KR102016658B1 - Conjugate of salicylic acid and peptide - Google Patents

Conjugate of salicylic acid and peptide Download PDF

Info

Publication number
KR102016658B1
KR102016658B1 KR1020170021170A KR20170021170A KR102016658B1 KR 102016658 B1 KR102016658 B1 KR 102016658B1 KR 1020170021170 A KR1020170021170 A KR 1020170021170A KR 20170021170 A KR20170021170 A KR 20170021170A KR 102016658 B1 KR102016658 B1 KR 102016658B1
Authority
KR
South Korea
Prior art keywords
compound
present
peptide
hair
water
Prior art date
Application number
KR1020170021170A
Other languages
Korean (ko)
Other versions
KR20180094693A (en
Inventor
정용지
김은미
Original Assignee
(주)케어젠
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)케어젠 filed Critical (주)케어젠
Priority to KR1020170021170A priority Critical patent/KR102016658B1/en
Publication of KR20180094693A publication Critical patent/KR20180094693A/en
Application granted granted Critical
Publication of KR102016658B1 publication Critical patent/KR102016658B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/60—Salicylic acid; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/08—Peptides having 5 to 11 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/10—Peptides having 12 to 20 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/542—Carboxylic acids, e.g. a fatty acid or an amino acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q1/00—Make-up preparations; Body powders; Preparations for removing make-up
    • A61Q1/14—Preparations for removing make-up
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q17/00—Barrier preparations; Preparations brought into direct contact with the skin for affording protection against external influences, e.g. sunlight, X-rays or other harmful rays, corrosive materials, bacteria or insect stings
    • A61Q17/005—Antimicrobial preparations
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q5/00—Preparations for care of the hair
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K19/00—Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Dermatology (AREA)
  • Birds (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Cosmetics (AREA)

Abstract

The present invention relates to a composition for antibacterial, anti-inflammatory or antioxidant, and more particularly, to a compound having a structure in which salicylic acid and a peptide are covalently linked, and to a pharmaceutical or cosmetic composition for antimicrobial, anti-inflammatory or antioxidant comprising the same. will be. Compounds having a structure in which the salicylic acid and the peptide of the present invention are covalently linked are not only excellent in physiological activities such as antibacterial, anti-inflammatory, or antioxidant action, but also excellent in solubility in water, such as food, drugs, or cosmetics. It can be usefully used in various fields such as.

Description

A combination of salicylic acid and a peptide {CONJUGATE OF SALICYLIC ACID AND PEPTIDE}

The present invention relates to a compound having a structure in which salicylic acid and a peptide are covalently linked, and a use thereof.

Salicylic acid is a compound of formula C 7 H 6 O 3 corresponding to o-oxybenzoic acid, and has various physiological activities such as antipyretic and analgesic action as well as antibacterial, anti-inflammatory and antioxidant activity. It is widely used in. For example, salicylic acid is used as an exfoliant, hair-conditioning agent, dandruff treatment or skin-conditioning agent in cosmetic formulations, and derivatives of salicylic acid are known to be used as preservatives, UV-absorbers, fragrance components or solvents in cosmetics. (Patent Document 1). In addition, salicylic acid and its derivatives have been used for the improvement of the major clinical symptoms of skin aging such as biological effects on the skin, in particular fine lines and wrinkles, degradation of skin tissue, changes in skin color and loss of skin firmness and tension ( Patent document 2).

However, the use of such salicylic acid and its derivatives can cause tingling, itching and pulling, which can cause significant discomfort after application to the skin, and therefore users with sensitive skin often suffer from the use of such compounds. In addition, since salicylic acid has a very low solubility in water, it is necessary to add various organic solvents to solubilize it, which may add inconvenience to the composition containing salicylic acid.

Accordingly, there is a need for the development of novel compounds that can improve the problems of salicylic acid, in particular, low solubility in water, and can further enhance the physiological efficacy of salicylic acid.

Republic of Korea Patent Publication No. 10-2009-0004980 Republic of Korea Patent Publication No. 10-2000-0017297

The present invention is to improve the problems of the conventional salicylic acid as described above, and to provide a material having excellent properties such as solubility in water while showing the same or better physiological activity as compared to the natural salicylic acid It is a task.

In order to achieve the above object, the present invention provides a compound having a structure in which salicylic acid and a peptide is covalently linked.

According to one embodiment of the invention, the peptide may consist of 2 to 30 amino acids, preferably 5 to 20, more preferably 8 to 15, more preferably 10 to 12 amino acid sequences, but is not limited thereto. It doesn't happen.

According to another embodiment of the invention, the peptide is preferably a water soluble peptide, but is not limited thereto. According to a preferred embodiment of the present invention, the water-soluble peptide has a ratio of amino acid having a hydrophilic side chain of 50% or more, preferably 60% or more, more preferably 70% or more, more preferably 80% or more, more preferably Preferably as high as 90% or more, most preferably 100%. According to another preferred embodiment of the present invention, the water-soluble peptide has 5 or less amino acids, preferably 4 or less amino acids, more preferably 3 or less amino acids, more preferably 2 or less amino acids, having a hydrophobic side chain. Is present in one or less, most preferably none.

According to another embodiment of the present invention, the peptide may be a peptide consisting of the amino acid sequence of SEQ ID NO: 1 to SEQ ID NO: 4, but is not limited thereto.

The present invention also provides a pharmaceutical composition for antibacterial, anti-inflammatory or antioxidant containing any one of the compounds disclosed above.

The present invention also provides a cosmetic composition for antimicrobial, anti-inflammatory or antioxidant containing any one of the compounds disclosed above.

According to one embodiment of the invention, the cosmetic composition is a flexible lotion, nourishing lotion, nourishing cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray, powder, hair tonic, hair cream , Hair lotion, hair shampoo, hair rinse, hair conditioner, hair spray, hair aerosol, pomade, sol gel, emulsion, oil, wax, aerosol can have a formulation such as, but not limited to.

Compounds having a structure in which the salicylic acid and the peptide of the present invention are covalently linked are not only excellent in physiological activities such as antibacterial, anti-inflammatory, or antioxidant action, but also excellent in solubility in water, such as food, drugs, or cosmetics. It can be usefully used in various fields such as.

1 is a photograph showing the solubility of water of the compound of the present invention and salicylic acid.
Figure 2a is an immunostaining picture showing the shape and number of keratinocytes after treatment with the compound of the present invention and salicylic acid, Figure 2b is a graph showing the relative number of keratinocytes according to the treatment concentration of the compound.
3A and 3B are photographs and graphs showing antimicrobial activity against acne bacteria after treatment with the compound of the present invention and salicylic acid.
Figures 4a and 4b shows the results of Fluorescence-activated Cell Sorter (FACS) analysis and intracellular reactive oxygen species (Active) showing the effect of the compound of the present invention and salicylic acid on human hair dermal papilla cells (HHDPC) Oxygen Species (ROS) is a graph showing the relative levels.
5A and 5B are graphs showing FACS analysis showing the effect of the compound of the present invention and salicylic acid on NIH3T3 fibroblasts and relative levels of intracellular reactive oxygen species.
6A and 6B are graphs showing the results of FACS analysis showing the effect of the compound of the present invention and salicylic acid on HaCaT keratinocytes and the relative levels of intracellular reactive oxygen species.
7A and 7B are photographs showing the results of immunohistochemical staining and RT-PCR analysis showing the effect of the compound of the present invention and salicylic acid on the expression of extracellular matrix of HaCaT keratinocytes.
8 is an electrophoretic sardine showing the effect of the compound of the present invention and salicylic acid on the expression of inflammatory cytokines induced by acne bacteria in HaCaT keratinocytes.

In order to achieve the above object, the present invention provides a compound having a structure in which salicylic acid and a peptide is covalently linked.

The salicylic acid represents 2-hydroxybenzoic acid represented by Chemical Formula C 7 H 6 O 3 , and has a chemical structure represented by the following formula.

Figure 112017016260603-pat00001

As used herein, the term "peptide" refers to a linear molecule formed by binding amino acid residues to each other by peptide bonds. Such peptides can be prepared according to conventional biological or chemical synthesis methods known in the art, in particular solid-phase synthesis techniques (Merrifield, J. Amer. Chem. Soc. 85: 2149-54). (1963) Stewart, et al., Solid Phase Peptide Synthesis, 2nd.ed., Pierce Chem. Co .: Rockford, 111 (1984)).

The peptide is intended to increase the water solubility of salicylic acid, and in this respect the peptide is preferably, but not limited to, a water soluble peptide. According to one embodiment of the invention, the peptide consists of 2 to 30, preferably 5 to 20, more preferably 8 to 15, more preferably 10 to 12 amino acid sequences. According to a preferred embodiment of the present invention, the peptide has a proportion of amino acids having a hydrophilic side chain of 50% or more, preferably 60% or more, more preferably 70% or more, more preferably 80% or more, more preferably Is preferably at least 90%, most preferably 100%. On the other hand, the peptide has a proportion of amino acids having hydrophobic side chains of less than 50%, preferably 40% or less, more preferably 30% or less, more preferably 20% or less, more preferably 10% or less, Most preferably, as low as 0%. In the present invention, "amino acid having a hydrophilic side chain" is arginine (Arg), histidine (His), lysine (Lys), aspartic acid (Asp), glutamic acid (Glu), serine (Ser), threonine (Thr), asparagine ( Asn), glutamine (Gln), cysteine (Cys), selenocysteine (Sec), glycine (Gly) and proline (Pro), and "amino acids with hydrophobic side chains" are alanine (Ala), valine (Val), Isoleucine (Ile), leucine (Leu), methionine (Met), phenylalanine (Phe), tyrosine (Tyr) and tryptophan (Trp), but is not limited to such amino acids present in nature In addition to these modifications and the like can also be used without limitation. According to a preferred embodiment of the present invention, the amino acid having the hydrophobic side chain is 5 or less, preferably 4 or less, more preferably 3 or less, more preferably 2 or less, more preferably 5 or less in the peptide. It is most preferred that there is no more than one, and no one. According to one embodiment of the invention, the peptide is preferably a peptide consisting of the amino acid sequence of SEQ ID NO: 1 to SEQ ID NO: 4, but is not limited thereto.

According to one embodiment of the present invention, the compound of the present invention has excellent solubility in water (see FIG. 1B), and also has a growth promoting ability on keratinocytes (see FIGS. 2A and 2B). According to another embodiment of the present invention, the compound of the present invention has antibacterial activity against acne bacteria (see FIGS. 3A and 3B) and antioxidant activity against various cell lines (see FIGS. 4A to 6B). According to another embodiment of the present invention, the compounds of the present invention increase the expression of extracellular matrix distributed from cells (see FIGS. 7A and 7B) and also inhibit the expression of inflammatory cytokines caused by acne bacteria. Have activity (see FIG. 8).

The compound of the present invention is excellent in stability by itself, but may be further improved by modifying any amino acid constituting the peptide bound to the compound. According to one embodiment of the invention, the N-terminus of the peptide is from the group consisting of acetyl group, fluorenyl methoxy carbonyl group, formyl group, palmitoyl group, myristyl group, stearyl group and polyethylene glycol (PEG) The protecting group selected can be combined to further improve stability. According to another embodiment of the invention, the peptide is a protecting group selected from the group consisting of acetyl group, fluorenyl methoxy carbonyl group, formyl group, palmitoyl group, myristyl group, stearyl group and polyethylene glycol (PEG) Can be combined to further improve stability.

Modifications of amino acids such as those described above serve to greatly improve the stability of the compounds of the present invention. As used herein, the term "stability" is used to encompass not only "in vivo" stability but also "in vitro" stability, such as storage stability (eg, room temperature storage stability). In addition, the aforementioned protecting groups serve to protect the compounds of the invention from the attack of protein cleavage enzymes in vivo and in vitro.

The present invention also provides a composition for antibacterial, anti-inflammatory or antioxidant comprising the compound as an active ingredient. According to another embodiment of the present invention, the present invention provides a composition for improving skin condition comprising the compound as an active ingredient. In the present invention, the composition may be in the form of a pharmaceutical composition, health food, or cosmetic composition, but is not limited thereto. Further, according to one embodiment of the present invention, the improvement of the skin condition by the compound of the present invention may be wrinkle improvement, skin elasticity improvement, skin aging prevention, skin moisturization improvement, wound removal or skin regeneration, but is not limited thereto. .

Since the composition of the present invention includes the above-described compound of the present invention as an active ingredient, the common content between the two is omitted in order to avoid excessive complexity of the present specification.

According to a preferred embodiment of the present invention, the composition of the present invention comprises (a) a pharmaceutically effective amount of a compound of the present invention as described above; And (b) a pharmaceutically acceptable carrier.

As used herein, the term "pharmaceutically effective amount" means an amount sufficient to achieve the efficacy or activity of the compounds of the invention described above.

Pharmaceutically acceptable carriers included in the pharmaceutical compositions of the present invention are those commonly used in the preparation of lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, Calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and the like. It is not. In addition to the above components, the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical compositions of the present invention may be prepared in unit dosage form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporating into a multi-dose container. In this case, the formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or may be in the form of extracts, powders, granules, tablets, capsules or gels (eg hydrogels), and may further include a dispersant or stabilizer. have.

The pharmaceutical composition according to the present invention can be administered orally or parenterally during clinical administration and can be used in the form of general pharmaceutical preparations. That is, the pharmaceutical composition of the present invention may be administered in various oral and parenteral dosage forms in actual clinical administration, and when formulated, diluents such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants that are commonly used Or using excipients. Solid preparations for oral administration include tablets, pills, powders, granules, capsules and the like, which solid preparations contain at least one excipient such as starch, calcium carbonate, sucrose or lactose in the herbal extract or herbal fermentation product. Mixed with gelatin. In addition to simple excipients, lubricants such as magnesium styrate talc are also used. Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups, and may include various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin. have. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories. As the non-aqueous solvent and the suspension solvent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used. As the base of the suppository, uthepsol, macrogol, tween 61, cacao butter, laurin butter, glycerol, gelatin and the like can be used.

Dosage units may, for example, contain 1, 2, 3 or 4 times the individual dose, or 1/2, 1/3 or 1/4 times. Individual dosages contain amounts in which the effective drug is administered at one time, which usually corresponds to all, 1/2, 1/3 or 1/4 times the daily dose.

The pharmaceutical compositions of the present invention may be prepared in unit dosage form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporating into a multi-dose container. In this case, the formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or may be in the form of extracts, powders, granules, tablets, capsules or gels (eg hydrogels), and may further include a dispersant or stabilizer. have.

According to a preferred embodiment of the present invention, the composition of the present invention comprises (a) a cosmetically effective amount of the above-described compound of the present invention; And (b) a cosmetically acceptable carrier.

As used herein, the term "cosmetic effective amount" means an amount sufficient to achieve the skin improving efficacy of the composition of the present invention described above.

Cosmetic compositions of the present invention may also be prepared in any formulations conventionally prepared in the art, including, for example, solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, surfactants- Containing cleansing, oils, powder foundations, emulsion foundations, wax foundations, sprays, and the like, but is not limited thereto. More specifically, flexible lotion, nutrition lotion, nutrition cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray, powder, hair tonic, hair cream, hair lotion, hair shampoo, hair It may be prepared in various forms such as a rinse, hair conditioner, hair spray, hair aerosol, pomade, gel, solution, sol gel, emulsion, oil, wax, aerosol, but is not limited thereto.

When the formulation of the present invention is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, trakant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide, etc. may be used as carrier components. Can be.

When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used, in particular in the case of a spray, additionally chlorofluorohydrocarbon, propane Propellants such as butane or dimethyl ether may be included, but are not limited thereto.

When the formulation of the present invention is a solution or emulsion, a solvent, solubilizer or emulsifier is used as the carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 Fatty acid esters of, 3-butylglycol oil, glycerol aliphatic esters, polyethyleneglycol or sorbitan may be used, but are not limited thereto.

When the formulation of the present invention is a suspension, liquid carrier diluents such as water, ethanol or propylene glycol, suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystals Sex cellulose, aluminum metahydroxy, bentonite, agar or tracant may be used, but is not limited thereto.

When the formulation of the present invention is a surfactant-containing cleansing, the carrier component is an aliphatic alcohol sulfate, an aliphatic alcohol ether sulfate, a sulfosuccinic acid monoester, isethionate, an imidazolinium derivative, a methyltaurate, a sarcosinate, a fatty acid amide. Ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters may be used, but are not limited thereto.

When the formulation of the present invention is a hair shampoo, the compounds of the present invention are mixed with base ingredients for shampoo composition such as thickeners, surfactants, viscosity modifiers, humectants, pH adjusters, preservatives, essential oils and the like. CDE may be used as a thickener, LES (anionic surfactant) or cocobetaine (an amphoteric surfactant), polyquater as a viscosity modifier, glycerin as a moisturizer, glycerin as a moisturizer, citric acid as sodium hydroxide, and as a preservative Grapefruit extract may be used, in addition to essential oils such as cedarwood, peppermint, rosemary, and silkamino acids, pentaol, vitamin E may be added. According to an embodiment of the present invention, when the compound of the present invention is 100 parts by weight, 5 to 10 parts by weight of CDE, 30 to 40 parts by weight of LES, 10 to 20 parts by weight of cocobetaine, and 0.1 to 0.2 parts by weight of polyquarters , 5 to 10 parts by weight of glycerin, 0.1 to 1.01 parts by weight of grapefruit extract, 0.5 to 1 part by weight of silkamino acid, 0.5 to 1 part by weight of pentaol, 0.5 to 2 parts by weight of vitamin E, cedarwood, peppermint and rosemary as essential oils One may be mixed 0.01 to 0.1 parts by weight, but is not limited thereto.

The components included in the cosmetic composition of the present invention include components conventionally used in cosmetic compositions in addition to the compound of the present invention and the carrier component as active ingredients, and include, for example, antioxidants, stabilizers, solubilizers, vitamins, pigments and perfumes. It may include, but is not limited to, conventional adjuvants.

Hereinafter, the present invention will be described in detail through examples.

However, the following examples are only for illustrating the present invention, and the content of the present invention is not limited by the following examples.

Example  1. Synthesis of Compounds of the Invention

<1-1> Peptide  synthesis

<1-1-1> SEQ ID NO: 1 Peptide  synthesis

Chloro trityl chloride resin (CTL resin, Nova biochem Cat No. 01-64-0021) 700 mg was added to the reaction vessel and 10 ml of methylene chloride (MC) was added and stirred for 3 minutes. The solution was removed, 10 ml of dimethylformamide (DMF) was added thereto, stirred for 3 minutes, and then the solvent was removed again. 10 mL of dichloromethane solution was added to the reactor, 200 mmole of Fmoc-His (Trt) -OH (Bachem, Swiss) and 400 mmole of diisopropyl ethylamine (DIEA) were added to the mixture, followed by stirring to dissolve well. I was. After the reaction, the mixture was washed with methanol and DIEA (2: 1) in dichloromethane (DCM) for 10 minutes and washed with excess DCM / DMF (1: 1). The solution was removed, 10 ml of dimethylformamide (DMF) was added thereto, stirred for 3 minutes, and then the solvent was removed again. 10 ml of deprotection solution (20% of piperidine / DMF) was placed in a reaction vessel, stirred at room temperature for 10 minutes, and then the solution was removed. After adding the same amount of deprotection solution to maintain the reaction again for 10 minutes, the solution was removed and washed with DMF twice, once with MC, once with DMF for 3 minutes each to prepare His (Trt) -CTL resin.

10 mL of DMF solution was added to a new reactor, 200 mmole of Fmoc-Thr (tBu) -OH (Bachem, Swiss), 200 mmole of HoBt, and 200 mmole of Bop were stirred and dissolved. 400 mmol DIEA was added to the reactor twice in fractions and stirred for at least 5 minutes until all solids dissolved. The dissolved amino acid mixture solution was placed in a reaction vessel with a deprotected resin and reacted with stirring at room temperature for 1 hour. The reaction solution was removed and stirred with a DMF solution three times for 5 minutes and then removed. A small amount of the reaction resin was taken and the degree of reaction was checked using a Nihydrin Test. The deprotection reaction was performed twice as described above with the deprotection solution to prepare a Thr (tBu) -His (Trt) -CTL resin. After sufficient washing with DMF and MC, once again Kaiser test was performed, and the following amino acid attachment experiment was performed as above.

Fmoc-Trp, Fmoc-Gly, Fmoc (Gly), Fmoc-Lys (Boc), Fmoc-Lys (Boc), Fmoc-Ser (tBu), Fmoc-Lys (Boc), and Fmoc based on selected amino acid sequences Chain reaction was performed in order of -Tyr (tBu). The Fmoc-protector was reacted twice with a deprotection solution twice for 10 minutes and then washed well. After acetylation with acetic anhydride, DIEA, and HoBt for 1 hour, the prepared peptidyl resin was washed three times with DMF, MC, and methanol, and dried slowly by flowing nitrogen air. After drying, 30 ml of a fugitive solution (95% of trifluoroacetic acid, 2.5% of distilled water and 2.5% of thioanisole) was added thereto, and the reaction was kept at room temperature for 2 hours. The resin was filtered by filtration and the resin was washed with a small amount of TFA solution and then combined with the mother liquor. Distillation was carried out using a reduced pressure to half the total volume and 50 ml of cold ether was added to induce precipitation, followed by centrifugation to collect the precipitate and washing with two more cold ethers. The mother liquor was removed and dried sufficiently under nitrogen to synthesize 1.15 g of Ac-YKSKKGGWTH peptide (SEQ ID NO: 1) before purification (yield: 89.5%). Molecular weight 1233.3 (theoretical value: 1233.4) was obtained by using a molecular weight measuring instrument.

<1-1-2> Synthesis of Peptides of SEQ ID NO: 2 to SEQ ID NO: 4

Peptide of SEQ ID NO: 2 (Tyr-Ile-Ser-Lys-Lys-His-Ala-Gly-Lys-Asn-Trp-Phe: YISKKHAGKNWF), using the same method as in Example <1-1-1> Peptide No. 3 (Lys-Leu-Lys-Lys-Thr-Glu-Thr-Gln: KLKKTETQ) and Peptide No. 4 (Glu-Leu-Ile-Glu-His-Gly-Gly-Gly-Arg-Pro- Ala-Asp: ELIEHGGGRPAD) was synthesized.

SEQ ID NO: Amino acid sequence Analytical Values (Mass Spectrometer) Analysis value Theoretical value One Ac-YKSKKGGWTH 1233.3 1233.4 2 YISKKHAGKNWF 1478.8 1478.7 3 KLKKTETQ 975.1 975.1 4 ELIEHGGGRPAD 1250.9 1250.35

<1-2> Synthesis of Compound of the Invention

Peptidyl resin (1 mmol) and 10 ml of 1-methyl-2-pyrrolidone (NMP) were added to the peptite reactor, 270 mg (2.0 equiv.) Of 1-hydroxybenzotriazole (HOBt) and N, N, N ', N'-tetramethyl-O- (1H-benzotriazol-1-yl) uronium hexafluorophosphate, O- (benzotriazol-1-yl) -N, N, N' , N'-tetramethyluronium hexafluorophosphate 759 mg (2.0 equiv.) And salicylic acid 277 mg (2.0 equiv.) Were added and reacted for 30 minutes. 388 mg (3 equiv.) Of N, N-diisopropylethylamine (DIEA) was added thereto to react at room temperature for 24 to 72 hours, followed by filtration to obtain a reacted peptidyl resin. The obtained resin was reacted for 2 hours at room temperature using a cleavage solution to remove the resin and the protecting group, and recrystallized with 10 ml (10 mmol) of diethyl ether to obtain a hybrid peptide.

Experimental Example  1. Solubility Testing of Compounds of the Invention

Salicylic acid-peptide 1 compound (compound 1), salicylic acid-peptide 2 compound (compound 2), salicylic acid-peptide 3 compound (compound 3), salicylic acid-peptide 4 compound (compound 4) prepared in Example <1-2> And salicylic acid were dissolved in distilled water at a concentration of 10 mg / ml, respectively.

As a result, it was confirmed that all compounds of the compounds 1 to 4 of the present invention are completely dissolved in water, in contrast to salicylic acid itself, which is hardly dissolved in water (FIG. 1).

Experimental Example  2. Keratinocyte growth effect of the compound of the present invention

To analyze the similar and inhibitory effects of growth factors on the compounds synthesized in Example <1-2>, refer to the method of Rizino et al. (Rizzino, et al. Cancer Res. 48: 4266 (1988)) with HaCaT. The keratinocyte line (Korea Cell Line Bank) was measured using SRB (Sulforhodamine B, Sigma) colorimetric method.

HaCaT keratinocyte lines were seeded in 96-well plates at 3,000 cells per well and then in Dulbecco's modied Eagle's medium (DMEM, Gibco, USA) containing 10% fetal bovine serum (Sigma) for 24 hours. C. was incubated under 5% CO 2 . The cultured cell lines were removed from the bottom of the culture vessel with 1% trypsin solution and centrifuged to collect only cell precipitates. It was suspended again in DMEM medium containing no FBS, and then cultured under 37 ° C. and 5% CO 2 conditions for 24 hours. After 24 hours, the medium was exchanged with the same medium except for the serum completely, and then the blank sample was sterilized in 10% DMSO for standard preparation, the compound of Formula 1 to Formula 4 (50 μM) and salicylic acid (50 μM) of the present invention. And EGF (100 nM) used as a positive control, and incubated for 72 hours under the same conditions as above. After the incubation was completed, the culture supernatant was removed, the cells were fixed with ethanol, and washed three times with PBS (phosphate buffer saline). After the washing solution was removed, treated with colorimetric SRB solution, washed thoroughly with 1% acetic acid, and then observed the cells under a microscope to observe the state of the viable cells, and the absorbance was measured at 560 nm wavelength of ultraviolet light to measure the viability of the cells. .

72 hours after treatment of the compound of the present invention with keratinocytes as described above, the morphological changes of the cells were observed under a microscope. It was confirmed that the compound of the present invention changed the growth and morphological appearance of keratinocytes (FIG. 2A). ). In addition, the salicylic acid used as a positive control group was found to significantly increase the growth of keratinocytes when treated with the compound of the present invention, as opposed to inhibiting the growth of keratinocytes due to toxicity (FIG. 2B).

Experimental Example  3. Antimicrobial Effects of Compounds of the Invention

The antimicrobial effect of the compound synthesized in Example <1-2> was confirmed using acne bacteria ( Protonibacterium acnes ). For this purpose, acne bacteria were first cultured in agar medium. The compounds 1 to 4 and salicylic acid synthesized in Example <1-2> were soaked in a paper disk at a concentration of 200 mM, respectively, and the paper disks soaked with samples were grown on the agar medium where acne bacteria were grown. After 3 days, the antimicrobial effect of each compound was confirmed by measuring the size of the zone where the microorganism did not grow and became transparent.

As a result, the compound of the present invention did not reduce the antimicrobial effect of salicylic acid used as a positive control group, especially compounds 1 and 3 confirmed that the antimicrobial effect against acne bacteria significantly increased compared to salicylic acid (Fig. 3a and 3b).

Experimental Example  4. Antioxidant Effect of Compounds of the Invention

HHDPC, NIH3T3 fibroblasts and HaCaT keratinocytes were used to determine the antioxidant effect of the compounds of the present invention. To this end, the three cell lines were incubated in 96-well plates in the same manner as in Experimental Example 2, and then the compounds 1, 3 and salicylic acid of the present invention were added at a concentration of 50 μM, respectively, 1 hour before UV treatment. Treated. HHDPC, NIH3T3 fibroblasts and HaCaT keratinocytes were irradiated with 50 mJ UVB, 5 J UVA and 16 mJ UVB, respectively, treated with DCFH-DA, and cells were recovered after incubation for 30 minutes. After dispersing the cells in PBS, the FL1 value was measured using FACS, and the change of free radical species in the cell was confirmed using this.

As a result, the compounds of the present invention did not reduce the antioxidant effect of salicylic acid used as a positive control group, especially the concentration of the active oxygen species in the cell generated by the treatment of ultraviolet rays was significantly lower than or equal to salicylic acid. It was confirmed that the reduction (Fig. 4a to 6b).

Experimental Example  5. The compound of the present invention Extracellular  Effect on the Expression of Substrate

NIH3T3 fibroblasts were used to determine the effect of the compounds of the invention on the expression of extracellular matrix. To this end, each well of a 6-well plate was inoculated with 300,000 cells of NIH3T3 fibroblasts and then incubated in DMEM culture medium containing 10% FBS (Gibco, USA) for 24 hours under 37 ° C., 5% CO 2 . The cultured cell lines were removed from the bottom of the culture vessel with 1% trypsin solution and centrifuged to collect only cell precipitates. It was suspended again in DMEM medium containing no FBS, and then cultured under 37 ° C. and 5% CO 2 conditions for 24 hours. After 24 hours, the medium was changed to the same medium except for the serum completely, and the blank sample sterilized in 10% DMSO for the standard, 50 μM of salicylic acid used as a positive control with the compound of Formula 1 and Formula 3 of the present invention. It was treated with a concentration of and cultured for 72 hours under the same conditions as above. Thereafter, 4% paraformaldehyde cells were fixed, infiltrated with 0.5% Triton X-100, and blocked using 3% BSA to confirm collagen, elastin, and fibronectin expression through cell immunostaining. Primary antibodies to collagen, elastin, and fibronectin were treated 1: 100 and reacted overnight at 4 ° C. The secondary antibody was treated 1: 500 and reacted at room temperature for 2 hours, followed by nuclear staining and mounting using DAPI, followed by fluorescence microscopy.

On the other hand, after separating the RNA of the treated cells in the same manner as the above experiment, cDNA synthesis using cDNA synthesis kit (Intron, Korea) and PCR premix (Intron, Korea) and collagen, elastin, fibronectin Table 2 PCR was performed using the primers shown in FIG. Thereafter, mRNA levels of collagen, elastin and fibronectin were confirmed by 5% agarose gel electrophoresis.

factor Primer sequence SEQ ID NO: Collagen Forward direction (5 ') CACCCTCAAGAGCCTGAGTC (3') 5 Reverse (5 ') AGACGGCTGAGTAGGGAACA (3') 6 Elastin Forward direction (5 ') GGACCCCTGACTCGCGACCT (3') 7 Reverse (5 ') GGGGAGGTGGGACTGCCCAA (3') 8 Fibronectin Forward direction (5 ') CCAGGAACCGAGTACACCAT (3') 9 Reverse (5 ') ATACCCAGGTTGGGTGATGA (3') 10

As a result, it was confirmed that the compounds of the formulas (1) and (3) of the present invention significantly increased the protein and mRNA expression of collagen, elastin and fibronectin constituting the extracellular matrix than the salicylic acid used as the positive control (Fig. 7A and Fig. 7b).

Experimental Example  6. Anti-inflammatory Effects of Compounds of the Invention

Acne bacteria were used to confirm the anti-inflammatory effects of the compounds of the present invention. To this end, each well of a 6-well plate was inoculated with 300,000 cells of keratinocytes, and then cultured in DMEM medium containing 10% FBS (Gibco, USA) for 24 hours under 37 ° C. and 5% CO 2 conditions. After exchange with fresh medium, acne bacteria were treated at a concentration of 50 μg / ml, and the treated acne bacteria were treated with the compounds of Formulas 1 and 3 of the present invention and salicylic acid used as a positive control at a concentration of 50 μM. Then, incubated for 24 hours under the same conditions as above. After separating the RNA of the cell, cDNA synthesis using cDNA synthesis kit (Intron, Korea) and PCR premix (Intron, Korea) and TNF-a, IL-6, IL-1b, COX-2 PCR was performed using the primers shown in FIG. 3. 5% agarose gels were run to confirm mRNA levels of TNF-a, IL-6, IL-1b and COX-2.

factor Primer sequence SEQ ID NO: TNF-α Forward direction (5 ') CGTCAGCCGATTRTGCTATCT (3') 11 Reverse (5 ') CGGACTCCGCAAAGTCTAAG (3') 12 IL-6 Forward direction (5 ') AAAGAGGCACTGCCAGAAAA (3') 13 Reverse (5 ') ATCTGAGGTGCCCATGCTAC (3') 14 IL-1B Forward direction (5 ') TTCGACACATGGGATAACGA (3') 15 Reverse (5 ') TCTTTCAACACGCAGGACAG (3') 16 COX-2 Forward direction (5 ') ATCATTCACCAGGCAAATTGC (3') 17 Reverse (5 ') GGCTTCAGCATAAAGCGTTTG (3') 18

As a result, the compounds of formulas 1 and 3 of the present invention significantly reduced the expression of various inflammatory cytokines induced by acne bacteria, whereas salicylic acid used as a positive control almost suppressed the expression of inflammatory cytokines. It was confirmed that it did not (Fig. 8).

Formulation example  1: flexible cosmetics

Including the compound of the present invention prepared in Example <1-2>, a flexible cosmetic made of the following composition was prepared according to a general lotion manufacturing method.

ingredient Content (% by weight) Compound of the Invention 2.5 1,3-butylene glycol 6 glycerin 4 PEG 1500 One Sodium hyaluronate One Polysorbate 20 0.5 ethanol 8 Preservative, pigment Quantity Benzophenone-9 0.05 incense a very small amount Purified water Remaining amount Sum 100

Formulation example  2. Nutrition Cream

A nutrition cream comprising the compound of the present invention prepared in Example <1-2> and having the following composition was prepared according to a general nutrition cream manufacturing method.

ingredient Content (% by weight) Compound of the Invention 2.5 Meadowfoam oil 3 Cetearyl Alcohol 1.5 Stearic acid 1.5 Glyceryl Stearate 1.5 Floating paraffin 10 Beeswax 2 Polysorbate 60 0.6 Solbitan Sesquioleate 2.5 Squalane 3 1,3-butylene glycol 3 glycerin 5 Triethanolamine 0.5 Tocopheryl Acetate 0.5 Preservative, pigment Quantity incense Quantity Purified water Remaining amount Sum 100

Formulation example  3. Nutritional Cosmetics

Including the compound of the present invention prepared in Example <1-2>, the nutrient lotion consisting of the following composition was prepared according to a general lotion manufacturing method.

ingredient Content (% by weight) Compound of the Invention 2.5 1,3-butylene glycol 4 glycerin 4 Cetearyl Alcohol 0.8 Glyceryl Stearate One Triethanolamine 0.13 Tocopheryl Acetate 0.3 Liquid paraffin 5 Squalane 3 Macadamia Nut Oil 2 Polysorbate 60 1.5 Sorbitan sesquioleate 0.5 Carboxy Vinyl Polymer One Preservative, pigment Quantity incense Quantity Purified water Remaining amount Sum 100

Formulation example  4. Essence

An essence comprising the compound of the present invention prepared in Example <1-2> and having the following composition was prepared according to a general essence preparation method.

ingredient Content (% by weight) Compound of the Invention 2.5 glycerin 10 1,3-butylene glycol 5 PEG 1500 2 Allantoin 0.1 DL-panthenol 0.3 EDTA-2Na 0.02 Hydroxyethyl cellulose 0.1 Sodium hyaluronate 8 Carboxy Vinyl Polymer 0.2 Triethanolamine 0.18 Octyldodeceth-16 0.4 ethanol 6 Incense, preservative, coloring Quantity Purified water Remaining amount Sum 100

Formulation example  5. Hair serum

A hair serum comprising the compound of the present invention prepared in Example <1-2> and having the following composition was prepared according to a general hair serum manufacturing method.

ingredient Content (% by weight) Compound of the Invention One glycerin 10 1,3-butylene glycol 5 PEG 1500 2 Allantoin 0.1 DL-panthenol 0.3 EDTA-2Na 0.02 Hydroxyethyl cellulose 0.1 Sodium hyaluronate 8 Carboxy Vinyl Polymer 0.2 Triethanolamine 0.18 Octyldodeceth-16 0.4 ethanol 6 Incense, preservative, coloring Quantity Purified water Remaining amount Sum 100

Formulation example  6. Hair toner

A hair serum comprising the compound of the present invention prepared in Example <1-2> and having the following composition was prepared according to a general hair serum manufacturing method.

ingredient Content (% by weight) Compound of the Invention One glycerin 2 1,3-butylene glycol 2 PEG 1500 2 Allantoin 0.1 DL-panthenol 0.3 EDTA-2Na 0.02 Sodium hyaluronate 8 Carboxy Vinyl Polymer 0.2 Triethanolamine 0.18 ethanol 10 Incense, preservative, coloring Quantity Purified water Remaining amount Sum 100

<110> CAREGEN CO., LTD. <120> CONJUGATE OF SALICYLIC ACID AND PEPTIDE <130> 2016-DPA-1739 <160> 18 <170> KopatentIn 2.0 <210> 1 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Peptide 1 <400> 1 Tyr Lys Ser Lys Lys Gly Gly Trp Thr His   1 5 10 <210> 2 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> Peptide 2 <400> 2 Tyr Ile Ser Lys Lys His Ala Gly Lys Asn Trp Phe   1 5 10 <210> 3 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Peptide 3 <400> 3 Lys Leu Lys Lys Thr Glu Thr Gln   1 5 <210> 4 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> Peptide 4 <400> 4 Glu Leu Ile Glu His Gly Gly Gly Arg Pro Ala Asp   1 5 10 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer for collagen <400> 5 caccctcaag agcctgagtc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for collagen <400> 6 agacggctga gtagggaaca 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer for elastin <400> 7 ggacccctga ctcgcgacct 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for elastin <400> 8 ggggaggtgg gactgcccaa 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer for fibronectin <400> 9 ccaggaaccg agtacaccat 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for fibronectin <400> 10 atacccaggt tgggtgatga 20 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> forward primer for TNF-alpha <400> 11 cgtcagccga ttrtgctatc t 21 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for TNF-alpha <400> 12 cggactccgc aaagtctaag 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer for IL-6 <400> 13 aaagaggcac tgccagaaaa 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for IL-6 <400> 14 atctgaggtg cccatgctac 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer for IL-1b <400> 15 ttcgacacat gggataacga 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for IL-1b <400> 16 tctttcaaca cgcaggacag 20 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> forward primer for COX-2 <400> 17 atcattcacc aggcaaattg c 21 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for COX-2 <400> 18 ggcttcagca taaagcgttt g 21

Claims (15)

A compound having a structure in which salicylic acid and a water-soluble peptide consisting of 8 to 12 amino acid sequences are covalently linked,
The water-soluble peptide has a ratio of at least 50% of amino acids having a hydrophilic side chain, and
The amino acid having the hydrophilic side chain is arginine (Arg), histidine (His), lysine (Lys), aspartic acid (Asp), glutamic acid (Glu), serine (Ser), threonine (Thr), asparagine (Asn), glutamine (Gln) ), Cysteine (Cys), selenocysteine (Sec), glycine (Gly) and proline (Pro). delete delete delete delete The method according to claim 1,
The water-soluble peptide is a compound having a ratio of more than 70% amino acid having a hydrophilic side chain. The method according to claim 6,
The water-soluble peptide is a compound having a ratio of more than 90% amino acid having a hydrophilic side chain. delete The method according to claim 1,
The water-soluble peptide is a compound having five or less amino acids having a hydrophobic side chain. The method according to claim 9,
The water-soluble peptide has three or less amino acids having a hydrophobic side chain. The method according to claim 9,
Amino acids having the hydrophobic side chain include alanine (Ala), valine (Val), isoleucine (Ile), leucine (Leu), methionine (Met), phenylalanine (Phe), tyrosine (Tyr) and tryptophan (Trp). A compound selected from the group consisting of. The method according to claim 1,
The peptide is selected from the group consisting of peptides consisting of the amino acid sequence of SEQ ID NO: 1 to SEQ ID NO: 4. Claim 1, 6, 7 and 9 to 12, wherein the antimicrobial or anti-inflammatory pharmaceutical composition containing a compound of any one of claims. Claim 1, 6, 7 and 9 to claim 12 containing a compound of any one of antimicrobial, anti-inflammatory or antioxidant composition. The method according to claim 14,
Flexible lotion, nourishing lotion, nourishing cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray, powder, hair tonic, hair cream, hair lotion, hair shampoo, hair rinse, hair conditioner, Cosmetic composition having a formulation selected from the group consisting of hairspray, hair aerosol, pomade, sol-gel, emulsion, oil, wax and aerosol.
KR1020170021170A 2017-02-16 2017-02-16 Conjugate of salicylic acid and peptide KR102016658B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020170021170A KR102016658B1 (en) 2017-02-16 2017-02-16 Conjugate of salicylic acid and peptide

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020170021170A KR102016658B1 (en) 2017-02-16 2017-02-16 Conjugate of salicylic acid and peptide

Publications (2)

Publication Number Publication Date
KR20180094693A KR20180094693A (en) 2018-08-24
KR102016658B1 true KR102016658B1 (en) 2019-08-30

Family

ID=63454519

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020170021170A KR102016658B1 (en) 2017-02-16 2017-02-16 Conjugate of salicylic acid and peptide

Country Status (1)

Country Link
KR (1) KR102016658B1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110160131A1 (en) 2008-04-11 2011-06-30 Caregen Co., Ltd. Growth Factor-Mimicking Peptides and Uses Thereof

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2782269B1 (en) 1998-08-17 2001-08-31 Oreal COSMETIC AND / OR DERMATOLOGICAL COMPOSITION CONTAINING SALICYLIC ACID OR A SALICYLIC ACID DERIVATIVE AND USE THEREOF
WO2007118605A1 (en) 2006-04-18 2007-10-25 Dsm Ip Assets B.V. Cosmetic compositions comprising salicylic acid and ascorbic acid
KR101198918B1 (en) * 2009-09-01 2012-11-07 (주)케어젠 WNT10 Derived Peptides and Uses Thereof
KR101582306B1 (en) * 2013-04-22 2016-01-05 애니젠 주식회사 Curcumin-peptide complexes having improved solubility in comparison with curcumin and methods of preparing the same

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110160131A1 (en) 2008-04-11 2011-06-30 Caregen Co., Ltd. Growth Factor-Mimicking Peptides and Uses Thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Journal of Controlled Release, Vol. 88, pp. 1-9 (2003)
Molecules, Vol. 19, pp. 2481-2496 (2014.02.21.)*

Also Published As

Publication number Publication date
KR20180094693A (en) 2018-08-24

Similar Documents

Publication Publication Date Title
US10080775B2 (en) Peptide having skin whitening activity, and use thereof
JP2021080273A (en) Conjugate of minoxidil and peptide
US12005123B2 (en) Conjugate of isotretinoin and peptide
KR102160565B1 (en) Finasteride and peptide conjugate
JP2021176330A (en) Conjugate of salicylic acid and peptide
KR102016658B1 (en) Conjugate of salicylic acid and peptide
KR102160566B1 (en) Conjugate of minoxidil and peptide
EA041180B1 (en) SALICYLIC ACID AND PEPTIDE CONJUGATE
OA19296A (en) Conjugate of salicylic acid and peptide.
KR20180125419A (en) Conjugate of isotretinoin and peptide
OA19680A (en) Conjugate of Isotretinoin and Peptide.
EA041637B1 (en) ISOTRETINOIN CONJUGATE WITH PEPTIDE

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant