KR102093373B1 - A method of increasing vitamin C in Brassicaceae sprout vegetables by means of conditioning LED light source - Google Patents

Abstract

The present invention relates to a method of increasing the vitamin C content of cabbage and sprout vegetables by conditioning the LED light source, and more particularly, irradiating cabbage and sprout vegetables with a single LED selected from white light, blue light, green light or red light, especially blue light By doing this it relates to a method of increasing the vitamin C content of cabbage and sprouts.
According to the present invention, the production of high-quality vegetable crops rich in functional substances, along with the establishment of cultivation conditions capable of increasing the content of antioxidants, especially vitamin C, in cabbage and sprouts through irradiation of LED light sources in a specific wavelength range and optimization of cultivation conditions This can contribute to increasing farm income. In addition, it can be usefully used to provide basic data for research on the mechanism of vegetable crops in which functional substances are generated by identifying the mutual relationship between light and metabolic control substances, and to construct facilities suitable for plant cultivation using LED light sources and light irradiation systems suitable for plant factories. have.

Description

A method of increasing vitamin C in Brassicaceae sprout vegetables by means of conditioning LED light source}

The present invention relates to a method of increasing the vitamin C content of cabbage and sprout vegetables by conditioning the LED light source, and more particularly, irradiating cabbage and sprout vegetables with a single LED selected from white light, blue light, green light or red light, especially blue light By doing this it relates to a method of increasing the vitamin C content of cabbage and sprouts.

Sprout vegetable is used to cultivate the buds generated from seeds for a short period of time to edible young embryonic axis and cotyledon at the early stage of growth, or to bury roots or stems of succulent roots, etc. Refers to vegetables.

Sprout vegetable is also called sprout vegetable or sprout vegetable. It does not refer to any specific vegetable, but collectively refers to harvesting young cotyledon or leaves or stems obtained by sowing seeds of vegetables or grains, and eating them fresh. It is a young vegetable with 1 ~ 3 main leaves, usually sprouted from seeds.

Vegetables biosynthesize precious substances such as nutrients for their growth at the time of sprouting from seeds, so the vitamin and mineral content of sprout vegetables is 3 to 4 times that of grown vegetables. Clean and fresh are the most important, so do not use pesticides.

There are many types of sprout vegetables, most commonly encountered are sprouts and green beans, and cabbage, red radish, radish, and bok choy (Brassicaceae) crops, and soybean, perilla, and pea crops. The seeds sprouted from these seeds are consumed in the least processed form for reproduction or cooking, and contain many nutrients such as amino acids, carbohydrates, minerals, vitamins, and polyphenols, and are receiving high attention as a health food.

Since sprouted vegetables use sprouts germinated from seeds, efficient production of sprouted vegetables and the identification of germination and growth environmental conditions that may contain large amounts of functional substances are very important in terms of efficiency of production and consumption of sprouted vegetables ( J. Bio -Environment Control. , 17: 116-123, 2008). In general, environmental factors affecting bud germination and growth are moisture, temperature, and light conditions. Of these, light has an important effect on seed germination.

In buds germinating from seeds, light affects the photoreceptive protein called phytochrome in the plant body, which acts as an energy source and regulator of growth, morphology and pigmentation, and also affects the production of bioactive substances. ( Annu . Rev. Cell Dev. Biol . , 13: 203-229, 1997). Thus, although the effect of light on the seed germination, growth, and content of functional substances in sprout vegetables is so great, there have been few cases or research results using various lights in the production of sprout vegetables at home and abroad.

Light is the primary source of energy for plants, controlling most stages of plant development and maintaining photosynthetic efficiency ( Plant Cell Environ. , 20: 796-800, 1997). Although sunlight is an optimal condition for plant cultivation, it is constantly used throughout the day or year and has various wavelengths, so there are not many wavelengths used for photosynthesis of plants ( HortScience , 24: 1609-1611, 2007). The irradiated light is regulated by the photochemical reaction of specific receptors for each light quality and plays a different role in plant growth ( Biochem. , 3: 851-857, 1964) . Research into how it affects has been continued. A long study of the relationship between light wavelength and growth of crops revealed that red light affects photosynthesis of plants and blue light is morphologically essential for healthy growth of plants ( Acta Hort . , 440: 111-116 O, 1996). Also, when irradiated with blue light on Arabidopsis thaliana, it has been reported that it inhibits elongation of the lower axis and causes cotyledon expansion, and red light promotes expansion of the lower axis and cotyledon ( Annual Plant Reviews , Volume 30. Blackwell Publishing Ltd. Oxford, 2007). . The physiology of plants within various facilities used to grow crops stably without being affected by the natural climate is influenced by the amount of light transmitted through the cladding material, the quality of light and the irradiation time ( Plant Physiol . , 63: 114-116, 1979). In order to replace the light required by plants with artificial lighting devices, we have developed a variety of artificial light sources such as high-pressure sodium lamps, metal halide lamps, fluorescent lamps, and LED lamps to irradiate useful light and luminous intensity to plants instead of sunlight. Came ( Food Chem. , 119: 423-428, 2010).

In particular, LED lamps are mercury-free, environmentally friendly, lightweight, have excellent power savings, have a long life, and have a simple driving circuit, and have the advantage of easily making certain light quality ( J Kor Ins Illumin Electric Install Eng . , 18 : 51-21, 2004). In addition, the light emission wavelength of the LED lamp can be almost matched with the absorption peak of plant chlorophyll, which is advantageous for photosynthesis and can operate at a low voltage ( J Plant Biotechnol . , 37: 442-455, 2010). Depending on the purpose of cultivation, the use of LED light sources for cultivation of leafy vegetables has been increasing by taking advantage of the ability to use specific qualities with customized qualities, but the quality of vegetables by identifying and controlling the relationship between germination and growth of plants and the content of functional substances is controlled. Research on research techniques to improve the quality of the research is still incomplete ( J Bio- Env Cont . , 20: 253-257, 2011; Kor J Hort Sci Technol . , 26: 106-112, 2008; Protected Hort and Plant Factory , 23: 19-25, 2014).

Under this background, the present inventors titrated the increase of vitamin C content as a functional material of cabbage and sprout vegetables according to LED light source and light quantity irradiation in order to increase the content of a functional material such as vitamin C (vitamin C) in cabbage and sprout vegetables As a result of the efforts to establish the conditions and to develop a method of increasing the vitamin C content of cabbage and sprouts by the LED light source conditions using the result, it is possible to increase the vitamin C content by controlling the amount of blue light in the LED light source. By confirming, the present invention has been completed.

J. Bio-Environment Control., 17: 116-123, 2008 Annu. Rev. Cell Dev. Biol., 13: 203-229, 1997 Plant Cell Environ., 20: 796-800, 1997 HortScience, 24: 1609-1611, 2007 Biochem., 3: 851-857, 1964 Acta Hort., 440: 111-116 O, 1996 Annual Plant Reviews, Volume 30.Blackwell Publishing Ltd. Oxford, 2007 Plant Physiol., 63: 114-116, 1979 Food Chem., 119: 423-428, 2010 J Kor Ins Illumin Electric Install Eng., 18: 51-21, 2004 J Plant Biotechnol., 37: 442-455, 2010 J Bio-Env Cont., 20: 253-257, 2011 Kor J Hort Sci Technol., 26: 106-112, 2008 Protected Hort and Plant Factory, 23: 19-25, 2014

An object of the present invention is to provide a method for increasing the vitamin C content of cabbage and sprout vegetables by irradiating LED single light by light amount (μmolm ^-2 s ^{- 1} ).

Another object of the present invention is to provide a method for producing cabbage and sprout vegetables with increased vitamin C content by irradiating LED single light by light amount (μmolm ^-2 s ^{- 1} ).

Another object of the present invention is to provide cabbage and sprout vegetables with increased vitamin C content.

As one aspect for achieving the above object, the present invention comprises the steps of germinating the seed sprouts (Brassicaceae) sprout vegetable (sprout vegetable) seeds; And irradiating the germinated cabbage and sprout vegetables with LED single light by the amount of light (μmolm ^-2 s ^{- 1} ); providing a method for increasing the vitamin C content of cabbage and sprout vegetables.

As another aspect, the present invention provides a method for producing cabbage and sprout vegetables with increased vitamin C content by irradiating LED single light by light amount (μmolm ^-2 s ^{- 1} ).

In addition, the present invention provides cabbage and sprout vegetables with increased vitamin C content produced by the production method.

According to the present invention, the production of high-quality vegetable crops rich in functional substances, along with the establishment of cultivation conditions capable of increasing the content of antioxidants, especially vitamin C, in cabbage and sprouts through irradiation of LED light sources in a specific wavelength range and optimization of cultivation conditions This can contribute to increasing farm income. In addition, it can be usefully used to provide basic data for research on the mechanism of vegetable crops in which functional substances are generated by identifying the mutual relationship between light and metabolic control substances, and to construct facilities suitable for plant cultivation using LED light sources and suitable irradiation systems for plant factories. have.

1 is a graph showing the analysis results of vitamin C content of DB cabbage grown under conditions of various light amounts for each LED light source according to an embodiment of the present invention, (A) 125μmolm ^-2 s ^-1 LED single light treatment , That is, the result of analyzing the vitamin C content of DB cabbage according to the treatment of white light, blue light, green light, and red light and (B) LED single light treatment with 150 μmolm ^-2 s ^-1 light amount, that is, white light, blue light, green light, red light treatment This is a graph showing the analysis results of vitamin C content in DB cabbage.
Figure 2, according to an embodiment of the present invention, according to the single light treatment of white light, blue light, green light, red light with a light amount of 125 μmolm ^-2 s ^-1 , cabbage and sprout vegetables, (A) sprout cabbage, (B) red light beet This is a photograph showing the phenotype of shoots, (C) radish, and (D) Chongkyungchae seedlings. Here, W is white light, B is blue light, G is green light, and R is red light.
Figure 3, according to an embodiment of the present invention, white light, blue light, green light, red light by treatment of each LED light source with a light amount of 125 μmolm ^-2 s ^-1 , cabbage and sprout vegetables, (A) sprout cabbage, (B) red radish It is a graph showing the growth length of the lower axis of shoots, (C) radish, and (D) Chungkyungchae.
Figure 4, according to an embodiment of the present invention, according to the LED single light treatment of white light, blue light, green light, red light with a light amount of 125μmolm ^-2 s ^-1 , cabbage and sprout vegetables, (A) sprout cabbage, (B) red beet It is a graph showing the results of vitamin C content analysis of sprouts, (C) radish, and (D) chunggyeongchae seedlings.
Figure 5, according to an embodiment of the present invention, (A) ascorbate biosynthesis genes (ABGs) and (B) ascorbate recycling genes (ARGs) by LED single light treatment This is an electrophoresis photograph showing the expression level. Here, W is white light, B is blue light, G is green light, R is red light, BrPGI1 is Brassica phosphoglucose isomerase 1, BrPGI3 is Brassica phosphoglucose isomerase 3, BrPMI1 is Brassica phosphomannose isomerase 1, BrPMI3 is Brassica phosphomannose isomerase 3, BrPMM1 is Brassica phosphomannomutase 1, BrPMM3 is Brassica phosphomannomutase 3, BrGMP2 is Brassica GDP-D-mannose pyrophosphorylase 2, BrGMP3 is Brassica GDP-D-mannose pyrophosphoryl Brassica GDP-D-mannose pyrophosphorylase 4, BrGMP5 for Brassica GDP-D-mannose pyrophosphorylase 5, BrGME1 for Brassica GDP-D-mannose 3,5-epimerase 1, BrGME2 for Brassica GDP-D-mannose 3,5-epimerase 2, BrGGP1 is Brassica GDP-Lgalactose phosphorylase 1, BrGGP3 is Brassica GDP-Lgalactose phosphorylase 3, BrGGP4 is Brassica GDP-Lgalactose phosphorylase 4, BrGPP is Brassica L-galactose-1-P phosphatase, BrGalLDH is Brassica L-galactose dehydrogenase, BrGLDH Brass L-galactono-1, 4-lactone dehydrogenase, BrAO2 is Brassica ascorbate oxidase 2, BrAO3 is Brassica ascorbate oxidase 3, BrAO6 is Brassica ascorbate oxidase 6, BrAPX2 is Brassica ascorbate peroxidase 2, BrAPX3 is Brassica ascorbate peroxidase 2, BrAPX3 is Brassica ascorbate peroxidase 3, BrAPX4 Brassica ascorbate peroxidase 6, BrAPX7 is Brassica ascorbate peroxidase 7, BrAPX-R is Brassica ascorbate peroxidase-R, BrSAPX is Brassica S ascorbate peroxidase, BrTAPX is Brassica T ascorbate peroxidase, BrDHAR3 is Brassica ehydroascorbate reductase 4, Brassica ehydroascorbate reductase 4 Brassica monodehydroascorbate reductase 1, BrMDHAR2 is Brassica monodehydroascorbate reductase 2, BrMDHAR4 is Brassica monodehydroascorbate reductase 4, BrMDHAR5 is Brassica monodehydroascorbate reductase 5, BrMDHAR6 is Brassica monodehydroascorbate reductase 6, BrGR 1 Brassica glutathione reductase 3, BrGR4 is Br It is assica glutathione reductase 4. BrActin is a Brassica intrinsic gene.
Figure 6 is a graph showing the results of the analysis of vitamin C content of cabbage seedlings grown under conditions of treatment duration and various light amounts for each LED light source according to an embodiment of the present invention, (A) 5 at 125 μmolm ^-2 s ^-1 light amount day, 7 days and 10 days a single LED light treatment, i.e., white light, blue light, analysis of vitamin C content of Chinese cabbage seedlings in accordance with the processing result and the red light ^{(B) 100μmolm -2 s -1,} 125μmolm -2 s -1 and 150μmolm ^{- It} is a graph showing the result of analyzing the vitamin C content of cabbage seedlings according to the treatment of LED single light with ² s ^-1 light, that is, white light, blue light, and red light.
7 is a graph showing the results of vitamin C content analysis of sprouts, red radish buds and radish sprouts grown under conditions of various amounts of light for each LED light source, according to one embodiment of the present invention.
Figure 8, according to an embodiment of the present invention, analyzes the expression level of ascorbate biosynthesis genes (ABGs) and ascorbate recycling genes (ARGs) according to the duration of the LED single light treatment It is the graph shown. Here, White is white light, Blue is blue light, Red is red light, BrPGI1 is Brassica phosphoglucose isomerase 1, BrPMI1 is Brassica phosphomannose isomerase 1, BrPMM1 is Brassica phosphomannomutase 1, BrGMP1 is Brassica GDP-D-mannose pyrophosphorylase 1, BrGME1 for Brassica GDP-D-mannose 3,5-epimerase 1, BrGGP1 for Brassica GDP-Lgalactose phosphorylase 1, BrGPP for Brassica L-galactose-1-P phosphatase, BrGalLDH for Brassica L- galactose dehydrogenase, BrGLDH for Brassica L-galactono-1,4-lactone dehydrogenase, BrAO6 for Brassica ascorbate oxidase 6, BrAPX6 for Brassica ascorbate peroxidase 6, BrMDAR1 for Brassica monodehydroascorbate reductase 1, BrDHAR1 for Brassica ehydroascorb reductase It is 3. On the other hand, the relative expression level of the gene is expressed by correcting based on the expression level of BrActin, a Brassica intrinsic gene.
Figure 9, according to an embodiment of the present invention, the road shown by analyzing the effect of removing free radicals (ROS) in cabbage seedlings according to the treatment by LED light source, (A) cabbage confirmed changes in free radicals through DAB staining A picture of seedlings, (B) is a graph showing by quantifying the accumulation content of hydrogen peroxide (H ₂ O ₂ ), and (C) is a graph showing by measuring the degree of superoxide dismutase (SOD) activity. Here, the control of (A) is a control treated with only 515 mM Na ₂ HPO ₄ without DAB staining.
10 is a schematic diagram briefly showing the ascorbate biosynthesis and recirculation pathway of the present invention.

The present invention relates to a method of increasing the vitamin C content of cabbage and sprout vegetables by conditioning the LED light source, and more particularly, irradiating cabbage and sprout vegetables with a single LED selected from white light, blue light, green light or red light, especially blue light By doing this it relates to a method of increasing the vitamin C content of cabbage and sprouts.

In one aspect, the present invention comprises the steps of germinating the seeds of cabbage (Brassicaceae) sprout vegetables (sprout vegetable); And irradiating the germinated cabbage and sprout vegetables with LED single light by the amount of light (μmolm ^-2 s ^{- 1} ); providing a method for increasing the vitamin C content of cabbage and sprout vegetables.

In general, sprout vegetable refers to a young leaf or stem that first germinates from a seed, and the cabbage and sprout vegetable of the present invention include all kinds of sprout vegetables belonging to the Brassica family, specifically Chinese cabbage, red radish, radish, It may be cheonggyeongchae, but is not limited thereto.

Chinese cabbage ( Brassica rapa L. ssp. Pekinensis , Chinese cabbage) is a leafy stem vegetable belonging to the cabbage family (Brassicaceae) and is one of the vegetables produced and consumed high in Korea, and contains vitamin A, carotene, vitamin B, vitamin B2, nicotinic acid, and vitamin C.

Red Radish ( Raphanus sativus L., red radish) is a plant belonging to the family Brassisicaceae, and the red radish buds have reddish stems and high vitamin C content, unlike ordinary radish buds.

Raphanus sativus L., radish sprouts, is also known as radish, is a plant of the Brassica family, and has a peculiar, spicy, bitter taste and is rich in vitamin A and vitamin C and minerals, soothing muscle swelling and stimulating gastric secretions It has the effect of improving digestibility.

Cheong Kyung Chae ( Brassica campestris L.) is an annual plant of the Brassica family, and is a type of Chinese cabbage. It is very light and has no special scent or taste, so it is used for cooking to enhance the flavor of the sauce. It is known to be rich in vitamin B and vitamin C.

In the method for increasing the vitamin C content of cabbage and sprouts by irradiating the LED single light of the present invention by light amount (μmolm ^-2 s ^{- 1} ), the LED single light is blue light, white light (white light), green light (green light) and may be one or more selected from the group consisting of red light (red light), but is not limited thereto, preferably blue light (blue light).

In the method for increasing the vitamin C content of cabbage and sprout vegetables by irradiating the LED single light of the present invention by light amount (μmolm ^-2 s ^{- 1} ), the light amount (μmolm ^-2 s ^-1 ) range, but are not limited to, 100μmolm ^-2 s ^-1 to 150μmolm ^-2 s ^-1 may be, and preferably 125μmolm ^-2 s ^-1 to 150μmolm ^-2 s ^-1 may be, even more preferably 125μmolm ^{- It} can be ² s ^-1 .

In one embodiment of the present invention, it was confirmed that as the amount of blue light in the LED light source is adjusted, the vitamin C content is significantly increased compared to white light, green light, and red light (FIGS. 1, 4, 6 and 7). .

As another aspect, the present invention provides a method for producing cabbage and sprout vegetables with increased vitamin C content by irradiating LED single light by light amount (μmolm ^-2 s ^{- 1} ).

The cabbage and sprout vegetables include all kinds of sprout vegetables belonging to the cabbage family (Brassicaceae), and may be, in particular, cabbage, red radish, radish, bok choy, but are not limited thereto.

In the method for producing cabbage and sprout vegetables with increased vitamin C content by irradiating the LED single light of the present invention by light amount (μmolm ^-2 s ^{- 1} ), the LED single light is blue light, white light (white light) It may be one or more selected from the group consisting of light, green light, and red light, but is not limited thereto, but may preferably be blue light.

In the method for producing cabbage and sprout vegetables with increased vitamin C content by irradiating the LED single light of the present invention by light amount (μmolm ^-2 s ^{- 1} ), the light amount (μmolm ^-2 s ^-1 ) range is limited to this include, but are not, 100μmolm ^-2 s ^-1 to 150μmolm ^-2 s ^-1 may be, and preferably 125μmolm ^-2 s ^-1 to 150μmolm ^-2 s ^-1 may be, it is 125μmolm ^-2 s and more preferably, ^It can be ^-1 .

In addition, the present invention provides cabbage and sprout vegetables with increased vitamin C content produced by the production method.

The cabbage and sprout vegetables include all kinds of sprout vegetables belonging to the cabbage family (Brassicaceae), and may be, in particular, cabbage, red radish, radish, bok choy, but are not limited thereto.

Hereinafter, the configuration and effects of the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Example  1: LED (Light Emitting Diode) Single light  Analysis of vitamin C content in DB cabbage by treatment

In order to establish appropriate conditions for increasing the vitamin C content of cabbage and sprout vegetables according to the irradiation of each LED light source, it was grown under various light conditions for each LED light source using seeds of DB cabbage. Thereafter, a sample was collected to analyze the change in vitamin C content, and based on this, proper cultivation conditions were established to increase the vitamin C content in cabbage and sprout vegetables.

Example  1-1: Sample and Light treatment

After incubating DB (Dongbu) Chinese cabbage (sun-based, inbred line; eastern Hannong) seeds in a petri dish containing water for 23 days at a temperature condition of 23 ° C. and dark condition Then, the LED single light of white light, blue light, green light or red light was irradiated in the LED chamber for 7 days at a temperature of 25 ° C. Then, a sample was taken to analyze the vitamin C content. In this case, a single LED illumination period is 16 hours and was irradiated to give 8 hours in darkness, by a single LED light intensity are respectively 125μmolm ^-2 s ^-1 (LED irradiation distance 17 ㎝) or 150μmolm ^-2 s under the single LED ^{light- It} irradiated with ¹ (LED irradiation distance 15 cm).

Example  1-2: Analysis of vitamin C content in DB cabbage

In Example 1-1, under the conditions of various light amounts for each LED light source, i.e., 125 μmolm ^-2 s ^-1 or 150 μmolm ^-2 s ^-1 light amount, grown under white light, blue light, green light, and red light single LED conditions, and collected The vitamin C content of each sample was analyzed. Vitamin C content was measured by HPLC (high performance liquid chromatography) analysis.

Specifically, after picking and grinding DB cabbage seedling samples, 2 g of the sample is weighed into a test tube tube, and 20 ml of 5% metaphosphoric acid (Wako) is added and the sample is homogenized (Ultra-Turrax T25, IKA Labo) And dissolved to a total amount of 50 ml. It was then shaken at 200 rpm for 20 minutes, then extracted for 30 minutes with an ultrasonic extractor, centrifuged at 3,200 rpm, and the supernatant was taken and filtered with a 0.20 μm syringe filter to use as a test solution.

At this time, ascorbic acid (Ascorbic acid) was used as a standard for vitamin C analysis. Specifically, as a standard product, 0.1 g of Sigma ascorbic acid (St. Louis, Mo, USA) was accurately weighed in a 100 mL volumetric flask to make a 1,000 mg / L solution, and the final concentration was 1 each. It was prepared and used to be ㎎ / ℓ, 10 ㎎ / ℓ, 50 ㎎ / ℓ and 100 ㎎ / ℓ. HPLC grade water was used to prepare the standard solution.

HPLC analysis conditions for vitamin C analysis are shown in Table 1 below.

Item Condition Equipment NANOSPACE SI-2, SHISEIDO, JAPAN Detector PDA detector (Theromo Fisher, USA) Analytical Column SHISEIDO MG120 C18 4.6 × 250 mm Column oven temperature 40 ℃ Mobile phase 0.05M potassium phosphate (KH ₂ PO ₄ ): acetonitrile (ACN) = 98: 2 Flow rate 0.5 ml / min (min) Wavelength [nm] 254 nm Injection volume 5 μl

As a result of analyzing the vitamin C content of DB cabbage seedlings grown under conditions of various amounts of light for each LED light source, as shown in FIG. 1, the vitamin C content compared to other light sources, that is, white light, green light and red light, under the condition of blue light among the LED single light It was confirmed that this is significantly increased, and when the blue light was irradiated with a 125 μmolm ^-2 s ^-1 light amount, the vitamin C content was increased by 22-32% compared to other light sources (A in FIG. 1), and a 150 μmolm ^-2 s ^-1 light amount. When irradiated with blue light, it was confirmed that the vitamin C content increased by 28-36% compared to other light sources (B in FIG. 1).

Through the above results, it was confirmed that the vitamin C content can be increased by controlling the amount of blue light in the LED light source.

Example  2: LED Single light  Phenotype and Vitamin C Content Analysis of Chinese Cabbage and Sprout Vegetables by Treatment

In Example 1, using a seed of DB cabbage, which is one of the cabbage family crops, LED single light, that is, white light, blue light, green light, and red light, was irradiated with blue light, in particular, with a light amount of 125 μmolm ^-2 s ^-1 or 150 μmolm ^-2 s ^-1 In case, it was confirmed that the vitamin C content is increased.

Accordingly, in order to establish appropriate cultivation conditions for increasing the vitamin C content of Chinese cabbage and sprout vegetables, after irradiating a single light of LED on several cabbage and other vegetables such as sprouts, radish radish buds, radish sprouts, and clear vegetables, samples Extracted and analyzed the phenotype and vitamin C content of the cabbage and sprouts.

Example  2-1: Sample and Light treatment

After cultivation of sprout vegetables, specifically sprout cabbage, red radish buds, radish sprouts, and bok choy, in a sprout cultivator containing water for 5 days under conditions of temperature and dark condition of 22 ° C. The cultivator was moved into the LED chamber for 3 days at a temperature of 22 ° C. Each single LED light of white light, blue light, green light or red light was irradiated. Subsequently, a sample was taken and the phenotype and vitamin C content of the cabbage and sprout vegetable seedlings were analyzed. At this time, the LED single light irradiation period was irradiated at a period of 16 hours under a single LED light and 8 hours at a dark state, and the amount of light per LED single light was irradiated to 125 μmolm ^-2 s ^-1 .

Example  2-2: Chinese cabbage and sprouts Seedling  Phenotypic analysis

In Example 2-1, under the conditions of 125 μmolm ^-2 s ^-1 light, by analyzing the single light of each LED light source, that is, white light, blue light, green light, and red light, analyze the phenotype of each cabbage and sprout seedling grown Did.

As a result of analyzing the phenotype of each cabbage and sprout vegetable seedlings grown under the conditions of 125 μmolm ^-2 s ^-1 light intensity for each LED light source, as shown in FIG. 2 below, among the cabbage and sprout vegetables, sprout cabbage and red radish buds are in green light. Under the growth of the lower axis was excellent, and the radish was observed to grow under the condition of white light.

On the other hand, when irradiating blue light with increased vitamin C content compared to white light, green light and red light, it was analyzed that the length growth of Chinese cabbage and sprouts was relatively slow compared to other light sources.

More specifically, as a result of comparing the length of growth of the lower cabbage axis of the sprout cabbage, red radish radish, radish radish and bok choy sprouts, the four cabbages and the sprout vegetables according to the treatment by LED light source, as shown in FIG. Grew by 3.72 cm in green light, and it was confirmed that the length growth of the lower axis was the best compared to other light sources. In addition, it was confirmed that the reddish radish buds also grew 7.11 cm in green light, so that the length of the lower axis was superior to other light sources, and it was confirmed that radish radish grew to 7.06 cm and 6.78 cm in white and red light, respectively. On the other hand, in the case of blue light treatment, Chongkyungchae was slow to grow to 3.75 cm in the length of the lower axis, and in the case of sprout cabbage, the length of the lower axis was 2.54 cm in the case of blue light, and it was confirmed to grow smaller.

Through the above results, it could be confirmed that cabbages and sprouts such as sprout cabbage, red radish radish sprouts, radish sprouts, and chunggyeongchae exhibit various growth patterns according to each LED light source.

Example  2-3: Analysis of vitamin C content in Chinese cabbage and sprout vegetables

In Example 2-1, in the condition of 125 μmolm ^-2 s ^-1 light amount, each cabbage and bud vegetable sample grown by irradiating LED single light of each LED light source, that is, white light, blue light, green light, and red light, was collected and vitamins The C content was analyzed. Vitamin C content was measured by HPLC (high performance liquid chromatography) analysis.

Specifically, after extracting and crushing the samples of the sprout cabbage, red radish radish, radish and bok choy sprouts, the above four cabbage and sprout vegetable seedlings, respectively, 2 g of each sample was weighed into a test tube tube, and 5% metaphosphoric acid solution (metaphosphoric acid , Wako) 20 ml was added and each sample was homogenized (Ultra-Turrax T25, IKA Labo), and the total amount was dissolved to 50 ml. It was then shaken at 200 rpm for 20 minutes, then extracted for 30 minutes with an ultrasonic extractor, centrifuged at 3,200 rpm, and the supernatant was taken and filtered with a 0.20 μm syringe filter to use as a test solution.

At this time, as a standard for the analysis of vitamin C was used ascorbic acid (Ascorbic acid) prepared by the method of Example 1-2, the vitamin C content was measured by the HPLC analysis conditions shown in Example 1-2.

As a result of analyzing the vitamin C content of each cabbage and sprout vegetable seedlings grown under the conditions of 125 μmolm ^-2 s ^-1 light intensity for each LED light source, as shown in FIG. 4 below, during the blue light treatment, sprout cabbage among the cabbage and sprout vegetables was treated with white light. Compared, the vitamin C content increased by 31%, and it was confirmed that the content increased by 25% or more compared to green light (A in FIG. 4).

In addition, in the case of red radish radish buds, vitamin C content increased by 20% compared to white light when treated with blue light, and it was confirmed that the content was higher than that of green light by 16% or more (Fig. 4B). Vitamin C content of radish was increased by 28% compared to white light when irradiated with blue light, and increased by more than 49% compared to red light. In particular, in the case of radish, it was shown that the amount of vitamin C synthesis increased most compared to other light sources, that is, white light, green light, and red light, from blue light among LED light sources (C in FIG. 4). Likewise, in the case of cheonggyeongchae, vitamin C content increased by 14% compared to white light when irradiated with blue light, and it was confirmed that the content of 27% or more was higher than that of red light (D in FIG. 4).

Through the above results, it was confirmed that the cabbage and sprout vegetables such as sprout cabbage, red radish radish sprout, radish radish, and chunggyeongchae can increase the vitamin C content by irradiating blue light among the LED light sources.

Example  3: LED Single light  Analysis of expression of genes related to vitamin C biosynthesis and recycling from DB cabbage by treatment

In Example 1, using a seed of DB cabbage, which is one of the cabbage family crops, LED single light, that is, white light, blue light, green light, and red light, was irradiated with blue light, in particular, with a light amount of 125 μmolm ^-2 s ^-1 or 150 μmolm ^-2 s ^-1 In case, it was confirmed that the vitamin C content is increased.

Thus, in order to analyze the gene expression level related to the increase in vitamin C content of Chinese cabbage crops according to the treatment by LED light source, RT-PCR was performed. RT-PCR was performed to analyze the expression patterns of 18 genes out of 23 ascorbate biosynthesis genes (ABGs) of DB cabbage (sun line, inbred line) by LED single light treatment, and ascorbate recycling gene (ascorbate recycling genes, ARGs) The expression pattern of 22 out of 29 genes was analyzed.

Specifically, DB (Dongbu) cabbage (sun-based, inbred line; Dongbu Hannong) seeds were cultured in a petri dish containing water for 23 days at a temperature condition of 23 ° C. and dark condition. After that, each single LED light of white light, blue light, green light, or red light in the LED chamber was transferred to the soil for 7 days at a temperature of 25 ° C. It was irradiated with 125 μmolm ^-2 s ^-1 . Subsequently, the sample was taken and immediately frozen in liquid nitrogen and ground with a mortar. As for the ground sample, total RNA was extracted using RNeasy plant mini kits (Qiagen, Germany), cDNA was synthesized as a template, and PCR was performed. PCR reaction conditions were initially performed at 98 ° C for 3 minutes, and then repeated for 30 seconds at 98 ° C, 30 seconds at 55 ° C to 60 ° C, and 2 minutes at 98 ° C for a total of 35 to 45 cycles, and the final step was 98. It proceeded under the condition of further heating at 5 degreeC.

Meanwhile, primer sets and specific annealing temperatures used for analysis of expression of genes related to vitamin C biosynthesis and recycling from DB cabbage are shown in Table 2 below.

gene
(Gene) Forward primer
(forward primer) Sequence number Reverse primer
(reverse primer) Sequence number Annealing  Temperature
(℃) PGI1 CTTCTCCTTCTCTCAAACAGTCC One TAAAACGACCCGCAGGAG 2 55 PGI3 GGCTGCACATTTGTCAGAGA 3 CAATGTCCTAGCGTTCAGCA 4 55 PMI1 GGTTGTCGACGGCGTCTT 5 ACTGGAGCCATCAGCATCC 6 56.8 PMI3 GCGAATTCGGATCAACCA 7 GGTGTTTCAGTTTGGATACGAT 8 55 PMM1 TCAAAAAGCCCGGAGTGA 9 ACATGAACAGAGCTTTGCATTTA 10 55 PMM3 GCCAAGAAGCCAGGAGTGA 11 ACATGAATAGAGCCTTGCATTTC 12 55 GMP2 ATGGAGGAGGAAGGTAAAGAAGA 13 TAGAAGCCCCGCTGCTATAA 14 55 GMP3 ATGGAGAAAGAAGAAGCAAGAGTC 15 ATGATCTCTGGTTTCGCAGAC 16 56.8 GMP4 TGGAGTTGATGAGGTGGTGTT 17 TTATGTAGTCCTTGGGTTGTCCA 18 55 GMP5 GGTTGATGAAGTGGTTTTGACAG 19 TCACGTGGTTGACCAATGTC 20 55 GME1 AAGCTCAAGATATCAATCACAGGAG 21 TTCCGAAAGGACCGTAAATG 22 55 GME2 CCTTCCGAGAAGCTGAGGA 23 GGTAAATGAACGGGTCTGAAGC 24 55 GGP1 GAAGCCGGTGGCTTTTCTT 25 CTTCGGCAGCCATGTGAA 26 55 GGP3 AGACTCCGGAGAGAAAGCTAGAG 27 AGGCATGCAGGGTAAGACCT 28 55 GGP4 GATCAGCCACGAAGCTAAAGA 29 TCTCCTGGAGGCAAACACAG 30 55 GPP GGAGGGAGGGAGGATCAAAT 31 TGAGTTCATGAGGTGTGACCA 32 55 GalLDH TGGCATGAAGCTTGTCACTC 33 TCCCTGCTGTCAGGAGTCTT 34 55 GLDH TGGCATGAAGCTTGTCACTC 35 TCCTGTCTTTCAACGCACTG 36 58.8 AO2 GCAGCACATCGTTACCAACAT 37 CAACCGTTCGTCGAATGTC 38 55 AO3 CACCTACAAATTCACTGTTGATAAGC 39 TTTGGCAGAAAGACCGAGTT 40 55 AO6 GGGTTGAACACGCTTAGCTACTT 41 GTAACGGCGGATTCTTCAAA 42 55 APX2 AATCAAGGTTCCAAACATCTGAA 43 ATAGTGACTGTAGACGTTGGTGTGA 44 55 APX3 CGGTGCCACTCTTCTTCTTC 45 AGCAGCTTTACCCTTCGTCA 46 55 APX4 GTCTGGCTTCGATGGACCT 47 TCCCTGAGCCAGAACAGTG 48 55 APX6 TGAGGCCAACAGTGGTATCC 49 AGAAAAAGGCGTCCTCATCA 50 57 APX7 TTGATGCTGAGCAAGGTCAC 51 TTGTCGGAAACAAGCTGAAG 52 55 APX-R AGGAAGCCAAGAAGGAGATTG 53 ATCAGGACCCAAGAATGCAG 54 55 SAPX CACCACCACTATGGCTTCCT 55 CCGTAGCTGCTGTGCAGTG 56 55 TAPX GGACAGTGAAATGGCTCAAGT 57 GTTAGTGGGCAATGGCTTGT 58 55 DHAR3 AGCGACGGATCCGAGAAG 59 TTAGGGGTTAACCTTGTGTTCC 60 55 DHAR4 AGTGACGGTCCTTTGCTTCA 61 GTGGAGGGAGAACACAGCAT 62 55 MDHAR1 ACATGGGTAAAGGAGTGAAGTTTATC 63 ACCGTCACAAGACTCACAACTCT 64 58.8 MDHAR2 ATGAGCTCGTGACTGCAATG 65 AGGTCTAGCGCCAACACCTA 66 58.8 MDHAR4 CAGTGCTAAAGGAGTGGAGTTCA 67 GAGGCTTCTCCATCATCACC 68 55 MDHAR5 CCGGATTGTCTCTTTGGTGT 69 AAAGCTGATCTTCGGGGAAT 70 55 MDHAR6 GCACATCCAAATGGAGAGGT 71 CAAACGAGCGGGAGTAGAAG 72 55 GR1 AAGCCACGGAGGCTCACTA 73 TTCCTAAAGAATAGATCCACTGTACCA 74 55 GR2 ATGGGTGTTCCCTATTTCATTTC 75 AATATAAGCTCTCCTGAGAATCTGGT 76 55 GR3 GGAGGAAGCTACAACCGAGAC 77 AAATCTACAGTAGCACCCATTCCA 78 55 GR4 TCAAACCACCGCTACTACTCCT 79 CGGAAGAGATGGTGGAAAAG 80 58.8 Actin CTCAGTCCAAAAGAGGTATTCT 81 GTAGAATGTGTGATGCCAGATC 82 55

By performing RT-PCR, ascorbate biosynthesis genes (ABGs) and ascorbate of DB cabbage (inbred line) by LED light source treatment by LED light source, that is, white light, blue light, green light, and red light As a result of analyzing the expression level of recycled genes (ascorbate recycling genes, ARGs), as shown in FIG. 5, among the ABGs of Chinese cabbage, BrPMI1 (phosphomannose isomerase) was strongly expressed in blue light and red light, but not in white light and green light. Was confirmed. Since BrPMI1 is strongly expressed in blue light, it has been inferred that it will play an important role in the initial synthesis stage of the vitamin C biosynthetic pathway.

In addition, among ABGs, BrPMM1 (3 phosphomannose mutase) was strongly expressed in white light and green light, BrPMM3 was strongly expressed in red light, and BrGMP (GDP-mannose pyrophosphorylase) genes were found to have different expression patterns according to light. BrGME2 (GDP-D-mannose 3,5-epimerase) was expressed during blue light and green light treatment, but weakly expressed in white light and red light. It was confirmed that BrGLDH (L-galactono-1,4-lactone dehydrogenase) was strongly expressed in white light and blue light, but not in red light and green light. Since BrGLDH was strongly expressed during blue light treatment, it was inferred that it would play an important role in the late synthesis step of the vitamin C biosynthetic pathway (FIG. 5A).

On the other hand, most of the cabbage-derived ARGs were expressed equally according to the LED light source, but BrAPX6 (ascorbate peroxidase) and BrMDHAR1 (monodehydroascorbate reductase) were strongly expressed only in blue light. As it was strongly expressed during blue light treatment of BrAPX6 (ascorbate peroxidase) and BrMDHAR1 (monodehydroascorbate reductase), it was inferred that it might be related to increase in synthesis when vitamin C is recycled (Fig. 5B).

Based on the results of the molecular and biological studies, the increase in the amount of vitamin C synthesis in Chinese cabbage and crops by blue light treatment among LED single light, ascorbate biosynthesis genes (ABGs) and ascorbate recycling related genes specifically expressed The functions of (ascorbate recycling genes, ARGs) were revealed, and the possibility was deduced by controlling them.

Example  4: LED (Light Emitting Diode) Single light  Analysis of vitamin C content in Chinese cabbage seedlings according to treatment duration and amount of light treated

To investigate the effect of LED single light treatment period on the accumulation of vitamin C in cabbage and sprout vegetables, white light, blue light, or blue light on Chinese cabbage seedling in the LED chamber Each single LED light of red light is irradiated for 5 days, 7 days, or 10 days at a light amount of 125 μmolm ^-2 s ^-1 (LED irradiation distance 17 cm), and then samples are taken to determine the vitamin C content. Analysis (A in Figure 6).

As a result of analyzing the vitamin C content of cabbage seedlings according to the duration of the LED single light treatment, as shown in A of FIG. It was confirmed that the vitamin C content was significantly increased to 73.36 ~ 83.27 mg / 100g.

In addition, in order to investigate the effect of light intensity of LED single light on the accumulation of vitamin C in Chinese cabbage and sprout vegetables, each LED of white light, blue light, or red light on a cabbage seedling light to 100μmolm ^-2 s ^-1, 7 ilgan irradiated with 125μmolm ^-2 s ^-1, or 150μmolm ^-2 s ^-1 light intensity condition, and collected after the sample was analyzed for vitamin C content (B in Fig. 6).

As a result of analyzing the vitamin C content of Chinese cabbage seedlings according to the light intensity of the LED single light treatment, as shown in B of FIG. 6 below, regardless of the type of single light, that is, white light, blue light under conditions of 100 μmolm ^-2 s ^-1 light amount Or it was not effective to improve the accumulation of vitamin C regardless of red light. On the other hand, 100μmolm ^-2 s ^-1 light conditions as compared to 125μmolm ^-2 s ^-1 under the conditions of the amount of light was the vitamin C content increased significantly accumulate, especially vitamin blue light than the other two single light, i.e., white light and red light It was confirmed that the most effective in increasing the C content.

Through the above results, it was found that blue light having a light condition of 125 μmolm ^-2 s ^-1 was most effective in improving the vitamin C content of sprout cabbage.

On the other hand, in the case of 100 μmolm ^-2 s ^-1 light quantity condition, it had no effect on vitamin C accumulation regardless of the type of single light, but white light, blue light, or white light, under 125 μmolm ^-2 s ^-1 and 150 μmolm ^-2 s ^-1 light conditions In the case of red light, it was found that the vitamin C content was increased. In particular, it was found that the increase in vitamin C content was more pronounced in the case of blue light compared to white light or red light under the light conditions of 125 μmolm ^-2 s ^-1 and 150 μmolm ^-2 s ^-1 .

As a result, since blue light is effective in increasing the vitamin C content of cabbage and sprouts, it can be inferred that blue light can be used as a useful tool to control vitamin C biosynthesis.

Example  5: LED (Light Emitting Diode) Single light  Analysis of vitamin C content in cabbage and sprout vegetables according to the amount of processed light

Example 4 LED single light, i.e., confirming the increase vitamin C content of Chinese cabbage seedlings in accordance with the degree of white light, blue light or red light resulting from the light amount of each processing, 100μmolm ^-2 s ^-1 125μmolm ^-2 s except for the light conditions ^{- It} was confirmed that the vitamin C content increased under light conditions of ¹ and 150 μmolm ^-2 s ^-1 . In particular, it was confirmed that the vitamin C content of cabbage seedlings was significantly increased under the blue light condition of 125 μmolm ^-2 s ^-1 light amount.

Accordingly, in order to confirm whether it can be widely applied to the development of high-quality crops with high vitamin C content by controlling the light condition of each LED single light, Chinese cabbage sprouts, red cabbage radish (red) young radish sprouts), a random sequence is (radish sprouts) in white light (white light), the blue light (blue light) or red light (each of the single LED light 100μmolm ^-2 s ^-1 of ^{red light), 125μmolm -2 s -1} , Alternatively, it was irradiated for 5 days under the condition of 150 μmolm ^-2 s ^-1 light amount, and then samples were taken to analyze the vitamin C content (FIG. 7). At this time, the cabbage and sprout vegetables were cultivated for 3 days in dark conditions, and then irradiated with each LED single light for 5 days.

As a result of analyzing the vitamin C content of cabbage and sprout vegetables according to the light intensity of the LED single light treatment, as shown in FIG. 7, in the case of sprout cabbage and red radish radish, the vitamin C content in the blue light condition of 125 μmolm ^-2 s ^-1 light amount It increased significantly, and the vitamin C content was about 77 mg / 100g. This was similar to the result of 73.36 ~ 83.27 mg / 100g of vitamin C content of Chinese cabbage seedling confirmed under blue light condition of 125 μmolm ^-2 s ^-1 light.

On the other hand, unlike sprouts and red radish buds, in the case of radish radish, it was found that the vitamin C content was 68 mg / 100 g, which was the highest in the blue light condition of 100 μmolm ^-2 s ^-1 light.

Through the above results, it was found that blue light can be effectively used to increase vitamin C content in cabbages and sprouts as well as other edible crops such as red radish radish and radish radish.

Example  6: LED Single light  Analysis of the expression of genes related to vitamin C biosynthesis and recycling in Chinese cabbage seedlings according to the treatment period

In Example 4, as a result of confirming the degree of vitamin C content enhancement of cabbage seedlings according to each treatment period of the LED single light, that is, white light, blue light, or red light, other light sources, that is, white light and red light, under the condition of blue light among the LED single light In comparison, it was confirmed that the vitamin C content was significantly increased regardless of the irradiation period.

Accordingly, qPCR (Quantitative PCR) was performed to analyze the gene expression level related to the increase in vitamin C content of cabbage seedlings according to the treatment period for each LED light source. By performing qPCR, the expression of 9 genes out of 23 ascorbate biosynthesis genes (ABGs) of cabbage seedlings according to the LED single light treatment period, specifically 5 days, 7 days, and 10 days by LED light source irradiation The patterns were analyzed, and the expression patterns of 5 genes out of 29 ascorbate recycling genes (ARGs) were analyzed (FIG. 8).

Meanwhile, primer sets used for analysis of the expression of genes related to vitamin C biosynthesis and recycling of cabbage seedlings according to the treatment period for each LED light source are shown in Table 3 below.

gene
(Gene) Forward primer (5 '→ 3')
(forward primer) Sequence number Reverse primer (5 '→ 3')
(reverse primer) Sequence number BrPGI1 CTTGCAAAAGCGTGTGTTGT 83 GCAGACATGTGCGCTATGAT 84 BrPMI1 TCTGTGCCAGGTCCTTCTCT 85 TCTGCAGGCACAAACAGAAC 86 BrPMM1 ATGGAATGCTCAACGTGTCA 87 CGAAGTTCAGCCACCATCTT 88 BrGMP1 GCAGTGGGCTAGGATTGAGA 89 TGATCTCCTTGTGTGGCAAA 90 BrGME1 TGGCCGTAACTCAGACAACA 91 GCGACACATCACTGCCTTTA 92 BrGGP1 AGGAGGAGCTTGAAGGAACC 93 ACAAGGCACTCAGAGGCAGT 94 BrGPP GATGGAACTGAAAGCGGCTA 95 GCAGAGTCCTCGTCATCCTC 96 BrGalDH CGTTCCGACAAGGCATTAAC 97 TAACGTCCACACTTGGTTGC 98 BrGLDH TGGCATGAAGCTTGTCACTC 99 TCCTGTCTTTCAACGCACTG 100 BrAO6 GGACGGCGTTAAGGTTTGTA 101 CAATCCGGTCTACTCCCTCA 102 BrAPX6 AAGGAACTCTTGAGCGGTGA 103 AGAAAAAGGCGTCCTCATCA 104 BrMDHAR1 GAAGGTGGGACCAAAGAACA 105 ACCCGAGTCCTTCTCTTTCC 106 BrDHAR1 CATTGGGGCATTACAAGGAT 107 TGCTTGAGCTTGTGTTTTCG 108 BrGR3 GACCGGGGATATTTTGGTTT 109 TTGGTTGCTCCACACTTGAG 110 BrActin2 CTCAGTCCAAAAGAGGTATTCT 111 GTAGAATGTGTGATGCCAGATC 112

By performing qPCR, ascorbate biosynthesis genes (ABGs) and ascorbate recycling genes (ARGs) of cabbage seedlings according to the LED single light treatment period for each LED light source, that is, white light, blue light, and red light As a result of analyzing the expression level of, the expression level of BrPGI1, BrPMI1, BrPMM1, BrGMP1, BrGME1, BrGGP1 and BrGPP among the ABGs of Chinese cabbage was significant only when blue light was irradiated for 5 days among the LED single light. It was confirmed that the increase. On the other hand, the expression levels of BrGalDH and BrGLDH did not increase significantly regardless of the LED single light type, that is, regardless of white light, blue light or red light. On the other hand, similarly, the expression levels of BrAO6, BrAPX6, BrMDAR1, BrDHAR1 and BrGR3 in ARGs were also significantly increased only when blue light of LED single light was irradiated for 5 days.

Through the above results, ascorbate biosynthesis genes (ABGs) and ascorbate recycling related genes (ascorbate recycling) in the ascorbate biosynthesis and recirculation pathway (FIG. 10) as the LED single light and blue light are treated for 5 days genes, ARGs) to increase the amount of vitamin C synthesis in cabbage seedlings.

In addition, it was found that most ascorbate biosynthesis related genes (ABGs) and ascorbate recycling related genes (ARGs) were more strongly expressed under blue light irradiation than white light and red light.

On the other hand, it was found that the expression levels of BrGalDH and BrGLDH, which are responsible for the last two steps of the ascorbate biosynthetic pathway, are not affected by each LED single light, that is, white light, blue light and red light. That is, it was found that down-regulation of the BrGalDH and BrGLDH gene expression did not affect vitamin C biosynthesis.

Example  7: Blue light (blue light) Analysis of the effect of reducing the accumulation of free radicals (ROS) due to increased vitamin C content

Vitamin C synthesis of cabbage seedlings by controlling the expression of ascorbate biosynthesis related genes (ABGs) and ascorbate recycling related genes (ARGs) compared to other light sources, that is, white light and red light, under the condition of blue light among the LED single light in Example 6 above. It was confirmed that the amount was significantly increased.

Meanwhile, one of the most important functions of vitamin C is an antioxidant action that protects cells from reactive oxygen species (ROS) generated by various environmental stresses.

Accordingly, in order to investigate whether the increase in the vitamin C content of cabbage seedlings by irradiation of blue light is related to the scavenging activity of free radicals, LED light sources, specifically, white light, blue light, or red light of 125 μmolm ^-2 s ^-1 light amount The superoxide dismutase (SOD) activity, which is an enzyme that converts hydrogen peroxide (H ₂ O ₂ ) content and superoxide ions, which are representative active oxygen, into cabbage and seedlings grown for 7 days under conditions, is converted into oxygen and hydrogen peroxide. It was measured (Fig. 9).

As a result, as shown in Figs. 9A and 9B, the accumulation content of hydrogen peroxide (H ₂ O ₂ ) of the cabbage seedlings grown under blue light irradiation conditions was lower than that of the cabbage seedlings grown under red or white light irradiation conditions. Did.

In addition, as shown in C of FIG. 9, the activity of superoxide dismutase (SOD), an enzyme that catalyzes the disproportionation reaction that converts superoxide ions into oxygen and hydrogen peroxide, is irradiated under white or red light irradiation conditions. Compared to the grown cabbage seedlings, the cabbage seedlings grown under blue light irradiation conditions increased more.

Through the above results, the increase in vitamin C content by blue light irradiation enhances the activity of superoxide dismutase (SOD), a ROS-scavenging enzyme, and eventually vitamin C by blue light irradiation It can be seen that the increase in content affects the antioxidant activity.

Therefore, by confirming an increase in the activity of superoxide dismutase (SOD) and a decrease in the content of hydrogen peroxide (H ₂ O ₂ ), increased vitamin C accumulation by blue light irradiation synergistically increases antioxidant activity It was found to induce.

Through the series of results, it was found that the vitamin C content of Chinese cabbage and sprouts was increased by irradiating LED single light of each LED light source, that is, white light, blue light, green light, and red light. In particular, it was found that blue light among the single LEDs significantly increases the vitamin C content of various cabbages and sprouts such as sprout cabbage, red radish sprouts, radish sprouts, and cheonggyeongchae. In addition, it was found that blue light induces the expression and activity of the ascorbate biosynthetic gene and ascorbate recycle gene of Chinese cabbage, thereby enhancing vitamin C accumulation and increasing antioxidant activity by activating major ROS-erasing antioxidant enzymes such as SOD. .

Accordingly, in enhancing the vitamin C content of cabbage and sprouts, high-quality crops can be developed through optimization of cultivation conditions and irradiation of LED light sources in a specific wavelength range rather than genetic manipulation.

<110> Republic of Korea <120> A method of increasing vitamin C in Brassicaceae sprout          vegetables by means of conditioning LED light source <130> P17R12C1011 <150> KR 10-2016-0151852 <151> 2016-11-15 <160> 112 <170> KoPatentIn 3.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PGI1_F <400> 1 cttctccttc tctcaaacag tcc 23 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PGI1_R <400> 2 taaaacgacc cgcaggag 18 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PGI3_F <400> 3 ggctgcacat ttgtcagaga 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PGI3_R <400> 4 caatgtccta gcgttcagca 20 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PMI1_F <400> 5 ggttgtcgac ggcgtctt 18 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PMI1_R <400> 6 actggagcca tcagcatcc 19 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PMI3_F <400> 7 gcgaattcgg atcaacca 18 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PMI3_R <400> 8 ggtgtttcag tttggatacg at 22 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PMM1_F <400> 9 tcaaaaagcc cggagtga 18 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PMM1_R <400> 10 acatgaacag agctttgcat tta 23 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PMM3_F <400> 11 gccaagaagc caggagtga 19 <210> 12 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PMM3_R <400> 12 acatgaatag agccttgcat ttc 23 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> GMP2_F <400> 13 atggaggagg aaggtaaaga aga 23 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GMP2_R <400> 14 tagaagcccc gctgctataa 20 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> GMP3_F <400> 15 atggagaaag aagaagcaag agtc 24 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GMP3_R <400> 16 atgatctctg gtttcgcaga c 21 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GMP4_F <400> 17 tggagttgat gaggtggtgt t 21 <210> 18 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> GMP4_R <400> 18 ttatgtagtc cttgggttgt cca 23 <210> 19 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> GMP5_F <400> 19 ggttgatgaa gtggttttga cag 23 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GMP5_R <400> 20 tcacgtggtt gaccaatgtc 20 <210> 21 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> GME1_F <400> 21 aagctcaaga tatcaatcac aggag 25 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GME1_R <400> 22 ttccgaaagg accgtaaatg 20 <210> 23 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GME2_F <400> 23 ccttccgaga agctgagga 19 <210> 24 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GME2_R <400> 24 ggtaaatgaa cgggtctgaa gc 22 <210> 25 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GGP1_F <400> 25 gaagccggtg gcttttctt 19 <210> 26 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> GGP1_R <400> 26 cttcggcagc catgtgaa 18 <210> 27 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> GGP3_F <400> 27 agactccgga gagaaagcta gag 23 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GGP3_R <400> 28 aggcatgcag ggtaagacct 20 <210> 29 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GGP4_F <400> 29 gatcagccac gaagctaaag a 21 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GGP4_R <400> 30 tctcctggag gcaaacacag 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GPP_F <400> 31 ggagggaggg aggatcaaat 20 <210> 32 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GPP_R <400> 32 tgagttcatg aggtgtgacc a 21 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GalLDH_F <400> 33 tggcatgaag cttgtcactc 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GalLDH_R <400> 34 tccctgctgt caggagtctt 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GLDH_F <400> 35 tggcatgaag cttgtcactc 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GLDH_R <400> 36 tcctgtcttt caacgcactg 20 <210> 37 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> AO2_F <400> 37 gcagcacatc gttaccaaca t 21 <210> 38 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> AO2_R <400> 38 caaccgttcg tcgaatgtc 19 <210> 39 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> AO3_F <400> 39 cacctacaaa ttcactgttg ataagc 26 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AO3_R <400> 40 tttggcagaa agaccgagtt 20 <210> 41 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> AO6_F <400> 41 gggttgaaca cgcttagcta ctt 23 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AO6_R <400> 42 gtaacggcgg attcttcaaa 20 <210> 43 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> APX2_F <400> 43 aatcaaggtt ccaaacatct gaa 23 <210> 44 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> APX2_R <400> 44 atagtgactg tagacgttgg tgtga 25 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> APX3_F <400> 45 cggtgccact cttcttcttc 20 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> APX3_R <400> 46 agcagcttta cccttcgtca 20 <210> 47 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> APX4_F <400> 47 gtctggcttc gatggacct 19 <210> 48 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> APX4_R <400> 48 tccctgagcc agaacagtg 19 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> APX6_F <400> 49 tgaggccaac agtggtatcc 20 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> APX6_R <400> 50 agaaaaaggc gtcctcatca 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> APX7_F <400> 51 ttgatgctga gcaaggtcac 20 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> APX7_R <400> 52 ttgtcggaaa caagctgaag 20 <210> 53 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> APX-R_F <400> 53 aggaagccaa gaaggagatt g 21 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> APX-R_R <400> 54 atcaggaccc aagaatgcag 20 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SAPX_F <400> 55 caccaccact atggcttcct 20 <210> 56 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SAPX_R <400> 56 ccgtagctgc tgtgcagtg 19 <210> 57 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TAPX_F <400> 57 ggacagtgaa atggctcaag t 21 <210> 58 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TAPX_R <400> 58 gttagtgggc aatggcttgt 20 <210> 59 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> DHAR3_F <400> 59 agcgacggat ccgagaag 18 <210> 60 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> DHAR3_R <400> 60 ttaggggtta accttgtgtt cc 22 <210> 61 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DHAR4_F <400> 61 agtgacggtc ctttgcttca 20 <210> 62 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DHAR4_R <400> 62 gtggagggag aacacagcat 20 <210> 63 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> MDHAR1_F <400> 63 acatgggtaa aggagtgaag tttatc 26 <210> 64 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> MDHAR1_R <400> 64 accgtcacaa gactcacaac tct 23 <210> 65 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MDHAR2_F <400> 65 atgagctcgt gactgcaatg 20 <210> 66 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MDHAR2_R <400> 66 aggtctagcg ccaacaccta 20 <210> 67 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> MDHAR4_F <400> 67 cagtgctaaa ggagtggagt tca 23 <210> 68 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MDHAR4_R <400> 68 gaggcttctc catcatcacc 20 <210> 69 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MDHAR5_F <400> 69 ccggattgtc tctttggtgt 20 <210> 70 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MDHAR5_R <400> 70 aaagctgatc ttcggggaat 20 <210> 71 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MDHAR6_F <400> 71 gcacatccaa atggagaggt 20 <210> 72 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MDHAR6_R <400> 72 caaacgagcg ggagtagaag 20 <210> 73 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GR1_F <400> 73 aagccacgga ggctcacta 19 <210> 74 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> GR1_R <400> 74 ttcctaaaga atagatccac tgtacca 27 <210> 75 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> GR2_F <400> 75 atgggtgttc cctatttcat ttc 23 <210> 76 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> GR2_R <400> 76 aatataagct ctcctgagaa tctggt 26 <210> 77 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GR3_F <400> 77 ggaggaagct acaaccgaga c 21 <210> 78 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> GR3_R <400> 78 aaatctacag tagcacccat tcca 24 <210> 79 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GR4_F <400> 79 tcaaaccacc gctactactc ct 22 <210> 80 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GR4_R <400> 80 cggaagagat ggtggaaaag 20 <210> 81 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Actin_F <400> 81 ctcagtccaa aagaggtatt ct 22 <210> 82 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Actin_R <400> 82 gtagaatgtg tgatgccaga tc 22 <210> 83 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrPGI1_F <400> 83 cttgcaaaag cgtgtgttgt 20 <210> 84 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrPGI1_R <400> 84 gcagacatgt gcgctatgat 20 <210> 85 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrPMI1_F <400> 85 tctgtgccag gtccttctct 20 <210> 86 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrPMI1_R <400> 86 tctgcaggca caaacagaac 20 <210> 87 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrPMM1_F <400> 87 atggaatgct caacgtgtca 20 <210> 88 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrPMM1_R <400> 88 cgaagttcag ccaccatctt 20 <210> 89 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrGMP1_F <400> 89 gcagtgggct aggattgaga 20 <210> 90 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrGMP1_R <400> 90 tgatctcctt gtgtggcaaa 20 <210> 91 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrGME1_F <400> 91 tggccgtaac tcagacaaca 20 <210> 92 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrGME1_R <400> 92 gcgacacatc actgccttta 20 <210> 93 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrGGP1_F <400> 93 aggaggagct tgaaggaacc 20 <210> 94 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrGGP1_R <400> 94 acaaggcact cagaggcagt 20 <210> 95 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrGPP_F <400> 95 gatggaactg aaagcggcta 20 <210> 96 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrGPP_R <400> 96 gcagagtcct cgtcatcctc 20 <210> 97 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrGalDH_F <400> 97 cgttccgaca aggcattaac 20 <210> 98 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrGalDH_R <400> 98 taacgtccac acttggttgc 20 <210> 99 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrGLDH_F <400> 99 tggcatgaag cttgtcactc 20 <210> 100 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrGLDH_R <400> 100 tcctgtcttt caacgcactg 20 <210> 101 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrAO6_F <400> 101 ggacggcgtt aaggtttgta 20 <210> 102 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrAO6_R <400> 102 caatccggtc tactccctca 20 <210> 103 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrAPX6_F <400> 103 aaggaactct tgagcggtga 20 <210> 104 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrAPX6_R <400> 104 agaaaaaggc gtcctcatca 20 <210> 105 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrMDHAR1_F <400> 105 gaaggtggga ccaaagaaca 20 <210> 106 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrMDHAR1_R <400> 106 acccgagtcc ttctctttcc 20 <210> 107 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrDHAR1_F <400> 107 cattggggca ttacaaggat 20 <210> 108 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrDHAR1_R <400> 108 tgcttgagct tgtgttttcg 20 <210> 109 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrGR3_F <400> 109 gaccggggat attttggttt 20 <210> 110 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrGR3_R <400> 110 ttggttgctc cacacttgag 20 <210> 111 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BrActin2_F <400> 111 ctcagtccaa aagaggtatt ct 22 <210> 112 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BrActin2_R <400> 112 gtagaatgtg tgatgccaga tc 22

Claims (9)

Seeding and germinating sprouts (Brassicaceae) sprout vegetable; And irradiating the germinated cabbage and sprout vegetables with LED single light by light amount (μmolm ^-2 s ^-1 );
The LED single light is any one or more selected from the group consisting of blue light, white light, green light and red light,
The light amount (μmolm ^-2 s ^-1 ) range is 125 μmolm ^-2 s ^-1 to 150 μmolm ^-2 s ^-1 ,
Method for increasing the vitamin C content of the cabbage and sprout vegetables, the treatment time of the LED single light is 5 to 10 days.
The method of claim 1, wherein the cabbage and sprout vegetables are at least one selected from the group consisting of Chinese cabbage, red radish radish, radish and bok choy, and increase the vitamin C content of Chinese cabbage and sprout vegetables.
delete The method of claim 1, wherein the LED single light is blue light.
delete A method for producing cabbage and sprout vegetables, wherein the vitamin C content is increased, including the method of any one of claims 1 to 2 and 4.
The method of claim 6, wherein the cabbage and sprout vegetables are at least one selected from the group consisting of Chinese cabbage, red radish radish, radish and bok choy.
Chinese cabbage and sprouts with increased vitamin C content produced by the method according to claim 6.
According to claim 8, wherein the cabbage and sprouts vegetables are cabbage, sprouts and radish, radish, and any one or more selected from the group consisting of bok choy, cabbage and sprouts.

Images