KR102035458B1 - Method for treating of preventing psoriasis with liquid type plasma - Google Patents

Abstract

The present invention relates to a method for preventing or treating psoriasis using liquid plasma. More specifically, the present invention provides a method of producing a liquid plasma for the prevention or treatment of psoriasis, a pharmaceutical composition for the prevention or treatment of psoriasis using the liquid plasma prepared by the method, and a method for preventing or treating psoriasis using the liquid plasma It is about.
Since the liquid plasma of the present invention is remarkably effective in inhibiting the production and proliferation of psoriasis, it is expected to be greatly utilized for the prevention and treatment of psoriasis.

Description

Method for treating of preventing psoriasis with liquid type plasma}

The present invention relates to a method for preventing or treating psoriasis using liquid plasma. More specifically, the present invention provides a method of producing a liquid plasma for the prevention or treatment of psoriasis, a pharmaceutical composition for the prevention or treatment of psoriasis using the liquid plasma prepared by the method, and a method for preventing or treating psoriasis using the liquid plasma It is about.

Psoriasis is an immune-mediated autoimmune skin disease induced by chronic activation of inflammatory cell infiltration in the skin and dysregulation of epidermal keratinocytes. Histologically, psoriasis is considered to be thickening and scaling of the epidermis and hyperproliferative parakeratosis in skin biopsy. Yet, the pathogenesis of psoriasis has not been fully elucidated, and has been reported to be related to a complex mechanism involving the interaction between inflammatory cytokines and immune cell infiltration such as T cells. ) And Th17-mediated cytokines such as IL-17A, IL-22 and IL-23 have been reported to induce psoriasis triggers.

Common treatments for such psoriasis include topical, phototherapy and oral medications. Topical treatments are therapies including steroids, coal tar, anthraline, vitamin D3 and analogs thereof, retinoids and sunburn, and the like, which have the side effects of skin thinning, stretch marks, burns, irritation and photosensitivity. In addition, steroids can induce resistance, affecting subsequent steroid treatment. Phototherapy involves the administration of soralene with ultraviolet B or ultraviolet A, with the disadvantage that the skin ages quickly and the incidence of skin cancer is increased. Internal administration is the administration of immunomodulators such as cyclosporin and is currently the most used method. However, there is a problem of nephrotoxicity or high blood pressure caused by long time use. Therefore, the present invention is to solve the problems of psoriasis treatment, and to develop a treatment that can effectively treat psoriasis has been the subject of a major problem, and research has been made, but there is no known effective treatment.

On the other hand, the low temperature atmospheric pressure plasma refers to a plasma in which the energy of the ions and electrons of the plasma is greater than the energy possessed by the ions, and is also referred to as a low temperature atmospheric pressure plasma. In other words, low-temperature plasma is generated when the high-pressure electric discharge in the exhaust gas causes electrons generated by the discharge to collide with molecules of the exhaust gas to change the outer electron state of the gas molecules. For example, OH, COOH, CHO, etc.), excitation molecules, and ions are charged positively or negatively to become an electrically neutral gas. Plasma is classified into a high temperature thermal plasma having high electron, ion, and molecular temperature, and a low temperature plasma having only electron temperature. The high temperature thermal plasma can be used to melt the material to obtain a high temperature, and the low temperature plasma can be applied to materials or conditions that cannot be applied to high temperature because only the temperature of the electron is high, and the device has a simple advantage. Since such plasmas induce various chemical reactions, many studies have been made to apply them to various fields. However, it is not yet known how to treat psoriasis using it.

Applicants of the present invention thus completed the present invention. The present invention relates to a method for preventing or treating psoriasis using liquid plasma, and the liquid plasma of the present invention is remarkably effective in inhibiting the generation and proliferation of psoriasis, and is expected to be greatly utilized for the prevention and treatment of psoriasis.

The present invention has been made to solve the above problems in the prior art, and relates to a method for preventing or treating psoriasis using liquid plasma.

Accordingly, the present invention provides a method for producing a liquid plasma for the prevention or treatment of psoriasis, a pharmaceutical composition for the prevention or treatment of psoriasis using the liquid plasma prepared by the method, and the prevention of psoriasis using the liquid plasma prepared by the method Or to provide a method of treatment.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problem, another task that is not mentioned will be clearly understood by those skilled in the art from the following description.

Hereinafter, various embodiments described herein are described with reference to the drawings. In the following description, for a thorough understanding of the present invention, various specific details are described, such as specific forms, compositions, processes and the like. However, certain embodiments may be practiced without one or more of these specific details, or in conjunction with other known methods and forms. In other instances, well known processes and manufacturing techniques have not been described in particular detail in order to not unnecessarily obscure the present invention. Reference throughout this specification to "one embodiment" or "embodiment" means that a particular feature, form, composition or characteristic described in connection with the embodiment is included in one or more embodiments of the invention. Thus, the context of “in one embodiment” or “embodiment” expressed at various places throughout this specification does not necessarily represent the same embodiment of the invention. In addition, particular features, forms, compositions, or properties may be combined in any suitable manner in one or more embodiments.

In one embodiment of the present invention, "psoriasis" is a erythematous skin lesion covered with a clear border of silvery white scale (the gray-white matter from dead skin cells), mainly elbows, knees, hips, scalp, etc. Occurs in areas of high irritation. Pulmonary papules (a pulmonary rash) appear on the skin during skin disease, plaques, pustules, deprived psoriasis, psoriatic arthritis, and various clinical manifestations. It is an inflammatory skin disease. According to the shape of the lesion can be further divided into plaque, interrogation, water droplets, pustules, erythematosis. Specifically, platelet psoriasis is most commonly observed as a representative clinical form of psoriasis. Individual lesions have a clear circumference and border, reddish, covered with silver-white scales, and common areas are elbows, knees, hips, scalp, etc., which occur symmetrically. Chronic plaque cases are called psoriasis vulgaris. Interrogative psoriasis rarely occurs when psoriasis occurs in areas where the skin overlaps, such as in the armpits and groin, and is also called oyster psoriasis or inverted psoriasis. Diffuse psoriasis develops rapidly after tonsillitis caused by streptococcus, with small droplets of 0.5-1.5 cm in size spread throughout the body. Patients' blood tests may increase the levels of antibodies to streptococcal toxin (ASO). Pulmonary psoriasis is an acute form of psoriasis that is rarely seen, including local pulmonary psoriasis with pustules on the hands and soles, and systemic pulmonary psoriasis with the whole body. In the case of acute systemic molding, there are systemic symptoms such as chills, high fever, malaise, joint pain, and leukocytosis. Finally, psoriasis scleroderma is a form of acute psoriasis that is accompanied by erythema and sulcus over the entire skin. Severe droughts are sometimes called deprived psoriasis. Severe symptoms tend to be more itchy and invasive to the face. Psoriatic arthritis is observed in 5-10% of patients with psoriasis. Asymmetrically invading one or a few joints, invading the distal interphalangeal joint, symmetrically causing arthritis, or arthritis mutilans resulting in severe deformation of the joint , Spondylitis and other clinical forms. In addition, most psoriasis patients are accompanied by an early nail lesion.

To date, accumulated research shows that psoriasis activates psoriasis-related T lymphocytes by stimulation of psoriasis antigens in people with a genetic predisposition to psoriasis, and the resulting cytokines induce hyperplasia of keratinocytes. In addition, it is understood that CLA + T lymphocytes specific to the skin are continuously introduced into the skin lesion and generated. Therefore, psoriasis lesions are classified as chronic lymphocytic mediated autoimmune diseases. As the skin region of the T lymphocyte-mediated autoimmune disease, T lymphocyte-mediated skin disease can be used in the same sense, and the T lymphocyte-mediated skin disease is systemic lupus erythematosus, cutaneous lupus erythematosus (cutaneous). It is preferably one or more selected from the group consisting of lupus erythematosus, scleroderma, psoriasis, dermatomyositis, and chronic dermatitis, but is not limited thereto.

In one embodiment of the present invention, "non-thermal atmospheric pressure plasma" refers to an ionized gas that satisfies Debye shielding. This, along with the three basic states of matter, gas, liquid, and solid, is considered to be another state and is expressed in the fourth state. In the plasma according to the present invention, the neutral gas is phase-transferred into the plasma by an external voltage, and electrons and cations may be generated by excitation and ionization of the neutral gas, and radicals in which molecular gas is excited may exist. If the plasma generating apparatus can generate a low temperature atmospheric plasma according to the object of the present invention, a known plasma generating apparatus can be used without limitation, and preferably using nitrogen gas, but is not limited thereto.

In one embodiment of the present invention "Liquid type plasma (Liquid type plasma, LTP)" means to generate a high-density high-energy plasma in the liquid, it is to be prepared by exposure to atmospheric nonthermal plasma (NTP) of atmospheric pressure Can be. The term "liquid plasma" may be used interchangeably with the term "plasma-conditioned liquid material" and the term "liquid material" may be used without limitation in the form of a liquid, but preferably Preferably water, saline, buffer, or medium, most preferably medium.

Since the liquid plasma of the present invention can be supplied in the form of a liquid composition, it is convenient to distribute and carry, and it is possible to simultaneously provide moisturizing and treatment in psoriasis in which moisture is important. In addition, there is less cell damage than the plasma treatment directly to the psoriasis skin, there is no risk of skin damage, such as a burn due to the wrong operation of the user, there is an advantage that can be uniformly applied to a wide and curved area.

In one embodiment of the present invention, "culture media" means a medium capable of supporting cell growth and survival in vitro, and is conventionally used in the art suitable for culturing cells. Include all media. Depending on the type of cells, medium and culture conditions can be selected. The basal medium used for culturing the cells is preferably a cell culture minimum medium (CCMM), and generally includes a carbon source, a nitrogen source and a trace element component. Such cell culture basal media include, for example, Dulbeco's Modified Eagle's Medium (DMEM), Minimal Essential Medium (MEM), Basic Medium Eagle (BME), RPMI1640, F-10, F-12, (Minimal Essential Medium), GMEM ( Glasgow's Minimal Essential Medium), Iscove's Modified Dulbecco's Medium, but are not limited to these.

In one embodiment of the present invention "treatment" refers to any action that improves or advantageously changes the symptoms of psoriasis or a disease caused by using the liquid plasma according to the present invention. Those skilled in the art will be able to determine the exact criteria of psoriasis, and determine the degree of improvement, improvement and treatment, with reference to data presented by the Korean Medical Association.

In one embodiment of the present invention, "prevention" means any action that inhibits or delays the development of psoriasis or other diseases by using the liquid plasma according to the present invention. It will be apparent to those skilled in the art that the compositions herein having a therapeutic effect on psoriasis can prevent these diseases using the liquid plasma according to the invention before the initial symptoms or symptoms of psoriasis appear.

As used herein, the term "pharmaceutical composition" means a composition to be administered for a specific purpose. For the purposes of the present invention, the pharmaceutical composition of the present invention includes a liquid plasma prepared by irradiating a plasma to a liquid substance as an active ingredient, and may include a protein and a pharmaceutically acceptable carrier, excipient or diluent involved therein. have. Said "pharmaceutically acceptable" carrier or excipient means that which has been approved by the governmental regulatory authority, or listed in government or other generally approved pharmacopoeia for use in vertebrates, and more particularly in humans. do.

For parenteral administration, the pharmaceutical compositions of the invention may be in the form of suspensions, solutions or emulsions in oily or aqueous carriers, and may be prepared in the form of solids or semisolids. In addition, the pharmaceutical compositions of the present invention may include formulating agents such as suspending, stabilizing, dissolving and / or dispersing agents and may be sterilized. The pharmaceutical composition may be stable under the conditions of manufacture and storage, and may be preserved against the contaminating action of microorganisms such as bacteria or fungi. Alternatively, the pharmaceutical compositions of the present invention may be in sterile powder form for reconstitution with a suitable carrier prior to use. The pharmaceutical compositions may be in unit-dose form, in microneedle patches, in ampoules, or in other unit-dose containers, or in multi-dose containers. Alternatively, the pharmaceutical composition may be stored in a freeze-dried (freeze-dried) state, which requires the addition of a sterile liquid carrier, eg, water for injection just before use. Immediately injectable solutions and suspensions may be prepared as sterile powders, granules or tablets.

In some non-limiting embodiments, the pharmaceutical compositions of the present invention can be formulated or included in the form of microspheres in a liquid. In certain non-limiting embodiments, the pharmaceutical compositions of the present invention may comprise their pharmaceutically acceptable compounds and / or mixtures at concentrations between 0.001 and 100,000 U / kg. In addition, in certain non-limiting embodiments, the pharmaceutical compositions of the present invention may include suitable excipients, preservatives, suspending agents, additional stabilizers, dyes, buffers, antibacterial agents, antifungal agents, and isotonic agents, for example, sugars or sodium chloride. Can be. As used herein, the term "stabilizer" refers to a compound that is optionally used in the pharmaceutical compositions of the present invention to increase shelf life. In a non-limiting implementation, the stabilizer can be a sugar, an amino acid, or a polymer. In addition, the pharmaceutical composition of the present invention may include one or more pharmaceutically acceptable carriers, and the carrier may be a solvent or a dispersion medium. Non-limiting examples of pharmaceutically acceptable carriers include water, saline, ethanol, polyols (eg glycerol, propylene glycol and liquid polyethylene glycols), oils, and suitable mixtures thereof. Non-limiting examples of sterilization techniques applied to the pharmaceutical compositions of the present invention include filtration through bacteria-inhibiting filters, terminal sterilization, incorporation of sterile preparations, irradiation, sterile gas irradiation, heating, vacuum drying and freeze drying. do.

As used herein, "administration" means introducing the composition of the present invention to a patient in any suitable manner, and the route of administration of the composition of the present invention may be administered via any general route as long as it can reach the desired tissue. have. Oral administration, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, intranasal administration, pulmonary administration, rectal administration, intraluminal administration, intraperitoneal administration, intradural administration, The composition is most preferably provided in the form of an application on the skin or subcutaneous or intradermal injection, but is not limited thereto.

The method of treatment of the present invention may comprise administering the pharmaceutical composition in a pharmaceutically effective amount. In the present invention, the effective amount is defined as the type of disease, the severity of the disease, the type and amount of the active ingredient and other ingredients contained in the composition, the type of formulation and the age, weight, general health condition, sex and diet, time of administration, route of administration of the patient. And various factors, including the rate of secretion of the composition, the duration of treatment, and the drugs used concurrently.

In one embodiment of the present invention, (a) filling the plasma generating apparatus with a carrier gas; (b) generating a plasma by supplying a voltage of 5 kV to 20 kV and a frequency of 10 to 30 kHz to the plasma generator; And (c) irradiating the generated plasma to a liquid substance. A liquid plasma manufacturing method for preventing or treating T lymphocyte-mediated skin disease, wherein the carrier gas in step (a) is nitrogen or helium. It provides a liquid plasma manufacturing method for the prevention or treatment of T lymphocyte-mediated skin disease, which is at least one selected from the group consisting of argon, and oxygen, wherein the irradiation in step (c) is 0.1 cm from the surface of the liquid material. It provides a liquid plasma manufacturing method for the prevention or treatment of T lymphocyte-mediated skin disease, characterized in that it is carried out for 5 minutes to 120 minutes at a distance of 15 to 15 cm, wherein the liquid substance in step (c) is water, It provides a method for producing a liquid plasma for the prevention or treatment of saline, buffer, or medium for lymphocyte-mediated skin diseases, and mediating the T lymphocyte mediation. Skin diseases are composed of systemic lupus erythematosus, cutaneous lupus erythematosus, scleroderma, psoriasis, dermatomyositis, and chronic dermatitis. It provides a liquid plasma production method for the prevention or treatment of any one or more T lymphocyte-mediated skin diseases selected from.

In another embodiment of the present invention, there is provided a pharmaceutical composition for the prevention or treatment of T lymphocyte-mediated skin diseases comprising a liquid plasma prepared by any one or more of the above methods as an active ingredient, wherein the pharmaceutical composition is an oral dosage form, It provides a pharmaceutical composition for the prophylaxis or treatment of T lymphocyte-mediated skin disease, characterized in that the parenteral formulation or topical formulation, the pharmaceutical composition alone or surgery, radiation therapy, hormonal therapy, chemotherapy and biological response It provides a pharmaceutical composition for the prevention or treatment of T lymphocyte-mediated skin disease, characterized in that it is used in combination with methods using a modulator, the T lymphocyte-mediated skin disease is systemic lupus erythematosus, skin Cutaneous lupus erythematosus, scleroderma, psoriasis, dermatomyo Provided is a pharmaceutical composition for preventing or treating T lymphocyte-mediated skin disease, which is at least one selected from the group consisting of sitis, and chronic dermatitis.

In another embodiment of the present invention, there is provided a method for the prevention or treatment of T lymphocyte-mediated skin disease comprising administering to the subject, except human, a liquid plasma prepared by any one or more of the above method, the T lymphocyte Mediated skin diseases consist of systemic lupus erythematosus, cutaneous lupus erythematosus, scleroderma, psoriasis, dermatomyositis, and chronic dermatitis. Provided is a method for preventing or treating T lymphocyte mediated skin disease, which is at least one selected from the group consisting of:

Hereinafter, the present invention will be described in detail step by step.

The present invention relates to a method for preventing or treating psoriasis using liquid plasma, and the liquid plasma of the present invention is remarkably effective in inhibiting the generation and proliferation of psoriasis, and is expected to be greatly utilized for the prevention and treatment of psoriasis.

FIG. 1 is a diagram showing a schematic diagram of an IMQ and / or NTP treatment and a back skin photograph of a mouse in order to verify the efficacy of treating psoriasis of plasma according to an embodiment of the present invention.
Figure 2 is a diagram showing the change in the formation of the stratum corneum of the mouse skin treated with IMQ and / or NTP according to an embodiment of the present invention.
3 is a diagram showing that vehicle cream and / or nitrogen gas of IMQ does not significantly affect the formation of the stratum corneum of the mouse skin, according to an embodiment of the present invention.
Figure 4 shows that, according to one embodiment of the present invention, NTP treatment does not significantly affect the inflammatory response factors of the mouse skin.
Figure 5 is a diagram showing the change in infiltration amount of CD4 + T cells, CD11c + cells, CD11b + cells and Gr-1 + cells by IMQ stimulation and NTP treatment, according to an embodiment of the present invention.
Figure 6 is a diagram showing the change in the expression level of inflammatory response factors (IL-6, IL-17, IL-22, CXCL1, and CCL20) by IMQ stimulation and NTP treatment in accordance with an embodiment of the present invention.
7 is a view showing the degree of inhibition of differentiation of Th17 cells by IMQ stimulation and NTP treatment, according to an embodiment of the present invention.
8 is a schematic diagram showing a method of manufacturing LTP compared to NTP according to an embodiment of the present invention.
9 is a diagram showing the degree of inhibition of the differentiation of Th17 cells when No LTP, LTP 30, or LTP 60 treatment according to an embodiment of the present invention.
Figure 10 is a diagram showing the degree of inhibition of differentiation of Th1 cells when No LTP, LTP 30, or LTP 60 treatment according to an embodiment of the present invention.
11 is a diagram showing the degree of inhibition of the activity of BMDC by LTP treatment, according to an embodiment of the present invention by the expression of CD80, CD86 and MHC II.
12 is a view showing a result of reducing the expression of inflammatory cytokines by LTP treatment in BNDC treated with TNF-α or Lipopolysaccharide (LPS) according to an embodiment of the present invention.
FIG. 13 is a diagram showing changes in gene expression of interleukin and cytokine by LTP treatment in HaCaT cells activated with TNF-α and IFN-γ according to one embodiment of the present invention.
14 is a view showing the change in gene expression of interleukin and cytokines by LTP treatment in LPS stimulated HaCaT cells according to an embodiment of the present invention.
Figure 15 is a diagram showing the change in STAT3 activation (pSTAT3) by LTP treatment in IL-6 stimulated HaCaT cells according to an embodiment of the present invention.
FIG. 16 is a diagram showing changes in PD-L1 expression by LTP treatment in TNF-α and IFN-γ or LPS-stimulated HaCaT cells according to an embodiment of the present invention.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example 1 Confirmation of Psoriasis Treatment Effect of Non-thermal Atmospheric Pressure Plasma (NTP)

Example 1-1. Effect of Psoriasis Treatment on Animal Model by Non-thermal Atmospheric Plasma (NTP)

In order to verify the efficacy of psoriasis treatment of non-thermal plasma, an animal model in which psoriasis was induced was applied to the back skin of a C57 / BL6 mouse with imiquimod (IMQ). After shaving the back of 8-week-old C57 / BL6 mice, 62.5 mg of IMQ cream (sigma, USA) was applied per day to induce psoriasis-like skin, and on days 3 and 4, a voltage of 15 kV at a distance of 2 cm from the epidermis of the mouse. Then, the skin tissues were analyzed by immunohistochemical staining by sacrifice of mice on day 5 after the non-thermal plasma was treated for 60 seconds using a plasma generator using a nitrogen gas as a carrier gas and a frequency of 15 kHz. The imiquimod and the plasma treatment schematic and the back skin photograph of the mouse are shown in FIG.

Experimental results showed that in the mice treated with IMQ, the thickness of the stratum corneum was significantly increased, causing psoriasis, but in the mice treated with IMQ and NTP, the thickness of the stratum corneum was reduced by more than 50% compared to the mice treated with IMQ only. . The results are shown in FIG. The above results are shown in Figure 3 to the experiment that proved the effect of the plasma. Plasma treatment in normal mouse skin did not affect skin tissue, and mice treated with vehicle cream of IMQ only, or vehicle cream and nitrogen gas only, did not develop skin inflammation. Plasma treatment, however, has been shown to inhibit skin inflammation similar to IMQ-induced psoriasis. It was also confirmed by comparing the expression levels of various inflammatory response factors (IL-6, IL-17, IL-22, CXCL1, and CCL20) that plasma treatment did not cause side effects in normal skin tissue. The results are shown in FIG.

Example 2-2. Inhibition of Immune Cell Infiltration in Animal Models by Non-thermal Atmospheric Pressure Plasma (NTP)

To determine if the non-thermal plasma can inhibit immune cell infiltration in IMQ-induced psoriasis-like skin inflammation, single cell suspensions of mouse skin were analyzed by flow cytometry (FACS) and the results are shown in FIG. 5. Experimental results show that the infiltration of CD4 + T cells, CD11c + cells, CD11b + cells and Gr-1 + cells is increased in IMQ treated mouse skin, and immune cell infiltration is suppressed in IMQ and plasma treated skin. appear.

In addition, the expression levels of inflammatory response factors (IL-6, IL-17, IL-22, CXCL1, and CCL20) were also compared, which is shown in FIG. 6. In the results of Example 1-1, it was confirmed that plasma treatment to normal skin did not cause an inflammatory response factor change. However, the experimental results showed that the expression of cytokines and chemokines in IMQ and plasma-treated skin was significantly reduced compared to the negative control group or plasma alone treatment group, whereas the expression of cytokines and chemokines was significantly reduced. Appeared to be.

5 and 6, it can be seen that non-thermal plasma treatment can effectively alleviate psoriasis-like skin inflammation through the inhibition of gene expression of inflammatory cytokines and chemokines.

Example 2-3. Inhibitory Effects of Th17 Cell Differentiation on Animal Models by Non-thermal Atmospheric Pressure Plasma (NTP)

Whether or not the differentiation of Th17 cells induced by IMQ in the draining lymph nodes of C57 / BL6 mice by the nonthermal plasma according to the present invention was inhibited by the plasma. Th17 cells are known to be important for the pathogenesis of psoriasis. The degree of differentiation of Th17 cells was analyzed by flow cytometry (FACS) in the same manner as in Example 1-1.

Experiments show that IMQ treatment in mice increases Th17 cells in drained lymph nodes, but this is effectively inhibited by plasma treatment. This is described in FIG. 7.

Example 2 Confirmation of Psoriasis Treatment Effect of Liquid Plasma (LTP)

Example 2-1. Preparation of Liquid Plasma (LTP)

Liquid plasma is a method of irradiating the plasma generated under the conditions of Example 1-1 to culture medium (RPMI 1640 or DMEM) for 0 seconds (mL LTP) 30 seconds (LTP 30) or 60 seconds (LTP 60) per ml It was prepared by. A schematic diagram of the non-thermal atmospheric plasma (NTP) and liquid plasma (LTP) treatments of Example 1 is shown in FIG. 8.

Example 2-2. Inhibitory Effect of Th17 Cell Differentiation by Liquid Plasma (LTP)

In the same manner as the non-thermal atmospheric plasma of Example 1, CD4 + T cells of C57 / BL6 normal mice were isolated to observe whether the differentiation of Th17 cells was inhibited by liquid plasma, and the isolated cells were 10ng / ml of anti-CD3. and Th17 cells in RPMI1640 cultures containing 5ng / ml anti-CD28, 10ng / ml IL-6, 5ng / ml TGF-β, IFN-γ antibody, and IL-4 antibody. At this time, the culture medium was No LTP, LTP 30, or LTP 60 was used. The degree of differentiation of Th17 cells in each culture was observed through flow cytometry (FACS), and the results are shown in FIG. 9. As a result, it was confirmed that the differentiation of Th17 expressing IL-17 was performed in the non-plasma culture (No LTP), but the differentiation of Th17 was significantly suppressed in the plasma-treated cultures LTP 30 and LTP 60.

Example 2-3. Inhibition Effect of Th1 Cell Differentiation by Liquid Plasma (LTP)

In order to observe whether the differentiation of Th1 cells was inhibited by liquid plasma, the cells isolated from the mice in Example 2-2 were used as anti-CD3 10ng / ml, anti-CD28 5ng / ml and IL-12 10ng for CD4 + T cells. Differentiated to Th1 cells in RPMI1640 culture containing / ml. At this time, the culture medium was No LTP, LTP 30, or LTP 60 was used. The degree of differentiation of Th1 cells in each culture was observed through flow cytometry (FACS), and the results are shown in FIG. 10. As a result, it was confirmed that the differentiation of Th1 cells was induced in the non-plasma culture (No LTP), but the differentiation of Th1 cells was significantly suppressed in the plasma treated cultures LTP 30 and LTP 60. In particular, it was shown that differentiation into Th1 cells rarely occurs in culture LTP 60.

Example 2-4. Inhibitory Effect of BMDC Cells by Liquid Plasma (LTP)

In order to observe whether the activity of bone marrow derived dendritic cells (BMDC) is inhibited by the liquid plasma according to the present invention, bone marrow cells of C57 / BL6 normal mice were isolated, and the isolated bone marrow cells were prepared as described above. After activation with TNF-α (20 μg / mL) in the same culture as 2-2, expression of CD80, CD86 and MHC II, which are activation markers of dendritic cells, was measured. TNF-α is known to be involved in the pathogenesis of psoriasis. Experimental results showed that TNF-α stimulation improved CD80, CD86 and MHCII expression in BDCM, whereas the expression of CD80, CD86 and MHC II and TNF-α were significantly increased in the plasma treated cultures LTP 30 and LTP 60. It was confirmed that the decrease. This is shown in FIG. 11.

In addition, expression of inflammatory cytokines was confirmed in TNF-α or LPS (Lipopolysaccharide) treated BMDCs. Among the interleukins and cytokines used in the present invention, primer sets of mouse IL-6, IL-17, TNF-α, CXCL1, CCL20, PD-L1, and GAPDH were purchased from commercially available (Qiagen, Hilden, Germany), human IL-1β, IL-8, IL-10, IFN-γ, and TGF-β1 primer sets were synthesized using the sequences shown in Table 1 below. GAPDH was used as a negative control.

hIL-1β Forward 5'ACAGATGAAGTGCTCCTTCCA3 ' Reverse 5'GTCGGAGATTCGTAGCTGGAT3 ' hIL-8 Forward 5'ATGACTTCCAAGCTGGCCGTGGCT3 ' Reverse 5'TCTCAGCCCTCTTCAAAAACTTCT3 ' hIL-10 Forward 5 'CATCGATTTCTTCCCTGTGAA3' Reverse 5 'TCTTGGAGCTTATTAAAGGCATTC3' hIFN-γ Forward 5'CTAATTATTCGGTAACTGACTTGA3 ' Reverse 5'ACAGTTCAGCCATCACTTGGA3 ' hTGF-β1 Forward 5'CCCAGCATCTGCAAAGCTC3 ' Reverse 5'GTCAATGTACAGCTGCCGCA3 '

As a result, the expression of inflammatory cytokines was increased in BNDC treated with TNF-α or Lipopolysaccharide (LPS), and the expression of inflammatory cytokines was decreased by liquid plasma. These results suggest that plasma can negatively regulate DC activation, which inhibits T cell activation and differentiation. The results are shown in FIG. 12.

Example 2-5. Inhibition of Inflammation Effect of Activated HaCaT (epithelial Cell) by Liquid Plasma

In order to confirm the anti-inflammatory effect of liquid plasma in skin similar to psoriasis, expression of inflammatory factors in HaCaT cells was analyzed. To this end, HaCaT cells were first activated with TNF-α and IFN-γ, treated with liquid plasma, and gene expression of interleukins and cytokines involved in psoriasis was measured by real-time PCR. The results are shown in FIG. Experimental results showed that the liquid plasma has an anti-inflammatory effect in HaCaT cells stimulated by TNF-α and IFN-γ.

The inhibitory effect of liquid plasma on IL-1β, IL-6, IL-8, IL-10, IFN-γ, TGF-β1 and VEGFA gene expression in LPS stimulated HaCaT cells was also confirmed. As a result, IL-1β, IL-6, IL-8, and IFN-γ had an effect of decreasing the amount of expression increased by LPS stimulation by liquid plasma treatment, and IL-10 and VEGFA were expressed by liquid plasma treatment. The amount increased further, and TGF-β1 was found to have no significant change. The results are shown in FIG. 14.

In addition, it was confirmed whether the liquid plasma affects the STAT3 activation in HaCaT. STAT3 activation is known to play an important role in Th17 cell differentiation and psoriasis development. The results are shown in FIG. Experimental results showed that liquid plasma treatment inhibited STAT3 activation (pSTAT3) in IL-6 stimulated HaCaT cells. These results suggest that liquid plasma may inhibit the STAT3 signaling pathway, leading to inhibition of psoriasis in mice.

Example 2-6. Increased PD-1 Expression in Activated HaCaT and BMDC Cells by Liquid Plasma (LTP)

It was confirmed whether the expression of PD-L1 is increased in HaCaT and BMDC cells activated by the liquid plasma according to the present invention, and the results are shown in FIG. 16. PD-L1 expression in DC has been reported to inhibit T cell activation via PD-1 / PD-L1 binding. Therefore, it has been suggested that overexpression or high expression of PD-L1 may induce T cell inactivation and may be helpful in the treatment of autoimmune diseases in which CD4 + T cells are abnormally activated. Recently, it has been reported that administration of recombinant PD-L1 has improved skin inflammation induced by IMQ in mice.

Experimental results show that liquid plasma treatment induces PD-L1 expression in HaCaT cells. In addition, RNA levels of PD-L1 were increased in TNFα / IFN-γ-stimulated, or LPS-stimulated HaCaT cells, and liquid plasma treatment in the stimulated cells further enhanced PD-L1 expression. These results suggest that liquid plasma therapy can alleviate psoriasis-like skin inflammation through the regulation of PD-L1 gene expression.

Example 3 Comparison of Psoriasis Treatment Effects of Non-thermal Atmospheric Pressure Plasma (NTP) and Liquid Plasma (LTP)

The effect of the liquid plasma (LTP) and plasma direct treatment (NTP) on the cells of the present invention was compared. Plasma direct treatment generates plasma under the same conditions using the same plasma apparatus used in liquid plasma production, but directly exposes the plasma to a culture dish in which HaCaT cells stimulated by TNF-α and IFN-γ are incubated. Method was used.

As a result of comparing the liquid plasma or plasma-treated cells, it was analyzed that the plasma-treated cells appeared to dry the cell surface. Considering that moisturizing is very important in psoriasis, the usefulness of a liquid plasma that can be provided in the form of a liquid substance such as a moisturizer is considered to be remarkable.

From the results of Examples 1 to 3, it was found that the liquid plasma of the present invention is remarkably effective in the prevention and treatment of skin inflammatory diseases including psoriasis.

Claims (11)

(a) filling a carrier gas into a plasma generating device;
(b) generating a plasma by supplying a voltage of 5 kV to 20 kV and a frequency of 10 to 30 kHz to the plasma generator; And
(c) a method for producing a liquid plasma for preventing or treating T lymphocyte-mediated skin disease, comprising irradiating the generated plasma to a liquid substance;
The liquid plasma suppresses the differentiation of Th 17 cells and Th 1 cells, and inhibits the expression of TNF-α, IFN-γ, IL-1β, IL-6 and IL-8, T lymphocyte mediated activity Liquid plasma production method for the prevention or treatment of skin diseases.
The method of claim 1,
The carrier gas in the step (a) is any one or more selected from the group consisting of nitrogen, helium, argon, and oxygen, liquid plasma production method for preventing or treating T lymphocyte-mediated skin diseases.
The method of claim 1,
The irradiation in step (c) is characterized in that it is carried out for 5 minutes to 120 minutes at a distance of 0.1cm to 15cm from the surface of the liquid material, liquid plasma preparation for the prevention or treatment of T lymphocyte-mediated skin diseases Way.
The method of claim 1,
The liquid substance in step (c) is water, saline, buffer, or medium, liquid plasma production method for the prevention or treatment of T lymphocyte-mediated skin diseases.
The method of claim 1,
The T lymphocyte-mediated skin diseases include systemic lupus erythematosus, cutaneous lupus erythematosus, scleroderma, psoriasis, dermatomyositis, and chronic dermatitis. A liquid plasma production method for the prevention or treatment of T lymphocyte-mediated skin diseases, which is at least one selected from the group consisting of
A pharmaceutical composition for preventing or treating T lymphocyte-mediated skin disease, comprising a liquid plasma prepared by the method of any one of claims 1 to 5 as an active ingredient.
The method of claim 6,
The pharmaceutical composition is an oral, parenteral or topical formulation, characterized in that the pharmaceutical composition for the prevention or treatment of T lymphocyte-mediated skin diseases.
The method of claim 6,
The pharmaceutical composition is used alone or in combination with methods using surgery, radiation therapy, hormonal therapy, chemotherapy and biological response modifiers, pharmaceutical composition for the prevention or treatment of T lymphocyte-mediated skin diseases. .
The method of claim 6,
The T lymphocyte-mediated skin diseases include systemic lupus erythematosus, cutaneous lupus erythematosus, scleroderma, psoriasis, dermatomyositis, and chronic dermatitis. A pharmaceutical composition for the prophylaxis or treatment of T lymphocyte-mediated skin diseases, which is at least one selected from the group consisting of
delete delete

Images