 CN123 Song Hak-gok + - - - AO3 O 8 CN131 Pearl (domestic) + - - - AO3 O 9 CN132 Pearl (import) + - - - AO3 O 10 CN152 Taein (Artisan Yeast) - - - - - X 11 CN261 Hallasan green beans + + + + AO2 O 12 CN262 Suncheon (bottom section) + - - - AO3 O 13 CN263 Raw film + - - - AO3 O 14 LNBS1 Busan (softener D) + - - - AO3 X 15 LNBS2 Busan (softener F) + - - - AO3 O 16 LNBS3 Busan (Hyunje Red Ginseng) + + + + AO2 O 17 LNJJ12 Jeju Provincial Office (Yeast) + - - - AO3 O 18 LNJJ13 Millet + - - - AO3 O 19 LNJJ14 Jungmun 1,2 (Jeju Jungmun) + - - - AO3 O 20 LNJJ15 Seogwipo (local) + - - - AO3 O 21 LNBA1 Baek-Asan-Rice grains + - - - AO3 O 22 LNBA2 Baek-Asan-Powder + - - - AO3 O 23 CN251 Well-sum (WEL-SUM): Rice Makgeolli Mix + - - - AO3 X 24 CN252 Win-win Village: The Makgeolli + - - - AO3 O 25 CN121 Song Hakgok: Small songs + - - - AO3 O 26 CN253 Sherwood: Yeast flour + - - - AO3 O 27 CN254 Skinpapa: Natural grain pack-yeast + - - - AO3 O 28 CN255 Natural love: yeast powder - - - - - O 29 CN141 KB Biotech: Makgeolli - - - - - O 30 CN256 Blue field garden: yeast (gokja) - - - - - X 31 CN257 Nature in Jeju: Jejusa yeast powder yeast pack - - - - - X 32 CN258 Chungnam Budget / Traditional Wine Research Institute (Yaksun Yeast) - - - - - X 33 CN259 Chungnam Budget / Traditional Wine Research Institute (Ewha Gok) - - - - - X 34 CN2510 Chungnam Budget / Traditional Wine Research Institute - - - - - X 35 CN2511 Yeast shop: For traditional wheat No. 2 vinegar - - - - - X 36 CN2512 Yeast Shop: Whitening Yeast (Small) - - - - - O 37 CN2513 White Briquette: Yeast Powder (Nonsan, Chungnam) - - - - - O 38 CN161 Korea Enzyme Co., Ltd .: Bio Yeast Yeast Science - - - - - X 39 CN122 Jeonnam Gwangju / Songhak Concerto (Soyulgok) - - - - - X 40 CN2519 Chungnam Seocheon / Hansang Sogokju (Hansan Sogokju Nuruk) + ++ + + AO1 O + + + + AO2 41 CN2514 Chungbuk Jecheon / Traditional Market Yeast + - - - AO3 O 42 LNJJ1 Jeju A - - - - - X 43 LNJJ3 Jeju C - - - - - X 44 LNJJ5 Jeju E - - - - - X 45 LNJJ6 Jeju F - - - - - X 46 LNJJ7 Jeju G - - - - - X 47 LNJJ8 Jeju H1 - - - - - X 48 LNJJ9 Jeju H2 - - - - - X 49 CN2520 Jeju Seogwipo Jungmun Traditional Market 1 - - - - - X 50 CN2521 Jeju Seogwipo Jungmun Traditional Market 2-1 - - - - - X 51 CN2522 Jeju Seogwipo Jungmun Traditional Market 2-2 - - - - - X 52 LNJJ10 Jeju Island Teacher Collection 1 + - - - AO3 O 53 LNJJ11 Jeju Island Teacher Collection 2 + - - - AO3 O 54 CN151 Jeonbuk Taein / Taein Casting (Song Myeong-seop Makgeolli yeast) - - - - - X 55 CN2517 Yongin, Gyeonggi-do / Sulsam (Ewha-gok) + ++ + + AO1 O + + + + AO2 56 CN2517 Yongin / Sulsam, Gyeonggi-do (Baeksu Hwandong) + - - - AO3 O 57 LNPT1 Seopyeongtaek 1 + - - - AO3 X 58 LNSC1 Suncheon + - - - AO3 X 59 LNSW1 Suwon: Internal Vision Song + - - - AO3 O 60 LNSW2 Suwon: Internal Vision Song + ++ + + AO1 O + + + + AO2 61 LNSW3 Suwon: Lee Hwa-gok + - - - AO3 O 62 LNSW4 Suwon: Baeksuhwandonggok - - - - - X 63 LNSW5 Suwon - - - - - X 64 LNSW6 Suwon: Internal Vision Song + - - - AO3 O 65 LNSW7 Suwon: Migok + + - + Etc. O 66 LNSW8 Suwon: Chogok + + + + AO2 O 67 LNSW9 Suwon: Jukgok + + + + AO2 O 68 LNSW10 Suwon: Hyangongok + + + + AO2 O 69 LNSW11 Suwon: Jeonghwagok + + - + Etc. O 70 VM1 M1 - - - - - X 71 VM2 M2 - - - - - X 72 VM3 M3 - - - - - X 73 VM4 M4 - - - - - X 74 VM5 M5 - - - - - X 75 VM6 M6 - - - - - X 76 VM7 M7 - - - - - X 77 VM8 M8 + - - - AO3 O 78 VM9 M9 + - - - AO3 O 79 VM10 M10 - - - - - X 80 VM11 M11 - - - - - X 81 VM12 M12 - - - - - X 82 VB Boiled - - - - - X 83 VNB No Boiled + - - - AO3 O 84 LNDG1 Downward R + - - - AO3 O 85 LNDG2 Downward W + - - - AO3 O 86 CN272 Rice yeast (mainly immigration) + - - - AO3 O 87 CN273 Rice Entry (Joeun Grain) + - - - AO3 O 88 CN274 Rice Yeast (Lee Inza Salt Yeast) + - - - AO3 O 89 CN275 Agricultural Corporation Korea Fermented Korea Yeast + + + + AO2 O

<110> Foundation of Soongsil University-Industry Cooperation <120> Composition for detection of strain producing aflatoxin and          detection method using the same <130> 1066223 <160> 8 <170> KopatentIn 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> YE_F primer <400> 1 catgtgcatc acggcatgag 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> YE_R primer <400> 2 ataaccagcg gttctgccaa 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CT_F primer <400> 3 tgtgtcgggg acctctatgt 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CT_R primer <400> 4 ccctccctgt gtgatgtgtc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> UF_F primer <400> 5 caactgctcg actgtcgtct 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> UF_R primer <400> 6 gaattggctt cgctccctct 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> End_F primer <400> 7 aggctctggg atcaaagctc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> End_R primer <400> 8 tagcgctggc attgaaacag 20

Claims (12)

A composition for detecting aflatoxin-producing strain comprising a third primer set consisting of a primer pair comprising a base sequence of SEQ ID NO: 5 and a base sequence of SEQ ID NO: 6.
The method of claim 1, wherein the primer set is a composition for detection characterized in that it is used for PCR (polymerase chain reaction).
The composition for detection according to claim 1, wherein the aflatoxin-producing strain is a strain present in food.
According to claim 1, wherein the aflatoxin-producing strain is Aspergillus flavus , Aspergillus oryzae , Aspergillus parasiticus , Aspergillus sojae ) And aspergillus fumigatus ( Aspergillus fumigatus ) at least one selected from the group consisting of a composition for detection.
According to claim 1, The composition for detection,
A first primer set consisting of a primer pair comprising the nucleotide sequence of SEQ ID NO: 1 and a nucleotide sequence of SEQ ID NO: 2;
A second primer set consisting of a primer pair comprising the nucleotide sequence of SEQ ID NO: 3 and a nucleotide sequence of SEQ ID NO: 4; And
A fourth primer set consisting of a primer pair comprising the base sequence of SEQ ID NO: 7 and the base sequence of SEQ ID NO: 8;
It characterized in that it further comprises any one or more primer sets selected from the group consisting of.
a) separating the strain from the food;
b) extracting the gene of the strain isolated in step a);
c) amplifying the gene extracted in step b) using a third primer set consisting of a primer pair comprising the base sequence of SEQ ID NO: 5 and the base sequence of SEQ ID NO: 6; And
d) checking the size of the product amplified in step c);
Aflatoxin-containing strain detection method comprising a.
The method according to claim 6, wherein the food in step a) is yeast.
The method according to claim 6, wherein the amplification of step c) is performed by polymerase chain reaction (PCR).
The method of claim 6, wherein the aflatoxin-producing strain is Aspergillus flavus , Aspergillus oryzae , Aspergillus parasiticus , Aspergillus sojae ) And Aspergillus fumigatus ( Aspergillus fumigatus ) detection method characterized in that at least one selected from the group consisting of.
The method of claim 6, wherein the detection method is step e),
Determining the aflatoxin-producing strain when the size of the amplified product of step d) is 1.6 to 2.2 kb;
Detection method characterized in that it further comprises.
The method of claim 6, wherein in step c), the gene
A first primer set consisting of a primer pair comprising the nucleotide sequence of SEQ ID NO: 1 and a nucleotide sequence of SEQ ID NO: 2;
A second primer set consisting of a primer pair comprising the nucleotide sequence of SEQ ID NO: 3 and a nucleotide sequence of SEQ ID NO: 4; And
A fourth primer set consisting of a primer pair comprising the base sequence of SEQ ID NO: 7 and the base sequence of SEQ ID NO: 8;
A detection method characterized in that amplification is further performed using any one or more primer sets selected from the group consisting of.
The method of claim 11, wherein step e),
The size of the amplified product in step d) is
0.3 kb when amplified with the first primer set;
Amplified with the second primer set 1.7 kb;
Amplified with a third primer set 2.2 kb; And
0.3 kb when amplified with the fourth primer set;
In the case of determining the strain to produce aflatoxin;
Detection method characterized in that it further comprises.

Images