KR102022247B1 - Novel proteins enhancing drought stress tolerance of plants, genes encoding the proteins and transgenic plants transformed with the genes - Google Patents

Abstract

Disclosed herein is a PagSAP5 protein that enhances plant dry stress resistance from Populus alba × Populus glandulosa , a tolerant gene encoding the protein, and a plant transformed with the gene to increase resistance to dry stress. .
PagSAP5 gene / protein according to the present invention is involved in the resistance to dry stress of plants, can be usefully used for the improvement of trees and crops, etc. through the expression control of the gene / protein, plants transformed with PagSAP5 gene It has excellent resistance to dry stress and can be usefully used as a plant with improved biomass productivity in a dry environment caused by climate change due to global warming.

Description

Novel proteins enhancing drought stress tolerance of plants, genes encoding the proteins and transgenic plants transformed with the genes}

The present invention relates to a protein for enhancing the dry stress resistance of a plant, a novel gene encoding the protein, a plant transformed with the gene, and more specifically, a plant drying derived from Populus alba × Populus glandulosa . PagSAP5 protein that promotes stress resistance, a tolerant gene that encodes this protein, and a plant that has been transformed with this gene and has enhanced resistance to dry stress.

Forest species that rarely manage growth after planting face a variety of abiotic stresses such as dryness, high salt, cold water, heavy metals, thermal shock, and ozone during a lifetime in a fixed growth environment. It is a limiting factor of development and is a major cause of production decline.

In particular, as global average temperatures increase due to global warming, the deaths of trees with weak dry tolerance are increasing, forests and soils are gradually desolated, and soil desertification is continuously increasing. Therefore, it is important to study the functions of proteins and genes related to dry stress resistance that affect tree productivity.

 Genetic engineering studies using genes encoding dry stress-related proteins are very useful methods for developing dry stress resistant transgenic plants, and reports of many transgenic plants developed by genetic engineering techniques have increased the resistance to dry stress. In addition, various resistance genes have been found in various crops, and research on the expression network has been actively conducted (Registration 10-1325044, Registration 10-1758868).

However, there are very few reports on the proteins that improve resistance to dry stress in trees and genes encoding them, and their function is not well known.

 Accordingly, the present inventors continued to search for genes that can improve the dryness of trees, and as a result, genes having the nucleotide sequence of SEQ ID NO: 1 are involved in tree dry resistance traits and this gene has increased expression during dry stress treatment. In addition, when transformed to the plant was confirmed that can improve the drying resistance of the plant was completed the present invention.

It is therefore an object of the invention is SEQ ID NO: 1 Promotion of tree drying resistance having the nucleotide sequence PagSAP5 (P opulus a lba × Populus g landulosa S tress A ssociated P rotein 5) gene, and SEQ ID NO: 1 or encoded by the nucleotide sequence of SEQ ID NO: To provide a dry-resistant enhancing PagSAP5 protein comprising the amino acid sequence of No. 2.

Still another object of the present invention is to provide a vector comprising the PagSAP5 gene and a plant having improved resistance to dry stress transformed by the vector.

Still another object of the present invention is to provide a method of increasing the expression of the PagSAP5 gene to enhance the dry stress resistance of plants.

In order to achieve the above object of the present invention, the present invention provides a PagSAP5 gene having a nucleotide sequence of SEQ ID NO: 1, encoding a protein that enhances dry stress resistance.

PagSAP5, a gene of the present invention, was isolated from the Populus alba × Populus glandulosa , and was confirmed to consist of the nucleotide sequence of SEQ ID NO: 1 through sequencing (Example 1).

The present inventors studied the dry stress response of the hawthorn tree, the fact that the PagSAP5 gene is strongly expressed in plants when treated with absicic acid (ABA), a dry stress and plant hormone, and when the expression of the gene is increased. Confirming that the resistance to dry stress is enhanced, the PagSAP5 gene was identified as a gene involved in dry stress resistance (Example 2).

According to another object of the present invention, the present invention provides a dry-tolerance enhancing PagSAP5 protein, encoded by the nucleotide sequence of SEQ ID NO: 1 or comprising the amino acid sequence of SEQ ID NO: 2.

In the present invention, the tolerability enhancing PagSAP5 protein comprises an amino acid sequence having at least 90%, preferably 95%, more preferably 98% or more sequence homology with the amino acid sequence of SEQ ID NO. Also includes functional equivalents exhibiting homogeneous, dry tolerant activity.

In such functional equivalents, the substitution of amino acids is preferably a conservative substitution. Examples of conservative substitutions of naturally occurring amino acids include aliphatic amino acids (Gly, Ala, Pro), hydrophobic amino acids (Ile, Leu, Val), aromatic amino acids (Phe, Tyr, Trp), acidic amino acids (Asp, Glu) And basic amino acids (His, Lys, Arg, Gln, Asn) and sulfur-containing amino acids (Cys, Met). Deletion of amino acids is preferably located in portions not directly involved in the activity of the PagSAP5 protein of the invention. In addition, the functional equivalent range includes protein derivatives in which some chemical structures of the protein are modified while maintaining the basic skeleton of the PagSAP5 protein and its physiological activity. For example, fusion proteins made by fusion with other proteins such as GFP (Green Fluorescent Protein), or the like, while maintaining the physiological activity of the protein of the present invention include.

According to another object of the present invention, the present invention provides a recombinant vector comprising the PagSAP5 gene.

In the present invention, the recombinant vector containing the PagSAP5 gene is preferably a plant expression vector, more preferably the recombinant vector described in FIG. 5A, but is not limited thereto. In general, vectors can be used if they can replicate and stabilize in plants.

In the present invention, the recombinant vector is functionally linked with an expression control sequence so that the PagSAP5 gene can be expressed. For example, a vector may contain a signal sequence or leader sequence for membrane targeting or secretion in addition to expression control elements such as promoters, operators, initiation codons, termination codons, polyadenylation signals, enhancers and may be prepared in various ways depending on the purpose. . In addition, the vector may comprise a selectable marker, and the vector may self replicate or integrate into the host DNA. Vectors of the present invention can be prepared using genetic recombination techniques well known in the art, and site-specific DNA cleavage and ligation uses enzymes commonly known in the art.

Preferred examples of plant expression vectors of the invention are Ti-plasmid vectors capable of transferring part of themselves, the so-called T-region, to plant cells when present in a suitable host such as Agrobacterium tumerfaciens. Other types of Ti-plasmid vectors are currently used to transfer hybrid DNA sequences to protoplasts from which plant cells, or new plants, that properly insert hybrid DNA into the plant's genome can be produced.

Other suitable vectors that can be used to introduce the genes according to the invention into plant hosts are viral vectors, such as those which can be derived from double stranded plant viruses (eg CamV) and single stranded viruses, gemini viruses, etc. For example, it may be selected from an incomplete plant viral vector. The use of such vectors can be advantageous, especially when it is difficult to properly transform a plant host.

According to another object of the present invention, the present invention provides a plant having improved resistance to dry stress transformed by the vector.

In the present invention, "plant" is understood as a meaning including not only mature plants but also plant cells, plant tissues and seeds of plants that can develop into mature plants. In the present invention, transforming a plant with the vector may be performed by a transformation technique known to those skilled in the art. Preferably, transformation method using Agrobacterium, microprojectile bombardment, electroporation, PEG-mediated fusion, microinjection, vacuum infiltration method), floral meristem dipping method, and Agrobacteria spraying method can be used.

In the present invention, the plants are trees including evergreens, deciduous trees, conifers, deciduous trees, trees, shrubs, vines and the like; Fruit trees including grapes, apple trees, pear trees, jujube trees, peaches and the like; Food crops, including rice, wheat, barley, corn, and the like; Vegetable crops including Arabidopsis, cabbage, radish, red pepper, strawberries and the like; Special crops including ginseng, tobacco and the like; Flowers including roses, gladiolus, and the like; And it is any one selected from the group consisting of fodder crops including lygras, red clover and the like, preferably a tree, more preferably a poplar including a thorn tree and the like.

Plants transformed with the PagSAP5 gene according to the present invention significantly enhanced the resistance to dry stress (Fig. 6, Fig. 7, Table 3).

Still another object of the present invention is to provide a method of increasing the expression of the PagSAP5 gene to enhance the dry stress resistance of plants. The method comprises the steps of (a) transforming a plant with a PagSAP5 gene; And (b) overexpressing PagSAP5 gene in said transformed plant.

"Overexpression" in the present invention means increased expression of the gene, specifically, transcription to RNA.

"Dry stress tolerance" in the present invention means to maintain growth and production by a comprehensive response effort of various morphological, physiological or biochemical traits in dry stress conditions. The main traits related to dry stress resistance include myocardiality, leaf aging, pore opening, osmotic control, and cell membrane structure ability, which contribute to maintaining good moisture and productivity under dry conditions.

PagSAP5 gene / protein according to the present invention is involved in the resistance to dry stress of plants, it can be usefully used for the improvement of trees and crops, etc. through the expression control of the gene / protein.

Plants transformed with the PagSAP5 gene according to the present invention can be usefully used as plants with improved biomass productivity in a dry environment caused by changes in climatic conditions due to global warming due to excellent resistance to dry stress.

1 shows the nucleotide sequence of the PagSAP5 gene.
2 shows the amino acid sequence of PagSAP5 protein.
Figure 3 shows the expression of PagSAP5 gene following dry stress treatment (250 mM mannitol, Man) and plant hormone treatment (25 μM of abscitic acid, ABA) in the suspension tree culture.
4 shows the results of tissue-specific expression analysis of the PagSAP5 gene. ML is Mature Leaf, YL is Young Leaf, S is Stem, R is Root, F is Flower.
5A shows a gene map of the recombinant expression vector pBI121-PagSAP5 prepared by inserting the PagSAP5 gene into the pBI121 vector.
5B shows a gene map of the recombinant vector pK7GWIWG2 (I) -PagSAP5, which is an RNAi vector for suppressing the expression of the PagSAP5 gene.
FIG. 6A shows the results of analysis of the expression level of PagSAP5 gene of the hawthorn line (OX1, OX2, OX3) transformed with pBI121-PagSAP5 overexpression vector (OX) by real-time qRT-PCR. WT is control type (Wild type)
Figure 6b is a real-time-qRT-PCR analysis of the expression level of PagSAP5 gene of the hawthorn line (Ri1, Ri2, Ri3, Ri4) transformed with pK7GWIWG2 (I) -SAP5 expression inhibitory RNAi vector (Ri) Indicates. WT is control type (Wild type)
Figure 7a shows the results of analyzing the phenotype after growth in dry stress conditions (single 12 days) of transformed cultivars (OX1, OX3, Ri2, Ri3).
FIG. 7B shows the change in chlorophyll fluorescence (Fv / Fm) in growth under dry stress conditions (single 12 days) of transformed cultivars (OX1, OX3, Ri2, Ri3).

Hereinafter, the configuration and effects of the present invention will be described in more detail with reference to specific examples in order to help understanding of the present invention. However, the following examples are only illustrated to more clearly understand the present invention, and the scope of the present invention is not limited by the following examples.

Example 1 Dry-Stress Tolerance-related Genes Treated by Prunus japonica

<Dry stress treatment using suspension cultured cells>

Populus alba × P. glandulosa was used as a plant material. Callus was induced by placing the leaves of the hawthorn on MS callus solid medium. The induced callus was suspended in MS callus liquid medium and shaken at 120 rpm in a weak light condition (20 μmol m ⁻² s ⁻² ) at 22 ± 1 ° C.

MS callus liquid medium was prepared in MS medium (Duchefa, Netherlands) in 1.0 mg / L of 2,4-dichlorophenoxyacetic acid (2,4-D), 0.1 mg / L of 1-naphthaleneacetic acid (NAA), 0.01 mg / The pH adjusted to 5.8 by adding L of 6-benzylaminopurine (6-BAP) and 30 g sugar was used, and MS callus solid medium was used by adding 0.8% agar to MS callus liquid medium.

0.4g of suspension cultured cells were transferred to 100ml of MS callus medium and incubated for 5 days, and then treated with dry stress (mannitol 250 mM, Man) and phytohormone (20 μM of abscitic acid, ABA) for 2 hours and 10 hours, respectively. After shaking culture, the medium was removed using a vacuum pump to recover the cells. The control group (WT) recovered the cells in the same manner after 2 hours and 10 hours, respectively, without any treatment of the same suspension culture cells used for stress treatment. The recovered sample was immediately frozen in liquid nitrogen and stored at 80 ° C.

<total RNA isolation>

Total RNA was recovered from the suspension cultured cells of the recovered suspension trees using the RNeasy plant Minin kit (Qiagen, Germany). Primers used for real-time qPCR analysis were designed with Primer3 program (http://fokker.wi.mit.edu).

<cDNA Synthesis and qRT-PCR Analysis>

CDNA was synthesized according to the manual using PrimeScript RT reagent Kit (Takara, Japan) from 1 μg of total RNA isolated. The primers were prepared using the Primer3 program based on the nucleotide sequence of P. tricocarpa (Potri.003G117100.1) showing homology to the stress-related protein family (Table 1).

primer order PagSAP5_qRT_F (SEQ ID NO: 3) 5’- gtcagttgtgtctgctgaagct -3 ’ PagSAP5_qRT_R (SEQ ID NO: 4) 5’- agcacctttgaaatcaaagag -3 ’ Actin-F (SEQ ID NO: 5) 5’- gccatctctcatcggaatgga -3 ’ Actin-R (SEQ ID NO: 6) 5’- agggcagtgatttccttgctca -3 ’

PCR amplification was real-time monitoring is possible CFX96 Touch ^TM Real-Time PCR (BioRad, USA) and AmpOne Taq DNA polymerase was used (GeneAll, South Korea) 5 at 1 times in 95 ℃, at 95 ℃ 30 seconds, at 56 ℃ The procedure of 30 seconds and 1 minute at 72 ° C. was repeated 40 times. Finally, the reaction was terminated by treatment at 72 ° C. for 10 minutes. Actin genes (SEQ ID NO: 5 and SEQ ID NO: 6) were used as internal standards for the quantification of PCR amplification products.

<Gene Separation and Sequence Analysis>

Among the cDNAs synthesized from dried stress-treated suspension tree suspension cells, cDNA clones showing sequence homology with stress-associated protein family genes reported in Arabidopsis were selected by EST (expressed sequence tag) analysis. The base sequence of the clone was determined, and the result is shown in FIG. 1.

As shown in FIG. 1, the cDNA sequence has an open reading frame of 528 base pairs (bp) and is named PagSAP5 (SEQ ID NO: 1).

Based on the cDNA sequence, the predicted amino acid sequence was investigated using Vector NTI advance 10.0 (Invitrogen, USA), and the results are shown in FIG. 2.

As shown in Figure 2, the amino acid sequence encodes a protein consisting of 175 amino acids, A20 domain (amino acid position 19-40) and ZnF- identified in plant stress related protein family genes such as Arabidopsis, rice It contains the AN1 domain (positions 116-148).

Example 2 PagSAP5 Gene Expression According to Stress

As described in Example 1, the expression level of PagSAP5 gene was analyzed by qRT-PCR in each suspension culture cell recovered 2 and 10 hours after culture. The expression value of each PagSAP5 gene was calculated relative to the expression value of the actin gene, and primers of SEQ ID NO: 3 and SEQ ID NO: 4 were used. The result is shown in FIG.

As shown in FIG. 3, the expression of PagSAP5 gene was increased by 1.5 times or more compared to the control (WT) after 10 hours of dry stress and ABA treatment. Thus PagSAP5 The gene is believed to be involved in ABA-dependent dry stress tolerance.

Example 3: Tissue Specific Expression of PagSAP5 Gene

Leaves (young leaves, mature leaves), stems, and roots were collected from the seedlings of the uniennial stems of PasapAP5 gene tissue-specific expression analysis. Flowers were collected in March from 25-year-old trees. All samples were immediately frozen in liquid nitrogen (-80 ° C.), stored and used for analysis.

From the flowers, young leaves and mature leaves, stems and roots of the thorn tree, qRT-PCR analysis was performed by separating the total RNA in the same manner as in Example 1, the results are shown in FIG.

As shown in FIG. 4, the PagSAP5 gene was highest expressed in stem (S) and lowest in root (R). Next to the stem, it was highly expressed in the flower (F), and at about the same level in the mature leaf (ML) and young leaf (YL).

Example 4: Transformation recombinant vector construction and transgenic plant construction

<Transformation recombinant vector construction>

Overexpression of the PagSAP5 gene The recombinant recombinant vector and the PagSAP5 gene expression inhibitory RNAi vector were constructed, respectively. Primers shown in Table 2 were used for PCR amplification.

primer order PagSAP5-XbaI_F (SEQ ID NO: 7) 5’- cacgggggactctagaatgggttctgagcaaaacgatggc -3 ’ PagSAP5-SacI_R (SEQ ID NO: 8) 5’- gatcggggaaattcgagctctcagaacctctccaccttattagc -3 ’ PagSAP5_RNAi_F (SEQ ID NO: 9) 5’- gccgcccccttcacccaaagccggcaaataggtgctttag -3 ’ PagSAP5_RNAi-R (SEQ ID NO: 10) 5’- tcggcgcgcccacccttaatacattcacttggtgctctc -3 ’ CamV 35S_F (SEQ ID NO: 11) 5’- gaaacctcctcggattccat -3 ’ attB1_F (SEQ ID NO: 12) 5’- acaagtttgtacaaaaaagcaggct -3 ’

Specifically, PCR amplification was performed using primers of SEQ ID NO: 7 and SEQ ID NO: 8 to produce the overexpression vector of PagSAP5 gene. PCR amplification was performed using AmpOne Taq DNA polymerase (GeneAll, South Korea). The procedure was repeated once for 5 minutes at 95 ° C, 30 seconds at 95 ° C, 30 seconds at 56 ° C and 1 minute at 72 ° C. And reaction was terminated for 7 minutes at 72 degreeC. PCR amplification products (561bp) were electrophoresed and separated on 1.0% agarose gel (Promega, USA), purified using manual using Expin combo kit (GeneAll, South Korea), and then pGEM-T easy vector (Promega, USA). ) Was subcloned. After digestion with restriction enzymes XbaI and SacI, the fragments were isolated and purified, and then inserted into the XbaI / SacI position of the pBI121 vector to prepare a pBI121-PagSAP5 (OX) overexpression vector. The gene map of the pBI121-PagSAP5 (OX) overexpression vector is shown in FIG. 5A.

Hairpin RNAi (RNA interference) production method using Gateway system was used for the expression of PagSAP5 gene, and pENTR_IF and pK7GWIWG2 (I) binary vectors were used. The selected PagSAP5 site was PCR amplified using primers SEQ ID NO: 9 and SEQ ID NO: 10. pK7GWIWG2 (I) -PagSAP5 (Ri) RNAi vectors were constructed. The genetic map of the pK7GWIWG2 (I) -PagSAP5 (Ri) RNAi vector is shown in FIG. 5B.

<Presentation of Sapwood Transfected with PagSAP5 Gene>

PagSAP5 gene overexpression vector and RNAi expression suppression vector were respectively identified as Agrobacterium tumafaciene ( Agrobacterium). tumefaciens ) Standard test method for the transformation of hawthorn trees following introduction into LBA4404 (Noh et al, 1994, Res Rep For Gen Res Inst Kor, 30, 114-120; Kim et al, 2011, Plant Biotecchnology Journal, 9, 334-347).

Cut the stems of sage-grown sterile trees into a length of about 5-7 mm for 6 weeks in a test tube, co-culture with a transformed Agrobacterium strain for 15 minutes, and callus-induced medium (MS, 2,4-D 1.0 mg / L, BAP 0.1 mg / L, NAA 0.01 mg / L, agar 0.8%, pH5.8) for 2 days and then incubated in antibiotic-added callus induction medium for 4-5 weeks. Subsequently, transfer to stem-derived medium (WPM, Zeatin 1.0mg / L, BAP 0.1mg / L, NAA 0.01mg / L, agar 0.8%, pH5.8) with antibiotics to induce shoots from callus 4 ~ 6 Incubated weekly. Induced shoots were transferred to root induction medium (1/2 MS, IBA 0.2 mg / L, pH5.8). Plants were incubated at 25 ° C., 30 μmole m ⁻² S ⁻¹ , and light conditions for 16 hours to prepare PagSAP5 overexpressing transform poplar and PagSAP5 expression suppressing transform poplar. Antibiotic was used kanamycin 50 ㎍ / ㎖.

Transformation of regenerated plants was confirmed by genomic DNA PCR analysis.

PagSAP5 Overexpressing Transgenic Seeding Trees OX1, OX2, OX3 (SEQ ID NO: 8 and SEQ ID NO: 11 Primer, Table 2) and Expression Suppressing Transgenic Seeding Trees Ri1, Ri2, Ri3, Ri4 (SEQ ID NO: 10 and SEQ ID NO: 12 Primer, Table 2) ) GDNA-PCR analysis was PCR amplified according to the user manual using the Thermo Scientific Phire Plant Direct PCR kit (Thermon scientific, USA). PCR amplification was performed in a C1000 touch thermal cycler (Bio-Rad, USA) for 40 cycles of 5 seconds at 98 ° C., 5 seconds at 98 ° C., 5 seconds at 60 ° C., and 30 seconds at 72 ° C., followed by 1.0% agarose gel. Were electrophoresed and visualized in UV light.

Example 5 Analysis of Expression Pattern of PagSAP5 Gene of Transgenic Crow

QRT-PCR was performed to confirm the expression of PagSAP5 genes in PagSAP5 overexpressing Sashimi and RNAi expression inhibition Sashimi.

For qRT-PCR analysis, SEQ ID NO: 3 and SEQ ID NO: 4 primers specific for PagSAP5 gene were used (Table 1). Seven lines of transformed siliceous trees and 1 g of total RNA of untransfected siliceous trees (control) were used as templates for qRT-PCR, using PrimeScript RT reagent Kit (Takara, Japan), respectively. cDNA was synthesized. qRT-PCR amplification was performed in a Multi-color Real-time PCR System CFX96 (Bio-Rad, USA) for 40 cycles of 3 seconds at 95 ° C, 10 seconds at 95 ° C, 10 seconds at 60 ° C, and 30 seconds at 72 ° C. . Actin was amplified equally by primers of SEQ ID NO: 5 and SEQ ID NO: 6 as an internal standard gene. PCR products were electrophoresed on 1.0% agarose gels and visualized in UV light. The expression value of each PagSAP5 gene was calculated relative to the expression value of the actin gene, and the results are shown in FIGS. 6A and 6B.

As shown in FIG. 6A, the expression of PagSAP5 gene was increased about 180-313 fold in the hawthorn line OX1, OX2, OX3 transformed with PagSAP5 gene compared to the control (WT).

As shown in FIG. 6B, the expression of PagSAP5 gene in transformed hawthorn lines Ri1, Ri2, Ri3, Ri4, which inhibited the expression of PagSAP5, decreased by about 0.22 to 0.88 fold compared to the control (WT).

Example 6: Dry Stress Tolerance Assay of Transformed Sagewood

Two PagSAP5 overexpressing transformants (OX1 and OX3) expressing PagSAP5 gene expression 200 times or more among transformants in Example 5 and PagSAP5 expression suppressing transformant 2 expressing PagSAP5 gene expression 0.4 times or less Species (Ri2 and Ri3) were selected to assay dry stress tolerance.

To examine dry stress tolerance, each transformant suspension tree was grown for 8 weeks in photoperiod of 24 ± 1 ° C., 50% relative humidity and 16 hours light / 8 hours cancer. One day before the drying treatment, the water was watered until the soil water content reached 48%, and the condition (phenotype) of each sapling tree was observed until 12 days when the soil moisture content was 0% without watering for 12 days. The resulting photograph is shown in Figure 7a.

In addition, the chlorophyll fluorescence (Fv / Fm) of the Pocket PEA chlorophyll fluorometer (Hansatech, Germany) was measured on the 0, 9 and 12 days of growth under dry stress conditions (single 12 days) of each transformed hawthorn tree. The photosynthetic efficiency was analyzed by measuring using the result, and the result is shown in FIG. 7B.

As shown in FIG. 7A, when 12 days after the singular treatment, the PagSAP5 overexpressing transformed hawthorn trees (OX1 and OX3) exhibited normal growth of leaves, showing control of leaf sagging and leaf dryness (WT). Compared to the thorny bark, it showed enhanced drying resistance, but the PagSAP5 expression-inhibiting transformant thorny bark (Ri2 and Ri3) showed severe leaf dryness and was sensitive to drying.

As shown in Figure 7b, when comparing the chlorophyll fluorescence of 12 days to the chlorophyll fluorescence of day 0, photosynthetic efficiency of control (WT) banyan tree is 82.7%, photosynthesis of PagSAP5 expression inhibitory transformant (Ri) banyan tree The efficiency was 38.3%, PagSAP5 overexpressing transformant (OX) sage tree showed 95% photosynthetic efficiency, indicating that the transgenic sage tree with increased expression of PagSAP5 gene significantly enhanced dry stress resistance.

On the other hand, irrigation was carried out again from the 13th day to the five kinds of thorny bark (control); two PagSAP5 overexpressing transformants (OX1 and OX3) and two PagSAP5 expression suppressing transformants (Ri2 and Ri3) for one week. After growth, the survival rate was examined and the results are shown in Table 3.

division Number of survivors Number of individuals Survival rate WT 3 12 25.0 OX1 8 12 66.7 OX3 5 11 45.5 Ri2 One 12 16.7 Ri3 2 12 0.0

As shown in the above table, the survival rate of the PagSAP5 overexpressing transformed suspension tree was 45.5 to 66.7%, which was more than 2 times higher than that of the control (WT) suspension tree. On the other hand, the survival rate of PagSAP5 expression-inhibited transformant cultivars was 0 to 16.7%, which was lower than that of control cultivars. Therefore, it was confirmed that the increased expression of PagSAP5 gene significantly enhanced the dry resistance of the hawthorn tree.

<110> National Institute of Forest Science <120> Novel proteins enhancing drought stress tolerance of plants,          genes encoding the proteins and transgenic plants transformed          with the genes <130> P-10187 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 528 <212> DNA <213> Populus sieboldii x Populus grandidentata <220> <221> gene (222) (329) .. (528) <223> RNAi construct <220> <221> gene (222) (1) .. (528) <223> Open reading frame <400> 1 atgggttctg agcaaaacga tggcacaagc ttcccaccag cagagccaaa gctttgtgtt 60 aatgggtgtg gattttttgg tacggctgca aacatgaacc tttgctccaa gtgttaccgt 120 gaccttcgtg ccgaagaaga gcaggctgcc tctgccaagg ctgccatgga aaagacactg 180 aatatcaatc caaaacaaca tattgattct aaggttgttg tcgatgcccc tcaagttgtg 240 gtggcggcta attccgtgca gttagatgtg tctgatgaag cttcttcgtc agcagaaact 300 gttgttgctg gtggtggtca ggtgccatca aagccggcaa ataggtgctt tagctgcaat 360 aagaaggttg gtttgacagg attcaagtgc aagtgcggtg gcacttactg cgggactcat 420 aggtacgcag agaatcacga gtgcctcttt gatttcaaag gtgccggccg tgatgcaatc 480 gcgaaggcaa atcctgtgat taaggctaat aaggtggaga ggttctga 528 <210> 2 <211> 175 <212> PRT <213> Populus sieboldii x Populus grandidentata <220> <221> PEPTIDE (222) (1) .. (175) <223> Amino acid sequence of Patg SAP 5 <400> 2 Met Gly Ser Glu Gln Asn Asp Gly Thr Ser Phe Pro Pro Ala Glu Pro   1 5 10 15 Lys Leu Cys Val Asn Gly Cys Gly Phe Phe Gly Thr Ala Ala Asn Met              20 25 30 Asn Leu Cys Ser Lys Cys Tyr Arg Asp Leu Arg Ala Glu Glu Glu Gln          35 40 45 Ala Ala Ser Ala Lys Ala Ala Met Glu Lys Thr Leu Asn Ile Asn Pro      50 55 60 Lys Gln His Ile Asp Ser Lys Val Val Val Asp Ala Pro Gln Val Val  65 70 75 80 Val Ala Ala Asn Ser Val Gln Leu Asp Val Ser Asp Glu Ala Ser Ser                  85 90 95 Ser Ala Glu Thr Val Val Ala Gly Gly Gly Gln Val Pro Ser Lys Pro             100 105 110 Ala Asn Arg Cys Phe Ser Cys Asn Lys Lys Val Gly Leu Thr Gly Phe         115 120 125 Lys Cys Lys Cys Gly Gly Thr Tyr Cys Gly Thr His Arg Tyr Ala Glu     130 135 140 Asn His Glu Cys Leu Phe Asp Phe Lys Gly Ala Gly Arg Asp Ala Ile 145 150 155 160 Ala Lys Ala Asn Pro Val Ile Lys Ala Asn Lys Val Glu Arg Phe                 165 170 175 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PagSAP5 qRT Forward primer <400> 3 gtcagttgtg tctgctgaag ct 22 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PagSAP5 qRT Reverse primer <400> 4 agcacctttg aaatcaaaga g 21 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> Actin Forward primer <400> 5 gccatctctc atcggaatgg a 21 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Actin Reverse primer <400> 6 agggcagtga tttccttgct ca 22 <210> 7 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> PagSAP5-XbaI forward primer <400> 7 cacgggggac tctagaatgg gttctgagca aaacgatggc 40 <210> 8 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> PagSAP5-XbaI reverse primer <400> 8 gatcggggaa attcgagctc tcagaacctc tccaccttat tagc 44 <210> 9 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> PagSAP5 RNAi Forward primer <400> 9 gccgccccct tcacccaaag ccggcaaata ggtgctttag 40 <210> 10 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> PagSAP5 RNAi Reverse primer <400> 10 tcggcgcgcc cacccttaat acattcactt ggtgctctc 39 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CamV 35S Forward primer <400> 11 gaaacctcct cggattccat 20 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> attB1 Forward primer <400> 12 acaagtttgt acaaaaaagc aggct 25

Claims (10)

Comprising a PagSAP5 gene consisting of the nucleotide sequence of SEQ ID NO: 1, a composition for enhancing the dry stress resistance of the plant.
According to claim 1, wherein the gene encodes a PagSAP5 protein consisting of the amino acid sequence of SEQ ID NO: 2, the composition for improving the dry stress resistance of plants.
delete The composition of claim 1, wherein the gene is derived from a Populus alba × Populus glandulosa .
A recombinant vector comprising a PagSAP5 gene consisting of the nucleotide sequence of SEQ ID NO: 1 to enhance the dry stress resistance of the plant.
A transgenic plant transformed by the recombinant vector of claim 5 and having enhanced dry stress resistance.
The transgenic plant of claim 6, wherein the plant is any one selected from the group consisting of trees, fruit trees, vegetable crops, specialty crops, flowers, and feed crops.
The transgenic plant of claim 7, wherein the tree is a poplar.
As a method of enhancing the dry stress resistance of the plant, the method
(a) transforming a plant with a PagSAP5 gene consisting of the nucleotide sequence of SEQ ID NO: 1; And
(b) overexpressing the gene in the transformed plant.
10. The method of claim 9, wherein the plant is a tree.

Images