KR102062980B1 - Amplified double-stranded DNA detection method and apparatus using the same - Google Patents

Abstract

The present invention is a DNA detection method, wherein the DNA detection method, the isothermal amplification of the double-stranded DNA and the step of detecting the amplified double-stranded DNA is carried out simultaneously or sequentially in one chamber (Chamber), the double The isothermal amplification of the strand DNA is performed by an amplification reaction with a forward primer and a reverse primer, and the ends of the forward primer are labeled with a material friendly to the forward primer binding layer applied to the electrode, and the amplified double stranded DNA is The detecting may include: (a) generating a conjugate by binding of the amplified double-stranded DNA to a protein that specifically binds to the double-stranded DNA; And (b) the electrons are transferred to the electrode by the oxidation-reduction reaction of the redox marker and the electron mediator attached to the conjugate, and the DNA is detected by the difference in the electron transfer rate of the electron transfer mediator. step; Including, but the detection is a DNA detection method and apparatus using the same, which does not require a denaturation (Denaturation) step of the amplified double-stranded DNA.

Description

Amplified double-stranded DNA detection method and apparatus using the same

The present invention is a DNA detection method, wherein the DNA detection method, the isothermal amplification of the double-stranded DNA and the step of detecting the amplified double-stranded DNA is carried out simultaneously or sequentially in one chamber (Chamber), the double The isothermal amplification of the strand DNA is performed by an amplification reaction with a forward primer and a reverse primer, and the ends of the forward primer are labeled with a material friendly to the forward primer binding layer applied to the electrode, and the amplified double stranded DNA is The detecting may include: generating a conjugate by binding the amplified double-stranded DNA and a protein that specifically binds to the double-stranded DNA; And moving the electrons to the electrode by the oxidation-reduction reaction between the redox marker and the electron mediator attached to the conjugate, and detecting the DNA by the difference in the electron transfer rate of the electron transfer medium. Including, but the detection, DNA denaturation (Denaturation) step of the amplified double-stranded DNA, relates to a DNA detection method and apparatus using the same.

Molecular diagnostics play an important role in disease diagnosis and pathogen identification. For such molecular diagnosis, a method of detecting a selective nucleic acid (nucleic acid) in a short time with high sensitivity has been developed in the past. However, the molecular diagnostic techniques developed to date are not suitable for point-of-care testing requiring simple and fast detection (Craw, P .; Balachandran, W. Lab Chip 2012, 12 , 2469). . The biggest reason for not being suitable for in situ testing is the need for fast and precise temperature controlled circulation when detecting using polymerase chain reaction (PCR), which is most commonly used for nucleic acid amplification. (Li, J .; Macdonald, J. Biosens. Bioelectron. 2015, 64 , 196).

In recent years, attempts to apply isothermal amplification to molecular diagnosis have been increasing in order to overcome the above-mentioned problems of temperature control. Representative isothermal amplification methods include recombinase polymerase amplification (RPA), loop-mediated isothermal amplification (LAMP), and helicase-dependent amplification (HDA). In addition, the detection used for on-the-spot inspection should be capable of high-sensitivity measurement using a small device, and therefore, the detection by electrochemical signal is suitable.

Of course, there have been attempts to detect nucleic acids by a combination of isothermal amplification and electrochemical measurements, but conventional detection methods do not measure electrochemical signals immediately after the amplification reaction of nucleic acids. Electrochemical measurements are made after having an incubation period. In addition, all of these attempts required a washing process or a purification process. The washing or purification process is a process necessary for non-specifically removing a label attached to the electrode surface and removing interfering species present in the sample. This cleaning or purification process can provide a low background level to increase the accuracy of the detection, but it can complicate the entire detection process and increase the overall detection time, thus requiring on-the-spot inspections that require fast and simple detection. It is not suitable for the purpose. In addition, washing specific intensity may affect biospecific binding, thereby affecting the reproducibility of detection results. That is, an isothermal amplification reaction and an electrochemical measurement are combined, and development of a method for detecting nucleic acid with high sensitivity in a fast time is required.

In order to detect biomolecules quickly and without washing, a method using a mediation rate of an electron mediator that exchanges electrons between an electrode and a redox enzyme label may be applied. Can be. (Dutta, G .; Kim, S .; Park, S .; Yang, H. Anal. Chem. 2014 , 86 , 4589; Dutta, G .; Park, S .; Singh, A .; Seo, J .; Kim, S .; Yang, H. Anal.Chem . 2015 , 87 , 3574-3578). However, such an electron mediated method cannot be easily used for the detection of amplified double stranded DNA using conventional DNA hybridization. Conventional hybridization detection requires denaturation of double-stranded DNA into single-stranded DNA. The denaturation process requires a high temperature and is therefore not suitable for simple inspection because of the large temperature change required. If the amplified double-stranded DNA is denatured to form single-stranded DNA, recombination of the original complementary single-stranded DNA with higher affinity between the single-stranded DNA prior to denaturation, rather than binding to the complementary probe supplied. There is a problem that is easy.

The present invention aims to enable simultaneous or sequential isothermal amplification reaction and amplified DNA detection in one chamber using a protein that specifically binds to double stranded DNA. It is also an object that denaturation of the double stranded DNA amplified for detection is not required separately. It also aims to detect amplified double-stranded DNA using the mediated rate difference of the electron transfer mediator between the electrode and the redox marker, so that no separate washing procedure is required.

However, the problem to be solved by the present invention is not limited to the above-mentioned problem, another task that is not mentioned will be clearly understood by those skilled in the art from the following description.

According to one embodiment of the invention, in the DNA detection method, the DNA detection method, the isothermal amplification of the double-stranded DNA and the step of detecting the amplified double-stranded DNA simultaneously or sequentially in one chamber (Chamber) Isothermal amplification of the double-stranded DNA, the amplification reaction by a forward primer and a reverse primer, the ends of the forward primer is labeled with a material friendly to the forward primer binding layer applied to the electrode, Detecting the amplified double-stranded DNA, the combination of the amplified double-stranded DNA and a protein that specifically binds to the double-stranded DNA to produce a conjugate and the redox marker attached to the conjugate and the electron The electrons are transferred to the electrode by the oxidation-reduction reaction of the electron mediator, and the electron transfer rate of the electron transfer medium Comprising the step of detecting DNA by the said detection, this will be a, DNA detection method that does not require a modification (Denaturation) phase of the amplified double-stranded DNA is provided separately.

According to one side, the protein that specifically binds to the double-stranded DNA may be a zinc finger protein.

According to one side, the zinc finger protein may be any one or more selected from the group consisting of Zif268, TFIIIA, GAGA and Ros.

According to one side, the isothermal amplification reaction is recombinase polymerase amplification (RPA), loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HDA), Any of rolling circle amplification (RCA), multiple displacement amplification (MDA), strand displacement amplification (SDA), and nucleic acid sequence-based amplification (NASBA) It can be one.

According to one side, the DNA detection method, may be one that does not require a washing process during detection.

According to one side, the redox markers are glucose oxidase, glycerol-3-phosphate dehydrogenase, ascorbate oxidase, horseradish oxidase, soybean oxidase, lacage, bilirubin oxidase, tyro It may be any one selected from the group consisting of synages, gold nanoparticles, silver nanoparticles, platinum nanoparticles, iridium nanoparticles, palladium nanoparticles, Prussian blue nanoparticles, and combinations thereof.

According to one side, the electron transfer mediator is Ru (NH ₃ ) ₆ ³⁺ , Ru (NH ₃ ) ₆ ²⁺ , Fe (CN) ₆ ^3- , Fe (CN) ₆ ^4- , Ru (NH ₃ ) ₅ (pyridine) ³⁺ , Ru (NH ₃ ) ₅ (pyridine) ²⁺ , ferrocene, ferrocene methanol, ferrocene carboxylic acid, Os (bpy) ₂ Cl ₂ ³⁺ , Ox (bpy) ₂ Cl ₂ ²⁺ and combinations thereof It may be any one selected from the group consisting of.

According to one side, the step of detecting the amplified double-stranded DNA, including two or more kinds of electrodes, may be to detect two or more kinds of amplified DNA through each electrode at the same time without interference between the electrodes.

According to one side, the electrode is a tin oxide (ITO) electrode, a tin oxide electrode coated with graphene (grapheme), a tin oxide electrode coated with carbon nanotube, carbon electrode, gold electrode, silver It may be any one selected from the group consisting of electrodes, Ag / AgCl electrodes, platinum electrodes, and combinations thereof.

According to one side, it may be a DNA detection device for detecting a double-stranded DNA amplified using the above-described DNA detection method.

According to the present invention, a protein that specifically binds to double-stranded DNA can be used to detect amplified double-stranded DNA without a separate denaturation step, thereby enabling quick and simple detection. In addition, electrochemical signal detection can occur during or after an isothermal amplification reaction in one chamber, enabling amplified DNA detection in a short time. Moreover, since the median speed difference of the electron transfer mediator is used, the amplified DNA can be detected without a separate washing process, thereby reducing the loss of DNA.

1 schematically depicts amplified double stranded DNA detection using proteins that specifically bind to double stranded DNA.
Figure 2 schematically shows two amplified double stranded DNA detections using proteins that specifically bind to double stranded DNA.
Figure 3 schematically shows the detection of amplified double stranded DNA using zinc finger protein according to an embodiment of the present invention.
Figure 4 schematically shows the detection of DNA amplified by RPA using Zif268 according to another embodiment of the present invention.
FIG. 5 shows experimental data of electron transfer mediated effects of Zn ²⁺ for binding Zif268 to double-stranded DNA.
FIG. 6 shows data of nonspecific adsorption of GOx-Zif268 conjugates on ITO modified electrodes.
7 is data for experiments on RPA amplification specificity of target DNA and detection selectivity of amplified target DNA.
8 is a graph showing the experimental results of amplifying the DNA of Pissirikesia salmonis and detecting it without washing.

Hereinafter, exemplary embodiments will be described in detail with reference to the accompanying drawings. However, various changes may be made to the embodiments so that the scope of the patent application is not limited or limited by these embodiments. It is to be understood that all changes, equivalents, and substitutes for the embodiments are included in the scope of rights.

The terminology used herein is for the purpose of description and should not be construed as limiting. Singular expressions include plural expressions unless the context clearly indicates otherwise. In this specification, terms such as "comprise" or "have" are intended to indicate that there is a feature, number, step, operation, component, part, or combination thereof described on the specification, and one or more other features. It is to be understood that the present invention does not exclude the possibility of the presence or the addition of numbers, steps, operations, components, components, or a combination thereof.

Unless defined otherwise, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art. Terms such as those defined in the commonly used dictionaries should be construed as having meanings consistent with the meanings in the context of the related art, and shall not be construed in ideal or excessively formal meanings unless expressly defined in this application. Do not.

In addition, in the description with reference to the accompanying drawings, the same components will be given the same reference numerals regardless of the reference numerals and duplicate description thereof will be omitted. In the following description of the embodiment, if it is determined that the detailed description of the related known technology may unnecessarily obscure the gist of the embodiment, the detailed description thereof will be omitted.

Terms used in the present invention may be defined as follows.

The term "denaturation" in the present invention means that the complementary binding of the double stranded DNA is broken to form two single stranded DNA.

In the present invention, the term “modified electrode” refers to an electrode to which a forward primer binding layer is added by applying a forward-friendly material and a binding friendly material to the electrode.

As used herein, the term “forward primer binding layer” refers to a monolayer artificially designed to bind to a forward primer used in an isothermal amplification reaction.

Hereinafter, terms that are not defined otherwise in the present specification have the meanings commonly used in the art to which the present invention belongs.

In the DNA detection method according to an embodiment of the present invention, the step of isothermally amplifying double stranded DNA and detecting the amplified double stranded DNA are simultaneously or sequentially performed in one chamber. The isothermal amplification of DNA is an amplification reaction by a forward primer and a reverse primer, and the ends of the forward primer are labeled with a material friendly to the forward primer binding layer applied to the electrode, and the amplified double-stranded DNA is detected. The step of (a) generating a conjugate by combining the amplified double-stranded DNA and a protein that specifically binds to the double-stranded DNA; And (b) the electrons are transferred to the electrode by the oxidation-reduction reaction of the redox marker and the electron mediator attached to the conjugate, and the DNA is detected by the difference in the electron transfer rate of the electron transfer mediator. step; Including, but the detection is that does not require a denaturation step of the amplified double-stranded DNA separately.

In the following description and drawings, a protein that specifically binds to double stranded DNA is referred to as a double stranded DNA binding protein.

During the isothermal amplification of the double stranded DNA, the amplified step and the detecting step can proceed simultaneously because the amplified double stranded DNA can be detected whenever an amplified double stranded DNA is generated. In addition, even after all isothermal amplification is completed, amplified double-stranded DNA that is not detected may be detected, and thus may proceed sequentially. Here, the step of isothermally amplifying the double stranded DNA is by means of a reverse primer and an end-labeled forward primer supplied to the chamber. In addition, in order to detect the electrochemical signal by amplifying the double-stranded DNA adjacent to the electrode, the material labeled at the end of the forward primer is preferably a material having high affinity with the forward primer binding layer applied to the working electrode. When at least one double stranded DNA is amplified in the chamber by an isothermal amplification reaction, the step of detecting the amplified double stranded DNA is performed. The amplified double stranded DNA is adjacent to the electrode by binding of the forward primer end and the forward primer binding layer, and specifically binds to the double stranded binding protein to generate a bond. At this time, the double-stranded DNA binding protein is bonded in the state in which the redox marker is attached, and the distance between the electrode and the redox marker is changed depending on the presence or absence of the binding. When a conjugate is formed by binding to amplified double-stranded DNA, the electron transfer mediator is reduced by an oxidation-reduction marker at a position adjacent to the electrode and repeats the process of oxidizing again while transferring electrons to the working electrode. It has a fast medium speed. On the other hand, when it does not bind to the amplified double stranded DNA, the double stranded DNA binding protein that does not bind to the amplified double stranded DNA is not adjacent to the electrode, and thus has a relatively slow mediating speed. In other words, when amplified double-stranded DNA is present, the electron transfer rate is increased by a fast medium speed, so that a high electrochemical signal can be detected at the electrode.

According to one side, the electron transfer medium is Ru (NH ₃ ) ₆ ³⁺ , Ru (NH ₃ ) ₆ ²⁺ , Fe (CN) ₆ ^3- , Fe (CN) ₆ ^4- , Ru (NH ₃ ) ₅ (pyridine) ³⁺ , Ru (NH ₃ ) ₅ (pyridine) ²⁺ , ferrocene, ferrocene methanol, ferrocene carboxylic acid, Os (bpy) ₂ Cl ₂ ³⁺ , Ox (bpy) ₂ Cl ₂ ²⁺ and combinations thereof It may be any one selected from the group consisting of.

According to one side, the redox markers are glucose oxidase, glycerol-3-phosphate dehydrogenase, ascorbate oxidase, horseradish oxidase, soybean oxidase, laccase, bilirubin oxidase, tyrosine Nase, gold nanoparticles, silver nanoparticles, platinum nanoparticles, iridium nanoparticles, palladium nanoparticles, Prussian blue nanoparticles and combinations thereof.

According to one side, the double-stranded DNA binding protein may be a zinc finger protein. Zinc finger proteins are capable of binding to double stranded DNA or RNA-DNA hybrids with high affinity and are thus readily used for detecting double stranded DNA. The zinc finger protein used in the present invention is Cys ₂ His ₂ -type zinc finger protein, which has a relatively high amount of guanine, which does not bind well to single-stranded DNA, and binds strongly to double-stranded DNA. . Zinc finger proteins of the Cys ₂ His ₂ -type mediate the binding of various protein-DNAs and protein-proteins. In addition, the zinc finger domain of the Cys ₂ His ₂ -type is a small, self-folding protein structure, which is generally conserved between cysteine or histidine amino acids. zinc) adjusts the binding of ions Due to this motif (motif) can form a ββα structure, it is possible to further obtain stability by combining with zinc ions (Zn ²⁺ ).

According to one side, the zinc finger protein of the present invention may be any one or more selected from the group consisting of Zif268, TFIIIA, GAGA and Ros.

According to one side, the isothermal amplification reaction is recombinase polymerase amplification (RPA), loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HDA), Any one of rolling circle amplification (RCA), multiple displacement amplification (MDA), strand displacement amplification (SDA), and nucleic acid sequence-based amplification (NASBA) It may be that. Any suitable isothermal amplification method can be selectively used among the isothermal amplification reactions listed according to the type of DNA and the primer to be targeted. Examples described below describe the experiments by isothermally amplifying the target DNA with RPA. .

Detecting amplified double-stranded DNA that proceeds concurrently or sequentially with an isothermal amplification reaction is made possible by the amplified double-stranded DNA adjacent to the electrode due to the high affinity present between the forward primer end label and the forward primer binding layer described above. do. At this time, the electrode in the chamber is an indium tin oxide (ITO) electrode, a tin oxide electrode coated with graphene, a tin oxide electrode coated with carbon nanotube, a carbon electrode, a gold electrode, a silver electrode It may be any one selected from the group consisting of Ag / AgCl electrode, platinum electrode and a combination thereof. In addition, two or more kinds of the listed electrodes can be selected, and two or more kinds of amplified DNA can be detected simultaneously through each electrode without interference between the electrodes. Even if the redox marker is bonded to one electrode and the mediating speed is increased, the redox marker has little effect on the current of neighboring electrodes, thereby enabling simultaneous detection without interference. In this case, it is preferable that two or more selected electrodes are patterned on one substrate in the chamber, and the forward primer bonding layers applied to the respective electrodes are different materials. A method of detecting two different amplified double-stranded DNAs using a mediated velocity difference by an electron transfer medium will be described later with reference to FIG. 2.

According to one side, the DNA detection device may be using the above-described DNA detection method. In this case, the DNA detection device is preferably made of a suitable material in accordance with the above description.

1 schematically illustrates the detection of amplified double stranded DNA using a protein that specifically binds to double stranded DNA.

1 shows a forward primer binding layer by an electron transfer mediator in an isothermal amplification chamber supplied with double stranded DNA binding protein, reverse primer, forward primer, electron mediator, substrate and template DNA to which redox markers are linked. The process of transferring electrons to the coated electrode is shown schematically. The supplied template DNA is subjected to an amplification reaction by a reverse primer and a forward primer, and the amplified double stranded DNA specifically binds to the double stranded DNA binding protein to which the redox marker is linked. This specific binding eliminates the need for a separate denaturation step, allowing the isothermal amplification reaction and signal detection to occur simultaneously in one chamber. In addition, the forward primer is end-labeled with a material having a high affinity with the forward primer binding layer, and serves to fix a double-stranded DNA binding protein connected to an redox marker that binds to the amplified double-stranded DNA near the electrode. do. Here, the redox markers oxidize the substrate to obtain electrons, and use the obtained electrons to reduce the electron transfer mediator. The reduced electron transfer mediator repeats the process of reoxidation by transferring electrons to the electrode, resulting in an electrochemical signal. At this time, depending on whether the amplified double-stranded DNA binding, the distance between the electrode and the redox marker is changed, the speed of the mediation of the electron transfer medium to exchange electrons between the electrode and the redox marker. Oxidation-reduction markers labeled on double-stranded DNA binding proteins that specifically bind to amplified double-stranded DNA are present near the electrode, thus exhibiting relatively high mediation rates and double-stranded DNA that does not bind to amplified double-stranded DNA. Oxidation-reduction markers labeled on the binding protein are farther away from the electrode and exhibit relatively small mediation rates. By using this speed difference, the amplified product of the target DNA can be selected, and the DNA amplified rapidly without washing can be detected.

Figure 2 schematically shows two amplified double stranded DNA detections using proteins that specifically bind to double stranded DNA.

2 illustrates an isothermal amplification chamber in which two electrodes are included in one substrate, a first forward primer binding layer is applied to a first electrode, and a second forward primer binding layer is applied to a second electrode. The chamber includes a double-stranded DNA binding protein linked to the redox marker, a first target DNA template, a second target DNA template, a first reverse primer, a second reverse primer, a first forward primer, a second forward primer, and an electron transfer medium. And substrates. Here, the first target DNA template isothermally amplified by the first reverse primer and the first forward primer, and the second target DNA template isothermally amplified by the second reverse primer and the second forward primer. In this case, the end of the first forward primer is labeled with a material having a high affinity with the first forward primer binding layer applied to the first electrode, and the end of the second forward primer is a second forward primer binding applied to the second electrode. It is labeled with a material having a high affinity for the layer. Here, the process of detecting the electrochemical signal using the electron transfer medium velocity difference by the electron transfer medium is the same as described above in FIG. However, when detecting a signal using the median speed difference, in order to minimize interference between two electrodes, the material of the first forward primer end label and the first forward primer binding layer may be formed of the second forward primer end label and the second forward primer binding layer. It must be different from the material. More preferably, the affinity between the terminal label of the first forward primer and the second forward primer binding layer and the affinity between the terminal label of the second forward primer and the first forward primer binding layer are better. According to the foregoing, two or more kinds of amplified DNA may be detected in one chamber.

Figure 3 schematically shows the detection of amplified double stranded DNA using zinc finger protein according to an embodiment of the present invention.

FIG. 3 includes only the difference of using a zinc finger protein as a double-stranded DNA binding protein, and includes the same configuration as that of FIG. 1. The zinc finger protein used herein may be any one or more selected from the group consisting of Zif268, TFIIIA, GAGA, and Ros. However, the kind is not necessarily limited to the contents listed above.

The following describes the amplified double-stranded DNA detection method according to an embodiment of the present invention with the accompanying drawings.

Example. Detection and Characterization of Double-stranded DNA Amplified with RPA Using Glucose Oxidates (GOx), Ferrocenemethanol, and Zif268

4 schematically illustrates the detection of double stranded DNA isothermally amplified with RPA using Zif268.

In Figure 4, to detect the amplified double-stranded DNA, the target DNA is the DNA of Piscirichechia Salmonis, Zif268 as the double-stranded DNA binding protein, glucose oxidase (GOx) as the redox marker, substrate Glucose and ferrocenemethanol were used as electron transfer mediators. Biotin was used as a material labeled at the end of the forward primer, and neutravidin, an avidin analog having high affinity with Biotin, was used as the forward primer binding layer applied to the electrode.

Amplified DNA detection method as shown in Figure 4 is as follows. The zinc finger protein Zif268, a double stranded DNA binding protein, is linked with glucose oxidase (GOx) as an oxidation-reduction marker and isothermally amplified by a reverse primer and a forward primer. Herein, the forward primer is labeled at the end of biotin, which is binding-friendly with avidin.

Then, the base sequence of the material used in the experiment described is shown in Table 1 below.

matter Base sequence Length Forward
primer
5'- biotin-CGACAACGGCGACAGTATTAGCACAAGCAATTATTC -3 '
36 mer Reverse
primer
5'- CTGTGCACGGTGTAGATAAGTCTTTTAATGCAG -3 '
33 mer
Pissirikechea
Salmonis 5'- CGACAACGGCGACAGTATTAGCACAAGCAATTATTC AAGAAGGCGTGAAGTCTGTTG
CTGCCGGCATGAACCCAATGGACCTAAAACGCGGCATCGATAAAGCCACTATCGCTG
CAGTTG CTGCATTAAAAGACTTATCTACACCGTGCACAG -3 '
153 bp
Nonspecific
primer
5'-biotin-ATG AGT ATA AAT AGT AGA AGT TGT GCT AGA GAT AAA AG-3 '
38 mer
Random sequence
5'-agaatagctaagatccatagatcagaaatctgtgaacgtaggaaaatctgtgaa
cgtaggaaaagaatagctaagatccatagatcagaatgtgtcctgtcc-3 '
102 bp

ITO, a tin oxide electrode, is used as the working electrode, and the avidin analog, neutravidin, is applied to the forward primer binding layer. The neutravidin has high affinity with labeled Biotin at the end of the forward primer so that the amplified double-stranded DNA is located near the electrode. Thus, Zif268 and its labeled glucose oxidase (GOx), which specifically bind to amplified double stranded DNA, are also located close to the electrode. Glucose, a substrate, is transported to glucose oxidase (GOx) as it is oxidized to glucose by glucose oxidase (GOx), and the oxidized ferrocenemethanol obtains electrons and is in reduced form by glucose oxidase (GOx). . Thereafter, the reduced ferrocenemethanol transfers electrons to the electrode and repeats the redox process in such a manner that the reduced ferrocenemethanol becomes an oxidized form. The repetition of this process generates a high electrochemical signal on the electrode, and the median velocity of the electron transfer mediator, which transfers electrons from the GOx-Zif268 conjugate away from the electrode, is significantly slowed down, resulting in a very low level of signal. This difference in mediation rate can detect the desired amplified DNA. Experiment to detect the amplified DNA on the same principle as described above was carried out.

1. Expression and Purification of Zif268

Zif268 was cloned into the bacterial expression vector Pmal-c2X and expressed using N-terminal maltose binding protein (MBP) as a purification tag. Zif268 expressed in Escherichia coli BL21 (Invitrogen) was purified as previously reported.

2. Preparation of Glucose Oxidates (GOx) -Zif268 Conjugate

Glucose Oxidates (GOx) -Zif268 conjugates were also prepared according to previously reported procedures.

First, a HEPES buffer containing Zn ²⁺ was used to maintain the Zif268 structure during conjugation. Mix 1 mL of HEPES containing 100 μg / mL Zif268 and 50 μL of HEPES buffer (including 1 mg / mL sulfo-SMCC (sulfosuccinimidyl 4- [N-maleimidomethyl] cyclohexane-1-carboxylate)) at 22 ± 2 ° C Incubate for 30 minutes. Sulfo-SMCC conjugated to Zif268 was filtered through a 10K centrifugal filter at 13500 g for 20 minutes to remove the remaining sulfo-SMCC, and the filtrate was dissolved in 1 mL of HEPES buffer.

Thereafter, 1 ml of HEPES buffer containing 280 μg / mL glucose oxidase (GOx) and 10 μl of HEPES buffer containing 2 mg / ml SATP were mixed, and the mixture was incubated at 22 ± 2 ° C. for 30 minutes. . The resulting solution was mixed with 20 μL of a deacetylation solution (HEPES buffer) containing 0.012 g / mL EDTA and 0.044 g / mL hydroxyl amine hydrochloride for 2 hours at 22 ± 2 ° C., followed by a 30 K centrifugal filter Was filtered through. Filter for 20 minutes at 13500 g to remove excess deacetyl solution. The remaining filtrate was dissolved in 1 mL of HEPES buffer.

The solution containing the conjugate of Zif268 and sulfo-SMCC and the SATP-GOx conjugate were mixed at a molar ratio of 1: 1 at 22 ± 2 ° C. for 2 hours. To filter GOx-Zif268 in the mixed solution, the final mixture was filtered through a 30 K centrifugal filter at 13500 g for 20 minutes. Finally, the remaining solution was dissolved in 1 mL of TZ buffer and stored as an aliquot at -20 ° C.

3. Sensor Preparation

Pretreatment by dipping the ITO electrode (1 × 2 cm) in a mixed solution of H ₂ O, H ₂ O ₂ (30%) and NH ₄ OH (30%) at 70 ° C. for 1 hour at a volume ratio of 5: 1: 1 It was. To obtain neutravidin-, streptavidin- and avidin- modified ITO electrodes, 10 μg / mL of neutravidin, streptavidin and avidin 70 μL of carbonate buffer (50 mM, pH 9.6) each containing was incubated at 20 ° C. for 2 hours on a pretreated ITO electrode. After blocking the electrode for 30 minutes at 20 ℃ with 70 μL blocking buffer, and stored in the refrigerator at 4 ℃ before use.

4. Preparation for No Clean DNA Detection

The electrochemical cell was assembled with ITO sensing electrode, Ag / AgCl (3M NaCl) reference electrode and platinum counter electrode. The exposed area of each ITO electrode was about 0.28 cm ² . Lyophilized RPA pellets were dissolved in ultrapure distilled water and then DTT (electrically active interference species) was removed using a 3K centrifugal filter. The remaining filtrate was suspended in 29.5 μL of rehydration buffer per pellet before use.

To detect RPA amplified double stranded DNA without washing, 100 μL of TZ buffer containing 1 mM ferrocene methanol, 100 μL of TZ buffer containing 50 mM glucose, 740 μL of TZ buffer, 2.4 μL of 10 μM biotin terminated forward primer 47.5 μL of the mixed solution was placed in a microporous tube, and resuspension containing 2.4 μL of 10 μM reverse primer, 13.2 μL of ultrapure distilled water solution containing different copy numbers of DNA template, and 29.5 μL of filtrate. RPA reaction was initiated by the addition of quenching buffer and 2.5 μL of Mg (CH ₃ COO) ₂ solution. At this time, the copy number was calculated as in Equation 1 below.

[Equation 1]

Thereafter, the mixture was mixed by vortexing and incubated at 37 ° C.

The cultured sample solution was soon vortexed for another 5 minutes and then injected into an assembled electrochemical cell with 10 μL of 10 μg / mL GOx-Zif268 conjugate at a final volume of 1 mL. The resulting concentrations of the GOx-Zif268 conjugate, ferrocene methanol, glucose, biotin-terminal forward primer and reverse primer were 0.1 μg / mL, 0.1 mM, 5 mM, 24 nM and 24 nM, respectively. Cells filled with 1 mL volume were further incubated at 37 ° C. for 10 min before electrochemical measurements (CH Instruments, Austin, TX, USA).

5. Confirmation of gel electrophoresis of double stranded DNA isothermally amplified with RPA

RPA reactions were performed in a solution consisting of 2.4 μL biotin terminal forward primer, 2.4 μL reverse primer, 13.2 μL 0.1 ng / μL DNA (temporal DNA or nonspecific random sequence DNA from Piscirickettsia Salmonis) and 29.5 μL of rehydration buffer. . The RPA reaction was initiated by vortexing after adding 2.5 μL of Mg (CH ₃ COO) ₂ solution to a final volume of 50 μL. The final solution was incubated at 37 ° C. for 5 minutes and then mixed again by short vortexing for 5 minutes. RPA amplified solution (50 μL) was purified according to the manufacturer's instructions (PCR Clean-up kit from NucleoSpin® Gel).

5 is a data showing the results of experiments on the electron transfer mediated effect of the TZ buffer (containing Zn ²⁺ ) used to maintain the binding of Zif268 and double-stranded DNA.

(I) to (iii) of FIGS. 5A and 5B, respectively, (i) when only 100 μM of ferrocene methanol was supplied, and (ii) 100 μM of ferrocene methanol was supplied with 5 μM of glucose, (iii) 100 In the case of μM ferrocene methanol, 5 μM glucose and 200 μM / ml glucose oxidase (GOx) supplied, the cases of (i) to (iii) were subjected to cyclic votammetry and chronocoulometry. ) Shows the results of the experiment.

The experiment of FIG. 5A is a graph measured by cyclic voltammetry using the detection method of FIG. 4 and recorded at a scan rate of 20 mV / s. Referring to the graph (i) of FIG. 5A, it can be seen that the ferrocene methanol exhibits reversible electrochemical behavior at the ITO electrode through fast external electron transfer through a cyclic voltage current graph obtained from a TZ buffer solution containing ferrocene methanol. have. Referring to the graph (ii) of FIG. 5A, the cyclic voltage current graph obtained from the TZ buffer containing ferrocene methanol and glucose is similar to that of FIG. 5A, but in the graph (iii) of FIG. 5A, the ferrocene methanol, glucose and The amount of current in the cyclic voltage current graph obtained in the TZ buffer containing glucose oxidase (GOx) was measured high. These results indicate that the direct reaction between ferrocene methanol and glucose was not very slow or occurred, and the electron transfer mediation of ferrocene methanol proceeds rapidly in TZ buffer.

FIG. 5B shows that ferrocene methanol acts as an electron transfer mediator by glucose and redox marker glucose oxidase (GOx), in an ITO electrode applied 0.13V voltage to TZ buffer solution at 37 ° C. The results of measuring chronocoolometry are shown graphically. As shown in FIG. 5B, low charges are measured in case of (i) of FIG. 5B in which only ferrocene methanol is present or in case of (ii) of FIG. 5B in which only glucose is added, but ferrocene methanol, glucose and glucose are measured. In (iii) of FIG. 5B in which all of the oxidases (GOx) exist, data in which the amount of charge is rapidly increased can be obtained. Based on the data obtained, it was confirmed that the direct redox reaction between ferrocene methanol and the substrate glucose was very slow or did not occur. In addition, in the graph (iii) of FIG. 5B, when glucose oxidase (GOx) is present, the signal measured over time increases substantially, indicating that the electron-mediated velocity is high regardless of the presence of Zn ²⁺ . I could confirm that

6 is data showing the results of experiments on the non-specific adsorption of the GOx-Zif268 conjugate on the ITO-modified electrode.

First, a strained electrode was made by applying a forward primer bonding layer to an electrode. The materials used as the forward primer binding layer were all avidin analogs (neutravidin, streptavidin and avidin), which were used to generate neutravidin-modified electrodes, streptavidin-modified electrodes and avidin-modified electrodes. The resulting three electrodes showed different nonspecific bindings because each of the three avidin analogs had different PI values (neutravidin = 6.3, streptavidin = -5-6 and avidin = 10, respectively).

In FIG. 6, (i) is used as a control, (ii) to (vii) is used as a control, and (ii) is used as neutravidin as a binding layer in order to compare the difference of nonspecific adsorption at each modified electrode. In case (iii) is supplied with forward primer to (ii), (iv) is used with streptavidin as binding layer, (v) is supplied with forward primer to (iv), (vi In the case of using avidin as the binding layer, (vii) is a case where the forward primer is supplied to (vi) together, the results of the experiment are shown graphically. As a result, the high amount of charge was measured in the streptavidin modified electrode and the avidin modified electrode, it was confirmed that a high level of non-specific adsorption occurred. On the other hand, in the case of (ii) and (iii) it was confirmed that the low non-specific adsorption was not significantly different from the control. Therefore, in the verification experiment according to an embodiment of the present invention, the ends of the forward primers were labeled with biotin, and the electrodes were amplified DNA detection using a neutravidin-modified electrode.

FIG. 7 shows data showing the results of experiments on RAP amplification specificity of target DNA and detection selectivity of amplified target DNA using the present invention.

FIG. 7A shows a chronocoolometry graph measured at 100 seconds after application of a potential of 0.13V at 37 ° C. in a TZ buffer (PH 8.5) after RPA reaction. In the case of (i) to (v), respectively, the control group (i) is supplied with only specific primers, (ii) is supplied with non-specific primers and target DNA, and (iii) is specific primers and calf thymus When DNA is supplied, (iv) is supplied with specific primers and random sequence DNA, (v) is supplied with specific primers and target DNA, and the experiment amplifies and detects DNA under different conditions. Proceeded. As shown in the graph, it can be seen that (i) to (iv) measured similar levels of charge, but in the case of (v), very high levels of charge were measured. This means that in case of supplying the target DNA and specific primers complementarily binding thereto, the amplified DNA can detect a much higher signal than the non-target DNA, so that interference of signals from other materials can be ignored. do. That is, it can be said that the data demonstrates that the selectivity of detection of this invention using a target DNA and a specific primer is very high.

In Figure 7b is the data confirming the RPA amplification specificity of the target DNA through gel electrophoresis. Lanes 1 to 4, lane 1 is a marker, lane 2 is 0.1ng / μL of target DNA before amplification, lane 3 is an RPA amplification product containing target DNA, and lane 4 is RPA of random sequence DNA without target DNA. As amplification product, gel electrophoresis was performed to confirm amplification specificity of RPA amplification reaction and target DNA, and amplification of target DNA while no band was observed in lane 4 where only nonspecific random sequence DNA was present In lane 3, a clear band was observed. That is, it was confirmed by gel electrophoresis of FIG. 7B that the RPA reaction was specific for the target DNA template.

Figure 8 is a graph of the experimental results of amplifying the DNA of Pissirikesia Salmonis detected by no-clean.

Figure 8a is a graph showing the results of measuring the time versus charge of the double-stranded DNA amplified Pissirichechia Salmonis DNA as a template. The isothermal amplification of the template DNA was performed in the same manner as in the above-described example. Immediately after 15 minutes of isothermal amplification reaction, chronocoulometry was measured with different initial copy numbers on ITO electrodes applied 0.13V to 37 ° C TZ buffer solution without any incubation period. It is shown in Figure 8a. Looking at the graph, it can be seen that the amount of change of the charge (tilt) increases with time, and as the number of copies increases, the amount of change of the charge also increases.

FIG. 8B is a correction plot graph using charge data recorded at 100 seconds in the chronocoolometry graph of FIG. 8A. The measurements were repeated seven times for zero concentration and three times with different sensing concentrations for the same sample. The amount of charge for each initial copy number was calculated without the average value for zero concentration. The graph indicated by the dotted line shows three times the standard deviation of the chronocoolometry measurements for zero concentration. The calculated detection limit was measured in about 13.2 μL 300 copies, it was confirmed that the high sensitivity detection of the amplified DNA using the above-described example.

Although the embodiments have been described with reference to the accompanying drawings, those skilled in the art may apply various technical modifications and variations based on the above. For example, the described techniques may be performed in a different order than the described method, and / or components of the described systems, structures, devices, circuits, etc. may be combined or combined in a different form than the described method, or other components. Or, even if replaced or substituted by equivalents, an appropriate result can be achieved.

Therefore, other implementations, other embodiments, and equivalents to the claims are within the scope of the following claims.

Claims (10)

By DNA detection method,
In the DNA detection method, isothermal amplification of the double-stranded DNA and detecting the amplified double-stranded DNA are simultaneously or sequentially performed in one chamber,
Isothermal amplifying the double stranded DNA is an amplification reaction by a forward primer and a reverse primer,
Detecting the amplified double stranded DNA,
(a) combining the amplified double-stranded DNA with a protein that specifically binds to the double-stranded DNA to produce a conjugate; And
(b) the electrons are transferred to the electrode by the oxidation-reduction reaction of the redox marker and the electron mediator attached to the conjugate, and the DNA is detected by the difference in the electron transfer rate of the electron transfer mediator. ; Including but not limited to:
Wherein said detection does not require a denaturation step of the amplified double stranded DNA separately. The method of claim 1,
The protein that specifically binds to the double-stranded DNA is a zinc finger protein, DNA detection method. The method of claim 2,
The zinc finger protein is any one or more selected from the group consisting of Zif268, TFIIIA, GAGA and Ros, DNA detection method. The method of claim 1,
The isothermal amplification reaction, recombinase polymerase amplification (RPA), loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HDA), rotation ring amplification ( DNA, either rolling circle amplification (RCA), multiple displacement amplification (MDA), strand displacement amplification (SDA), or nucleic acid sequence-based amplification (NASBA) Detection method. The method of claim 1,
The DNA detection method does not require a washing process during detection. The method of claim 1,
The redox markers include glucose oxidase, glycerol-3-phosphate dehydrogenase, ascorbate oxidase, horseradish oxidase, soybean oxidase, lacage, bilirubin oxidase, tyrosinase, gold DNA detection method, any one selected from the group consisting of nanoparticles, silver nanoparticles, platinum nanoparticles, iridium nanoparticles, palladium nanoparticles, Prussian blue nanoparticles and combinations thereof. The method of claim 1,
The electron transfer mediator is Ru (NH ₃ ) ₆ ³⁺ , Ru (NH ₃ ) ₆ ²⁺ , Fe (CN) ₆ ^3- , Fe (CN) ₆ ^4- , Ru (NH ₃ ) ₅ (pyridine) ^{3 +} , Ru (NH ₃ ) ₅ (pyridine) ²⁺ , ferrocene, ferrocene methanol, ferrocene carboxylic acid, Os (bpy) ₂ Cl ₂ ³⁺ , Ox (bpy) ₂ Cl ₂ ²⁺ and combinations thereof Any one selected, DNA detection method. The method of claim 1,
The detecting of the amplified double-stranded DNA includes two or more kinds of electrodes, and simultaneously detects two or more kinds of amplified DNA through each electrode without interference between the electrodes. The method of claim 1,
The electrode may be a tin oxide (ITO) electrode, a tin oxide electrode coated with graphene, a tin oxide electrode coated with carbon nanotube, a carbon electrode, a gold electrode, a silver electrode, Ag / DNA detection method, any one selected from the group consisting of AgCl electrode, platinum electrode and combinations thereof. delete

Images