KR102002962B1 - Composition for anti-obesity using vanadium binding proteins purifiedfrom the sea squirt and functionalfood composition comprising this - Google Patents

Abstract

The present invention relates to an anti-obesity composition containing vanadium binding proteins purified from sea squirt as an active ingredient and a functional food composition comprising the same. The vanadium binding proteins separated from sea squirt according to the present invention have an activity of inhibiting lipogenesis. Accordingly, the composition containing the proteins as an active ingredient can be used as a functional food for preventing and treating obesity.

Description

TECHNICAL FIELD The present invention relates to a composition for anti-obesity using a vanadium-binding protein purified from a sea urchin, and a functional food composition containing the vanadium binding protein,

The present invention relates to a composition for anti-obesity comprising a vanadium-binding protein having a lipid-inhibiting effect purified from sea squirt as an active ingredient, and a functional food composition containing the same.

Lipid production is regulated by a complex and highly coordinated gene expression program in which PPAR-γ (peroxisome proliferator-activated receptor γ) and C / EBP-α (CCAT / enhancer binding protein-α) play an important role in mammalian cells Siersbaek et al., 2012). In lipogenesis, progenitor stem cells differentiate into lipid-accumulated adipocytes. Fat tissue is considered to be an important human energy store that serves as an important regulator of glucose homeostasis (Rosen et al., 2010). There are two types of fat tissue in the human body; There are brown fat and white fat tissue, and white fat tissue is most abundant, storing energy in the form of triglyceride. Increased white adipose tissue leads to obesity, which results in the destruction of hormones and the release of inflammatory cytokines and adipokines, which in turn alter normal energy homeostasis, leading to many disorders such as cardiovascular disease (Farmer et al. , 2008). The secreted adipokines interfere with insulin signaling by inducing insulin resistance, resulting in increased demand for insulin production and, if the production fails to meet the requirement, leads to type 2 diabetes (T2DM) (Siersbaek et al., 2012).

The process of lipogenesis is also associated with changes in cell morphology, induction of insulin sensitivity, and changes in secretory cells (Lefterova et al., 2009). Molecular and cellular mechanisms of lipogenesis have been extensively studied using 3T3-L1 preadipocyte cell lines, which differentiate into adipocytes upon stimulation similar to human obesity (Gregoire et al., 1998). Numerous genes are known to be involved in the lipogenesis process. In addition to PPAR-γ and C / EBP-α, many regulators have been shown to produce mature adipocytes such as fatty acid synthase (FAS), sterol regulatory factor binding protein-1 (SREBP-1) and lipid protein lipase (LPL) Regulate lipogenesis at other stages (Kim et al., 1998).

PPAR-y is induced during the differentiation of progenitor adipocytes into adipocytes and is essential for this process, and when it is lacking, precursor cells can not differentiate into mature adipocytes. PPAR-γ is known to promote lipid production in C / EBP-α deficient cells, but C / EBP-α can not induce lipid production in PPAR-γ deficient cells (Wu et al., 1999). Cells deficient in C / EBP-α can differentiate into adipocytes, but they demonstrate that cross-regulation between C / EBP-α and PPAR-γ is required to maintain differentiation by accumulating smaller lipid particles (Kim et al., 1998).

Sterol regulatory factor-binding protein 1 (SREBP-1), also referred to as adipocyte differentiation and differentiation-dependent factor 1 (ADD1), is associated with adipocyte differentiation and cholesterol homeostasis (Yokoyama et al., 1993). SREBP-1 plays a role in adipocyte gene expression by regulating the expression of FAS and LPL, which are important genes involved in fatty acid metabolism (Kim et al., 1996).

Vanadium compounds are known to mimic the metabolic effects of insulin in rat adipocytes (Heyliger et al., 1985). Liu et al. (2015) reported that vanadium-binding protein isolated from the field of Apostichopus japonicus activates the WNT / β-catenin pathway by down-regulating the expression of PPAR-γ and C / EBP-α to significantly inhibit adipocyte differentiation Respectively.

Accordingly, the present inventors have completed the present invention by purifying vanadium-binding protein from the blood of H. roretzi and confirming their lipid-producing inhibitory effect while trying to find an anti-obesity substance.

It is an object of the present invention to provide an anti-obesity composition comprising a vanadium-binding protein having a lipid-inhibiting activity purified from sea squirt as an active ingredient and a functional food composition containing the same.

In order to accomplish the above object, the present invention provides an anti-obesity composition comprising, as an active ingredient, a vanadium-binding protein having a lipid-inhibiting effect isolated from sea squirt.

In addition, the present invention provides a functional food composition for preventing and treating obesity containing the vanadium-binding protein as an active ingredient.

Hereinafter, the present invention will be described in detail.

The present invention provides an anti-obesity composition comprising, as an active ingredient, a vanadium-binding protein having a lipid-inhibiting effect isolated from sea squirt.

In the composition for anti-obesity of the present invention, it is preferable that the bark is Halocynthia roretzi, wherein the protein is more preferably separated from plasma of the bark, and the composition further comprises inorganic vanadium More preferably, the inorganic vanadium is most preferably ammonium metavanadate.

In the present invention, the intestinal motility and the vanadium-binding protein separated from plasma are abbreviated as VBP-embedded and VBP-plasma, respectively.

Lipid production is regulated by the cascade of gene expression programs. In mammalian cells, peroxisome proliferator-activated receptor gamma (PPAR-gamma) and C / EBP-alpha (CCAT / enhancer binding protein-alpha) are considered important regulators of lipid production. Apart from other genes such as fatty acid synthetase (FAS), enzymes such as sterol regulatory factor binding protein-1 (SREBP-1) and lipoprotein lipase (LPL) and hormone-sensitive lipase are also known to modulate the lipogenesis process . In the present invention, 3T3L-1 cells treated with VBP-plasma and inorganic vanadium significantly decreased lipid content during the maturation of progenitor-adipocytes in a dose-dependent manner, but VBP-embryos did not have a significant effect on lipid accumulation. Both VBPs did not have a significant effect on cell viability, but inorganic vanadium significantly reduced cell viability. To understand the antiproliferative effects of VBP-plasma, several lipid-producing transcription factors and enzyme expression were examined using RT-PCR. VBP-plasma and inorganic vanadium down-regulated the expression of transcription factors, PPAR-γ, C / EBP-α, SREBP1 and FAS. However, there was no significant effect on HSL, LPL and lipolytic enzyme expression by VBP-plasma. On the other hand, inorganic vanadium significantly increased the expression of LPL. Based on these results, the reduction of lipoprotein accumulation by VBP-plasma may be mediated by reducing lipogenesis rather than by lipid degradation. Thus, VBP-plasma can be applied to obesity treatment.

In the present invention, the effect of vanadium binding protein and inorganic vanadium extracted from H. roretzi on lipid production of 3T3L-1 cells was examined. Although crude and purified VBP-plasma and inorganic vanadium decreased lipid content in a dose-dependent manner, untreated and purified VBP-viscera had no significant effect on lipid accumulation in 3T3 L1 cells. In mature adipocytes, 20 μM inorganic vanadium significantly reduced cell viability compared to the control, but untreated and purified VBP did not significantly affect cell viability. VBP-plasma and ammonium metavanadate at 5, 10 and 20 μM in RT-PCR and Western blot, respectively, significantly reduced the expression of PPAR-γ and C / EBP-α mRNA and protein. The decrease in mRNA and protein expression of C / EBP-α by VBP-plasma was significantly higher than inorganic vanadium. FAS and SREBP-1 mRNA levels and protein expression were slightly inhibited by purified VBP-plasma and ammonium metavanadate. Expression by LPL was significantly enhanced by 20 μM inorganic vanadium, but the crude and purified VBP-plasma was not significantly more effective than the control. The decrease in lipid accumulation in 3T3 L1 cells by VBP-plasma may be mediated by decreasing lipogenesis and not by lipid degradation. The reduction of lipid accumulation and cell viability by inorganic vanadium may be two actions that reduce lipogenesis and induce lipolysis. Thus, VBP-plasma can be applied as a potential therapeutic for obesity treatment.

In addition, the composition of the present invention may further comprise other herbal medicines or extracts thereof which are pharmaceutically acceptable for enhancing the pharmacological effect. In this case, the extract of the herb medicine may be prepared according to the above-mentioned extraction method, and then added to the composition of the present invention or may be incorporated into the composition obtained by mixing the herb medicine. The term "pharmaceutically acceptable" as used herein means physiologically acceptable and does not normally cause an allergic reaction or a similar reaction when administered to humans.

In addition, the composition according to the present invention may further comprise one or more pharmaceutically acceptable carriers, excipients or diluents.

The pharmaceutically acceptable carrier may further include, for example, a carrier for oral administration or a carrier for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like.

In addition, the carrier for parenteral administration may contain water, a suitable oil, a saline solution, an aqueous glucose and a glycol, and may further contain a stabilizer and a preservative. Suitable stabilizers include antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. Other pharmaceutically acceptable carriers can be found in Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, Pa., 1995).

The composition for anti-obesity of the present invention can be administered to mammals including humans by any method. For example, it can be administered orally or parenterally. Parenteral administration methods include, but are not limited to, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual or rectal administration Lt; / RTI > Preferably, the composition of the present invention can be administered transdermally. The term " transdermal administration " as used herein refers to administration of the composition of the present invention to cells or skin to allow the active ingredient contained in the anti-obesity composition to be delivered into the skin. For example, the composition of the present invention can be administered in a scanning type formulation, pricking the skin lightly with a 30-gauge thin injection needle, or directly applying it to the skin.

The composition of the present invention may be formulated into oral or parenteral dosage forms according to the route of administration as described above.

In the case of a preparation for oral administration, the composition of the present invention may be formulated into a powder, a granule, a tablet, a pill, a sugar, a tablet, a liquid, a gel, a syrup, a slurry, . For example, an oral preparation can be obtained by combining the active ingredient with a solid excipient, then milling it, adding suitable auxiliaries, and then processing the mixture into a granular mixture. Examples of suitable excipients include, but are not limited to, sugars including lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol and maltitol, and starches including corn starch, wheat starch, rice starch and potato starch, Cellulose such as methylcellulose, sodium carboxymethylcellulose and hydroxypropylmethyl-cellulose and the like, fillers such as gelatin, polyvinylpyrrolidone and the like. In addition, crosslinked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may optionally be added as a disintegrant. Further, the pharmaceutical composition of the present invention may further comprise an anti-coagulant, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent and an antiseptic agent.

In the case of a preparation for parenteral administration, it can be formulated by a method known in the art in the form of injection, cream, lotion, external ointment, oil, moisturizer, gel, aerosol and nasal aspirate. These formulations are described in Remington's Pharmaceutical Science, 15th Edition, 1975. Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour, which is a commonly known formulary for all pharmaceutical chemistries.

The total effective amount of the vanadium-binding protein, which is an active ingredient of the composition of the present invention, can be administered to a patient in a single dose and can be administered to a patient in a fractionated treatment protocol administered at multiple doses over a prolonged period of time ≪ / RTI > The composition of the present invention may vary in the content of the active ingredient depending on the degree of the disease. Preferably, the preferred total dose of the vanadium-binding protein of the present invention may be from about 100 μg to 5 mg per kilogram of patient body weight per day, most preferably from 500 μg to 1 mg per kilogram of patient body weight per day. However, the dosage of the protein depends on various factors such as the patient's age, body weight, health condition, sex, severity of disease, diet and excretion rate as well as administration route and frequency of treatment of the pharmaceutical composition, In view of this point, one of ordinary skill in the art will be able to determine the appropriate effective dose according to the particular use of the protein as an anti-obesity treatment. The composition according to the present invention is not particularly limited to the formulation, administration route and administration method as long as the effect of the present invention is exhibited.

In addition, the present invention provides a functional food composition for preventing and treating obesity containing the vanadium-binding protein as an active ingredient.

In the functional food composition for preventing and treating obesity of the present invention, it is preferable that the composition further contains inorganic vanadium as an active ingredient, and the inorganic vanadium is preferably ammonium metavanadate.

The food composition of the present invention includes all forms such as functional food, nutritional supplement, health food and food additives. Food compositions of this type may be prepared in a variety of forms according to conventional methods known in the art.

For example, as a health food, the seaweed binding protein of the present invention itself may be prepared in the form of tea, juice, and drink and then consumed, or granulated, encapsulated, and powdered. The vanadium binding protein of the present invention may be mixed with a known substance or active ingredient known to have antidiabetic and antioxidative effects to form a composition.

Functional foods also include beverages (including alcoholic beverages), fruits and their processed foods (e.g., canned fruits, bottled, jam, maalmalade, etc.), fish, meat and processed foods such as ham, Etc.), breads and noodles (eg udon, buckwheat noodles, ramen noodles, spaghetti, macaroni, etc.), fruit juice, various drinks, cookies, Retort foods, frozen foods, various seasonings (e.g., soybean paste, soy sauce, sauces, etc.) by adding the DN and HP of the present invention.

In order to use the vanadium-binding protein of the present invention in the form of a food additive, it may be prepared in the form of a powder or a concentrated liquid.

As described above, the vanadium-binding protein isolated from the sea weed of the present invention has a lipid-production inhibiting activity, so that a composition containing it as an active ingredient can be used for anti-obesity, and a functional food composition for the treatment and prevention of obesity .

FIG. 1 is a graph showing the effect of non-purified vanadium binding protein on 3T3-L1 cell viability on (a) 3 days and (b) 6 days.
FIG. 2 is a graph showing the effect of purified vanadium binding protein and inorganic vanadium on 3T3-L1 cell viability on (a) 3 days and (b) 6 days.
Figure 3 is a graph showing the effect of the Vanadium binding protein and inorganic vanadium from H. roretzi on (a) control, (b) 400 μM untreated VBP blood vessels, (c) 400 μM untreated VBP- ) Of 20 μM of purified VBP-plasma, (e) 20 μM of purified VBP-embedded, and (f) 20 μM of ammonium metavanadate.
Figure 4 is a graph showing the effect of (a) untreated VBP and (b) purified VBP and inorganic vanadium on lipid accumulation of 3T3-L1 adipocytes.
FIG. 5 is a photograph showing the effect of VBPs and inorganic vanadium on mRNA expression in 3T3-L1 mature adipocytes. FIG.
Figure 6 is a graph showing the effect of VBPs and inorganic vanadium on the relative mRNA expression of (a) PPAR-gamma and (b) C / EBP- alpha in mature adipocytes, showing that untreated and purified VBP- There was a significant difference (p <0.05) between plasma and inorganic vanadium (p <0.05).
Figure 7 A graph showing the effect of VBP and inorganic vanadium on the relative mRNA expression of (a) SREBP-1 and (b) FAS in mature adipocytes, compared to untreated and purified VBP-plasma and inorganic vanadium at the same concentration of xz There was a significant difference (p <0.05), indicating that there was a significant difference compared to each concentration of ac (p <0.05).
Figure 8 is a graph showing the effect of VBP and inorganic vanadium on the relative mRNA expression of (a) LPL and (b) HSL in mature adipocytes, compared to untreated and purified VBP-plasma and inorganic vanadium at the same concentration of xz (P <0.05), indicating that there was a significant difference compared to each concentration of ac (p <0.05).
9 shows (a) a photograph of the effect of VBP on protein expression of adipocyte-specific gene in mature amyloid adipocytes detected by Western blot and (b) a graph of protein expression, (P < 0.05).

Hereinafter, preferred embodiments of the present invention will be described in detail with reference to the drawings. However, it should be understood that the following embodiments are provided so that those skilled in the art may understand the present invention without departing from the scope and spirit of the present invention. It is not.

<Example> Isolation of Vanadium Binding Protein from Murine

<1-1> Materials

3T3-L1 precursor adipocytes were obtained from the American Type Culture Collection (ATCC, Mansassas, VA, USA). Cell culture medium Dulbecco's modified Eagle's medium (DMEM), penicillin / streptomycin, Bovine calf serum (BCS), and other materials required for cell culture were purchased from Gel Company (San Francisco, CA, USA). 2-sulfophenyl] -2H-tetrazolium disodium salt of the compound [WST-1] [2- (4-nitrophenyl) Were purchased from DoGenBio Co., Ltd (Seoul, Kyunggi, Korea). Isobutylmethylxanthine (IBMX), dexamethasone, insulin and Oil-Red-O solution were purchased from St. Louis, MO, USA. TRIzol reagent was purchased from Invitrogen (Carlsbad, CA, USA). Rabbit anti-mouse PPAR-γ, C / EBP-α, FAS, SREBP-1, LPL and β-actin antibodies were obtained from Cell Signaling (Danvers, MA, USA). All of the reagents used in the experiments were used for analytical grade.

&Lt; 1-2 > Cell line and cell culture

3T3-L1 precursor adipocytes were obtained from the American Type Culture Collection (ATCC, Mansassas, VA, USA). Cells were inoculated into DMEM medium supplemented with 10% BCS, 1% penicillin and 100 μg / mL streptomycin and cultured in a humidified incubator at 37 ° C in 95% air and 5% CO ₂ .

<1-3> Fat Cell Differentiation

3T3-L1 precursor adipocytes were induced to mature adipocytes according to the method of Barun et al. (2014). For adipocyte differentiation, 3T3-L1 precursor adipocytes were cultured in 10% BCS / DMEM. Two days after confluence (day 0), the cells were stimulated in 10% BCS / DMEM for 2 days with differentiation medium containing 1.0 μM dexamethasone, 0.5 mM IBMX and 1.0 μg / mL insulin. On day 2, the differentiation medium was replaced with an adipocyte-containing medium containing 1.0 μg / mL insulin in DMEM supplemented with 10% BCS. After 2 days (4 days), the medium was replaced with 10% BCS / DMEM and the cells were cultured for 4 days (day 8).

<1-4> Sample preparation

Halocynthia roretzi, fresh from the local fish market (Gangneung, Korea), was packed in ice and transferred to the laboratory within 1 hour. *? * Separation of blood plasma, It was frozen (at -80 ° C) and stored at -25 ° C.

<1-5> Extraction of Vanadium Binding Protein

Extraction of VBP from plasma was performed with slight modification of the method of Yoshihara et al., (2005. Biochim. Biophys. Acta., 1730: 206-14). After centrifugation at 1000 xg for 10 min at 4 ° C to remove blood cells, plasma was isolated from the body cavity. Then, 500 mM Tris-HCl (pH 8.0) was added (1/9 of the sample volume) and mixed well. Proteins in the plasma were precipitated with 80% ammonium sulfate at 4 ° C for 20 hours. Plasma proteins were obtained by centrifugation at 17,400 xg and 4 ° C for 30 min and resuspended in 200 ml of 20 mM NaH ₂ PO ₄ (pH 7.2) containing 500 mM NaCl. Thereafter, dialysis was performed with 50 mM Tris-HCl buffer containing 1 mM each of PMSF and EDTA at pH 7.4 and 4 ° C for 24 hours. VBP extraction from intestines and muscles was performed with slight modification of the method of Liu et al., (2015. J. Funct. Foods 17: 504-13). Each viscera of intestines and muscles were harvested and homogenized in 5 volumes (ml per gram wet weight) of buffer (200 mM Tris-HCl, 150 mM NaCl, 10 mM EDTA, pH 8.0). The homogenized solution was precipitated with 30% ammonium sulfate and centrifuged at 17,400 x g and 4 ° C for 10 min. The supernatant obtained by centrifugation was then precipitated with 80% ammonium sulfate and centrifuged at 17,400 x g and 4 ° C for 30 minutes. The 80% ammonium sulphate precipitate was redissolved in 5X dose (ml per gram wet weight) in Tris-HCl buffer (50 mM, pH 8.0) and incubated at 4 ° C for 24 hours at 4 ° C against the same buffer containing 1 mM PMSF and EDTA, Hour dialysis, and then lyophilized.

<1-6> Purification of Vanadium Binding Protein

Plasma (1.8g) and internal (1.4g) ammonium sulfate precipitate was dissolved in _{20 mM NaH 2 PO 4 (pH} 7.2) in 5 ml. It was then filtered through a 0.45 μm membrane and loaded onto a DEAE Sepharose fast flow ion exchange column (1.6 x 30.0 cm) pre-equilibrated with 50 mM Tris-HCl (pH 7.4). The vanadium binding protein was eluted with a linear gradient buffer of 0-400 mM NaCl at a flow rate of 1.0 ml / min. For the first 30 minutes, the elution buffer was changed to a gradient of 100, 200 and 400 mM NaCl concentration every 90 minutes after elution with only equilibrium buffer. 6 ml / tube were collected with a fraction collector (FC204; Gilson Inc., Middleton, WI, USA). The vanadium-containing protein fraction purified by ion exchange chromatography was redissolved in a 50 ml Tris-HCl buffer (pH 8.0) at a flow rate of 0.7 ml / min using a Sephacryl S-200 HR column (2.6 x 90.0 cm). The protein fraction (6 ml / tube) containing vanadium (VBP-plasma: 18-36 fraction, VBP-visceral: 25-42 fraction) was lyophilized and stored at -25 ° C.

The purity and yield of VBP-embedded and VBP-plasma were 13.4-fold, 7.1%, 20.9-fold and 6.8%, respectively. There were two protein peaks (peaks I and II) in the pattern of the ion exchange chromatograms of viscera and plasma, and only double internal peak II and plasma peak I contained 10.0 and 54.0 mg / kg vanadium, respectively. The pattern of the gel filtration chromatogram of plasma peak I had two protein peaks, peak IA and IB, and only one protein peak, peak IIA of visceral peak II. Only the dual peaks IB and IIA contained vanadium at 64.0 and 15.0 mg / kg, respectively. Peak IIA contained one protein while Peak IB showed two protein bands on SDS-PAGE with apparent molecular weights of 26.5 and 68.8 and 24.3 kDa, respectively. When Peak IB was further analyzed using native-PAGE, it was analyzed as a single protein with an apparent molecular weight of 96.7 kDa. Thus, the peak IB of VBP-plasma was a protein dimer whereas the peak VBA-IIA was a protein monomer.

Experimental Example 1 Cell viability

Cell viability was measured with the EZ-cytox assay kit and the procedure was performed according to the manufacturer's manual. 3T3-L1 precursor adipocytes were seeded in 96-well plates at a density of 3 x 10 ³ / well and stimulated mature adipocytes as described above. Cell viability was measured using an EZ-cyTox Cell Viability Assay Kit (DoGenBio Co., Ltd., Guro-gu, Seoul, Korea) at 3 and 6 days of culture. 10 占 퐇 of WST-1 solution was added to each well, and the solution was further incubated at 37 占 폚 for 4 hours. Optical density was measured at 450 nm with a microplate reader (Bio-Tek Instruments Inc., Winooski, VT, USA).

The effects of VBP and inorganic vanadium compounds (ammonium metavanadate) on the survival rate of 3T3-L1 mature adipocytes were evaluated on days 3 and 6 of culture. The intestinal and plasma amorphous and purified vanadium-binding proteins did not affect cell viability until day 6 of culture (Fig. 1). Ammonium metavanadate, an inorganic vanadium compound, had a cell viability of 74.2 ± 4.89% at a concentration of 20 μM on the 6th day of culture. Thus, it has been found that inorganic vanadium (vanadium binding protein) is not cytotoxic, whereas inorganic vanadium is somewhat cytotoxic (FIG. 2).

<Experimental Example 2> Effect of VBPs on lipid accumulation of 3T3L-1 cells by oil-red-O staining analysis

On the 6th day of incubation, 3T3-L1 cells were washed twice with PBS (pH 7.4) and fixed with 10% paraformaldehyde for 1 hour at room temperature. The cells were then washed with PBS and stained with 0.36% Oil-red O filtrate solution (60% isopropanol and 40% water) for 30 minutes. Excess oil-red O dye was removed by washing three times with distilled water. The oil droplets stained in 3T3-L1 cells were extracted with 0.5 mL of 100 mL of isopropanol and absorbance was measured at 490 nm (FIG. 3).

3T3L-1 adipose precursor cells can differentiate into many adipocytes within approximately one week upon induction with dexamethasone (DEX), isobutylxanthin (IBMX) and insulin (Green et al., 1975). This cocktail activates lipogenesis differentiation and leads to the next stage of lipid production. DEX and IBMX are direct inducers of genes responsible for the expression of C / EBP-β and C / EBP-δ, which are reduced and replaced by C / EBP-α and PPAR-γ at the final stage of differentiation (Yeh et al 1995). And insulin promotes glucose uptake in preadipocytes (Summers et al., 1999).

The effects of H. roretzi plasma and visceral vanadium binding protein, and inorganic vanadium on the lipid content are shown in FIG. The lipid content of cells treated with various concentrations of VBP and ammonium metavanadate were quantitated using Oil-Red-O staining assay and the results were compared with control (cells treated with cell culture medium and differentiation medium only). On day 6 of culture, untreated and purified VBP-plasma and inorganic vanadium decreased lipid accumulation in 3T3L-1 mature adipose precursor cells in a dose-dependent manner, whereas untreated and purified VBP-embedded were not significantly associated with lipid accumulation (Fig. 4).

EXPERIMENTAL EXAMPLE 4 Effect of VBPs on Expression of Lipid-Producing Specific Cells of Mature Preadipocytes Using Reverse Transcription-Polymerase Chain Reaction (RT-PCR)

3T3-L1 precursor adipocytes were seeded into 96 well plates at a density of 2 x 10 &lt; ⁴ &gt; / well and stimulated with mature adipocytes as described above. Total RNA of each well was extracted using 1 ml of TRIzol reagent (Invitrogen, Carlsbad, Calif., USA) according to the manufacturer's protocol and stored at -80 ° C until use. The concentration of extracted RNA was measured with a NanoDrop spectrophotometer at 260/280 nm. CDNA was then prepared with oligo (dT) 20 primer and Superscript III RT (Invitrogen). The resulting cDNA was amplified by PCR using GoTaq Flexi DNA Polymerase (Promega, Madison, WI, USA). Reverse transcriptase amplification was carried out at 94 ° C for 30 cycles of 3 cycles of initial denaturation and denaturation (94 ° C for 30 seconds), annealing (56 ° C for 40 seconds) and extension (72 ° C for 1 minute) . RT-PCR products were separated by gel electrophoresis using 1% agarose gel stained with ethidium bromide. The gel was observed under UV trans-illumination (Kodak Digital Science, Kennesaw, GA, USA) Respectively. The sequences of the primers used in the experiments are shown in Table 1.

The sequence of the oligo (dt) primer used for RT-PCR gene The primer sequence (5 '- &gt; 3' PPAR-γ Forward TTTTCAAGGGTGCCAGTTTC Reverse AATCCTTGGCCCTCTGAGAT C / EBP-alpha Forward AGACATCAGCGCCTACATCG Reverse TGTAGGTGCATGGTGGTCTG SREBP-1 Forward GCGCTACCGGTCTTCTATCA Reverse TGCTGCCAAAAGACAAGGG FAS Forward GATCCTGGAACGAGAACAC Reverse AGACTGTGGAACACGGTGGT LPL Forward TCCTCTGACATTTGCAGGTCTATC Reverse GTGAATCCAGTTATGGGTTCCAC HSL Forward GCTGGGCTGTCAAGCACTGT Reverse GTAACTGGGTTGGCTGCCAT β-actin Forward ATGTGCAAAAAGCTGGCTTTG Reverse ATTTGTGGTGGATGATGGAGG

Adipocyte differentiation is characterized by the expression of various genes according to the chronological order that leads to the formation of adipocyte phenotype, which involves the expression of mRNA / protein markers and the accumulation of tryglycerides (Farmer et al., 2006; Gregoire et al., 1998). Cultured adipose precursor cells undergo proliferation before entering the growth arrest phase, at which time they begin to express early markers of differentiation (Tong et al., 2001).

The effect of VBPs and inorganic vanadium in 3T3-L1 mature lipoproteins on mRNA expression of PPAR-γ, C / EBP-α, SREBP-1, FAS, LPL and HSL in 3T3L-1 adipocytes is shown in FIG. The crude and purified VBP-plasma did not significantly affect the mRNA level of LPL, and ammonium metavanadate increased the expression of LPL in a dose-dependent manner. None of the samples had a significant effect on HSL mRNA expression (Figure 8). LPL and HSL are two major enzymes that regulate the lipolytic process (Zechner et al. 2012). Since the activity of these enzymes is dependent on phosphorylation (Rayala, et al., 2008), increased mRNA and protein expression at LPL levels in ammonium metavanadate treated cells may be due to lipid degradation.

MRNA expression levels of PPAR-y, C / EBP-alpha and FAS were measured using purified VBP-plasma And ammonium 20 [mu] M metavanadate. VBP-plasma And mRNA expression of PPAR-y at ammonium metatabarbate 5, 10 and 20 [mu] M were 0.76, 0.63, 0.14 and 1.16, 0.81 and 0.12, respectively. PPAR-γ is known to be a major regulator of lipidogenesis and is known to regulate gene expression in a variety of other physiological processes, including glucose metabolism and inflammation, and is also an important receptor of the anti-diabetic drug system (Kliewer et al Tontonoz et al., 2008). Antidiabetic agents increase the expression of PPAR-gamma (Kim et &lt; RTI ID = 0.0 &gt; et al., &Lt; / RTI &gt; al., 2015; Picard et al., 2002).

The decrease in mRNA level and protein expression of C / EBP-alpha in 20 μM VBP-plasma treated samples was significantly higher than that treated with the same concentration of ammonium metavanadate (FIG. 6). The lipogenesis marker C / EBP-α is a CCAT / enhancer-binding protein that plays an important role in terminal differentiation of adipocytes (Linhart et al, 2001). Thus, strong downward regulation of C / EBP-a indicates that the differentiation of 3T3-L1 cells is significantly inhibited by purified VBP-plasma than inorganic vanadium.

Both purified VBP-plasma and ammonium metavanadate moderately down-regulated the expression of SREBP-1 mRNA and protein levels, whereas the ternary restricted VBP-plasma did not show a significant effect compared to the control (FIG. 7). SREBP-1, also known as ADD1 (adipocyte crystallization and differentiation factor), controls lipogenesis differentiation and cholesterol homeostasis (Yokoyama et al., 1993). Fajas et al. (1999) reported that SREBP-1 expression in 3T3-L1 cells induces PPAR-γ mRNA levels, and SREBP-1 stimulates PPAR-γ expression to increase lipogenesis differentiation.

Experimental Example 5 Western blot analysis

3T3-L1 cells were cultured in 6-well plates (8 x 10 ⁴ / well) and stimulated mature adipocytes as described above. On day 6 of culture, cells were lysed in RIPA buffer containing inhibitor cocktail (Halt ™ Protease and phosphatase). Cell lysates (30 μg protein / lane) were separated by 10% SDS-PAGE and transferred to a nitocellulose membrane. The membranes were then blocked for 1 hour at room temperature with 5% non-fat defatted milk and incubated with PPAR-gamma (1: 1000 C / EBP-alpha (1: 1000), FAS (1: 1000) SREBP- The membrane was incubated with the first antibody against LPL (1: 400), HSL (1: 1000) and β-actin overnight at 4 ° C. The membrane was washed with TBST and incubated with HRP-conjugated anti- rabbit antibody for 1 hour at room temperature Protein bands were visualized using an enhanced chemiluminescence (ECL) kit and quantified with Image Lab software (version 6.0).

&Lt; Experimental Example 6 > Statistical analysis

Statistics were made using Statistix 8.1 software. All procedures were performed 3 times (n = 3) and recorded as mean with standard deviation (SD). Statistical differences were analyzed using one-way analysis of variance (ANOVA). Multiple comparisons were used to assess significant differences between groups using LSD tests. Statistical significance was defined as p <0.05.

<Other Examples> Preparation of functional food containing vanadium-binding protein as an active ingredient

The inventors of the present invention confirmed that vanadium-binding protein components are excellent in antidiabetic and antioxidative activities through the above examples, and prepared functional foods containing the active ingredients as follows.

<1> Production of beverage

Honey 522 mg

5 mg &lt; RTI ID = 0.0 &gt;

Nicotinic acid amide 10 mg

3 mg of sodium riboflavin hydrochloride

Pyridoxine hydrochloride 2 mg

Inositol 30 mg

Orthoic acid 50 mg

0.018 to 0.038 mg vanadium binding protein

200 ml of water

A beverage was prepared using the above-mentioned composition and content by a conventional method.

<2> Production of chewing gum

Gum base 20%

Sugar 76.36 ~ 76.76%

Vanadium binding protein 0.011 to 0.024%

Fruit flavor 1%

Water 2%

Chewing gum was prepared using the above-mentioned composition and content by a conventional method.

<3> Manufacture of candy

Sugar 50 to 60%

Syrup 39.26 ~ 49.66%

Vanadium binding protein 0.011 to 0.024%

Orange fragrance 0.1%

The composition and the content of the candy were prepared using a conventional method.

&Lt; 4 > Production of biscuit

First class 88 ㎏ power

Gravity Class 1 76.4 kg

16.5 kg

Salt 2.5 ㎏

Glucose 2.7 kg

Palm shortening 40.5 kg

Ammonium 5.3 kg

0.6 kg

Sodium bisulfite 0.55 kg

Rice powder 5.0 kg

Vitamin B1 0.003 kg

Vitamin B2 0.003 kg

Milk flavor 0.16 kg

Water 71.1 kg

Whole milk powder 4 ㎏

1 kg of substitute milk powder

Calcium phosphate 0.1 kg

Spray salt 1 kg

Spray oil 25 kg

0.01 to 0.02 kg of vanadium binding protein

The biscuits were prepared using the above-mentioned composition and content by a conventional method.

<5> Production of ice cream

Fat milk 10.0%

Solid oil content 10.8%

Sugar 12.0%

Starch syrup 3.0%

Emulsion stabilizer (span) 0.5%

Perfume (Strawberry) 0.15%

Water 63.31 ~ 62.91%

Vanadium binding protein 0.011 to 0.024%

Ice cream was prepared using the above-mentioned composition and content by a conventional method.

<6> Production of chocolate

Sugar 34.36 ~ 34.76%

Cocoa Butter 34%

Cocoa mass 15%

Cocoa powder 15%

Lecithin 0.5%

Vanilla flavor 0.5%

Vanadium binding protein 0.011 to 0.024%

The composition and the content thereof were used to prepare chocolate by a conventional method.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed exemplary embodiments. Various changes and modifications may be made by those skilled in the art without departing from the scope and spirit of the invention. This is possible.

Claims (8)

It has a molecular weight of 96.7 kDa in native-PAGE separated from the plasma of Halocynthia roretzi sea squirt, has two protein bands with molecular weights of 24.3 and 68.8 kDa in SDS-PAGE, 64.0 mg / kg of vanadium and has a lipid-binding inhibitory effect as an active ingredient.
In a SDS-PAGE separated from the intestines of Halocynthia roretzi moonfish (sea squirt), a vanadium-binding protein with a molecular weight of 26.5 kDa, containing 15.0 mg / kg of vanadium and having a lipid- As an active ingredient.
delete delete The anti-obesity composition according to claim 1 or 2, wherein the vanadium is ammonium metavanadate.
A functional food composition for preventing obesity comprising the vanadium-binding protein of claim 1 or 2 as an active ingredient.
delete 7. The functional food composition for preventing obesity according to claim 6, wherein the vanadium is ammonium metavanadate.

Images