KR102035654B1 - Novel mutant insect cell line producing antimicrobial peptide or a preparation method thereof - Google Patents

Abstract

The present invention relates to a mutant insect cell line that produces an antimicrobial peptide or a method for producing the same. In the present invention, a cactus gene of the Bm 5 silkworm ovary cell line is cut through gene editing technology using guide RNA and Cas9 protein to induce overexpression of antimicrobial peptides such as lysozyme, moricin, lebocin 1 and the like, thereby providing a method for mass production of antimicrobial peptides in a natural state different from recombinant proteins.

Description

Novel mutant insect cell line producing antimicrobial peptide or a preparation method

The present invention relates to a mutant insect cell line or a method for producing the same that produces an antimicrobial peptide.

Gene editing technology originates from the adaptive immunity of microorganisms. The bacteriophage infection started with an immune system that remembers fragments of bacteriophage as DNA and then cuts it back with Cas9 (CRISPR associated protein 9: RNA-guided DNA endonuclease enzyme), a nuclease that acts as a genetic scissors when reinfected. .

This has led to the development of genetic correction technology that can cut and fix the desired site if specific nucleotide sequences can be recognized by the guide RNA (gRNA) in the genome (Woo JW et al., 2015), and beyond the genes that have been separated into incurable diseases. BACKGROUND OF THE INVENTION Induced diseases have been spotlighted as a method of treating the root cause of a disease or a method of producing a transformed cell or animal causing permanent gene mutations.

The inventors of the present invention have been studying a method for producing antimicrobial substances from mutant insect cells through gene editing without transformation and immune response, and due to mutations in the Cactus gene, lysozyme, moricin, The present invention was completed by confirming that overexpression of antimicrobial peptides such as lebocin 1 (lebocin 1).

Republic of Korea Patent Publication No. 10-2015-0096064 (Invention: Method of recognizing the AAS1 position in the chromosomes of MCDC II cells and introducing foreign genes stably here, Applicant: Seoul National University Industry-Academic Cooperation Foundation, Publication Date: Aug 24, 2015 Republic of Korea Patent Publication No. 10-2001-0074351 (Invention: Expression vector for transforming insect cell lines and transformants for producing antibacterial protein containing the same, Applicant: Republic of Korea, published date: August 04, 2001)

PLOS ONE, 2014, 9 (7), e101210. Heritable Genome Editing with CRISPR / Cas9 in the Silkworm, Bombyx mori., PLOS ONE, 2014, 9 (7), e101210.

It is an object of the present invention to provide a mutant insect cell line or a method for producing the same that produces an antimicrobial peptide.

The present invention relates to a mutant insect cell line, characterized in that the expression of mRNA or protein of the gene is inhibited due to mutation of the Cactus gene.

The insect cell line is characterized in that obtained by inserting the guide RNA and Cas9 protein comprising the nucleotide sequence of SEQ ID NO: 2.

SEQ ID NO: CUCACUUUAGGUAAUGCCUA

The insect cell line may be overexpressed with at least one antimicrobial peptide selected from the group consisting of lysozyme, lysine (moricin) and lebocin 1 (lebocin 1). That is, expression of these antimicrobial peptides can be enhanced compared to the wild type before the Cactus gene is mutated.

The mutant insect cell line may be a silkworm ovary cell line.

The silkworm ovary cell line Bm 5 or BM-N May be a cell.

Thus, the present invention may also be directed to a method for preparing a mutant insect cell line damaged by the Cactus gene by inserting the guide RNA and Cas9 protein of SEQ ID NO: 2 into a mutant insect cell line.

Insertion of the guide RNA and Cas9 protein of SEQ ID NO: 2 may be performed by performing electroporation for 12-20 ms at 200 ~ 350V. Even more preferably, it may be performed by performing the electroporation for 12 to 17ms at 250 ~ 350V. Most preferably, the electrocleaning method may be performed at 300 V for 15 ms.

The electrocleaning method is preferably carried out by putting an insect cell line in sucrose buffer.

The sucrose buffer may be 5-20 mM HEPES (N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid) buffer containing 200-300 mM sucrose (pH 7.0-7.5).

The guide RNA and the Cas9 protein may be mixed in a weight ratio of 1: 1 to 1: 2 and inserted into an insect cell line.

The present invention relates to a mutant insect cell line or a method for producing the same that produces an antimicrobial peptide. In the present invention, the Cmtus gene of Bm 5 silkworm ovary cell line is cut through a gene editing technique using guide RNA and Cas9 protein, and lysozyme, lysine (moricin), and lebocin 1 (lebocin 1), etc. By inducing overexpression of the antimicrobial peptide, it provides a method for mass production of antimicrobial peptides in a natural state different from recombinant proteins.

As a prior art, Korean Patent Publication No. 10-2015-0096064 discloses a method for genetic modification through Cas9 / guide RNA, which is only performed in mammalian cells, and Wei Wei et al. Discloses Cas9 / in silkworms. Although we propose a method of gene mutagenesis through guide RNA, this document selects four loci of Bm-ok, BmKMO, BmTH and Bmtan as candidate target genes to be suppressed, and by using silkworm inhibiting Cactus gene Techniques for inducing increased expression of various antimicrobial peptides expressed in the cells themselves have not yet been identified.

1 is a schematic diagram showing a change in the humoral immune response activation pathway of silkworms by mutation.
Figure 2 is a diagram showing the Cactus gene sequence of Bm 5 cells.
3 is a diagram showing the binding position in the Cactus gene of the guide RNA.
4 is a gel-electrophoresis result photograph showing the DNA template of synthesized guide RNA (gRNA) (FIG. 4A) and guide RNA transcribed in vitro (FIG. 4B).
5 is a diagram showing the structure of the pGEM-T easy vector plasmid inserted with the Cactus substrate gene (FIG. 5A), a gel-electrophoresis result photograph (FIG. 5B) showing the DNA cleavage efficiency according to the guide RNA type, and the numerical value thereof. The graph (FIG. 5C) is shown.
Figure 6 is a graph showing the survival rate of Bm 5 cells according to the electroporation pulse.
7 is a gel-electrophoresis result photograph (FIG. 7A) and a graph showing the numerical value thereof to confirm the mutation efficiency of the F10 guide RNA according to the electroporation pulse.
Figure 8 is a graph showing the mutagenesis efficiency according to the type of buffer (Fig. 8A) and Cas 9 / gRNA mixing ratio (Fig. 8B).
9 is a gel-electrophoresis result photograph (FIG. 9A) showing the cleavage pattern of heterologous DNA molecules by treating T7 endonuclease I enzyme to identify Cm mutant-induced Bm 5 cells. Fig. 9B shows the results of nucleotide sequence analysis.
10 is a graph showing gel-electrophoresis results (FIG. 10A) and real-time PCR results confirming gene expression for Cactus, Lysozyme, Moricin, and Lebocin1 in Cactus mutant Bm 5 cells by RT-PCR (FIG. 10B). ).
11 is a graph showing the lysozyme activity of Cactus mutant Bm 5 cells.

Hereinafter, a preferred embodiment of the present invention will be described in detail. However, the present invention is not limited to the embodiments described herein and may be embodied in other forms. Rather, it is provided to fully convey the spirit of the present invention to those skilled in the art so that the contents introduced herein are thoroughly and completely.

<Example 1. Mutation target selection and guide RNA production>

Example 1-1. Target selection

According to the humoral immune response pathway of silkworm, Myd 88 signaling pathway is activated by the infection of Gram-positive bacteria and fungi, which leads to degradation of transcriptional factor (Cactus), which activates Dorsal and antibacterial peptide inside the nucleus. Expression is promoted (FIG. 1).

Therefore, when a mutation occurs in Cactus and malfunction occurs, it is determined that automatic activation of Dorsal is possible without external stimulation, so the Cactus gene was selected as a target gene in the present invention.

Example 1-2. Target gene sequencing

To identify the sequence of Cactus (Protein ID: NP 001166191.1), which is a mutagenesis target in Bm 5 cells, the full gene sequence of Bombyx mori strain p50T (Dazao) registered with NCBI (NW_004581774.1) and mRNA sequence of Cactus (NM_001172720. Based on 1), PCR primers having the sequences of Cactus F: 5'-TGTCAAAACATGGTTCCGTGTTC-3 'and Cactus R 5'-CGTAAGTGGAAATTCCGAGTTTGTA-3' were prepared, and PCR was performed using genomic DNA of Bm 5 cells, a silkworm ovary cell line, as a template. . 3.3 kb of DNA obtained by PCR was cloned into pGEM-T easy vector (Promega, Cat. No. A137A), and then sequenced first using a pair of universal primer sequences present in the vector, and then primer working. Gene sequence of 3.3 kb was analyzed. Sequencing analysis showed 99.62% similarity with Dazao base sequence (Gene ID: 100379185) of the Cactus gene registered in NCBI among the Bm 5 gene sequences (FIG. 2).

Example 1-3. Guide RNA Locus Determination

PAM sequence (NGG) present in exon 1 and exon 2 nucleotide sequences of the Cactus nucleotide sequence of the identified Bm 5 cells and for the production of guide RNA (gRNA) for Cactus gene editing and PAM sequence for the silkworm whole gene Off-target possibilities for 20, 12, and 8 bases adjacent to were analyzed using the CRISPRdirect Tool (http://crispr.dbcls.jp). * PAM (protospacer adjacent motif: the Cas9 protein cuts the PAM site, resulting in mutation of the DNA sequence during the repair of the cut DNA itself).

As a result, six target sites with high specificity (F3, F10, F13, R4, R10, and R13) were selected at the exon site (Table 1). The target site in the gene of each guide RNA is as shown in FIG.

Guide RNA target site and off-target likelihood analysis of the Cactus gene

Locus No Target sequence
(N ₂₀ NGG) GC
(%) Possibility of off-target recognition hit_20 hit_12 hit_8 Exon 1 F2 GAGGACGAGTACGCTGATTC CGG 55 One One 219 F10 GAGTGAAATCCATTACGGAT AGG 40 One One 509 F13 TCTACTGTTCCAACAGGACG AGG 500 One One 222 Exon 2 R4 CCT CATCAGGGTGTGCCCTGAGA 600 One One 182 R10 CCA CTGCATCTAGCGGTGATGAG 550 One One 251 R13 CCT CGGAGAGACTCCGCTACACA 600 One One 197

Example 1-4. Guide RNA Synthesis

To synthesize six selected guide RNAs, the primers of Table 2 were prepared. The synthesis of guide RNA was performed by mixing DNA polymerase, a pair of primers corresponding to each guide RNA, a universal primer, and dNTP's. NTP's and T7 RNA polymerase were added to the obtained PCR product to react at 37 ° C. for 3 hours to synthesize guide RNA, and then treated with DNase I to remove DNA used as a template, followed by pure guide using a RNA purification column. Only RNA was purified. Purified guide RNA was electrophoresed on a 2% formaldehyde-agarose gel to confirm concentration and purity (FIG. 4). The sequences of the six guide RNAs that can form a complex to the actual Cas9 protein synthesized using the sequence of the guide RNA binding to the target DNA of Table 1 (Table 3) are shown in Table 4. Each guide RNA comprises 20 nucleotides complementary to the target sequence; And a scaffold sequence of 72 nucleotides constituting a hairpin structure for binding to Cas 9 protein. This scaffold sequencing can be replaced with another sequence capable of binding to Cas9. The underlined portion of Table 4 is the sequence that binds to the target gene. The target genes of Table 3 and Table 4 are the same as those disclosed in Table 1.

Primer for Guide RNA Synthesis

Guide RNA Forward (5 'to 3') Reverse (5 'to 3') F2 TAATACGACTCACTATAGGAGGACGAGTACGCTGAT TTCTAGCTCTAAAACGAATCAGCGTACTCGTCCTC F10 TAATACGACTCACTATAGGAGTGAAATCCATTACGG TTCTAGCTCTAAAACATCCGTAATGGATTTCACTC F13 TAATACGACTCACTATAGTCTACTGTTCCAACAGGA TTCTAGCTCTAAAACCGTCCTGTTGGAACAGTAGA R4 TAATACGACTCACTATAGTCTCAGGGCACACCCTGA TTCTAGCTCTAAAACCATCAGGGTGTGCCCTGAGA R10 TAATACGACTCACTATAGCTCATCACCGCTAGATGC TTCTAGCTCTAAAACCTGCATCTAGCGGTGATGAG R13 TAATACGACTCACTATAGTGTGTAGCGGAGTCTCTC TTCTAGCTCTAAAACCGGAGAGACTCCGCTACACA Universal TAATACGACTCACTATAG GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTT

Guide RNA Sequence for Target Gene

SEQ ID NO: Target genes Guide RNA sequence for the target gene (5 'to 3') SEQ ID NO: 1 F2 CUCCUGCUCAUGCGACUAAG SEQ ID NO: 2 F10 CUCACUUUAGGUAAUGCCUA SEQ ID NO: 3 F13 AGAUGACAAGGUUGUCCUGC SEQ ID NO: 4 R4 AGAGUCCCGUGUGGGACUAC SEQ ID NO: 5 R10 GAGUAGUGGCGAUCUACGUC SEQ ID NO: 6 R13 ACACAUCGCCUCAGAGAGGC

Guide RNA Sequence Created for Cas9 Complex Preparation

SEQ ID NO: Target genes Guide RNA sequence (5 'to 3') SEQ ID NO: 7 F2 CUCCUGCUCAUGCGACUAAG GUUUUAGAGCUAUGCUGUUUUGGAAACAAAACAGCGAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCUUUU SEQ ID NO: 8 F10 CUCACUUUAGGUAAUGCCUA GUUUUAGAGCUAUGCUGUUUUGGAAACAAAACAGCGAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCUUUU SEQ ID NO: 9 F13 AGAUGACAAGGUUGUCCUGC GUUUUAGAGCUAUGCUGUUUUGGAAACAAAACAGCGAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCUUUU SEQ ID NO: 10 R4 AGAGUCCCGUGUGGGACUAC GUUUUAGAGCUAUGCUGUUUUGGAAACAAAACAGCGAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCUUUU SEQ ID NO: 11 R10 GAGUAGUGGCGAUCUACGUC GUUUUAGAGCUAUGCUGUUUUGGAAACAAAACAGCGAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCUUUU SEQ ID NO: 12 R13 ACACAUCGCCUCAGAGAGGC GUUUUAGAGCUAUGCUGUUUUGGAAACAAAACAGCGAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCUUUU

Example 1-5. Activity of Guide RNA

To confirm the operation of the synthesized guide RNA, each of the mixture of 750 ng guide RNA and 250 ng Cas9 nucease (Invitrogen, Cat. No. B25640) for 10 minutes at 25 ℃ to form a complex, Example 2 400 ng of the pGEM-T easy vector plasmid inserted with the Cactus gene sequence used at −1 was reacted at 37 ° C. for 1 hour, and electrophoresis was performed on 1% agar gel to analyze cutting efficiency. As a result, the cleavage efficiency of the F10 gRNA was the highest (about 60%) (FIG. 5).

Example 2. Establishment of Mutagenesis Conditions

Example 2-1. Establish electroporation conditions for Cas9 / gRNA complex delivery

Bm 5 cells were treated with TNM-FH medium (Welgene, Cat. No. LM 506-01) to which 10% FBS (Gemini, Cat. No. 100-500) was added. After culturing to the density, the cultured cells were collected by centrifugation and prepared ⁵ × 10 ⁵ cell / ml cell solution using Electroporation buffer (Bio-rad, Cat. No. 165-2677). BM 5 cells used in this experiment, or other insect cells with similar characteristics to these cells, BM-N cells, are cells that have both adhesion and suspension, but have stronger adhesion properties.

Cell viability analysis by electroporation was performed in vitro in 400 μl of cell fluid (2 × 10 ⁵ cells) using Gene Pulser Xcell System (Bio-rad) and 0.4 cuvette (Bi0-rad, Cat. No. 165-2088). The resulting Cas9 / gRNA (2.5 μg / 2.5 μg) complexes were mixed and subjected to electroshock for 5, 10, 15, and 20 ms at 100, 200, and 300 V. In each reaction, 20 μl of cell solution (1 × 10 ⁴ cells) was transferred to a 96 well plate, followed by adding 80 μl of TMN-FH medium with 10% FBS and 50 μl of XTT solution (Applichem, Cat. No. A8088). Cultured at 27 ° C. for 24 hours, the difference between 450 nm and 690 nm absorbance was measured using a spectrophotometer, and the survival rate was analyzed as a percentage of Bm 5 cells that were not subjected to electric shock. In general, the cell survival rate with the maximum mass transfer efficiency in the electric shock is 20-50%, and the analysis shows that the survival rate of Bm 5 cells is about 50% at 20 ms at 200V and 15 ms at 300V (Fig. 6).

Example 2-2. Optimization of Mutagenic Conditions by Cas9 / gRNA

After collecting the Bm 5 cells cultured in the same manner as in Example 2-1, treated with 0.4ml of Bio-rad's Electroporation buffer solution to prepare 2.5x10 ⁶ cell / ml of the cell solution in a sing cell state, and 1x10 ⁶ cells and test tube After mixing the Cas9 / gRNA (2.5 μg / 2.5 μg) complex generated in the above, the introduction of the Cas9 / gRNA complex was induced by applying an electric shock at the intensity of 200 V-20 ms and 300 V-15 ms, which showed a survival rate of 50% or less. .

Then, 400 μl of the cell solution induced by the introduction of the Cas9 / gRNA complex by electroporation was transferred to a 6 well plate, and 2 ml of TMN-FH containing 10% of FBS was added to each well and incubated for 48 to 72 hours. . Genomic DNA was extracted from the cultured Bm 5 cells, using a primer (EX1 assay F: 5'-GGTTCCGTGTTCATAAACAATTGT and Ex1 assay R: 5'-TTTATACATACGTGTCTCCGTCCT) for the target site. After obtaining a PCR product of size, it was heated at 90 ° C. for 5 minutes, cooled at 95 ° C. to 85 ° C. at a rate of −2 ° C./sec, and then cooled at 85 ° C. to 25 ° C. at −0.1 ° C./sec. Heterologous DNA molecules were formed through recombination of circular DNA. Subsequent analysis of the cleavage pattern of heterologous DNA molecules by electrophoresis on 2% agar gel by treatment of T7 endonuclease I enzyme, which recognizes and cleaves the malocclusion sequence, revealed that the mutagenesis efficiency was higher at 300 V and 15 ms (FIG. 7). ).

Cell fluid was prepared using Bio-rad's electroporation buffer, Sucrose buffer (10 mM HEPES pH 7.3, 272 mM Sucrose), and TMN-FH medium without FBS to determine suitable electroporation buffer for introducing Cas9 / gRNA complexes. T7 endonuclease I assay was performed by mixing with Cas9 / gRNA (2.5 ㎍ / 2.5 ㎍) complex and applying an electric shock of 300 V and 15 ms, followed by T7 endonuclease I assay. 8A).

In order to determine the concentration ratio of Cas 9 and F10 gRNA suitable for electroporation, 2.5 μg of Cas 9 and F10 gRNA were complexed at different concentrations from 0.5 to 5 μg, mixed with the cell solution prepared in Sucrose buffer, and then 300 V, 15 T7 endonuclease I analysis was performed by culturing the cells with an electric shock of ms. As a result, mutations were induced with the highest efficiency using 5 μg of gRNA. (FIG. 8B).

Example 3. Mutation Assay and Effect

Example 3-1. Cactus Gene Sequencing of Mutant Bm 5 Cells

Cas 9 / F10 gRNA (2.5: 5 μg) was confirmed by T7 endonuclease I analysis of mutations in Bm 5 cells introduced via electroporation on sucrose buffer. PCR was performed using primers (Ex1 assay F and Ex1 assay R) for the target site of the Cactus gene from the genomic DNA of the mutated cells, and the resultant was transferred to pJET 1.2 vector (Thermo, Cat, No. K1231). Cloned. The plasmid DNA of the clone thus obtained was purified and analyzed for nucleotide sequence.

As a result of analyzing the base sequence of the total 40 clones thus obtained, five deletion mutations and one insertion mutation were identified (FIG. 9).

Example 3-2. Antimicrobial Peptide Gene Expression Analysis of Mutant Bm 5 Cells

In Example 3-1, after culturing Bm 5 cells inducing various types of mutations, total RNA was extracted from the cells, and cDNA was synthesized from 700 ng of total RNA using an oligo dT primer. Since cDNA The primers of Table 5 were used to compare the antimicrobial peptide gene expression between normal Bm 5 cells and Cactus mutant Bm 5 cells by RT-PCR and Real-time PCR. As a result, the expression of the Cactus gene in the mutant cells was reduced compared to the normal cells of the wild type, while it was confirmed that the gene expression of lysozyme, moricin and lebocin increased significantly (Fig. 10).

RT-PCR and Real-time PCR primer

Gene Forward primer (5 'to 3') Reverse primer (5 'to 3') GAPDH GCTGGAATTTCTTTGAATGAC CAATGACTCTGCTGGAATAACC Rel a TCCTGTTGCCTTAGAGAACATG GGATAAGTTTTGTTCTCCGGAG Rel b AAGCGTGGTAATAGTCGAGCAA TTGTTGACGCAGGACACGACT Relish ATGCTAGTGAAATGGCTGGAAC TGCTCCTCAGGTGTCTTATGTT Cactus TGAAATCCATTACGGATAGGCTGT GTGTACGGAGGCGATGTGTA Moricin ATGTCTCTGGTGTCATGTAGTA TTGAAAACATCGTTGGCTGTAC Lysozyme AAGACTGCAACGTTAAGTGCTC ACAGTTCTGTTTCGAGGAGATC Lebocin1 TTATTATCGGACGCTGTGTT TATTATCGGACGCTGTGTT

Example 3-3. Analysis of lysozyme activity in mutant Bm 5 cells

After culturing the mutant-induced Bm 5 cells, the cells were collected and the protein was concentrated through 40-70% ammonium sulfate fraction. Salt was removed from the concentrated protein using a PD-10 column and used for activity analysis after lyophilization. Analysis of the activity of lysozyme using the cell wall (Invitrogen, Cat. NO.E22013) of the fluorescent dye-coupled Micrococcus lysodeikticus as a substrate showed that the Cactus gene mutant cells showed more than 10-fold higher lysozyme activity than normal Bm 5 cell culture. It was.

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Novel mutant insect cell line producing antimicrobial peptide or          a preparation method <130> 2018-0154 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> gRNA for Cactus <400> 1 cuccugcuca ugcgacuaag 20 <210> 2 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> gRNA for Cactus <400> 2 cucacuuuag guaaugccua 20 <210> 3 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> gRNA for Cactus <400> 3 agaugacaag guuguccugc 20 <210> 4 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> gRNA for Cactus <400> 4 agagucccgu gugggacuac 20 <210> 5 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> gRNA for Cactus <400> 5 gaguaguggc gaucuacguc 20 <210> 6 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> gRNA for Cactus <400> 6 acacaucgcc ucagagaggc 20 <210> 7 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> gRNA for Cactus <400> 7 cuccugcuca ugcgacuaag guuuuagagc uaugcuguuu uggaaacaaa acagcgauag 60 caaguuaaaa uaaggcuagu ccguuaucuu uu 92 <210> 8 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> gRNA for Cactus <400> 8 cucacuuuag guaaugccua guuuuagagc uaugcuguuu uggaaacaaa acagcgauag 60 caaguuaaaa uaaggcuagu ccguuaucuu uu 92 <210> 9 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> gRNA for Cactus <400> 9 agaugacaag guuguccugc guuuuagagc uaugcuguuu uggaaacaaa acagcgauag 60 caaguuaaaa uaaggcuagu ccguuaucuu uu 92 <210> 10 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> gRNA for Cactus <400> 10 agagucccgu gugggacuac guuuuagagc uaugcuguuu uggaaacaaa acagcgauag 60 caaguuaaaa uaaggcuagu ccguuaucuu uu 92 <210> 11 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> gRNA for Cactus <400> 11 gaguaguggc gaucuacguc guuuuagagc uaugcuguuu uggaaacaaa acagcgauag 60 caaguuaaaa uaaggcuagu ccguuaucuu uu 92 <210> 12 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> gRNA for Cactus <400> 12 acacaucgcc ucagagaggc guuuuagagc uaugcuguuu uggaaacaaa acagcgauag 60 caaguuaaaa uaaggcuagu ccguuaucuu uu 92

Claims (10)

Mutation of the Cactus gene (Cactus) gene mutant insect cell line characterized in that the expression of the mRNA or Cactus protein of the gene is suppressed, and inserted into the guide RNA and Cas9 protein represented by the nucleotide sequence of SEQ ID NO: 2.
delete The method of claim 1,
The insect cell line is a mutant insect cell line, characterized in that the anti-expression of at least one selected from the group consisting of lysozyme (lysozyme), moricin (moricin) and lebocin 1 (lebocin 1). The method of claim 1,
The mutant insect cell line is a mutant insect cell line, characterized in that the silkworm ovary cell line. The method of claim 4, wherein
The silkworm ovary cell line is a mutant insect cell line, characterized in that the Bm 5 cells. A method of producing a mutant insect cell line having a damaged Cactus gene by inserting a guide RNA and Cas9 protein of SEQ ID NO: 2 into an insect cell line. The method of claim 6,
Insertion of the guide RNA and Cas9 protein of SEQ ID NO: 2 is a method for producing a mutant insect cell line, characterized in that performed by electroporation for 12-20 ms at 200 ~ 350V. The method of claim 7, wherein
The electroporation method is a method for producing a mutant insect cell line, characterized in that the insect cell line is carried in sucrose buffer. The method of claim 8,
The sucrose buffer is a mutation, characterized in that 5 ~ 20 mM HEPES (N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid) buffer of pH 7.0 to pH 7.5 containing 200 ~ 300 mM sucrose Methods of Making Insect Cell Lines. The method of claim 6,
The guide RNA and the Cas9 protein are mixed in a weight ratio of 1: 1 to 1: 2 is inserted into the insect cell line method for producing a mutant insect cell line.

Images