KR101989466B1 - Diagnosis or treatment of vestibulopathy using microRNA - Google Patents

Abstract

The present invention relates to a composition for diagnosing a vestibular disorder comprising a preparation for quantifying the expression level of microRNA, a method for providing information on the diagnosis of vestibular disorders by quantifying the expression level of microRNA, and a vestibular disorder treatment including an agonist or antagonist for microRNA The present invention relates to a pharmaceutical composition, and more particularly, to a pharmaceutical composition comprising one species selected from the group consisting of miR-218a-5p, miR-219a-5p, and miR-221-3p present in blood, cerebrospinal fluid or tissue of a subject The amount of expression of microRNA on the vestibular nerve can be measured to provide information on the diagnosis of vestibular disorders.

Description

Diagnosis or treatment of vestibular disorders using microRNAs {Diagnosis or treatment of vestibulopathy using microRNA}

The present invention relates to the diagnosis and treatment of vestibular disorders using microRNA, and more particularly, to a vestibular diagnostic composition comprising a preparation for quantifying the amount of expression of microRNA, And a pharmaceutical composition for the treatment of a vestibular disorder comprising an agonist or antagonist of a microRNA.

The main cause of dizziness is a sudden impairment of vestibular function, and patients complain of severe dizziness and spontaneous nystagmus and feel a severe posture imbalance. The patient feels nausea, vomiting, dizziness, postural discordance, and gait disturbances. These vestibular symptoms recover naturally between 1 and 14 days, which is called vestibular compensation.

The vestibular nystagmus, which occurs during the acute phase of vestibular compensation, and the loss of body rotation, are mainly involved in the natural recovery of the central nervous system. It is known that the adaptation of the vestibular system and the confrontation of the sensory function will be involved in the subacute or chronic phase, which gradually improves after several days of vestibular loss. The mechanism of unilateral vestibular dysfunction is to block the afferent signal on the lesion side and then decrease the vestibular nuclear potential activity on the lesion side, but the opposite side vestibular activity is maintained or elevated and the bilateral vestibular nuclear potential evolving activity is relatively asymmetrical. The entire information is explained by the process of restoring the asymmetric spontaneous dislocation as described above. The change of the power level is closely related to the change of the vestibular nucleus and the surrounding gene expression. Asymmetric gene expression in the vestibular nucleus after vestibular damage was studied in c-Fos, GABA receptor, glutamate receptor, and pro-opiomelanocortin receptor.

MicroRNA is a single-strand RNA consisting of 21-25 nucleotides that regulates the expression of various genes and plays an important role in cell growth and death, regulating the regeneration of various tissues including bones, nerves, blood vessels, connective tissues and skin .

However, microRNA has not yet been studied in the diagnosis and treatment of vestibular disorders. Therefore, it is necessary to develop the technology using microRNA to diagnose and treat vestibular disorders.

Thus, the present inventors measured microRNA expression using microRNA, which plays an important role in the expression and inhibition of genes, to identify microRNAs involved in all information. When the microRNAs are induced to induce changes in the microRNAs, Thereby completing the invention.

Therefore, one object of the present invention is to provide a composition for diagnosing vestibular disorders, which comprises an agent for quantifying the amount of expression of microRNA present in a sample of a subject.

It is still another object of the present invention to provide a method for measuring microRNA expression in a sample,

A second step of measuring the expression level of microRNA present in a sample of a normal person; And

And a third step of comparing the amount of expression of the microRNA measured in the first step and the second step, to provide a method for providing information on vestibular disorder diagnosis.

Another object of the present invention is to provide a pharmaceutical composition for the treatment of vestibular disorders comprising at least one selected from the group consisting of an agonist and an antagonist of microRNA.

Another object of the present invention is to provide a food composition for improving vestibular disorders, which comprises at least one selected from the group consisting of an agonist of an microRNA and an antagonist.

A further object of the present invention is to provide a method for screening or screening at least one selected from the group consisting of an agonist of miR-218a-5p, an agonist of miR-219a-5p, and an antagonist of miR- .

Vestibulopaty causes dizziness, dizziness, unbalance, hearing changes, nausea, fatigue, anxiety, loss of concentration and other symptoms, and is associated with a person's daily life needs, work ability, relationship with family or friends, Can potentially be reduced.

In the present invention, the term "vestibular disorders" refers to conditions characterized by dizziness, visual or visual disturbance and balance impairment. Vocal disorders can result from a variety of impairments or dysfunctions, including acute and chronic syndromes. Non-limiting examples of vestibular disorders contemplated in the present invention include dizziness, benign paroxysmal vertigo, vestibular neuritis, Meniere's disease, endolymphatic fistula, external lymphoid fistula, head trauma involving vestibular disorders, Infections, serum maze, pressure disorders, autoimmune inner ear disease, migraine with vestibular disorders, vestibular disorders after middle ear surgery, middle ear, endolymphatic sac or cerebellar angle, Vestibular, schwannomas, senile vestibular, familial intermittent dizziness, and ataxia.

In the broadest terms, the term "treat" or "treatment" refers to reversing, alleviating, inhibiting the progress of the disorder or condition described above or preventing one or more symptoms of these disorders or conditions.

In the present invention, the expression amount of micro (micro) RNA refers to the amount of microRNA present in cells, tissues and the like, and the amount of microRNA expression can be measured by immunohistochemical analysis, Western blot analysis, northern blot analysis , And / or by PCR analysis and / or gene and / or tissue array analysis.

The present invention provides a composition for diagnosing vestibular disorders, a method for providing information on diagnosis of vestibular disorders, and a composition for treating vestibular disorders.

The present invention also provides a method for screening at least one selected from the group consisting of an agonist of miR-218a-5p, an agonist of miR-219a-5p, and an antagonist of miR-221-3p,

Contacting the candidate compound with a cell sample;

Measuring at least one selected from the group consisting of an expression level of miR-218a-5p, an expression level of miR-219a-5p, and an expression level of miR-221-3p in the cell sample; And

Screening the candidate compound with at least one member selected from the group consisting of an agonist of miR-218a-5p, an agonist of miR-219a-5p, and an antagonist of miR-221-3p.

an agonist of miR-218a-5p, an agonist of miR-219a-5p, and an antagonist of miR-221-3p.

Hereinafter, the present invention will be described in more detail.

In one aspect, the present invention relates to a composition for diagnosing vestibular disorders, which comprises an agent that quantifies the expression amount of microRNA present in a biological sample obtained from a subject.

The microRNA may include at least one selected from the group consisting of miR-218a-5p, miR-219a-5p, and miR-221-3p.

The biological sample may be blood, cerebrospinal fluid, or tissue, and preferably the tissue may be a cranial nerve tissue.

In one embodiment of the present invention, changes in the amount of microRNA expressed at 4 hours, 1 day, 2 days, 3 days, and 4 days after vestibular damage were compared, and miR-218a-5p and miR -219a-5p expression was increased and miR-221-3p expression was decreased (Example 1).

Specifically, the expression of miR-218a-5p and 219a-5p increased between 1 and 4 days after vestibular damage, and the expression of miR-221-3p decreased at 4 hours after vestibular damage.

The composition for the diagnosis of vestibular disorders includes a method of providing information on the diagnosis of vestibular disorders described below, a pharmaceutical composition for treating vestibular disorders, a food composition for treating vestibular disorders, an agonist of miR-218a-5p, miR-219a-5p And an antagonist of miR-221-3p, and a method of screening for an agonist of miR-218a-5p, an agonist of miR-219a-5p, and an antagonist of miR- 3p antagonist may be applied to the composition for screening in the same manner.

In yet another aspect, the present invention provides a method for measuring microRNA expression in a biological sample, comprising: a first step of measuring an expression amount of microRNA present in a biological sample obtained from a subject;

A second step of measuring the expression level of microRNA present in a biological sample obtained from a normal person; And

And a third step of comparing the amount of expression of the microRNA measured in the first step and the second step, to a method for providing information on vestibular disorder diagnosis.

The 'normal person biological sample' refers to a biological sample obtained from a normal person who has not developed a vestibular disorder, and the 'normal person' may mean a person who does not feel dizzy in daily life.

In the method for providing information on the diagnosis of vestibular disorders, the step of measuring the amount of expression of microRNA present in the sample may be performed by any conventional RNA quantitation method. For example, real-time RT-PCR, But are not limited to, those determined by RT-PCR, immunohistochemistry, Western analysis, Northern blot analysis, PCR analysis, gene array analysis, or tissue array analysis.

The microRNA may be one or more selected from the group consisting of miR-218a-5p, miR-219a-5p, and miR-221-3p, 218a-5p, or miR-219a-5p present in the sample after the third step is expressed by the amount of expression of miR-218a-5p or miR-219a-5p present in the sample of the subject, In many cases, it has been found that the former is in the action of information, thereby further including a step of confirming the vestibular disorder, or the presence of miR-221-3p in the sample after the third step, When the amount of expression of miR-221-3p is small, the vestibular compensation function is taking place, and the step of confirming the vestibular disorder can be additionally included.

In yet another embodiment, the invention provides a method of treating vestibular disorder, including at least one selected from the group consisting of miR-218a-5p, or an agonist of miR-219a-5p, and an antagonist of miR- ≪ / RTI >

In the present invention, ' treatment of vestibular disorders ' may mean promotion of all information action.

The former informative action refers to a process in which the vestibular disorder is restored after the vestibular disorder and naturally occurs at a relatively slow rate. However, when the pharmaceutical composition for treating vestibular disorders of the present invention or the food composition for treating vestibular disorders is administered The entire information action can be significantly promoted.

Therefore, when the expression level of miR-218a-5p or miR-219a-5p increased in the vestibular dysfunction process, the vestibular function can be promoted and the vestibular disorder can be treated, and miR-221-3p , The vestibular function can be promoted and vestibular disorders can be treated.

In one embodiment of the present invention, agonist (s) causing changes in the expression of miR-218a-5p, miR-219a-5p, and miR-221-3p against 36 SD (Sprague Dawley) ) Or antagonist and then subjected to rotarod test and BrdU immunohistochemistry to determine whether administration of antagonist of miR-218a-5p, miR-219a-5p and agonist of miR-221-3p (Fig. 2 and Fig. 3).

Therefore, when an agonist of miR-218a-5p or an agonist of miR-219a-5p is administered, the vestibular recovery is promoted and the vestibular disorder is healed. When the miR-221-3p antagonist is administered, And vice versa. Administration of an agonist of miR-218a-5p, an agonist of miR-219a-5p, or an antagonist of miR-221-3p may be administered separately or in combination. E.g. an agonist of miR-218a-5p, an agonist of miR-219a-5p, and an antagonist of miR-221-3p to treat vestibular disorders.

The agonist of miR-218a-5p is similar in structure and sequence to miR-218a-5p, and has the effect of healing vestibular disorders by promoting vestibular recovery. For example, Syn-rno-miR-218a-5p miScript miRNA Mimic, but are not limited thereto.

The agonist of miR-219a-5p is similar in structure and sequence to miR-219a-5p to promote vestibular recovery and to heal vestibular disorders. For example, in the case of miR-219a-5p, Syn- rno-miR-219a-5p miScript miRNA Mimic, but is not limited thereto.

The antagonist of miR-221-3p binds to miR-221-3p in a sequence-specific manner to promote vestibular recovery and heal vestibular disorders. For example, Anti-rno-miR-221-3p miScript miRNA Inhibitor But is not limited thereto.

The pharmaceutical compositions according to the present invention may be formulated into oral preparations such as powders, granules, tablets, capsules, ointments, suspensions, emulsions, syrups and aerosols, or in the form of transdermal preparations, suppositories, Parenteral formulations, and the like.

The pharmaceutical composition of the present invention may be pharmaceutically acceptable and may further contain adjuvants such as physiologically acceptable carriers, excipients and diluents. Examples of carriers, excipients and diluents that can be included in the pharmaceutical composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium Silicates, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In the case of formulation, diluents or excipients such as fillers, extenders, binders, humectants, disintegrants, surfactants and the like which are usually used can be used

When the composition for parenteral administration according to the present invention is used for parenteral administration, for example, topical administration of a liquid, a gel, a cleaning composition, a tablet for insertion, a suppository form, cream, ointment, dressing solution, spray, It may be a sterile aqueous solution, a non-aqueous solvent, a suspension, an emulsion, a freeze-dried preparation, a suppository, a cream, an ointment, a jelly, a foam, a cleanser or an insert, May be a skin external agent such as a liquid preparation, a gel preparation, a cleaning composition, and a tablet for insertion. The formulation can be prepared, for example, by adding a solubilizer, an emulsifying agent, a buffering agent for pH control, etc. to the sterilized water. Examples of the non-aqueous solvent or suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like.

More specifically, the pharmaceutical composition may include a carrier for additionally formulating the composition. The carrier may be a binder, a lubricant, a suspending agent, a solubilizer, a buffer, a preservative, a lubricant, an isotonic agent, an excipient, a stabilizer, a dispersant, a suspending agent,

In an embodiment where the pharmaceutical composition of the present invention is applied to humans, the pharmaceutical composition of the present invention may be administered alone, but is generally administered in a pharmacological manner selected in consideration of the mode of administration and standard phamaceutical practice. May be administered in admixture with a carrier. For example, the pharmaceutical composition of the present invention may be in the form of tablets containing starch or lactose, in the form of capsules containing the active ingredient alone or as an excipient, or as an elixir or a suspending agent containing a flavoring or coloring agent 0.0 > oral, < / RTI > intraoral, or sublingually.

The dose of the pharmaceutical composition of the present invention may be varied depending on the age, body weight, sex, dosage form, health condition, and disease severity of the patient, and may be determined by a doctor or pharmacist once, It may be administered in divided doses. For example, a daily dose, based on the active ingredient (ie, the agonist of miR-218a-5p, the agonist of miR-219a-5p, and one or more of the antagonists of miR-221-3p) 0.001 to 10000 mg / kg, 0.01 to 10000 mg / kg, 0.1 to 10000 mg / kg, 0.5 to 10000 mg / kg, 0.001 to 1000 mg / kg, 0.01 to 1000 mg / kg, 0.1 to 1000 mg / kg, 0.5 Kg, 0.1 to 500 mg / kg, 0.001 to 500 mg / kg, 0.01 to 500 mg / kg, 0.1 to 500 mg / kg, 0.5 to 500 mg / 300 mg / kg, or 0.5 to 300 mg / kg. The above-mentioned dosage is an average case, and the dose may be high or low depending on individual differences.

If the daily dosage of the pharmaceutical composition of the present invention is less than the above dose, a significant effect can not be obtained, and if it exceeds the above range, it is not only economical but also causes an undesirable side effect It is preferable to set the above range.

In yet another aspect, the invention provides a method of treating a vestibular disorder, comprising at least one selected from the group consisting of an agonist of miR-218a-5p, an agonist of miR-219a-5p, and an antagonist of miR- To a food composition for improving a disorder.

The above food is not limited to health supplements, health functional foods, functional foods and the like, and may be an agonist of miR-218a-5p of the present invention, an agonist of miR-219a-5p of the present invention in natural foods, , And an antagonist of miR-221-3p.

The food composition of the present invention can be used as it is or in combination with other food or food compositions, and can be suitably used according to conventional methods. The amount of the active ingredient to be mixed can be suitably determined according to the purpose of use thereof. Generally, at least one selected from the group consisting of miR-218a-5p or an agonist of miR-219a-5p and an antagonist of miR-221-3p of the present invention is a food Or 0.1 to 90 parts by weight, preferably 1 to 60 parts by weight, based on 100 parts by weight of the raw material of the beverage.

An effective dose of at least one selected from the group consisting of an agonist of miR-218a-5p, an agonist of miR-219a-5p, and an antagonist of miR-221-3p may be used according to the effective dose of the pharmaceutical composition However, in the case of long-term intake for the improvement of vestibular disorders, it may be less than the above range, and since the active ingredient has no problem in terms of safety, it may be used in an amount exceeding the above range.

There is no particular limitation on the kind of the food. The food composition comprising at least one selected from the group consisting of an agonist of miR-218a-5p, an agonist of miR-219a-5p, and an antagonist of miR-221-3p can be used as a tablet, a hard or soft capsule, , Suspensions, and the like, which may be used in admissible conventional carriers such as excipients, binders, disintegrants, lubricants, solubilizing agents, suspensions for oral administration, suspensions A preservative, an extender, or the like.

Examples of the food to which at least one member selected from the group consisting of an agonist of miR-218a-5p, an agonist of miR-219a-5p, and an antagonist of miR-221-3p can be added include meat, sausage, , Dairy products including chocolates, candies, snacks, confectionery, pizza, ramen, other noodles, gums, ice cream, various soups, drinks, tea, drinks, alcoholic beverages and vitamins, But is not limited to food.

In yet another embodiment, the present invention provides a method for screening at least one selected from the group consisting of an agonist of miR-218a-5p, an agonist of miR-219a-5p, and an antagonist of miR-221-3p ,

Contacting the candidate compound with a cell sample;

Measuring at least one selected from the group consisting of an expression level of miR-218a-5p, an expression level of miR-219a-5p, and an expression level of miR-221-3p in the cell sample; And

Screening the candidate compound with at least one member selected from the group consisting of an agonist of miR-218a-5p, an agonist of miR-219a-5p, and an antagonist of miR-221-3p.

an agonist of miR-218a-5p, an agonist of miR-219a-5p, and an antagonist of miR-221-3p.

When the expression amount of miR-218a-5p in the cell sample in contact with the candidate compound is increased, the candidate compound can be screened with an agonist of miR-218a-5p,

When the expression level of miR-219a-5p in the cell sample in contact with the candidate compound is increased, the candidate compound can be screened with an agonist of miR-219a-5p,

When the expression amount of miR-221-3p in the cell sample in contact with the candidate compound is decreased, the candidate compound can be screened with the antagonist of miR-221-3p.

In another embodiment, the present invention relates to a method for producing an expression vector comprising at least one expression selected from the group consisting of expression levels of miR-218a-5p, miR-219a-5p and miR-221-3p in a cell sample A composition for screening with at least one selected from the group consisting of an agonist of miR-218a-5p, an agonist of miR-219a-5p, and an antagonist of miR-221-3p, will be.

The candidate compound may be selected from the group consisting of various compounds such as proteins, polypeptides, oligopeptides, polynucleotides, oligonucleotides, various small molecular chemicals, natural products, and extracts of natural products.

The present invention relates to a composition for diagnosing a vestibular disorder comprising a preparation for quantifying the expression level of microRNA, a method for providing information on the diagnosis of vestibular disorders by quantifying the expression level of microRNA, and a vestibular disorder treatment including an agonist or antagonist for microRNA The present invention relates to a pharmaceutical composition which is convenient, quick, and inexpensive compared with a neuropsychological test, which requires specialized pre-training, or an MRI and vestibular function test, which requires high cost and patient inconvenience. To diagnose vestibular disorders.

The present invention relates to a method of inhibiting vestibular disorder in a patient suffering from a vestibular disorder, which comprises administering to a patient in need thereof an effective amount of at least one compound selected from the group consisting of miR-31a-5p, miR-133a-3p, miR-133b-3p, miR- miR-219a-5p, miR-221-3p, or miR-497-5p.
FIG. 2 shows results of administration of antagonists of miR-218a-5p and miR-219a-5p and rotarod test after administration of miR-221-3p agonist according to an embodiment of the present invention.
Figure 3 shows the results of immunohistochemical studies of the number of BrdU-positive cells in the medial vestibular nucleus of the antagonist of miR-218a-5p antagonist and miR-219a-5p antagonist according to one embodiment of the present invention.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Example 1: Selective microRNA screening for vestibular disorders

In order to select microRNA expressing specifically at the time of vestibular disorder, miR-31a-5p, miR-133a-3p, miR-133b-3p, miR-204-5p, miR- 5p, miR-219a-5p, miR-221-3p, and miR-497-5p.

Specifically, vestibular damage to SD rats was induced by surgical destruction of the vestibular system, and RNA in the medial vestibular nucleus neurons was extracted using miRNeasy Mini Kit (Qiagen, Hilden, Germany) (Qiagen, Hilden, Germany) and miScript microRNA PCR array (Qiagen, Hilden, Germany) were used for qRT-PCR. All reactions were performed in 96-well plates and the mean values were used to calculate mRNA expression. qRT-PCR was performed using QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The primer sequences used for qRT-PCR are shown in Table 1 below.

denomination The sequence (5 '> 3') Tm (占 폚) SEQ ID NO: miR-133b-3p UUUGGUCCCCUUCAACCAGCUA 71.3 One miR-204-5p UUCCCUUUGUCAUCCUAUGCCU 69.5 2 miR-206-3p UGGAAUGUAAGGAAGUGUGUGG 69.5 3 miR-218a-5p UUGUGCUUGAUCUAACCAUGU 65.0 4 miR-497-5p CAGCAGCACACUGUGGUUUGUA 71.3 5 miR-221-3p AGCUACAUUGUCUGCUGGGUUUC 71.8 6 miR-219a-5p UGAUUGUCCAAACGCAAUUCU 65.0 7 miR-133a-3p UUUGGUCCCCUUCAACCAGCUG 73.2 8 miR-31a-5p AGGCAAGAUGCUGGCAUAGCUG 73.2 9

As a result, as shown in Fig. 1, the expression level of miR-218a-5p was increased 2.9 times at 1 day, 2.0 times at 3 days and 1.7 times at 4 days after vestibular damage compared to the sham operation control, The expression level of 219a-5p was increased 2.8 times at 1 day, 1.8 times at 2 days, and 2.1 times at 4 days in the simulated control group. The expression level of miR-221-3p was 1.7 It was confirmed that it was decreased.

As a result, as shown in Fig. 1, the expression level of miR-218a-5p was increased 2.9 times at 1 day, 2.0 times at 3 days and 1.7 times at 4 days after vestibular damage compared to the sham operation control, The expression level of 219a-5p was increased 2.8 times at 1 day, 1.8 times at 2 days, and 2.1 times at 4 days in the simulated control group. The expression level of miR-221-3p was 1.7 It was confirmed that it was decreased.

Example 2. Healing of vestibular disorders due to microRNA expression changes (Rota Rod test)

Whether the symptoms of vestibular disorders can be treated by controlling the expression changes of miR-218a-5p, miR-219a-5p, and miR-221-3p, which confirmed that the expression level specifically changes in vestibular disorder in Example 1 The following experiment was carried out.

An agonist or an antagonist (such as an agonist or an antagonist) that causes a change in the efficacy of miR-218a-5p, miR-219a-5p, and miR-221-3p against 24 SD rats that caused vestibular damage in the same manner as in Example 1 antagonist) was administered and the rotarod test was performed.

Specifically, in order to perform the rotarod test, artificial cerebrospinal fluid (Artifical CSF) was used as a control for 24 SD rats that caused vestibular damage, 　 218a-5p antagonist (miR-218a-5p antagonist), which was an antagonist of miR-218a-5p, was administered to the experimental group (124 NaCl, 5 KCl, 1.2 KH ₂ PO ₄ , 1.3 MgSO ₄ , 2.4 CaCl ₂ , 26 NaHCO ₃ and 10 d- 221-3p agomir (Qiagen, Hilden, Germany), an agonist of miR-219a-5p (Qiagen, Hilden, Germany), an antagonist of miR-219a-5p , Germany), and the rotavirus test was performed from day 1 to day 11 of vestibular damage. The results are shown in FIG. The antagonist of miR-218a-5p, the antagonist of miR-219a-5p, and the agonist of miR-221-3p were infected with brain infusion cannula (Brain Infusion Kit 2; Alzet, Cupertino, The osmotic pump (Osmotic Pump 2001; Alzet) was administered to the cerebral lateral ventricle for 1 week at a rate of 1.0 μL / h. The Rotarod Prosecutor proceeded as follows. Before the induction of vestibular damage, the following training procedure was performed. The training was performed under conditions of gently accelerating the drum at 12 rpm at a rate of 16 rpm / min, and the time that the animal survived without falling off the drum was measured. After reaching the peak of this time, vestibular damage was induced, and the rotarod test was performed under the same conditions after the induction of vestibular damage.

As a result, as shown in FIG. 2, when the antagonist of miR-218a-5p or miR-219a-5p was treated with the vestibular damage animal, it was confirmed that the vestibular disorders were not restored due to the delay of the whole information, When animals were treated with miR-221-3p agonists, it was confirmed that the vestibular disorders were not restored due to the delay of all information.

Example  3. microRNA  Healing of vestibular disorders by alteration of expression BrdU  Immunohistochemistry)

218a-5p, and miR-219a-5p, which confirmed that the expression level specifically changes in the vestibular disorder in Example 1, were examined to determine whether the neuronal production involved in the whole information was changed by the effect of miR- And BrdU immunohistochemistry was performed. BrdU immunohistochemistry was performed after administering an antagonist that caused changes in the efficacy of miR-218a-5p and miR-219a-5p to 12 SD rats that caused vestibular damage in the same manner as in Example 1 Respectively.

Neuronal production involved in preinformation was one of the ways in which preinformation occurred, confirming whether the effect of miR-218a-5p and miR-219a-5p on neuronal production was affected.

In particular, for the BrdU immunohistochemistry, 12 SD rats that induced vestibular damage were treated with artificial CSF (124 NaCl, 5 KCl, 1.2 KH ₂ PO ₄ , 1.3 MgSO ₄ , 2.4 CaCl ₂ , 26 NaHCO ₃ and 10 d-glucose in) administration, the antagonist of the experiment, the miR-218a-5p a miR-218a-5p antagomir (Qiagen , Hilden, Germany), miR-219a-5p antagonist of miR-219a-5p of antagomir (Qiagen, Hilden, Germany). Two days after vestibular damage, 300 mg / kg BrdU (Sigma, St. Louis, Mo., USA) was administered intraperitoneally. One day later, medial vestibular nuclei were collected and BrdU immunohistochemistry was performed. The number of BrdU - positive cells in the medial vestibular nucleus was measured to determine the degree of neuronal production. The results are shown in Fig.

As a result, as shown in FIG. 3, when the antagonist of miR-218a-5p or miR-219a-5p was treated with the vestibular damage test animal, the number of BrdU positive cells was decreased and the generation of neuronal cells was inhibited.

<110> Seoul National University R & DB Foundation, INDUSTRY FOUNDATION OF CHONNAM NATIONAL UNIVERSITY <120> Diagnosis or treatment of vestibulopathy using microRNA <130> DPP20174277 <160> 9 <170> KoPatentin 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> miR-133b-3p <400> 1 uuuggucccc uucaaccagc ua 22 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> miR-204-5p <400> 2 uucccuuugu cauccuaugc cu 22 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> miR-206-3p <400> 3 uggaauguaa ggaagugugu gg 22 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> miR-218a-5p <400> 4 uugugcuuga ucuaaccaug u 21 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> miR-497-5p <400> 5 cagcagcaca cugugguuug ua 22 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> miR-221-3p <400> 6 agcuacauug ucugcugggu uuc 23 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> miR-219a-5p <400> 7 ugauugucca aacgcaauuc u 21 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> miR-133a-3p <400> 8 uuuggucccc uucaaccagc ug 22 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> miR-31a-5p <400> 9 aggcaagaug cuggcauagc ug 22

Claims (18)

218a-5p, miR-219a-5p, and miR-221-3p present in a biological sample obtained from a subject, wherein the expression level of one or more microRNAs selected from the group consisting of miR- Compositions for the diagnosis of vestibular disorders. delete The composition for diagnosing vestibular disorders according to claim 1, wherein the biological sample is blood, cerebrospinal fluid, or tissue. 4. The composition for diagnosing vestibular disorders according to claim 3, wherein the tissue is brain nerve tissue. A first step of measuring the expression level of at least one microRNA selected from the group consisting of miR-218a-5p, miR-219a-5p, and miR-221-3p existing in a biological sample obtained from a subject;
A second step of measuring the expression level of at least one microRNA selected from the group consisting of miR-218a-5p, miR-219a-5p, and miR-221-3p present in a biological sample obtained from a normal person; And
And a third step of comparing the expression levels of the microRNAs measured in the first and second steps. delete The method according to claim 5, wherein the expression level of miR-218a-5p, or miR-219a-5p present in a sample of a normal person after the third step is lower than that of a test sample of miR- 5p in the case of a large amount of expression, the information is acting on the whole, thereby allowing the identification of vestibular disorders. The method according to claim 5, wherein when the amount of expression of miR-221-3p present in the sample is smaller than the expression amount of miR-221-3p present in the sample of a normal person after the third step, Wherein the method further comprises the step of identifying a vestibular disorder. 6. The method of claim 5, wherein the biological sample is blood, cerebrospinal fluid, or tissue. 10. The method of claim 9, wherein the tissue is a brain nerve tissue. 6. The method of claim 5, wherein the expression level of the microRNA is measured by real-time RT-PCR, quantitative real-time RT-PCR, immunohistochemical analysis, Western blot analysis, northern blot analysis, PCR analysis, gene array analysis, A method for providing information on vestibular disorder diagnosis. an agonist of miR-218a-5p, an agonist of miR-219a-5p, and an antagonist of miR-221-3p. 13. The method of claim 12, wherein the agonist of miR-218a-5p is Syn-rno-miR-218a-5p miScript miRNA Mimic and the agonist of miR-219a-5p is Syn-rno- miR- Mimic, for the treatment of vestibular disorders. 13. The pharmaceutical composition according to claim 12, wherein the antagonist of miR-221-3p is Anti-rno-miR-221-3p miScript miRNA inhibitor. an agonist of miR-218a-5p, an agonist of miR-219a-5p, and an antagonist of miR-221-3p. The method of claim 15, wherein the agonist of miR-218a-5p is Syn-rno-miR-218a-5p miScript miRNA Mimic and the agonist of miR-219a-5p is Syn-rno- miR- Mimic, a food composition for improving vestibular disorders. 16. The food composition according to claim 15, wherein the antagonist of miR-221-3p is Anti-rno-miR-221-3p miScript miRNA inhibitor. Contacting the candidate compound to a cell sample;
Measuring at least one selected from the group consisting of an expression level of miR-218a-5p, an expression level of miR-219a-5p, and an expression level of miR-221-3p in the cell sample; And
Screening the candidate compound with at least one member selected from the group consisting of an agonist of miR-218a-5p, an agonist of miR-219a-5p, and an antagonist of miR-221-3p.
an agonist of miR-218a-5p, an agonist of miR-219a-5p, and an antagonist of miR-221-3p.

Images