KR102005192B1 - Method and kit for detecting Legionella pneumophila and analyzing its serogroup using PCR - Google Patents

Abstract

The present invention collects only the advantages of a lateral flow assay and a molecular biological detection method using PCR to detect Legionella pneumophila and analyze the serogroup thereof in one kit at the same time. Specifically, the present invention enables the lateral flow assay device, for instance, the detection of PCR amplification products of mompS gene for the detection of Legionella pneumophila serogroup 1 and mip gene for detecting Legionella pneumophila in a membrane strip. Therefore, even without expensive molecular diagnostic equipment, the detection of Legionella pneumophila and the serogroup analysis thereof can be efficiently and conveniently performed in one kit at a low cost.

Description

The present invention relates to a method and kit for detecting Legionella pneumoniae and detecting serogroups using Legionella pneumophila,

The present invention relates to a method and kit for detecting Legionella pneumoniae by using a polymerase chain reaction, and more particularly, to a method and kit for analyzing a genome of Legionella pneumophila by collecting merits of a molecular biology detection method and a lateral flow analysis method using PCR The present invention relates to a method and a kit for the same which can perform bacterial detection and its serogroup analysis simultaneously in one kit.

In addition, the present invention enables the detection of PCR amplification products for the mip gene for the bacteriological detection of Legionella pneumophila and the mompS gene for the serogroup 1 type of Legionella pneumophila in the lateral flow analysis device, The present invention relates to a method and kit for detecting a bacterium of the genus Paramecium, which can be efficiently and cheaply performed in a single kit.

Legionella is an infectious disease caused by Legionella spp. And has legionella (pneumonia) and Pontiac fever (flu). Legionella pneumonia is a serious symptom of infection, unlike the relatively mild Pontiac fever, and occurs frequently in chronic patients, smokers, and immunocompromised patients.

Legionella's radio waves are absorbed into the body in the form of droplets in the form of droplets of polluted water such as cooling towers of large buildings, air conditioners, showers, severe respiratory therapy devices, faucets, decorative fountains and atomizers. Pneumocystic Legionellosis is a disease with a 2-10 day latency and an average of 7 days latency and is characterized by fever, chills, coughing with a dry cough or a small amount of sputum, muscle aches, headache, general weakness, anorexia, gastrointestinal disorder symptoms, . Legionella infections occur throughout the year, but in the case of mass outbreaks occur during the summer to early autumn.

The diagnosis of Legionella infection is made by isolating or identifying Legionella from respiratory secretions, lung tissue, pleural fluid, blood, or detecting specific antigens from the specimen. However, in the case of the culture method, the results may vary depending on the skill of the experimenter, and contamination may occur during the culturing process. In addition, clinical symptoms alone are difficult to distinguish from other causative agents of bacterial pneumonia and viral pneumonia, so conducting genetic testing is a quick and accurate way to diagnose Legionella. In addition, genetic testing can be used not only for the identification of Legionella but also for the serotype analysis, which is also effective in the management of Legionella infection. Legionella is one of the serogroups 1 to 6 and the serogroup 7 to 15. In epidemiological studies to prevent the spread of infection, analysis of the serogroup is very important for identification of the first infectious agent and identification of the propagation pathway. Especially, serotype 1 serotype is highly serodiagnosed in Legionella epidemiology, so simultaneous analysis of serogroup as well as identification of Legionella itself is important.

Therefore, it is required to provide a new technology capable of performing Legionella self-detection and its serogroup analysis concurrently at low cost, simple, and high sensitivity than the conventional molecular biology diagnostic method using PCR have.

It should be understood, however, that the foregoing description of the background art is merely for the purpose of promoting an understanding of the background of the present invention, and not as an admission that it can be used as the "prior art "

Korean Registered Patent No. 10-0602843 (July 19, 2006)

It is an object of the present invention to provide a method and kit for the detection of Legionella pneumoniae using a polymerase chain reaction and a method for analyzing a serogroup. Specifically, the object of the present invention is to collect the merits of a molecular biological detection method and a lateral flow analysis method using PCR and to simultaneously perform the detection of bacteria of Legionella pneumophila and its serogroup analysis in a single kit And a kit for the same.

It is also an object of the present invention to provide a method of detecting a PCR amplification product of a mip gene for the bacteriological detection of Legionella pneumophila and a mompS gene for the serogroup 1 type of Legionella pneumophila in a lateral flow analysis device, The present invention also provides a method and kit for the detection of Mycobacterium Legionella pneumophila and its serogroup analysis efficiently and efficiently in a single kit.

However, the above-described problems of the present invention are illustrative and not intended to limit the scope of the present invention. Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

As a result of intensive researches in order to solve the technical problem of the invention described above, the present inventors have found that a mip (macrophage infectivity potentiator) gene is selected as a target gene for the detection of a bacterium of Legionella pneumophila, In order to detect the sera group 1 of the filamentous fungus, a muntrimer (Major Outer Membrane Protein Precursor) gene was selected as a target gene, and a common sequence of each of these target genes was selected to detect specific strains of Legionella pneumophila and its specific primer PCR amplification products of PCR amplification products amplified by these primers, namely mip gene for the detection of Legionella pneumophila bacterium and mompS gene for serogroup type 1 detection of Legionella pneumophila were analyzed by immunological analysis, Designing test kits and methods that can be verified by analytical methods Reached.

As used herein, the term "specimen" includes not only sputum, saliva, and blood of suspect patients but also various samples capable of detecting genes of Legionella pneumophila such as respiratory secretions, lung tissue, pleural fluid, blood, .

As used herein, the term "gene sample" is used as a broad concept including DNA, RNA, cDNA generated from RNA by a reverse transcriptase, DNA or cDNA amplified through pre-PCR (preliminary PCR) .

As used herein, "lateral flow analysis device", "lateral flow analysis strip" or "lateral flow analysis membrane strip" means that at least two antibodies are immobilized on a membrane, which is a porous membrane through which PCR amplification products can flow by capillary action, A loading pad may be provided on the upstream side to absorb the PCR amplification product to be loaded and to ensure a uniform flow. The loading pad may be immersed in gold nanoparticles conjugated with streptavidin (or equivalent) that can selectively bind biotin (or equivalent) contained in the PCR amplification product. The loading pad may be composed of a sample pad to which the PCR amplification product is dropped and a bonding pad in which gold nanoparticles bonded with streptavidin (or equivalent material) are immersed. On the downstream side of the membrane, an absorption pad May be provided.

The method of detecting Legionella pneumoniae and serogroup analysis using the polymerase chain reaction according to one embodiment of the present invention,

A first tag was labeled at the 5 'end of a first forward primer specifically binding to a mip (macrophage infectivity potentiator) gene of Legionella pneumophila, which is a target gene for the detection of a strain of Legionella pneumophila, A second tag is labeled at the 5 'end of a second forward primer that specifically binds to the mompS gene (Major outer membrane protein precursor) of Legionella pneumophila, which is a target gene for detection of a mold, Specific binding to the 5 'end of a first reverse primer that specifically binds to the mip gene of the target gene, Legonella pneumophila, and the mompS gene of Legionella pneumophila, a target gene for the detection of Serotype 1 type 1 of Legionella pneumophila Labeling a third tag at the 5 'end of the second reverse primer;

Amplifying a gene sample in a sample by PCR using the pair of the first forward primer and the first reverse primer, the pair of the second forward primer and the second reverse primer,

Loading the PCR amplification product on one side of a lateral flow analysis device to form a complex with gold nanoparticles conjugated with a binding agent that specifically binds to the third tag;

Moving the complex to the other side of the lateral flow analysis device and exposing the complex to an anti-first tag antibody in a first test line of the lateral flow analysis device and a second test Lt; RTI ID = 0.0 > anti-second < / RTI > tag antibody in the line,

The presence or absence of a band formed by the collection of gold nanoparticles of the complex in the first test line and the second test line was confirmed to detect the bacterium of Legionella pneumophila in the sample and the detection of the serogroup 1 type of Legionella pneumophila .

When a band is formed in the first test line, Legionella pneumophila exists in the specimen. If a band is formed in the second test line, it can be judged that a serogroup 1 Legionella pneumophila exists in the specimen.

In one embodiment of the present invention, the first tag may be digoxigenin (DIG), and the second tag may be fluorescein. In the method of detecting Legionella pneumoniae and serogroup analysis according to one embodiment of the present invention, the first tag may be digoxigenin (DIG) and the second tag may be fluorescein.

In one embodiment of the present invention, the anti-first tag antibody may be an anti-DIG antibody and the anti-second tag antibody may be an anti-FITC antibody in the detection of Legionella pneumoniae and the analysis of a serum group.

In one embodiment of the present invention, the third tag may be biotin and the binding agent may be streptavidin in the detection of Legionella pneumoniae and the analysis of serogroup.

In one embodiment of the present invention, the first forward primer and the first reverse primer may be a primer of SEQ ID NO: 1 and a primer of SEQ ID NO: 2, respectively, in the detection of Legionella pneumoniae and the analysis of a serogroup.

In the detection of Legionella pneumoniae and the serogroup analysis method according to one embodiment of the present invention, the second forward primer and the second reverse primer may be the primer of SEQ ID NO: 3 and the primer of SEQ ID NO: 4, respectively.

The kit for the detection and serogroup analysis of Legionella pneumoniae using the polymerase chain reaction according to one embodiment of the present invention,

A first forward primer which specifically binds to a mip (macrophage infectivity potentiator) gene of Legionella pneumophila, which is a target gene for the detection of bacteria of Legionella pneumophila, and a first tag is labeled at the 5 'end;

A second forward primer which specifically binds to a major outer membrane protein precursor (mompS) gene of Legionella pneumophila, which is a target gene for the detection of serogroup 1 of Legionella pneumophila, and a second tag is labeled at the 5 'end;

A first reverse primer that specifically binds to the mip gene of Legionella pneumophila, a target gene for the detection of Legionella pneumophila, and a third tag at the 5 'end; And

A composition for PCR amplification comprising a second reverse primer that specifically binds to the mompS gene of Legionella pneumophila, a target gene for the detection of serogroup 1 of Legionella pneumophila, and a third tag at the 5 'end,

A first test line having an anti-first tag antibody provided on one side and specifically binding to the first tag, the gold nanoparticles conjugated with the binding specifically binding to the third tag; And a second test line having an anti-second tag antibody that specifically binds to the tag and is located at a distance from the first test line.

In one embodiment of the present invention, the first tag may be digoxigenin (DIG), and the second tag may be fluorescein. In the kit for the detection of Legionella pneumoniae and the serogroup analysis kit of the present invention, the first tag may be digoxigenin (DIG).

In one embodiment of the present invention, the anti-first tag antibody may be an anti-DIG antibody and the anti-second tag antibody may be an anti-FITC antibody.

In one embodiment of the present invention, the third tag may be biotin and the binding agent may be streptavidin. In the kit for the detection of Legionella pneumoniae and the serogroup analysis kit of the present invention, the third tag may be biotin.

In one embodiment of the present invention, the composition for PCR amplification may further comprise a DNA polymerase, dNTPs and a PCR buffer solution in the kit for the detection and serogroup analysis of Legionella pneumoniae.

In one embodiment of the present invention, the first forward primer and the first reverse primer may be the primers of SEQ ID NO: 1 and SEQ ID NO: 2, respectively, in the detection of the Legionella pneumoniae strain and the serogroup analysis kit.

The second forward primer and the second reverse primer may be a primer of SEQ ID NO: 3 and a primer of SEQ ID NO: 4, respectively, in the kit for the detection of Legionella pneumoniae and the serogroup analysis kit according to one embodiment of the present invention.

According to the present invention, it is possible to simultaneously detect the bacterium of Legionella pneumophila and the serogroup analysis of Legionella pneumophila by collecting merits of the molecular biology detection method and the lateral flow analysis method using PCR simultaneously in one kit.

Specifically, the present invention makes it possible to detect the PCR amplification products of the mip gene for the bacterium detection of Legionella pneumophila in the membrane strip and the mompS gene for the serogroup type 1 detection of Legionella pneumophila in a lateral flow analysis device, Without the need for molecular diagnostic equipment of Legionella pneumophila and its serogroup analysis can be performed efficiently and cheaply in a single kit.

Accordingly, the present invention provides a method for rapidly and accurately diagnosing Legionella pneumoniae bacteria and its serogroup analysis at a low cost, promptly and accurately diagnosing the epidemiology for preventing the spread of Legionella pneumoniae, Can be prevented.

On the other hand, the scope of the present invention is not limited by the above-mentioned effects.

Brief Description of the Drawings Fig. 1 is a diagram showing a result of homology analysis for a mip (macrophage infectivity potentiator) gene, which is a target gene for the detection of bacteria of Legionella pneumophila.
FIG. 2 is a graph showing a result of homology analysis of mompS (major outer membrane protein precursor) gene, which is a target gene for detection of serogroup 1 type of Legionella pneumophila.
3 is a diagram illustrating a main structure of a lateral flow analysis device according to one embodiment of the present invention.
FIG. 4 is a graph showing the result of performing lateral flow analysis on PCR amplification products of mip gene and mompS gene using the lateral flow analysis device shown in FIG. 3. FIG.

Hereinafter, the present invention will be described in more detail in the following Examples. It should be noted, however, that the following examples are illustrative only and do not limit or limit the scope of the present invention. It will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. The references cited in the present invention are incorporated herein by reference.

Throughout the specification, when an element is referred to as "comprising ", it means that it can include other elements as well, without excluding other elements unless specifically stated otherwise.

Example 1: Analysis of the gene homology of Legionella pneumophila

The mop (macrophage infectivity potentiator) gene was selected as the target gene for identifying Legionella pneumophila and the mompS (major outer membrane protein precursor) gene was selected as the target gene for identifying the serogroup of Legionella pneumophila. Homology analysis was carried out using sequence information of these genes registered in Genbank. The homology of these genes was analyzed using the open homology analysis program MEGA 7.0 ( https://www.megasoftware.net/ ). Sequence information for analysis of the homology of the gene of the mop (macrophage infectivity potentiator) gene and sequence information for analysis of the homology of the gene of the major outer membrane protein precursor (mompS) gene of Legionella pneumophila are shown in Tables 1 and 2, respectively .

Sequence information for homology analysis of Legonella pneumophila mip gene AF095216.1 AF095225.1 AF095217.1 AF095226.1 AF095219.1 AF095227.1 AF095222.1 AF095228.1 AF095224.1 AF095229.1

Sequence information for homology analysis of Legonella pneumophila mompS gene Serogroup
(Serogroup) Accession no. Serogroup
(Serogroup) Accession no. Serogroup
(Serogroup) Accession no. One AF078136.1 6 AY194417.1 11 AY194421.1 2 AY194414.1 7 AF078142.1 12 AF078147.1 3 AF078138.1 8 AY194418.1 13 AY194422.1 4 AY194415.1 9 AY194419.1 14 AY194423.1 5 AY194416.1 10 AY194420.1 15 AY194424.1

Example 2: Positive control preparation for mip gene and mompS gene amplification experiments

Using the sequence information shown in Tables 3 and 4 below, gene synthesis was performed as a template for amplification of mip gene and mompS gene of Legionella pneumophila. Each gene synthesis was carried out using the gene synthesis service of Bioneer (Daejeon Metropolitan City, Korea), and the mip synthetic gene of Legionella pneumophila and the mompS synthetic gene of Legionella pneumophila were quantified to 10 ² to 10 ⁵ copies / L. < / RTI >

Mip synthetic gene sequence information of Legionella pneumophila (SEQ ID NO: 5) mip (macrophage infectivity potentiator) (nucleotide position, 69 ~ 182, JN697590.1) GGTGACTGCAGCTGTTATGGGGCTTGCAATGTCAACAGCAATGGCTGCAACCGATGCCACATCATTAGCTACAGACAAGGATAAGTTGTCTTATAGCATTGGTGCCGATTTGGG

MompS synthetic gene sequence information of Legionella pneumophila (SEQ ID NO: 6) mompS (outer membrane protein precursor) (nucleotide position, 827-915, AF078136.1) CAGCGATTTCTATGATGGAATAGGTTTCGTTACTGGTTCTAAAAATGCCATCGTTCCTGAGTTGGAAGCTAAGCTTGGCGCTGACTACA

Example 3: Primer preparation and gene amplification for amplification of mip gene and mompS gene of Legionella pneumophila

Primers for specifically amplifying the mip gene and mompS gene of Legionella pneumophila were designed to have similar Tm values so that the mip gene sequence and the mompS gene sequence were selected and the experiment was performed under the same amplification conditions . The Tm values for the selected primer sequences were analyzed using the oligoanalyzer 3.1, a web-based program provided by IDT (INTEGRATED DNA TECHNOLOGIES). Detailed primer sequence information is shown in Table 5 below.

Primer sequence information for mip gene and mompS gene amplification of Legionella pneumophila SEQ ID NO: designation The base sequence (5 '- > 3') Length % GC Tm size One mip forward primer GCTTGCAATGTCAACAGCA 19 47.4 54.4 83bp 2 mip reverse primer CACCAATGCTATAAGACAACTTATCCT 27 37.8 54.8 3 mompS forward primer CAGCGATTTCTATGATGGAATAGGT 25 40 54.7 89bp 4 mompS reverse primer TGTAGTCAGCGCCAAGCTTA 20 50 56.4

  The primers of SEQ ID NO: 1 and SEQ ID NO: 2 are forward primers and reverse primers for specifically amplifying the mip gene of Legionella pneumophila, respectively, and amplify mip gene of 83 bp upon amplification. The primers of SEQ ID NO: 3 and SEQ ID NO: 4 are forward primers and reverse primers for specifically amplifying the mompS gene of the serogroup 1 type having the highest detection rate among Legionella pneumophila, respectively. The 89 bp mompS gene was amplified can do.

In this example, biotin was labeled at the 5 'end of the primer of SEQ ID NO: 2 and the primer 5' of SEQ ID NO: 4 so that the mip gene and mompS gene amplification product of Legionella pneumophila could be confirmed by lateral flow analysis, Digoxigenin (DIG) was labeled at the 5 'end of the primer of SEQ ID NO: 1 and 6-Carboxyfluorescein was attached to the 5' end of the primer of SEQ ID NO: Each labeled primer was synthesized using oligo-synthesis service of Bioneer (Daejeon, Republic of Korea) and prepared by adding sterile distilled water to a final concentration of 100 μM. As a master mix for PCR amplification, a 2X PCR master mix of PEMDX (Yongin, Gyeonggi-do, Korea) was used.

Gene amplification was performed using the AllInOneCycler (TM) PCR system of Bioneer Co., Ltd. according to the composition of the following Table 6 and the reaction conditions of Table 7.

PCR amplification composition of mip gene and mompS gene of Legionella pneumophila density Amount used per reaction (volume) The primer of SEQ ID NO: 1 100 [mu] M 0.1 μL The primer of SEQ ID NO: 2 100 [mu] M 0.1 μL The primer of SEQ ID NO: 3 100 [mu] M 0.1 μL The primer of SEQ ID NO: 4 100 [mu] M 0.1 μL PCR Master Mix 2 × 10 μL DNA template 10 ² to 10 ⁵ copies / μL 1 μL DW (distilled water) - 8.6 μL Total volume - 20 μL

PCR reaction conditions of mip gene and mompS gene of Legionella pneumophila denaturalization 95 ° C, 5 minutes 1 cycle denaturalization 95 ° C, 15 seconds 32 cycles Annealing & Extension 55 ° C, 45 seconds extension 72 ° C, 5 min 1 cycle

Example 4: Confirmation of mip gene and mompS gene amplified product of Legionella pneumophila using lateral flow analysis

In this Example, digoxigenin was labeled at the 5 'end of a forward primer (forward primer of SEQ ID NO: 1) for detecting mip gene (a bacterium detection gene) of Legionella pneumophila and the mompS gene of Legionella pneumophila (Reverse primer of SEQ ID NOS: 2 and 4) at the 5 'terminus of the forward primer (forward primer of SEQ ID NO: 3) to detect fluorescein at the 5 ' end of the forward primer Biotin was labeled and the PCR amplification products amplified by the primers were injected into a lateral flow analysis device and labeled with anti-DIG antibody (Legionella pneumophila) and anti-FITC antibody (Legionella pneumophila serogroup 1 type Detection) were carried out with streptavidin-conjugated gold (streptavidin-conjugated gold) on labeled membranes, respectively. It provides an example of the base pillar and a bacteria detection kit for the simultaneous detection thereof serogroup.

A device for the lateral flow analysis according to the above-described design was manufactured by PIDEX Co., Ltd. (Yongin, Gyeonggi-do, Korea). In order to confirm the PCR amplification products amplified by the primer pairs of SEQ ID NOs: 1 and 2 and the primer pairs of SEQ ID NOs: 3 and 4 for the detection of the serogroup 1 type of Legionella pneumophila in order to detect bacteria of Legionella pneumophila, Antibodies (Legionella pneumophila detection) and anti-FITC antibodies (Legionella pneumophila serogroup type 1 detection) were immersed in test lines 1 and 2 of the membrane, respectively. Streptavidin-conjugated gold nanoparticles were immersed in a loading pad to which the PCR amplification product was added to prepare a device for lateral flow analysis (FIG. 3). 5 μL of the amplification product obtained in Example 3 was added to the loading pad of the device prepared as described above, and 100 μL of the developing buffer was added. After 5 minutes, the analysis was carried out.

Since the loading pad is immersed in gold nanoparticles conjugated with streptavidin capable of specifically binding to biotin, the biotin-labeled PCR amplification product (i.e., the amplified product of SEQ ID NO: 2 or SEQ ID NO: 4 with the reverse primer When mip gene amplification product of Legionella pneumophila and / or mompS gene amplification product of Legionella pneumophila is loaded onto the loading pad, the streptavidin-conjugated gold nanoparticles bind to the biotin-labeled PCR amplification product to form a complex.

And the complex is moved by the capillary phenomenon caused by the expansion buffer. In the complex, the digoxigenin-labeled amplification product (that is, mip gene amplification product of Legionella pneumophila amplified by the forward primer of SEQ ID NO: 1) DIG antibody in line 1 to collect red nano particles in test line 1. This indicates that the mip gene of Legionella pneumophila exists in the gene sample to be amplified, that is, the detection signal of Legionella pneumophila.

Further, the complex is further moved by the capillary phenomenon caused by the development buffer, and the fluorescence-labeled amplification product in the complex (i.e., mompS gene amplification product of Legionella pneumophila amplified by the forward primer of SEQ ID NO: 3) FITC antibody of test line 2 to collect gold nanoparticles and display a red band in test line 2. This indicates that the mompS gene of Legionella pneumophila exists in the gene sample to be amplified, that is, the detection signal of serotype 1 of Legionella pneumophila.

Therefore, if a detection signal is displayed in the test line 1 but no detection signal is displayed in the test line 2, Legionella pneumophila exists in the sample, but it is not the serogroup 1 type. When both the test line 1 and the test line 2 show a detection signal, it is shown that there is a serotype 1 Legionella pneumophila in the specimen. On the other hand, it is determined that an error signal indicates that a detection signal appears only on the test line 2 without a detection signal on the test line 1, and if there is such an error signal, it is necessary to prepare the gene sample again from the sample or consider modification of the inspection method. Therefore, in the present invention, there is an advantage that the detection accuracy of the Legionella pneumophila can be doubly checked by the combination of the test line 1 and the test line 2 to further increase the detection accuracy.

On the other hand, when there is no Legionella pneumophila in the gene sample to be tested, the streptavidin-conjugated gold nanoparticles do not form a complex with the PCR amplification product, and the test lines 1 and 2 . This is because, in test line 1 and / or test line 2, the digoxigenin or fluorescein must be present in the gold nanoparticle-complex in order for the streptavidin-conjugated gold nanoparticles to aggregate, but there is no legionella nematophila in the gene sample It is because the forward primer of SEQ ID NO: 1 labeled with digoxigenin or the forward primer of SEQ ID NO: 3 labeled with fluorescein is not used in the PCR amplification process. In the present embodiment, although not shown for the sake of simplicity of explanation, the control line in which the streptavidin-conjugated gold nanoparticles that do not form a complex with the PCR amplification product are provided at the terminal end (in the buffer expansion direction) of the membrane strip Line) may be used to indicate a red band.

Therefore, in the case of using Legionella pneumoniae detection kit and a serogroup analysis kit according to one embodiment of the present invention, whether or not a red band appears in the test lines 1 and 2 can be simply checked to determine whether Legionella pneumophila exists in the sample and its serogroup is simple Can be analyzed effectively.

On the other hand, in the present embodiment, as a result of the lateral flow analysis on the PCR amplification product of Example 3, amplification of the mip gene and mompS gene of Legionella pneumophila up to a concentration of 10 ² to 10 ⁵ copies / μL was confirmed in the detection kit 4).

As a result, as shown in Fig. 4, the present invention is applicable to a lateral flow analysis device, for example, a mip gene for the bacterium detection of Legionella pneumophila in a membrane strip and a PCR amplification product for the mompS gene for serogroup 1 detection of Legionella pneumophila It is possible to efficiently and efficiently perform the microorganism detection of Legionella pneumophila and its serogroup analysis inexpensively and conveniently in a single kit without expensive molecular diagnostic equipment.

Accordingly, the present invention provides a method for rapidly and accurately diagnosing Legionella pneumoniae bacteria and its serogroup analysis at a low cost, promptly and accurately diagnosing the epidemiology for preventing the spread of Legionella pneumoniae, Can be prevented.

Although the present invention has been described with reference to the above embodiments, the present invention is not limited thereto. It will be understood by those skilled in the art that modifications and variations may be made without departing from the spirit and scope of the invention, and that such modifications and variations are also contemplated by the present invention.

<110> YOON, Hyun Kyu <120> Method and kit for detecting Legionella pneumophila and analyzing          its serogroup using PCR <130> P18-0054KR <160> 6 <170> KoPatentin 3.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> mip forward primer <400> 1 gcttgcaatg tcaacagca 19 <210> 2 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> mip reverse primer <400> 2 caccaatgct ataagacaac ttatcct 27 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> mompS forward primer <400> 3 cagcgatttc tatgatggaa taggt 25 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mompS reverse primer <400> 4 tgtagtcagc gccaagctta 20 <210> 5 <211> 114 <212> DNA <213> Artificial Sequence <220> <223> mip (macrophage infectivity potentiator) (nucleotide position,          69 to 182, JN697590.1) <400> 5 ggtgactgca gctgttatgg ggcttgcaat gtcaacagca atggctgcaa ccgatgccac 60 atcattagct acagacaagg ataagttgtc ttatagcatt ggtgccgatt tggg 114 <210> 6 <211> 89 <212> DNA <213> Artificial Sequence <220> MompS (outer membrane protein precursor) (nucleotide position,          827 to 915, AF078136.1) <400> 6 cagcgatttc tatgatggaa taggtttcgt tactggttct aaaaatgcca tcgttcctga 60 gttggaagct aagcttggcg ctgactaca 89

Claims (13)

A first tag is labeled at the 5 'end of a first forward primer of SEQ ID NO: 1 that specifically binds to the mip (macrophage infectivity potentiator) gene of Legionella pneumophila, a target gene for the detection of a strain of Legionella pneumophila, The second tag is labeled at the 5 'end of the second forward primer of SEQ ID NO: 3, which specifically binds to mompS (Major outer membrane protein precursor) gene of Legionella pneumophila, which is a target gene for the detection of the serogroup 1 of Pila, The target gene for the detection of the 5'-terminal of the first reverse primer of SEQ ID NO: 2 and the serogroup 1 of Legionella pneumophila that specifically binds to the mip gene of Legionella pneumophila, a target gene for the detection of bacteria of Legionella pneumophila, Of the second reverse primer of SEQ ID NO: 4 that specifically binds to the mompS gene of Legionella pneumophila Marking a third tag at the end,
Using the pair of the first forward primer of SEQ ID NO: 1 and the first reverse primer of SEQ ID NO: 2, the second forward primer of SEQ ID NO: 3 and the second reverse primer of SEQ ID NO: 4, Amplifying the gene sample by PCR,
The mip gene PCR amplification product of 83 bp and the mompS gene PCR amplification product of 89 bp obtained by the PCR amplification were loaded on one side of the lateral flow analysis device to bind specifically to the third tag Forming a composite with self-bonded gold nanoparticles,
Moving the complex to the other side of the lateral flow analysis device and exposing the complex to an anti-first tag antibody in a first test line of the lateral flow analysis device and a second test Lt; RTI ID = 0.0 &gt; anti-second &lt; / RTI &gt; tag antibody in the line,
The presence or absence of a band formed by the collection of gold nanoparticles of the complex in the first test line and the second test line was confirmed to detect the bacterium of Legionella pneumophila in the sample and the detection of the serogroup 1 type of Legionella pneumophila A method for detecting Legionella pneumoniae and serogroup analysis using a combination of polymerase chain reaction and lateral flow analysis. The method according to claim 1,
Wherein said first tag is digoxigenin (DIG), and said second tag is fluorescein. A method for detecting Legionella pneumoniae and serogroup analysis using a combination of a polymerase chain reaction and a lateral flow analysis method . 3. The method of claim 2,
Wherein the anti-first tag antibody is an anti-DIG antibody and the anti-second tag antibody is an anti-FITC antibody, the detection of Legionella pneumoniae using a combination of a polymerase chain reaction and a lateral flow assay, Analysis method. The method of claim 3,
Wherein said third tag is biotin and said binding agent is streptavidin. 2. The method of claim 1, wherein said third tag is biotin and said binding agent is streptavidin. delete delete A first forward primer of SEQ ID NO: 1, specifically binding to a mip (macrophage infectivity potentiator) gene of Legionella pneumophila, a target gene for the detection of a bacterium of Legionella pneumophila, and having a first tag at its 5 'end;
3, which specifically binds to the major outer membrane protein precursor (mompS) gene of Legionella pneumophila, which is a target gene for the detection of serogroup 1 of Legionella pneumophila, and the second tag of SEQ ID NO: 3, primer;
A first reverse primer of SEQ ID NO: 2, specifically binding to a mip gene of Legionella pneumophila, a target gene for the detection of a bacterium of Legionella pneumophila, and having a third tag at the 5 'end; And
PCR amplification comprising a second reverse primer of SEQ ID NO: 4, which specifically binds to the mompS gene of Legionella pneumophila, a target gene for the detection of serogroup 1 of Legionella pneumophila, and a third tag at the 5 'end, The composition,
The mip gene PCR amplification product of 83 bp size and the mompS gene PCR amplification product of 89 bp size obtained through PCR amplification using the PCR amplification composition were loaded on one side and specifically bound to the third tag A first test line having an anti-first tag antibody provided on one side thereof and specifically binding with the first tag, and a second anti-first tag anti-binding agent which specifically binds to the second tag, A method for detecting Legionella pneumoniae using a combination of a polymerase chain reaction and a lateral flow assay, comprising a lateral flow analysis device having a second test antibody and a second test line positioned at a distance from the first test line, Analysis Kit. 8. The method of claim 7,
Wherein the first tag is a digoxigenin (DIG), and the second tag is fluorescein. A kit for detecting a Legionella pneumoniae strain and a serogroup analysis kit using a combination of a polymerase chain reaction and a lateral flow analysis method . 9. The method of claim 8,
Wherein the anti-first tag antibody is an anti-DIG antibody and the anti-second tag antibody is an anti-FITC antibody, the detection of Legionella pneumoniae using a combination of a polymerase chain reaction and a lateral flow assay, Analysis Kit. 10. The method of claim 9,
Wherein the third tag is biotin and the binding agent is streptavidin. 5. The kit of claim 1, wherein the third tag is biotin and the binding agent is streptavidin. 11. The method according to any one of claims 7 to 10,
The composition for PCR amplification comprises a combination of a polymerase chain reaction and a lateral flow analysis, further comprising a DNA polymerase, dNTPs and a PCR buffer solution, and a kit for the detection of the genus Legionella pneumoniae and a serogroup analysis kit. delete delete

Images