KR102082217B1 - Auxin-repressed gene of Brassica rapa and their uses - Google Patents

Abstract

The present invention relates to the inhibition of plant growth of the Chinese cabbage-derived BrARP1 gene and BrDRM1 gene, the growth of the transformed plant over-expressing the BrARP1 gene and BrDRM1 gene, respectively or together, so that the transformant is adversely affected by environmental and stress It can be used as a strong crop.

Description

Auxin-repressed gene of Brassica rapa and their uses

BrARP1 Isolated from Chinese Cabbage Gene and BrDRM1 gene.

Auxins are common growth-stimulating phytohormones, and are characterized by various plant phytohormones such as apical dominance, tropic response, side root formation, tube differentiation, seed formation, and elongation of young shoots. Regulates development and growth processes (Davies PJ (1995) Plant hormones: physiology, biochemistry and molecular biology, 2nd edn. Kluwer Academic Publishers, Dordrecht). These processes may be related to changes caused by the expression of many genes in which auxin is activated or inhibited. Auxin-activated genes include GH3 , SAUR and Aux / IAA families , as well as auxin response factors ( ARFs ) , and auxin-repressed protein ( ARP ) genes Glycine-rich protein 1. The ARP gene is closely related to the dormancy-associated protein 1 ( DRM ) gene, which forms the ARP / DRM gene family (Stafstrom JP, Ripley BD, Devitt ML, Drake B (1998) Dormancyassociated gene expression in pea axillary buds.Planta 205 (4): 547-552). Most molecular studies have focused on basic "response genes" such as up-regulation by auxin signals, while little is known about down-regulated genes by auxins.

It was isolated from; (DRM1 dormancy-associated protein 1 gene) is ssangjayeop plant and foreign plant leaves for the study of several dioxin-associated protein 1 gene-suppressed superfamily gene, for example tissue paper and ARP1. Strawberry ARP Expression of the gene ( SAR5 ) is usually suppressed during fruit development and this step is regulated by endogenous auxin. Peas DRM1 ( PsDRM1 ), Baby Pole Several dormant-associated genes, such as DRM1 and ARP1 ( AtDRM1 , AtARP1 ) and sorghum DRM1 ( SbDRM1 ), are expressed in dormant side eyes and their expression is inhibited by decapitation, auxin, and light. RpARP (Oxin-inhibited genes in soybean, acacia and acacia trees) are inversely related to both hypocotyls elongation and auxin use (Park S, Han KH (2003) An auxin-repressed gene (RpARP) from black locust (Robinia pseudoacacia) is posttranscriptionally regulated and negatively associated with shoot elongation.Tree Physiol 23 (12): 815-823). Tobacco ARP1 (ARPl1; 1) is highly expressed in pollen maturation, but decreased rapidly during Pollen Germination time. Abiotic stress up-regulates the expression of auxin suppressed genes in pepper and Arabidopsis. Although these previous studies have suggested that ARP1 and DRM1 maintain growth pauses and arrests , their functions are not known in transgenic and mutant plants.

When plants are exposed to adverse conditions and stress, they often respond by partially or completely inhibiting growth. This reaction is considered an adaptation strategy to enable plants to redistribute resources for survival and stress resolution (Xiong L, Zhu JK (2001) Abiotic stress signal transduction in plants: molecular and genetic perspectives. 2): 152-166).

Therefore, the present inventors used cabbage ( Brassica) which is an important agricultural product in East Asia. rapa L. ssp. pekinensis ) was confirmed to have both ARP1 and DRM1 , which was designated as BrARP1 and BrDRM1 , respectively. In addition, we confirmed the comprehensive expression patterns of Chinese cabbage BrARP1 and BrDRM1 under various growth and stress conditions, and inhibited plant growth by analyzing transgenic Arabidopsis plants after simultaneous overexpression or gene-removal (knockout) of genes. We confirmed the function.

An object of the present invention to provide an abiotic stress SEQ ID NO: 1 of BrARP1 vector for gene and / or inhibiting plant growth overexpressing BrDRM1 gene of SEQ ID NO: 2 in.

In addition, another object of the present invention to provide a transformed plant transformed with the vector.

In addition, another object of the present invention to provide a method for producing a plant is inhibited growth in abiotic stress conditions.

In order to achieve the above object, the present invention provides BrARP1 of SEQ ID NO: 1 in abiotic stress situation Provided is a plant growth inhibition vector that overexpresses a gene and / or BrDRM1 gene of SEQ ID NO: 2.

The present invention also provides a transgenic plant transformed with the vector.

In addition, the present invention provides a method for producing a plant in which growth is inhibited in an abiotic stress situation.

Since the abiotic BrARP1 gene and / or the transformed growth of the converted plant with a vector over-expressing the BrDRM1 gene of SEQ ID NO: 2 of SEQ ID NO: 1 over-expression by the stress suppression in Chinese cabbage of the present invention, the use of the two genes ratio When in a biological stress environment, unnecessary growth of the plant is suppressed, thus preventing damage to crops by abiotic stress.

1A is a Chinese cabbage and baby pole A comparison of the amino acid sequences of ARP1 and DRM1 ;
Black: matching amino acid sequence; And
Gray: similar sequences.
1B is a micrograph showing the intracellular location of BrARP1 and BrDRM1 ;
Bright field: optical micrograph (bright field);
Chlorophyll: using red fluorescent color representing chlorophyll;
GFP: using green fluorescent color; And
Comparative bar: 10 μm.
Figure 2 is a graph confirming the expression of BrARP1 , BrDRM1 and BrRPL27 in other tissues of Chinese cabbage ( Brassica rapa ssp. Pekinensis );
Floral bud I: <1 mm flower bud;
Floral bud II: flower buds of 1 to 3 mm; And
Floral bud III: Flower eyes> 3 mm.
Figure 3 shows the developmental, step-dependent expression of the auxin-inhibiting superfamily genes ( BrARP1 , BrDRM1 and BrRPL27) in the roots , embryos and cotyledons of Chinese cabbage;
A: Total RNA extracted from the cotyledons of 10 young plants at each stage 2, 3, 6, 8, 11, 13 and 15 days after germination (DAG); And
B: Levels of root and hypocotyl related mRNA expression cut in 5 mm segments from top to bottom.
4 is a diagram showing the expression of BrARP1 , BrDRM1 , BrRPL27 in Chinese cabbage leaves under various abiotic stress conditions;
Light chilling: low temperature stress;
Heat shock: high temperature stress; And
Salt: Salt stress.
Figure 5A is a photograph confirmed every 2 weeks after germination of the transformed Arabidopsis, knockout Arabidopsis and wild-type phenotype.
5B is a photograph confirming the morphology of the fifth leaf of the transgenic Arabidopsis, knockout Arabidopsis and wild type.
Figure 5C is a diagram measuring the size of the fifth leaf of the transgenic Arabidopsis, knockout Arabidopsis and wild type.
6A is a photograph comparing the root length traits of wild type and transgenic young Arabidopsis plants.
6B is a graphical representation of root length traits of wild type and transgenic young Arabidopsis plants.
Figure 6C is a diagram confirming the transcription level of BrARP1 and BrDRM1 in wild type and transgenic young Arabidopsis plants.
7 is BrARP1 - BrDRM1 and - over-expression in Arabidopsis is also confirming the inhibition of hypocotyl elongation;
NAA: naphthalene acetic acid.
8 is a graph quantifying seed germination of BrARP1 -overexpression and BrDRM1 -overexpression Arabidopsis.

Abbreviations used in the present invention are as follows.

ARP1: Auxin-repressed protein 1

DRM1: Dormancy-associated protein 1

RPL27: Ribosomal protein 27

ARF: Auxin response factor

ACT1: Actin 1

NAA: Naphthalene acetic acid

Br: Brassica rapa

At: Arabidopsis thaliana.

Hereinafter, the present invention will be described in detail.

The present invention provides an abiotic stress SEQ ID NO: 1 of BrARP1 vector for gene and / or inhibiting plant growth overexpressing BrDRM1 gene of SEQ ID NO: 2 in.

The recombinant vector preferably includes a herbicide resistant Bar gene, but is not limited thereto.

The vector preferably includes a promoter induced by abiotic stress, and may be SWPA4, but is not limited thereto.

The gene is Chinese cabbage ( Brassica rapa L. ssp. Pekinensis ) is an auxin-suppressing superfamily gene.

Auxin-repressed protein 1 ( ARP1 ) and ormancy-associated protein 1 ( DRM1 ) are highly expressed in dormant shoots and tissues that dormant in some plant species.

The abiotic stress refers to environmental stress, preferably low temperature, high temperature or osmotic stress, but is not limited thereto.

The term “vector” is used to refer to a DNA fragment (s), a nucleic acid molecule, that is delivered into a cell. Vectors can replicate DNA and be reproduced independently in host cells. The term "expression vector" is often used interchangeably with "recombination vector." The term “recombinant vector” refers to a recombinant DNA molecule comprising a coding sequence of interest and an appropriate nucleic acid sequence necessary to express a coding sequence operably linked in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.

Vectors of the present invention can typically be constructed as vectors for cloning or expression. In addition, the vector of the present invention can be constructed using prokaryotic or eukaryotic cells as hosts. For example, when the recombinant vector of the present invention is an expression vector and the prokaryotic cell is a host, a strong promoter (for example, a pLλ promoter, a trp promoter, a lac promoter, a T7 promoter, a tac promoter, etc.) capable of promoting transcription may be used. It is common to include ribosomal binding sites and transcription / detox termination sequences for initiation of translation.

On the other hand, vectors that can be used in the present invention are plasmids (eg, pSC101, ColE1, pBR322, pUC8 / 9, pHC79, pGEX series, pET series and pUC19, etc.) which are often used in the art, phage (e.g., λgt4.λB , λ-Charon, λΔz1 and M13, etc.) or viruses (eg SV40, etc.).

On the other hand, when the expression vector of the present invention is or a recombinant vector and the eukaryotic cell is a host, a promoter derived from the genome of the mammalian cell (e.g., a metallothionine promoter) or a promoter derived from a mammalian virus (e.g., : Adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter and tk promoter of HSV) can be used and generally have a polyadenylation sequence as a transcription termination sequence.

Vectors of the present invention may include antibiotic resistance genes commonly used in the art as optional markers, for example ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin And resistance genes for tetracycline and bastard herbicides.

In the vector of the present invention, the promoter may be a promoter induced by abiotic stress. The term "promoter" refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Constitutive promoters may be preferred in the present invention because selection of the transformants may be made by various tissues at various stages. The "promoter induced by abiotic stress" of the present invention is a promoter induced by abiotic stress, and refers to a promoter that causes overexpression of a gene in a disaster situation to which abiotic stress is applied.

In the vector of the present invention, conventional terminators can be used, for example nopalin synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens (Agrobacterium tumefaciens) Terminator of the octopine gene, etc., but is not limited thereto. With regard to the need for terminators, such regions are generally known to increase the certainty and efficiency of transcription in plant cells. Therefore, the use of terminators is highly desirable in the context of the present invention.

The present invention also provides a transgenic plant transformed with the vector.

The transgenic plant is BrARP1 And / or BrDRM1 gene is preferably over-expressed to inhibit the growth of the plant, it is more preferred that the two genes are over-expressed at the same time to suppress the growth of the plant, but is not limited thereto.

The transgenic plant is preferably, but not limited to, the growth of the plant when subjected to abiotic stress.

The abiotic stress is preferably low temperature, high temperature or osmotic stress, but is not limited thereto.

In addition, when transforming an expression vector of the present invention into eukaryotic cells, yeast ( Saccharomyce) as a host cell cerevisiae ), insect cells, human cells (eg, CHO cell lines (Chinese hamster ovary), W138, BHK, COS-7, 293, HepG2, 3T3, RIN and MDCK cell lines), plant cells and plants and the like can be used. The host cell is preferably a plant.

The method of transporting the expression vector of the present invention into a host cell includes a microinjection method, a calcium phosphate precipitation method, an electroporation method, a liposome-mediated transfection method, a DEAE-dextran treatment method, and a gene when the host cell is a eukaryotic cell. Vectors can be injected into host cells by Bamberbad, etc., preferably Agrobacterium-mediated transfection.

The expression vector will preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having properties that can be selected by chemical methods, which corresponds to all genes capable of distinguishing transformed cells from non-transformed cells. Examples include herbicide resistance genes such as glyphosate, glufosinate ammonium, or phosphinothricin, kanamycin, G418, bleomycin, hygromycin Antibiotic resistance genes such as, but not limited to, chloramphenicol.

Plant transformation refers to any method of transferring DNA to a plant. Such transformation methods do not necessarily have to have regeneration and / or tissue culture periods. Transformation of plant species is now common for plant species, including both dicotyledonous plants as well as monocotyledonous plants. In principle, any transformation method can be used to introduce hybrid DNA according to the invention into suitable progenitor cells. Method is calcium / polyethylene glycol method for protoplasts (Krens, FA et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987, Plant Mol. Biol. 8, 363-373), protoplasts Electroporation (Shillito RD et al., 1985 Bio / Technol. 3, 1099-1102), microscopic injection into plant elements (Crossway A. et al., 1986, Mol. Gen. Genet. 202, 179-185 ), (DNA or RNA-coated) particle bombardment of various plant elements (Klein TM et al., 1987, Nature 327, 70), Agrobacterium tumulopasis by plant infiltration or transformation of mature pollen or vesicles Appropriately selected from infection with (incomplete) virus (EP 0 301 316) in en mediated gene transfer. Preferred methods according to the invention include Agrobacterium mediated DNA delivery. Especially preferred is the use of the so-called binary vector technology as described in EP A 120 516 and US Pat. No. 4,940,838.

The plant according to the present invention is a food crop selected from the group consisting of rice, wheat, barley, corn, soybeans, potatoes, wheat, red beans, oats and sorghum; Vegetable crops selected from the group consisting of Arabidopsis, Chinese cabbage, radish, red pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, pumpkin, green onion, onion, and carrot; Special crops selected from the group consisting of ginseng, tobacco, cotton, sesame, sugar cane, sugar beet, perilla, peanut and rapeseed; Fruit trees selected from the group consisting of apple trees, pear trees, jujube trees, peaches, lambs, grapes, citrus fruits, persimmons, plums, apricots and bananas; Flowers selected from the group consisting of roses, gladiolus, gerberas, carnations, chrysanthemums, lilies and tulips; And fodder crops selected from the group consisting of lysis, redclover, orchardgrass, alphaalpha, tolsquescue and perennial lygragrass.

In addition, the present invention

1) preparing a vector comprising a BrARP1 gene of SEQ ID NO: 1 or a BrDRM1 gene of SEQ ID NO: 2; And

2) provides a method for producing a plant is inhibited growth in abiotic stress conditions comprising the step of transforming the plant with the vector introduced with the gene of step 1).

The vector preferably includes a promoter induced by abiotic stress, but is not limited thereto.

In addition, the present invention

1) preparing a vector comprising a BrARP1 gene of SEQ ID NO: 1;

2) preparing a vector comprising a BrDRM1 gene of SEQ ID NO: 2;

3) transforming the plant with the vector of step 1);

4) transforming the vector of step 2) to the plant transformed with the vector of step 3); And

5) Provides a method for producing a plant is inhibited growth in abiotic stress conditions comprising the step of selecting a transgenic plant overexpressing both BrARP1 gene and BrDRM1 gene.

The vector preferably includes a promoter induced by abiotic stress, but is not limited thereto.

In addition, the present invention

1) preparing a vector comprising a BrDRM1 gene of SEQ ID NO: 2;

2) preparing a vector comprising a BrARP1 gene of SEQ ID NO: 1;

3) transforming the plant with the vector of step 1);

4) transforming the vector of step 2) to the plant transformed with the vector of step 3); And

5) Provides a method for producing a plant is inhibited growth in abiotic stress conditions comprising the step of selecting a transgenic plant overexpressing both BrARP1 gene and BrDRM1 gene.

The vector preferably includes a promoter induced by abiotic stress, but is not limited thereto.

In a specific embodiment of the present invention, the inventors isolated the BrARP1 gene and BrDRM1 gene derived from Chinese cabbage and confirmed its sequencing and amino acid sequence, after inducing abiotic stress in the cabbage, the expression of BrARP1 gene and BrDRM1 gene It was confirmed that this is increased. In addition, it was confirmed that the growth of Arabidopsis transformed with the vector containing each of the genes was inhibited, and that the Arabidopsis pole overexpressed at the same time was further inhibited. However, when the two genes were knocked down, growth was not promoted, and the growth was similar to that of the wild type, indicating that the plant stopped growing and did not induce negative growth.

Therefore, the plants transformed with the vector comprising the BrARP1 gene and the BrDRM1 gene of the present invention are inhibited from growth in an abiotic stress situation, and thus usefully used as a plant in which overgrowth is suppressed in a situation in which growth is disadvantageous due to environmental stress. Can be used.

Hereinafter, examples will be described in detail to help understand the present invention. However, the following examples are merely to illustrate the content of the present invention is not limited to the scope of the present invention. The embodiments of the present invention are provided to more completely explain the present invention to those skilled in the art.

< Example  1> BrARP1  And BrDRM1 Sequence analysis

<1-1> BrARP1  And BrDRM1 of cDNA  Isolation and Sequence Similarity Analysis

The inventors compared the degree of similarity thereof after identification of the cDNA and BrARP1 BrDRM1.

Specifically, BrARP1 (SEQ ID NO: 1) was identified through cDNA microarray experiments involving hot-impact treatment of mature leaves in the Chiifu suburbs, BrDRM1 (SEQ ID NO: 2) was identified from the entire cDNA library of saline-treated cabbages. The isolated cDNA clones were arranged in an ABI 373091 autoarray (ArraDx, Craigavon, Northern Ireland). Similarity between DNA sequences was confirmed using the National Center for Biotechnology Information database / BLAST search program (http://www.ncbi.nlm.nih.gov).

As a result, ARP1 and DRM1 in both A. thaliana and Chinese cabbage Although the equivalence between was found to be relatively low, domains 1 and 2 were well conserved. In contrast, the equivalence of either ARP1 or DRM1 between Arabidopsis and cabbage is very high (FIG. 1A).

<1-2> Chinese cabbage BrARP1  And BrDRM1 Amino acid sequence analysis

We analyzed the amino acid sequences of BrARP1 and BrDRM1 .

Specifically, the homology of the amino acid sequences of BrARP1 and BrDRM1 was analyzed and aligned using the multisequence alignment program CLUSTAL W (1.82). The ARP / DRM family proteins used for sorting are BrARP1 ( B. rapa ARP1 , AAO32054) BrDRM1 ( B. rapa DRM1 ), AtARP1 ( Arabidopsis thaliana ARP1 , AAK32858) and AtDRM1 ( Arabidopsis thaliana DRM1 , NP_564305).

As a result, both the BrARP1 (FJ965338) and BrDRM1 (FJ965337) genes encode small peptide proteins (11.7 and 14.0 kDa proteins) at high isoelectric points (pIs; 9.52 and 9.10), and BrARP1 and BrDRM1 can encode cytosolic proteins. It was found that the organelle target and signal peptide sequences were indicative of their presence. In addition, the amino acid sequences of BrARP1 and BrDRM1 The Arabidopsis control group AtARP1 (At2G33830) and AtDRM1 (At1G28330) showed 93 and 90% similarity, respectively. Their high identity means that cabbage proteins can operate in the heterologous system of Arabidopsis plants. In addition, the identity between ARP1 and DRM1 in Chinese cabbage and Arabidopsis is low, with 53 and 63%, respectively (FIG. 1A).

<1-3> BrARP1 And BrDRM1  Locate your protein

We believe that BrARP1 And A GFP-vector was constructed to identify the location of the BrDRM1 protein in the plant.

Specifically, Chinese cabbage cDNA was PCR amplified using BrARP1- GFP primers (SEQ ID NOS: 3 and 4) and BrDRM1 -GFP primers (SEQ ID NOs: 5 and 6) of Table 1, followed by cloning into a pUC19-GFP3-containing vector. It became. The green fluorescent protein (GFP) complex was fused to the 3′-end of the gene to fit the frame and 30 μg of this DNA was introduced into the Arabidopsis protoplast. Protoplasts into which the genes were introduced were incubated for 24 hours at 22 ° C. in a dark condition, and then identified using fluorescence-microscopy and bright-field-microscopy.

As a result, BrARP1- GFP and BrDRM1- GFP were found to be located on the cytosol in Arabidopsis protoplasts (FIG. 1B).

SEQ ID NO: Primer sequence (5 '-> 3' 3 CGTACGGATCCATGTGGGATGA 4 GGTTCGGATCCACGGTGCTG 5 CGTACGGATCCATGGTTCTGCT 6 CGGCGGATCCTTTAATCCAC

< Example  2> in Chinese cabbage BrARP1  And BrDRM1 Expression Analysis

<2-1> Expression of BrARP1 and BrDRM1 in Various Tissues of Chinese Cabbage

We have identified qRT-PCR for BrARP1 and BrDRM1 expression at various stages of transcription in tissue to obtain basic functional information.

Specifically, BrRPL27 ( B. rapa ribosomal protein 27) (EST IdKFFB-141H09) and BrACT1 ( B. rapa actin 1 gene) (GenBank Accession Number FJ969844) were selected as growth markers and constitutively expressed-genes, respectively. BrARP1 , BrDRM1 , BrRPL27 , BrACT1 target primers of 80-90 bp fragments were designed via Primer Quest computer program (http://eu.idtdna.com/Scitools/Applications/Primerquest/) (SEQ ID NOs: 7 to Table 2) 14). After that, the cabbage ( Brassica) rapa ssp. whole RNA was extracted from the roots, hypocotyls and cotyledons of young plants grown for 7 days in pollen of pekinensis ), and total RNA was extracted from young, mature and flower tissues of 45-day-old plants. Cabbage cDNA from total RNA was synthesized according to the manufacturer's instructions using the iScript Select cDNA assay kit (BIO-RAD, BR170-8897). qRT-PCR was performed using MiniOption detection system (Bio-Rad, CFD-3120) and SYBR Green RT-PCR kit (IQ Sybr Green Super Mix, BR170-8880). Results were analyzed in BIORAD software (GeneXpression Macro Chromo4) using a comparative threshold cycle method, and expression was normalized to the reference gene BrACT1 according to manufacturer's instructions using data normalization. MRNA levels of BrACT1 were used in Korea.

As a result, the level of transcription of BrARP1 and BrDRM1 was higher in root, hypocotyl, mature leaves, petals and calyx compared to BrRPL27 , a growth-associated marker gene. In addition, although coarse leaves, young leaves, flower buds, stamens and anthers showed relatively low levels of BrARP1 and BrDRM1 , BrRPL27 levels were high, indicating that they were still growing. Overall transcription levels were low in pistils, stamens, anthers, petals, and calyxes, indicating low transcriptional activity, and the expression of BrARP1 and BrDRM1 was inversely related to BrRPL27 in various tissues (FIG. 2).

SEQ ID NO: primer  Sequence (5 '-> 3') 7 AGTAACATCGCCACCAGAGG 8 TCGTCGCTGTACAACCAGTC 9 CGTAAAATCACCACCCAACC 10 GTCGGCATAGTCAACGACCT 11 AGTTCGAGAAGTTTGGTCCCGACA 12 TCGACCGTAGCAGATGCAAGAACA 13 ACACCATGATGTCTTGGCCTACCA 14 AATGGTACCGGAATGGTCAAGGCT 15 CTAAGCCGGAGCATGGCCTT 16 GGCATGTCACTCCTTCCTCTCGAT 17 GGATAACGTGTGGAGGAGCGTC 18 GACTCAACCTCTCCACTTGCAAGTTAC 19 CTAAGCCGGAGCATGGCCTT 20 CGGCGACATGAAGCAAATAAAAG 21 GGATAACGTGTGGAGGAGCGTC 22 CTGTCTTCCCACCTAAGCAATGTG 23 GTCTTGACCTTGCTGGACGTGA 24 CCTTTCAGGTGGTGCAACGAC 25 GGGCTGCAGGAATTC 26 CAGGTCACCACTCACTATAGGGCGAAT 27 CGGCGGATCCATAAAATGGTTC 28 GCCCGTCTAGAGGGTTTTCATTT

<2-2> In young plants BrARP1  And BrDRM1 Expression of

We confirmed the expression of BrARP1 and BrDRM1 in young cabbage plants.

Specifically, Example <2-1> using total RNA extracted from the cotyledons of 10 young cabbage plants of each stage 2, 3, 6, 8, 11, 13, 15 days after germination (DAG) QRT-PCR was performed in the same manner. In addition, the total RNA was extracted from each of the 20 segments cut into 5 mm segments from the roots and hypocotyls of 20 young plants, and then qRT-PCR was performed. MRNA levels of BrACT1 were used in Korea.

As a result, the transcription levels of BrARP1 and BrDRM1 increased slowly during cotyledon development, but BrDRM1 did not change as much as BrARP1 (FIG. 3A). Transcription levels of BrRPL27 were mostly constant except for aging after 15 days of germination. The degree of stability of BrARP1 and BrDRM1 transcription in young plants grown for 72 hours in cancer conditions and 25 mm long axis is low in the upper part of the axis but high in the lower part. In contrast, in the upper part, the level of transcription of the BrRPL27 growth marker was high compared to the other part (FIG. 3B). The expression of BrARP1 and BrDRM1 was lower at the root end point and more kidneys could occur, but the change between points was not as large as BrARP1 . In contrast, BrRPL27 transcription levels preferentially increased in growing roots. These results indicate that the levels of BrARP1 and BrDRM1 are high in the plant region at the end of growth, and the expression of BrARP1 and BrDRM1 is negatively correlated with cotyledon development, hypocotyl extension, and root growth.

<2-3> Abiotic  Under stress conditions BrARP1  And BrDRM1 Expression of

We have confirmed the expression of BrARP1 and BrDRM1 in Chinese cabbage leaves under various abiotic stress conditions.

Specifically, 20 leaf disks (1 cm ² ) of cabbages grown for 45 days in a growth chamber at 22 ± 2 ° C. were subjected to 250 mM NaCl solution (salt stress), 4 ° C. (low temperature) or 42 ° C. (high temperature). 100 μmol photons / m ² s was exposed. Then total RNA was extracted from the leaf disk and qRT-PCR was performed by the method of Example <2-1>. MRNA levels of BrACT1 were referenced to domestic data.

As a result, when mature leaf discs were exposed to cold, heat shock, and salt stress, the transcription levels of BrARP1 and BrDRM1 were all increased, but the change in BrRPL27 was not as high as the auxin-inhibiting superfamily gene (FIG. 4). Thus, it can be seen that three types of abiotic stress promote the expression of BrARP1 and BrDRM1 genes and reduce BrRPL27 .

< Example  3> BrARP1  And BrDRM1  Transformation Arabidopsis Analysis

<3-1> BrARP1  And BrDRM1  Overexpression vector and transformant construction

The present inventors produced the vector containing the BrARP1 and BrDRM1 genes and transduced them into Arabidopsis.

Specifically, the full-length BrARP1 cDNA (GenBank Accession Number FJ965338) and BrDRM1 cDNA (GenBank Accession Number FJ965337) restriction position from the base sequence:;: BrARP1 containing (BrARP1 Nco I and Bst EII place BrDRM1 Bam HI and Xba I digit) And BrDRM1 The coding region was amplified by PCR using pBluescriptII KS (+) (Stratagene, USA) and primers (SEQ ID NOs 25-28 in Table 2). The amplified fragment was inserted between the nopalin synthase ( nos ) end of the modified pCambia3300 vector, which is a modified binary vector, and CaMV 35S-P ( 35S :: BrARP1 and 35S :: BrDRM1 ). The produced vector is Agrobacterium Agrobacterium tumefaciens strain GV3101), and transgenic genes were transformed into Arabidopsis (Ecology type, Columbia) by using general flower immersion method. 35S :: BrARP1 , 35S :: BrDRM1 Transformants were constructed and homogenous T ₃ with a single copy of each transgene Generation plants were maintained at 22 ° C. with a 16 hour photoperiod and the phenotype was analyzed according to the method described by Boyes et al. After that, BrARP1 And In order to produce Arabidopsis overexpressing both BrDRM1, 35S :: BrARP1 then transfected into a BrDRM1 plants, it was selected transgenic overexpression of both genes. Phenotypic analysis revealed three independent transgenic Arabidopsis of at least 20 wild-type plants and overexpressed BrARP1 or BrDRM1 . It was performed with the strain. The analysis was performed three times at three month intervals.

<3-2> ARP1  And DRM1  Knockout vector and transformant construction

The inventors knocked out the AtARP1 and AtDRM1 genes from Arabidopsis to confirm the effects of ARP1 and DRM1 genes knocked out.

Specifically, RNAi complexes were prepared by inserting two identical fragments of AtDRM1 cDNA in the opposite direction in the pSKint vector for Silence AtDRM1 expression. In AtDRM1 cDNA, the 399 bp fragment of AtDRM1 cDNA was amplified using a primer in which one of Xho I or Sal I was added at the 5 'end of the PCR product and one of Spe I or Pst I at the 3' end. PCR products were cleaved into pSKint by either Xho I or Sal I or Pst I in Spe I. The resulting AtDRM1- RNAi fragment results were released and subcloned into the Xho I and Spe I sites of binary vector pBA002. The final product was transferred to Agrobacterium ( A. tumefaciens GV3101 strain) and transformed into Arabidopsis by flower soaking. Three of the 14 transformants clearly reduced AtDRM1 RNA expression. double The line with the lowest AtDRM1 RNA expression was used for the experiment. In this manner, a transgenic Arabidopsis was knocked out of the AtARP1 gene.

In addition, the arp1 / drm1 double- knockout system was produced by crossing the same type of arp1 (male) and drm1 (female). Seeds obtained in the cross were germinated and grown until F ₁ was obtained. F ₁ generation was self-fertilized and F ₂ plants were selected using a Basa spray. DNA was extracted from 92 F ₂ generation plants with Basa-resistance. All arp1 / drm1 double gene deletion lines and Col-0 lines are AtARP1 And to analyze the presence or absence of AtDRM1 transcript by RT-PCR to select a knockout Arabidopsis.

< Example  4> BrARP1  or BrDRM1  Overexpressing Baby Pole and ARP1  And DRM1 gene Knockout  Phenotype Analysis of Arabidopsis

<4-1> ARP1  And DRM1 Knockout  Phenotype Verification

The inventors found that ARP1 and DRM1 inside the Arabidopsis pole The phenotype of the transformant with the gene knocked out was confirmed.

Specifically, knockout mutants ( arp1 , drm1 and arp1 / drm1 ) from which ARP1 and DRM1 genes were removed from Arabidopsis all had a phenotype similar to wild-type plants (FIG. 5A), which neither increased maximum size nor accelerated growth. Removal of growth-lowering protein is shown. A good sample for phenotypic analysis to clarify the relationship between growth rate or final plant size and two protein (ARP, DRM1) levels. Leaf length, petiole length, leaf length and leaf epidermal cell size were measured at day 42 to confirm the growth of the fifth leaf. After 5 weeks (35 days), leaf growth reached a stop phase in all plants. ARP1 and DRM1 gene knockout Arabidopsis did not accelerate growth and showed growth similar to their wild type (FIG. 5C).

Thus, the presence of both proteins has a brake-like effect, but when removed, they return to their original state, so both proteins are believed to be related to the "braking effect" in plant growth and final size.

<4-2> BrARP1  or BrDRM1  Confirmation of overexpressed Arabidopsis growth

We have identified the growth of transgenic Arabidopsis overexpressing BrARP1 and BrDRM1 .

Specifically, the overall growth of BrARP1 -overexpression and BrDRM1 -overexpressing Arabidopsis plants was delayed and further decreased over time. Double overexpression had an additional effect on growth reduction. The bolting time was not significantly different, and as a result, the total number of leaves in the flower bell was less in BrARP1 -overexpression and BrDRM1 -overexpression plants. Once the flowering stage begins, the kidneys are significantly inhibited in BrDRM1 -overexpressing plants ( 35S :: BrARP1 , 35S :: BrDRM1 in FIG. 5A). And 35S :: BrARP1 / 35S :: BrDRM1 ). Number of lateral shoots; Number and length of siliques; Number of seeds per silk; And seed weights were even more reduced in the overexpressing Arabidopsis. Among them, the length and the final number of the silks were greatly reduced to 30% and 20%, respectively. The number of seeds per plant was also reduced from 24 to 28% in overexpressed Arabidopsis (Table 3). These data mean that overexpression of BrARP1 or BrDRM1 reduces both plant growth and reproductive growth.

^a Data was recorded at the maturity of the plant. The results are expressed as ± SD (n = 20).

^b Results are expressed as ± SD (n = 20). Measurements were made on 5 silks / plants (n = 10).

<4-3> BrARP1  or BrDRM1  Leaf Growth Measurement of Overexpressed Arabidopsis

We measured the growth of BrARP1 or BrDRM1 overexpressing Arabidopsis in leaves.

Specifically, the plants were incubated for 30 days in long-day (16-h light / 8-h cancer) conditions in 2.5-inch pollen. To confirm the growth of the leaves of the transformants, the fifth leaf growth (leaf length, petiole length, leaf length, epidermal cell size) in the pollen was measured on day 42.

As a result, The quantitative increase of BrARP1, BrDRM1 or both resulted in a decrease in leaf growth from the beginning to the end of development, resulting in a decrease in final size. This reduction is BrARP1-BrDRM1 than overexpression body-expression of both the larger and, two genetic material from the over-expression have shown a synergistic effect (Fig. 5B and C). The length, width, weight, and area of the leaves were used to It was reduced by 11 to 59% in plants. Petiole length is BrARP1 44% and BrDRM1 in overexpressed Arabidopsis plants 111% reduction in overexpression Arabidopsis (FIG. 5C and Table 4).

SD: standard deviation.

^{The a} measurement was made at the fifth left lobe. The results are expressed as ± SD (n = 20).

^{The b} measurement was made from 30 epidermal cells of the fifth explant fifth left lobe.

<4-4> BrARP1  or BrDRM1  Checking Cell Size in Overexpressed Arabidopsis

We confirmed the cell size of the transformants.

Specifically, after cutting two to three fifth lobes of each transformant, at least five epidermal tissues were obtained at the central half point of the leaf between the attachment point and the tip. The obtained epidermal tissue was observed by placing on a microscope slide and a cover. Leaf area and hypocotyl cell area were measured using a shared NIH Image 1.61 program (National Institutes of Health, Bethesda, MD, USA). The experiment was repeated three times and the data combined.

As a result, the epidermal cell size BrARP1 - was found to be overexpressed in Arabidopsis thaliana 18% less (Table 4) over-expression in Arabidopsis thaliana, 13% and BrDRM1.

<4-5> BrARP1  or BrDRM1  Root Growth Measurement of Overexpressed Arabidopsis

We measured the growth of BrARP1 or BrDRM1 overexpressing Arabidopsis in the roots.

Specifically, by using reverse transcription polymerase chain reaction (RT-PCR) analysis, BrARP1 and BrDRM1 and endogenous genes To confirm the expression of AtARP1 , AtDRM1, and AtACT1 , total RNAs were extracted from young transgenic Arabidopsis using TriZol reagents, and Arabidopsis actin gene ( Atidae pole actin gene; AtACT1 ) was used as a loading control. . 30 min at 45 ° C., then 5 min at 94 ° C. according to the Access Reverse Transcription-PCR System (Promega, WI, USA) using the primers set forth in Table 2 (SEQ ID NOS: 15-24); RT-PCR was performed under conditions that the cycle was repeated for 30 seconds at 94 ° C., 30 seconds at 55 ° C., 1 minute at 72 ° C., and finally extended at 72 ° C. for 7 minutes.

In addition, seeds were sown in M5 medium as described above for root growth determination of the transformants. After 3 days of cold treatment, the plates were placed vertically in the growth chamber and root growth was measured on 4 day old plants.

As a result, root growth was overexpressed in BrARP1 and BrDRM1- Baby pole More than 50% in all plants 6A and B), the decrease correlated with an increase in BrARP1 and BrDRM1 expression levels (FIG. 6C), suggesting that BrARP1 and BrDRM1 are functional in Arabidopsis plants.

<4-6> BrARP1  or BrDRM1  Overexpressing Baby Pole Axle  Growth measurement

We measured the growth of BrARP1 or BrDRM1 overexpressed Arabidopsis in embryonic axis.

Specifically, the measurement of the hypocotyl length of the transgenic Arabidopsis is with or without naphthalene acetic acid (NAA); Cold-treated at 4 ° C. for 3 days; It was performed after seeding evenly on MS medium adapted for 4 days at dark condition 22 ℃. Axle length was measured directly via ImageJ 1.40 software (NIH-Image; http://rsbweb.nih.gov/ij/index.html).

As a result, hypocotyl elongation was also reduced by 37-40% when grown in dark in BrARP1 and BrDRM1-overexpressing plants, and this inhibition was more rapid in the presence of NAA (FIG. 7). These results indicate that both BrARP1 and BrDRM1 inhibit hypocotyl elongation.

Thus, overexpression of either BrARP1 or BrDRM1 indicates inhibition of leaf growth, which may be attributed to inhibition of cell elongation or reduction of cell expansion.

<4-7> BrARP1  or BrDRM1  Seed germination of overexpressed Arabidopsis

We have identified seed germination properties of BrARP1 or BrDRM1 overexpressing Arabidopsis.

Specifically, seeds of BrARP1 or BrDRM1 overexpressing Arabidopsis (35S :: BrARP1 and 35S :: BrDRM1 ) were grown under the same conditions and collected at the same time. Homogeneous seeds were surrounded on a Petri dish with MS medium. Plates were refrigerated at 4 ° C. for 3 days and then transferred to 22 ° C. growth chamber under dark conditions. The rate of seed germination was recorded 4 days after the end of absorption. Germination has been defined as the clearing of young roots through the epidermis.

As a result, seed germination was delayed in both 35S :: BrARP1 and 35S :: BrDRM1 Arabidopsis plants, but longer in BrDRM1 -overexpression (FIG. 8).

<110> The Industry & Academic Cooperation in Chungnam National University (IAC) <120> Auxin-repressed gene of Brassica rapa and their uses <130> p130089 <160> 28 <170> KopatentIn 2.0 <210> 1 <211> 597 <212> DNA <213> Brassica rapa <400> 1 atggcgattg caacatccat gagtttgaat ctaattggag cattcaaagg cctatccctc 60 tcttcaacct cgtctttcct aagaggcgat ttgaatctaa acccaaaaac ctccttcact 120 gtgacactcc ctttggaaaa actccaagct ccggttccat tgacgattga atctgcgcac 180 aagaaaggag ccggtagtac taagaacggt cgtgattctc cgggacaaag actcggcgtc 240 aagatttacg gtgaccaagt cgctaaacca ggggccatca tcgttcgtca acgtggcact 300 aagttccatg ctggaaagaa cgttgggatt ggtaaagatc ataccatctt ctctttaatc 360 gatgggttag tcaagttcga gaagtttggt cccgacagga agaagattag tgtgtaccca 420 agggaaattg tgccagagaa tcccaacagt tacagggcaa gaaagagaga agcttttaga 480 gtgcaaaggg agaagaagaa ggccagacgc gagaactaca cttacacact tcctacccct 540 gagcttgttc ttgcatctgc tacggtcgat gatgaggaaa ccaatgccga ttgctga 597 <210> 2 <211> 387 <212> DNA <213> Brassica rapa <400> 2 atggttctgc tagataagct ttgggatgat gttgttgccg gacctcaacc tgaccgtggc 60 ctagcccgcc tccgtaaaat caccacccaa cccattaata tcagaggaga aggaagcaac 120 aaggtgatgc ataggtcgtt gactatgccg acggtagtga gccccggaac tccaactact 180 ccgaccactc cgacaacgcc acataaggat aacgtgtgga ggagcgtctt taatcctgga 240 agcaatctcg ccacaagagc catcggctcc aacatctttg ataaaccagc ccacccaaat 300 tctccatccg tctacgactg cgatgataac gaagctcaaa ggaaggaaca cgtggcactg 360 tgtttagtag gcgcgtggat taaatga 387 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BrARP1-GFP forward primer <400> 3 cgtacggatc catgtgggat ga 22 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrARP1-GFP reverse primer <400> 4 ggttcggatc cacggtgctg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrDRM1-GFP forward primer <400> 5 ggttcggatc cacggtgctg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrDRM1-GFP reverse primer <400> 6 cggcggatcc tttaatccac 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrARP1 qRT-PCR forward primer <400> 7 agtaacatcg ccaccagagg 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrARP1 qRT-PCR reverse primer <400> 8 tcgtcgctgt acaaccagtc 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrDRM1 qRT-PCR forward primer <400> 9 cgtaaaatca ccacccaacc 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrDRM1 qRT-PCR reverse primer <400> 10 gtcggcatag tcaacgacct 20 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> BrRPL27 qRT-PCR forward primer <400> 11 agttcgagaa gtttggtccc gaca 24 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> BrRPL27 qRT-PCR reverse primer <400> 12 tcgaccgtag cagatgcaag aaca 24 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> BrACT1 qRT-PCR forward primer <400> 13 acaccatgat gtcttggcct acca 24 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> BrACT1 qRT-PCR reverse primer <400> 14 aatggtaccg gaatggtcaa ggct 24 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrARP1 RT-PCR forward primer <400> 15 ctaagccgga gcatggcctt 20 <210> 16 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> BrARP1 RT-PCR reverse primer <400> 16 ggcatgtcac tccttcctct cgat 24 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BrDRM1 RT-PCR forward primer <400> 17 ggataacgtg tggaggagcg tc 22 <210> 18 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> BrDRM1 RT-PCR reverse primer <400> 18 gactcaacct ctccacttgc aagttac 27 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AtARP1 RT-PCR forward primer <400> 19 ctaagccgga gcatggcctt 20 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> AtARP1 RT-PCR reverse primer <400> 20 cggcgacatg aagcaaataa aag 23 <210> 21 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AtDRM1 RT-PCR forward primer <400> 21 ggataacgtg tggaggagcg tc 22 <210> 22 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AtDRM1 RT-PCR reverse primer <400> 22 ctgtcttccc acctaagcaa tgtg 24 <210> 23 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AACT1 RT-PCR forward primer <400> 23 gtcttgacct tgctggacgt ga 22 <210> 24 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> AACT1 RT-PCR reverse primer <400> 24 cctttcaggt ggtgcaacga c 21 <210> 25 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> 35S :: BrARP1 forward primer <400> 25 gggctgcagg aattc 15 <210> 26 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> 35S :: BrARP1 reverse primer <400> 26 caggtcacca ctcactatag ggcgaat 27 <210> 27 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 35S :: BrDRM1 forward primer <400> 27 cggcggatcc ataaaatggt tc 22 <210> 28 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 35S :: BrDRM1 reverse primer <400> 28 gcccgtctag agggttttca ttt 23

Claims (12)

Plant growth inhibition vector overexpressing the BrDRM1 gene of SEQ ID NO: 2 in abiotic stress situations.
The vector for inhibiting plant growth according to claim 1, wherein the vector comprises a promoter induced by abiotic stress.
Transgenic plant transformed with the vector of claim 1.
The transgenic plant of claim 3, wherein the transgenic plant is overexpressed in the BrDRM1 gene of SEQ ID NO: 2 in abiotic stress conditions, thereby inhibiting plant growth.
The transgenic plant of claim 4, wherein the abiotic stress is low temperature, high temperature or osmotic stress.
1) preparing a vector comprising a BrDRM1 gene of SEQ ID NO: 2; And
2) A method for producing a plant, the growth of which is inhibited in abiotic stress conditions comprising the step of transforming the plant with the vector introduced with the gene of step 1).
The method of claim 6, wherein the vector of step 1) comprises a promoter induced by abiotic stress.
1) preparing a vector comprising a BrARP1 gene of SEQ ID NO: 1;
2) preparing a vector comprising a BrDRM1 gene of SEQ ID NO: 2;
3) transforming the plant with the vector of step 1);
4) transforming the vector of step 2) to the plant transformed with the vector of step 3); And
5) A method for producing a plant, wherein growth is inhibited in abiotic stress conditions, comprising selecting a transgenic plant that overexpresses both the BrARP1 gene and the BrDRM1 gene.
The method of claim 8, wherein the vector of step 1) or 2) comprises a promoter induced by abiotic stress.
1) preparing a vector comprising a BrDRM1 gene of SEQ ID NO: 2;
2) preparing a vector comprising a BrARP1 gene of SEQ ID NO: 1;
3) transforming the plant with the vector of step 1);
4) transforming the vector of step 2) to the plant transformed with the vector of step 3); And
5) A method for producing a plant, wherein growth is inhibited in abiotic stress conditions, comprising selecting a transgenic plant that overexpresses both the BrARP1 gene and the BrDRM1 gene.
The method of claim 10, wherein the vector of step 1) or 2) comprises a promoter induced by abiotic stress. The vector for inhibiting plant growth according to claim 1, wherein the plant growth inhibition vector further overexpresses the BrARP1 gene of SEQ ID NO: 1.

Images