KR102033911B1 - Single strain having excellent algicidal activity and method for removing red tide using the same - Google Patents

Abstract

The present invention relates to a strain having excellent killing capacity and a red tide removing method using the same, and more particularly, to the algae strain of the genus Roseivirga, the killing microorganism strain, the culture of the strain or their The present invention relates to a microorganism preparation for removing red tide including a combination, and a method for removing red tide, including the step of introducing the microalgae strain, a culture of the strain, or a combination thereof into a sea area where red tide has occurred.

Description

Strain having excellent killing ability and red tide removal method using the same {SINGLE STRAIN HAVING EXCELLENT ALGICIDAL ACTIVITY AND METHOD FOR REMOVING RED TIDE USING THE SAME}

The present invention relates to a strain having an excellent killing capacity and a red tide removal method using the same, and more particularly, Chattonella marina (Akashiwo sanguinea) and heterocapsa tricate among the algae causing algae The present invention relates to a strain having excellent selective killing ability against Heterocapsa triquetra and a red tide removing method using the same.

Red tide generally refers to a phenomenon in which marine microorganisms such as fauna and flora plankton, protozoa and bacteria multiply or accumulate in large amounts at one time, discoloring the color of seawater and adversely affecting marine life. Red tide kills or poisons fish and shellfish, causing enormous damage to fisheries, and even affecting humans, causing serious problems directly and indirectly. The red tide phenomenon occurs widely in all coastal waters of the world and occurs regularly regardless of the season. In particular, red tide organisms tend to change from diatoms to flagella algae and become denser.

The organisms that cause red tide are phytoplankton and include diatom, dinoflagellate, blue-green algae, microalgae, and protozoa. About 50 species are found in Korea. Leads to Depending on the type of plankton, the color of the seawater is not limited to red, but may be dark brown, blue, or white.

Meanwhile, the known methods of removing red tide causes organisms include chemical spraying, ultrasonic and ozone treatment, sponge recovery and sedimentation, and yellow soil spraying. The most widely used chemical spraying method has been used in the past as a method of spraying copper sulfate (CuSO ₄ ), chlorine dioxide (ClO ₂ ), simazine (Simazine), etc. The copper sulfate used is not specific to harmful flagella algae, affecting other marine organisms besides the red tide-causing organisms, which can cause problems in terms of toxicity and corrosion to other organisms in the water. It should be used repeatedly because it shows only the effect, and the copper sulfate becomes unstable under the high alkaline environmental conditions that occur when red tide occurs.

Korean Patent No. 0407829 discloses a method of removing red tide by ultrasonic treatment, and this technique is a method of destroying cells of a red tide causing organism with ultrasonic waves, and the ozone treatment method is performed by applying high-pressure ozone to a red tide generating zone. As a method of neutralizing the toxicity caused by both methods, both methods have not reached the practical stage. Sponge recovery and sedimentation methods are widely used in Korea as a method of generating bubbles by using a pressure flotation separator consisting of a centrifuge, agglomeration main tank, a mixing tank, and a pressure flotation tank to adsorb, float, and recover red tide organisms from the sea surface. . In addition, the Republic of Korea Patent No. 0325396 discloses a red tide removal method by the loess spread method, that is, by spraying the loess (surfactant clay, Montmorillonite) in seawater to adsorb and settle the red tide organisms, aluminum ions in the loess are red tide. It is widely used in Korea as a method that uses the property of destroying the cells of the causative organism. However, the application of ocher in seawater is likely to increase suspended solids, which can affect living organisms, such as respiratory failure due to fish gill closure, in fish farms and fisheries where settlement organisms live in the lower layers. In addition, ocher is believed to cause secondary pollution in the oceans by sinking and killing red tide creatures under the sea.

As another method for controlling red tide, many biological methods have been attempted, and the role of bacteria in red tide is important.

Therefore, when a new microorganism is provided that can solve the above problems and at the same time effectively remove red tide, it is expected to be usefully applied in related fields.

One aspect of the present invention is to provide a strain having excellent killing ability.

Another aspect of the present invention is to provide a microbial preparation for red tide removal comprising a strain having excellent killing ability.

Another aspect of the present invention is to provide a method for effectively removing red tide by using the microorganism agent or strain having excellent killing ability.

According to one aspect of the invention, there is provided a microorganism strain of genus Roseivirga genus having a killing power.

According to another aspect of the present invention, there is provided a microbial preparation for red tide removal comprising at least one selected from the group consisting of the supernatant obtained after centrifugation of the microalgae strain, the culture medium of the strain and the culture medium of the strain.

According to another aspect of the invention, the red tide removal comprising the step of injecting at least one selected from the group consisting of the supernatant obtained after centrifugation of the algae microorganism strain, the culture medium of the strain and the strain culture. A method is provided.

According to the present invention, there is provided a new microorganism having excellent killing ability and the red tide removing method using the same, which can effectively remove red tide microorganisms at the same time without causing secondary pollution or harmful effects on other organisms. By effectively controlling the water, it is possible to control red tide generated in seawater, farms and the like.

1 is a micrograph for the selection of bacterial culture media that do not affect Chattonella marina.
Figure 2 (a) is a micrograph comparing the killing rate of the control group and the experimental group for the Chattonella marina (C15) of the selected bactericidal bacteria (TF15), Figure 2 (b) is a graph related to this.
Figure 3 (a) is a micrograph showing the changes in the killing capacity of the selected antagonistic bacteria (TF15) over time Chattonella marina (Chattonella marina), Figure 3 (b) is a graph associated with this.
Figure 4 is a graph showing the killing efficiency of the Chattonella marina (Chattonella marina) according to the culture concentration (OD 600nm) of the selected microbial bacteria (TF15).
Figure 5 (a) is a micrograph showing the efficiency of the algae of the selected bactericidal bacteria (TF15) for Akashiwo sanguinea, Heterocapsa triquetra, Figure 5 (b) A graph showing the algae efficiency for red algae harmful algae.

Hereinafter, with reference to the accompanying drawings will be described a preferred embodiment of the present invention. However, embodiments of the present invention may be modified in various other forms, and the scope of the present invention is not limited to the embodiments described below.

According to the present invention, there is provided a microbial agent comprising at least one selected from the group consisting of a strain having excellent killing ability, a culture medium of the strain and a supernatant obtained after centrifugation of the culture medium of the strain, and a method of removing red tide using the same.

In the present invention, the strain having excellent killing ability means to effectively kill (kill) algae causing algae. By this action, the strain of the present invention can be widely used for controlling activities such as suppressing or removing red tide.

According to the present invention, there is provided a Roseivirga genus microbial strain having excellent killing ability, in particular the strain is a Roseivirga D-25 strain, Roseivirga genus TF15 (Roseivirga sp. TF15 , Accession number KACC81069BP). The Roseivirga sp. TF15 KACC81069BP strain was deposited with the National Institute of Agricultural Science (KACC) on November 24, 2017, and received a deposit certificate of KACC81069BP on January 3, 2018. Obtained.

In particular, compared to the marine bacteria belonging to γ-proteobacteria are known as the algae bacteria, the strain having the killing ability according to the present invention belongs to the sphingobacteria (Sphingobacteria), the killing ability of the bacteria belonging to this Not in condition. In addition, the Roseivirga D-25 strain has the characteristics of aerobic Gram-negative, rod-like, non-kinetic, optimal growth temperature is 30 ℃, the optimum salinity is 2% Nacl, the optimum pH is 7.0 to be.

The microorganism strain according to the present invention has a selective killing ability against Akashiwo sanguinea, Heterocapsa triquetra, or a combination thereof among red tide microorganisms, in particular among red tide producing algae.

In particular, it is possible to express excellent killing ability by using at least one selected from the group consisting of a microalgae strain, a culture solution of the strain and a culture solution of the strain obtained after centrifugation.

On the other hand, according to the present invention is provided a microorganism preparation for removing red tide comprising the microorganism strain of the present invention having an excellent killing ability as described above, in more detail the algal microorganism strain of the present invention, the culture medium and strain of the present invention There is provided a microbial preparation for red tide removal comprising at least one selected from the group consisting of a supernatant obtained after centrifugation of the culture.

The microbial agent is one that has selective killing ability against Akashiwo sanguinea, Heterocapsa triquetra, or a combination thereof among the red tide generating algae.

The microbial preparation can be prepared, for example, by immobilizing the strain on a carrier. When the carrier is used, the microbial agent enables stable distribution of the strain when applied to a red tide generating area, and the degree of dilution in seawater is reduced. Accordingly, it is possible to maintain the killing ability continuously.

According to another aspect of the invention, the step of injecting at least one selected from the group consisting of the supernatant obtained after centrifugation of the algae microorganism strain of the present invention, the culture medium of the strain and the culture medium of the strain as described above Red tide removal method comprising a.

At this time, the algae microorganism strain to be added to the sea area where the red tide is generated is preferably introduced at a concentration of 0.4 to 1 in O.D 600nm, more preferably at a concentration of 0.6 to 1 in O.D 600nm.

Referring to FIG. 4, when the concentration of the algae microorganism strain is 0.4 or more at O.D 600 nm, it can be confirmed that the algae efficiency is 50% or more, and in the case of 0.6 or more, the algae efficiency can be expressed by reaching 90% or more.

At this time, the control of the O.D value is a value calculated by adding only R2A 3.5% Nacl medium to Chattonella marina birds without inoculating TF15 bacteria.

On the other hand, the algae effect by the algae microorganism strain of the present invention is to express a remarkable algae effect from about 6 hours after the treatment for red tide removal, after 18 hours may exhibit about 90% or more of the algae effect.

In particular, the red tide which can be treated by the red tide removing method of the present invention is a red tide generated by algae including akashiwo sanguinea, heterocapsa triquetra, or a combination thereof among red tide generating algae. It is

Thus, according to the present invention, there is provided a new microorganism with excellent algae ability to effectively remove red tide microorganisms at the same time without causing secondary pollution or harmful effects to other organisms, and the red tide removal method using the same, according to the present invention By effectively controlling the red tide microorganisms, it is possible to control the red tide generated in seawater, fish farms and the like.

Hereinafter, the present invention will be described in more detail with reference to specific examples. The following examples are merely examples to help understanding of the present invention, but the scope of the present invention is not limited thereto.

EXAMPLE

1. Microbial Sampling

In order to secure strains with red tide removal efficiency, we collected the dredged soil of Changho-ri, Sadeung-myeon, Geoje-si, Gyeongsangnam-do, and the dredged soil of Jangsaengpo Port in Ulsan. Sampling was conducted three times: seawater at Geoje-si on May 8, 2017, 1st dredged soil in Jangsaengpo Port, Ulsan on June 12, 2017, and 2nd dredged soil of Jangsaengpo Port, Ulsan, June 21, 2017. Seawater samples were collected 20L each by using a sump, and dredged soil samples were collected by 10kg. The collected seawater and dredged soil samples were transported in ice box.

2. Strain Isolation

On the basis of the collected sample, a strain separation operation was performed to secure algae microorganisms.

(1) Isolation of Strain from Jangsaengpo Port Dredged Soil Sample

500 ml of marine broth (Difco 2261, Table 1) was added to 500 g of dredged soil obtained from Jangsaengpo Port in Ulsan, and then shaken at 150 rpm for 1 hour and centrifuged at 8000 rpm for 10 minutes to secure a supernatant. After filtering the supernatant with a filter of 0.2um pore size, the remaining strains in the filter were placed in 5ml of marine broth (Difco 2261, Table 1), and then smeared on the marine agar (Difco 2261, Table 1) to give aerobic conditions and temperature 30 Incubated for 48 hours.

(2) Isolation of Strains from Seawater Samples during Geoje

1 L of seawater samples obtained from Changho-ri, Sadeung-myeon, Geoje-si, Gyeongsangnam-do were filtered through a 0.2um pore filter. Then, the remaining strains in the filter was put in 5 ml of marine broth (Difco 2261, Table 1) and spread on the marine agar (Difco 2261, Table 1) and incubated for aerobic conditions, temperature 30 ℃, 48 hours.

Medium composition of marine medium 2216 (adjustable pH 7.6 ± 0.2) peptone 5 g Yeast extract 1 g Ferric Citrate 0.1 g Sodium chloride 35 g Magnesium chloride 5.9 g Magnesium sulfate 3.24 g Calcium chloride 1.8 g Potassium chloride 0.55 g Sodium bicarbonate 0.16 g Potassium bromide 0.08 g Strontium chloride 34 mg Boric acid 22 mg Sodium silicate 4 mg Sodium fluoride 2.4 mg Ammonium nitrate 1.6 mg Disodium phosphate 8 mg D.W. 1000 ml

The number of isolated bacteria according to the type of sample collected is shown in Table 2 below. The total number of isolates was 101 through three sampling processes. The killing ability was tested using the isolates thus separated. In Table 1, the dredged soil primary and secondary are sampled on different dates in the same region.

Geoje Sea Water
(2017.05.08Sampling) Ulsan Jangsaengpo Port 1st
(Sample 2017.06.12) Ulsan Jangsaengpo Port 2nd
(2017.06.21 sampling) synthesis Number of isolates 24 35 42 101

3. Selection and Cultivation of Red Tide

(1) Selection of Red Tide Creatures and Medium

In order to select the most frequently occurring red tide microorganisms offshore, we investigated the frequency of red tide based on existing papers and data. At this time, the database of red tide papers published in Korea, the Marine Fisheries Research and Development Institute, and the Marine Science and Technology Institute were used. Among them, the frequency of occurrence was steadily increasing, and Chattonella marina, which caused severe damage by increasing the risk of suffocation due to impaired gill function of fish, was selected and used in the experiment of the algae. The selected red tide was distributed from the Marine Sample Library of the Namhae Research Institute of the Korea Maritime Institute of Science and Technology. The precultured birds were incubated at 12,000Lux at 20 ° C. and 14:10 light intensity using f / 2 medium (Table 3).

ingredient Stock Solution sheep NaNO ₃ 75 g / L dH ₂ O 1 mL NaH ₂ PO ₄ H ₂ O 5 g / L dH ₂ O 1 mL Na ₂ SiO ₃ 9H ₂ O 30 g / L dH ₂ O 1 mL Trace metal solution (see recipe below) 1 mL Vitamin solution (see recipe below) 0.5 ml sea water 1L

Table 4 below shows the composition of the trace metal solution of f / 2 medium, and Table 5 shows the composition of the vitamin solution of f / 2 medium.

ingredient Primary Stock Solution sheep FeCl ₃ 6H ₂ O - 3.15 g Na ₂ EDTA2H ₂ O - 4.36 g CuSO ₄ 5H ₂ O 9.8 g / L dH ₂ O 1 mL Na ₂ MoO ₄ 2H ₂ O 6.3 g / L dH ₂ O 1 mL ZnSO ₄ 7H ₂ O 22.0 g / L dH ₂ O 1 mL CoCl ₂ 6H ₂ O 10.0 g / L dH ₂ O 1 mL MnCl ₂ 4H ₂ O 180.0 g / L dH ₂ O 1 mL D.W 1L

ingredient Primary Stock Solution sheep Thiamine HCl (vit. B ₁ ) - 200 mg Biotin (vit. H) 0.1 g / L dH ₂ O 10 mL Cyanocobalamin (vit.B ₁₂ ) 1.0 g / L dH ₂ O 1 ml D.W 1L

(2) Selection of medium which does not affect Chattonella marina

In the case of Chattonella marina, it was confirmed that the higher the nutrient concentration of the bacterial culture medium during killing activity screening, the more it was killed by the influence of the bacterial medium. Therefore, the culture medium of the bacteria which is not killed by Chattonella marina was primarily selected.

A total of four culture mediums (marine broth, 50% marine broth, LB broth and 3.5% Nacl R2A broth) and Chatonella Marina Chattonella marina) was mixed at a ratio of 9: 1 to determine whether or not Chattonella marina was killed by microscopic observation after 24 hours. At this time, the composition of the 3.5% Nacl R2A broth is shown in Table 6.

Composition of 3.5% Nacl R2A Broth (Controlled pH 7.2 ± 0.2) Proteos peptone 0.5 g Yeast extract 0.5 g Casein's Oxygen Digestion 0.5 g Glucose 0.5 g Soluble starch 0.5 g Dipotassium Phosphate 0.3 g Magnesium sulfate 0.024 g Sodium pyruvate 0.3 g Sodium chloride 35 g D.W. 1000 ml

As a result, it was confirmed that Chattonella marina was actively moved without being affected by the medium only in 3.5% Nacl Al2A broth (see FIG. 1). Therefore, the screening was performed by inoculating the bacteria to 3.5% Nacl Altoei broth (3.5% Nacl R2A broth).

4. Killer  Screening of Strains

The killing ability of each marine microbial strain was investigated through a mixed culture between the isolated marine microbial strain and Chattonella marina. The method used was a method of directly counting algae cells under a microscope. Screens of antagonistic strains were cultured with 0.9 mL of algae culture (3.5% Nacl R2A broth, OD 600nm 0.8 culture) in 24 transplate wells, supernatant after centrifugation, pellet suspension after centrifugation. Each 0.1ml was mixed and cultured in a total of 1.0ml 20 ℃ 12,000Lux, contrast cycle 14:10. After 24 hours, 1 ml was transferred to the Sedgwick-Rafter chamber to fix the alga with 1% of lugol's solution and count the algae directly on the microscope. Killing ability was calculated with reference to the following formula (1).

[Equation 1]

At this time, a total of three samples were prepared as follows to carry out a killing experiment on the Chattonella marina.

Sample No. 1: 1 ml of TF15 culture sample (3.5% Nacl R2A broth, O.D 600 nm 0.8 incubation)

Sample No. 2: A supernatant sample obtained by centrifuging 1 ml of TF15 culture at 13000 rpm for 3 minutes

Sample No. 3: A sample in which 1 ml of TF15 culture was centrifuged at 13000 rpm for 3 minutes and a pellet containing the supernatant was suspended with 1 ml of 3.5% NaCl.

As a result, it was confirmed that the culture solution of Roseivirga TF15 (sample 1) and the supernatant (sample 2) obtained after centrifugation of the culture solution showed more than 90% killing ability, whereas the supernatant was removed after centrifugation. The pellet suspension (sample 3) had no killing capacity (see Table 7, FIG. 2). This means that TF15 secretes algal material out of cells.

Compared to many marine bacteria belonging to γ-proteobacteria, known as algae, TF15 of the genus Roseivirga, which is selected through this study, belongs to the sphingobacteria. Manipulation is little known.

Sample Strain Chattonella Marina Removal rate (%) Count (number of cells / mL) 1 sample Roseivirga TF15 culture 95.7 8.51 × 10 ² (control: 1.97 × 10 ⁴ ) 2 samples Supernatant after centrifugation with Roseivirga TF15 95.9 7.89 × 10 ² (control: 1.97 × 10 ⁴ ) Sample 3 Pellet suspension after centrifugation with Roseivirga TF15 4.1 1.89 × 10 ⁴ (control: 1.97 × 10 ⁴ )

5. Rojbirza  Identification of Strains

Morphological identification of Roseivirga TF15 of the present invention was observed by culturing in Marine Agar medium, and the detailed structure of the strain grown in Marine Agar medium was identified by optical microscopy. Molecular biology was analyzed by 16s ribosomal RNA partial gene sequence. The 16s ribosomal RNA (1448 bp) partial gene sequence used for the analysis is as follows.

CAGGATGAACGCTAGCGGCAGGCCTAATACATGCAAGTCGAACGGTAGACTACTTTCGGGTAGTTGAGAGTGGCGCACGGGTGCGTAACGCGTATGCAACCTACCTTGTACAGGGGGATAGCCCGAAGAAATTCGGATTAATACCCCATAGCATTACCAGATGGCATCTGAAGGTAATTAAAGATTTATCGGTACAAGATGGGCATGCGTGACATTAGTTAGTTGGTAGGGTAACGGCCTACCAAGACTATGATGTCTAGGGGTTCTGAGAGGATGATCCCCCACACTGGTACTGAGATACGGACCAGACTCCTACGGGAGGCAGCAGTAGGGAATATTGGTCAATGGGCGAGAGCCTGAACCAGCCATGCCGCGTGCAGGAAGACGGCCTTCTGGGTTGTAAACTGCTTTTATACGGGAAGAAAAGACCCTTGCGAGGGAGATTGCCGGTACCGTATGAATAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGCCTTTAAGTCAGTGGTGAAAGCCTGCAGCTTAACTGTAGAACTGCCATTGATACTGGAGGCCTTGAGTGTACTAGAGGTAGGCGGAATTTATGGTGTAGCGGTGAAATGCATAGATACCATAAAGAACACCGATAGCGTAGGCAGCTTACTGGAGTACAACTGACGCTGAGGCACGAAAGCATGGGGAGCGAACAGGATTAGATACCCTGGTAGTCCATGCCGTAAACGATGATTACTCGATGTTGGCGATACACTGTCAGCGTCCAAGCGAAAGCGTTAAGTAATCCACCTGGGGAGTACGCTCGCAAGAGTGAAACTCAAAGGAATTGACGGGGGTCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGATACGCGAGGAACCTTACCTGGGCTAGAATGTGAGCGAATGATCCAGAGATGGATCAGTCTTCGGACGCGAA ACAAGGTGCTGCATGGCTGTCGTCAGCTCGTGCCGTGAGGTGTTGGGTTAAGTCCCGCAACGAGCGCAACCCCTATTGTTAGTTGCCAGCACGTAAAGGTGGGGACTCTAACAAGACTGCCTACGCAAGTAGAGAGGAAGGAGGGGACGACGTCAAGTCATCATGGCCCTTACGCCCAGGGCTACACACGTGCTACAATGGAGAGTACAGAGGGTCGCTACCTGGTAACAGGATGCCAATCTCAAAAAGCTCTTCTCAGTTCGGATTGAGGTCTGCAACTCGACCTCATGAAGTTGGAATCGCTAGTAATCGCGTATCAGCAATGACGCGGTGAATACGTTCCCGGACCTTGTACACACCGCCCGTCAAGCCATGGGAGTTGGGTGGACCTGAAGATGGTTGCTGCAAGGCGCTATTTAGGGTAAAACCAGCGACTGGGGCTAAGTCG

The 16s rRNA 1448bp of the Roseivirga TF15 strain was ncbi searched for Roseivirga sp . D-25 16S ribosomal RNA gene, partial sequence was confirmed to match 100% identical.

Accordingly, the present inventors identified the Roseivirga TF15 strain as a Roseivirga D-25 (Roseivirga sp. D-25) by synthesizing the morphological and molecular features as described above. It was deposited on November 24, 2017 by the Korean Agricultural Culture Collection (KACC), Academy of Sciences (accession number KACC 81069BP).

6. High efficiency strain Hourly , Bacteria Concentration Killer  Confirm

After confirming the high killing ability of Roseivirga TF15, experiments were performed to confirm the killing ability by time and the concentration of bacteria in detail.

(1) high efficiency strains Hourly Killer  Confirm

In order to see the change in the killing ability of the selected microorganisms through the 24-hour mixed culture, it was counted every 6 hours to confirm the hourly killing ability of the highly efficient strain Roseivirga TF15 of the present invention.

1 ml of Roseivirga TF15, inoculated with 3.5% Nacl R2A broth in 9 ml of Chontonella marina culture, and cultured up to OD 0.9. After that, the samples were sampled every 6 hours, 12 hours, 18 hours, and 24 hours from 0 to 1 ml in the Sedgwick-Rafter chamber to directly count the number of algae on the microscope. At this time, the algicidal power was calculated by referring to the above equation 1.

As a result, it showed a killing power of 79% after 6 hours and more than 95% killing power after 24 hours (see Fig. 3).

(2) high efficiency strains Concentration  ( O.D  600nm) Killer  Confirm

The following experiment was carried out to see the changes in the killing ability of each of the concentrations of Roseivirga TF15 selected through the 24 hours mixed culture.

0.1 ml of TF15 culture inoculated with 3.5% Nacl R2A broth in 0.9 ml of Chontonella marina culture was added to each concentration (OD 600nm 0.1 to OD 600nm 1.0). 24 hours mixed culture. 1 ml was then transferred to the Sedgwick-Rafter chamber to directly count the number of algae on the microscope. At this time, the algicidal power was calculated by referring to the above equation 1.

As a result, it was confirmed that 50% or more of O.D 600nm 0.4 or more, and 90% or more of O.D 600nm 0.6 or more of TF15 (see Fig. 4).

7. Rojbirza ( Roseivirga ) Other harmful birds in TF15 Killer  Confirm

An experiment was conducted to determine whether Roseivirga TF15, which has excellent killing ability in Chattonella marina, also kills other red algae that are frequently found in the coast of Korea.

A total of six red tide organisms were used in the experiment, and more specifically, akashiwo sanguinea, heterosigma akashiwo, prorocentrum minimum, and heterocapsa triquetra. , Cochlodinium polykrikoides and Skeletonema costatum.

The algal culture of each of the above red tide organisms and 0.1ml of the culture solution of Lojbirja TF15 (3.5% Nacl R2A broth, OD 600nm 0.8 culture) were mixed and mixed in a total of 1.0ml, 20 ℃ 12,000Lux, contrast cycle 14:10 Incubated for 24 hours. After 24 hours, 1 ml was transferred to Sedgwick-Rafter chamber to fix algae with 1% of lugol's solution, and the algae efficiency was directly counted under a microscope to measure algae efficiency. At this time, the control of the O.D value is a value calculated by adding only R2A 3.5% Nacl medium to Chattonella marina birds without inoculating TF15 bacteria.

As a result, the culture medium of TF15 showed 86.3% and 76.3% killing ability in Akashiwo sanguinea and Heterocapsa triquetra, respectively, and Heterosigma akashiwo and Prolocenetium. Prorocentrum minimum, Cochlodinium polykrikoides and Skeletonema costatum showed low killing capacity of less than 10% (see FIG. 5).

Although the embodiments of the present invention have been described in detail above, the scope of the present invention is not limited thereto, and various modifications and changes can be made without departing from the technical spirit of the present invention described in the claims. It will be obvious to those of ordinary skill in the field.

<110> Kyonggi University Industry & Academia Cooperation Foundation <120> SINGLE STRAIN HAVING EXCELLENT ALGICIDAL ACTIVITY AND METHOD FOR          REMOVING RED TIDE USING THE SAME <130> DPP172433 <160> 1 <170> KoPatentIn 3.0 <210> 1 <211> 1448 <212> RNA <213> Unknown <220> <223> RoseivirgaTF15 <400> 1 caggatgaac gctagcggca ggcctaatac atgcaagtcg aacggtagac tactttcggg 60 tagttgagag tggcgcacgg gtgcgtaacg cgtatgcaac ctaccttgta cagggggata 120 gcccgaagaa attcggatta ataccccata gcattaccag atggcatctg aaggtaatta 180 aagatttatc ggtacaagat gggcatgcgt gacattagtt agttggtagg gtaacggcct 240 accaagacta tgatgtctag gggttctgag aggatgatcc cccacactgg tactgagata 300 cggaccagac tcctacggga ggcagcagta gggaatattg gtcaatgggc gagagcctga 360 accagccatg ccgcgtgcag gaagacggcc ttctgggttg taaactgctt ttatacggga 420 agaaaagacc cttgcgaggg agattgccgg taccgtatga ataagcaccg gctaactccg 480 tgccagcagc cgcggtaata cggagggtgc aagcgttgtc cggatttatt gggtttaaag 540 ggtgcgtagg cgggccttta agtcagtggt gaaagcctgc agcttaactg tagaactgcc 600 attgatactg gaggccttga gtgtactaga ggtaggcgga atttatggtg tagcggtgaa 660 atgcatagat accataaaga acaccgatag cgtaggcagc ttactggagt acaactgacg 720 ctgaggcacg aaagcatggg gagcgaacag gattagatac cctggtagtc catgccgtaa 780 acgatgatta ctcgatgttg gcgatacact gtcagcgtcc aagcgaaagc gttaagtaat 840 ccacctgggg agtacgctcg caagagtgaa actcaaagga attgacgggg gtccgcacaa 900 gcggtggagc atgtggttta attcgatgat acgcgaggaa ccttacctgg gctagaatgt 960 gagcgaatga tccagagatg gatcagtctt cggacgcgaa acaaggtgct gcatggctgt 1020 cgtcagctcg tgccgtgagg tgttgggtta agtcccgcaa cgagcgcaac ccctattgtt 1080 agttgccagc acgtaaaggt ggggactcta acaagactgc ctacgcaagt agagaggaag 1140 gaggggacga cgtcaagtca tcatggccct tacgcccagg gctacacacg tgctacaatg 1200 gagagtacag agggtcgcta cctggtaaca ggatgccaat ctcaaaaagc tcttctcagt 1260 tcggattgag gtctgcaact cgacctcatg aagttggaat cgctagtaat cgcgtatcag 1320 caatgacgcg gtgaatacgt tcccggacct tgtacacacc gcccgtcaag ccatgggagt 1380 tgggtggacc tgaagatggt tgctgcaagg cgctatttag ggtaaaacca gcgactgggg 1440 ctaagtcg 1448

Claims (9)

Roseivirga sp. TF15, Roseivirga spp. No. KACC81069BP) Algae Microbial Strains.
delete delete Claim 1 for removing red tide comprising at least one composition selected from the group consisting of a composition comprising the strain of the microorganism, the composition comprising the culture medium of the strain and the supernatant obtained after centrifugation of the culture medium of the strain. Microbial agents.
The microorganism preparation according to claim 4, wherein the microbial preparation has a selective killing ability against Akashiwo sanguinea, Heterocapsa triquetra, or a combination thereof. .
Claim 1, wherein at least one composition selected from the group consisting of a composition comprising the microorganism strain, the composition comprising the culture medium of the strain and the supernatant obtained after centrifugation of the culture medium of the strain in the sea area where red tide occurs Red tide removal method comprising the step of injecting.
The red tide removing method according to claim 6, wherein the algae microbial strain introduced into the sea area where the red tide is generated is introduced at a concentration of 0.4 to 1 at OD 600 nm.
The method of claim 6. Red tide microorganism strain to be injected into the sea area where the red tide is generated is introduced at a concentration of 0.6 to 1 at OD 600nm, red tide removal method.
The red tide removing method according to claim 6, wherein the red tide is a red tide generated by an alga including akashiwo sanguinea, heterocapsa triquetra, or a combination thereof.

Images