KR101987282B1 - Method for producing transgenic Nannochloropsis salina with increased biomass using RHP1 gene from Chlamydomonas reinhardtii - Google Patents

Abstract

The present invention relates to a method for producing microalgae transformed with increased biomass using the RHP1 gene derived from Clamidomonas reinhidt, and more particularly, to a method for producing microalgae transformed with Chlamydomonas hint reinhardtii) by over-expressing the RHP1 gene derived from the nanno claw drop system in microalgae, nanno claw drop system in microalgae transformants (cells Ci (inorganic carbon), as well as to increase the density thereof, the growth rate of CrRHP1) It can be very useful for enhancing the productivity of microalgae in nanoprobe for cyanobacteria for bioenergy.

Description

[0001] The present invention relates to a method for producing transformed nanoclobloxys salinas using an RHP1 gene derived from Clamidomonas reinhardtii,

The present invention relates to a method for producing transformed Nanocrobrotopsis salina with increased biomass using the RHP1 gene derived from Clamidomonas reinhardtii.

Recently, due to the increase in the use of fossil fuels, the concentration of carbon dioxide in the atmosphere increases, and environmental problems such as global warming become serious. As a result, bio-fuel research is being actively carried out in each country in an economical and environmentally friendly manner. Biofuels are alternative fuels for petroleum energy, including biodiesel and bioethanol. Biodiesel is produced from algae lipids, crops such as soybeans, oilseed rape, and animal fats. Among them, biodiesel using microalgae is known to have an environmentally friendly and economical sustainability compared to agricultural products and animal fats.

Nannochloropsis is a potent microalgae that can be used to produce lipids for biofuels. Nanochlooropsis is a marine microalgae, a small elliptical micro-plankton with no flagella of 2-4 ㎛, composed of polysaccharide cell wall, chloroplast and four chloroplast membranes. Nanoclorepsis does not accumulate starch, but accumulates large amounts of lipids. The characteristics of fatty acid composition include EPA (eicosapentaenoic acid C20: 5), which is a long chain polyunsaturated fatty acid, and is used as a health functional food such as cardiovascular diseases. The CO ₂ diffusion rate is about 10,000 times lower than that in the atmosphere, which is the growth environment of nano-chloroprosis. In order to overcome this lack of CO ₂ , most microalgae, including nanocholrobosis, have developed a carbon concentrating mechanism (CCM) that evolutionarily enriches CO ₂ . CCM is regulated by the concentration of external inorganic carbon, such as being induced when the concentration of inorganic carbon (Ci) is low outside the cell, and suppressed when it is high. Studies on CCM have shown that microalgae, Chlamydomonas reinhardtii ) and cyanobacteria (cyanobacteria) have been intensively studied. In recent years, studies on various species such as injecting CCM-related apparatuses of aquatic plants into higher plants have been carried out to improve photosynthesis and water stress resistance. Of Chlamydomonas CCM is bicarbonate (bicarbonate) and CO ₂ of the interconversion role outside / inside of the CA (carbonic anhydrase), and CO ₂ channels involved in the absorption of CO _2, bicarbonate transporter to transport bicarbonate in the cell, such as . Recently, in the CCM study of nanoclo- ropsis, there is no external CA and only internal CA exists. Unlike the green algae, the existence of CO ₂ channels was not observed in the nanoproloxys salinase genome of this study, and only bicarbonate transporters were found to exist. In addition, since it is known that there is no pyrenoid, which is a CO ₂ spill prevention device, and that a considerable amount of CO ₂ that flows into the cell relatively has a bicarbonate pump / CO ₂ -leakage CCM activity out of the cell, Is expected to be less efficient than the Cramidomonas.

RHP1 (Rhesus protein 1) is generally known to play an important role in red blood cell membranes, and is present in a variety of species, from bacteria to mammals. In particular, it is known to be the most abundant in red blood cell membranes. RHP1 is a gas channel that transports ammonia / methyl ammonia and absorbs CO ₂ .

On the other hand, Korean Patent No. 1512479 discloses a nanocholrobicosis mutant strain having an increased lipid content and a method for producing a lipid using the same, and Korean Patent No. 1492402 discloses a method for producing a transformant microalga that overexpresses the FAB2 gene A method of increasing the total fatty acid content and the ratio of the useful fatty acid is disclosed. However, a method for producing the transformed Nanocrobrotopsis salinas having increased biomass using the RHP1 gene derived from Clamidomonas reinhidti of the present invention has not yet been disclosed.

SUMMARY OF THE INVENTION The present invention has been made in view of the above-mentioned needs, and it is an object of the present invention to provide Chlamydomonas reinhardtii) and polar Chlorella genus (Chlorella sp. ArM0029B) a result of the gene encoding the respective RHP1 protein derived from each over-expression in nanno claw Rob cis Salina (Nannochloropsis salina), in particular, Chlamydomonas lane hard Ti-derived RHP1 transgenic sieve (CrRHP1) of cells Ci (inoragnic carbon) and the concentration is increased, 3% CO ₂ condition as compared to wild-type nanno claw Rob cis Salina by that the growth rate increase 150%, Chlamydomonas lane hard Ti-derived RHP1 transfected Confirming that the biomass of the transformant ( CrRHP1 ) was significantly increased than that of the RHP1 transformant ( 29BRHP1 ) derived from the genus Chlorella sp. ( ArM0029B ), thus completing the present invention.

In order to solve the above-mentioned problems, the present invention provides a recombinant vector comprising a gene encoding RHP1 (Rhesus protein 1) protein derived from Chlamydomonas reinhardtii as a recombinant vector comprising Nannochloropsis sp. There is provided a method for increasing biomass of a microalgae of a nanocholrobosis microorganism including the step of overexpressing the RHP1 gene by transforming an alga .

The present invention relates to a method for transforming a microalgae of Nannochloropsis sp. Microorganism with a recombinant vector comprising a gene encoding RHP1 (Rhesus protein 1) protein derived from Chlamydomonas reinhardtii to produce RHP1 gene Over-expressing the microorganism of the present invention, wherein the biomass is increased compared to the wild-type microorganism.

In addition, the present invention provides microalgae transformed with increased biomass produced by the above method.

The present invention also relates to a method for producing biomass of a microorganism belonging to the genus Chlamydomonas reinhardtii comprising the gene coding for the RHP1 (Rhesus protein 1) protein comprising the amino acid sequence of SEQ ID NO: 2 / RTI > and a pharmaceutically acceptable carrier.

In addition, the present invention provides a method for producing microcystin, Separating the lipid from the culture liquid; Transesterifying the lipid to produce a fatty acid ester; And converting the produced fatty acid ester into biodiesel. The present invention also provides a method for producing biodiesel.

The present invention relates to the use of the Chlamydomonas reinhardtii) nanno RHP1 the gene derived from the claw drop cis Salina (Nannochloropsis salina ), it is possible to increase the intracellular Ci concentration of nancrochloropsis salinina transformant ( CrRHP1 ) as well as to greatly increase its growth rate, so that the productivity of nanocholrobrosis salina for bioenergy It can be very useful for height.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a plot of the Nannochloropsis salina strain containing the RHP1 gene from Chlamydomonas reinhardtii or Chlorella sp. ArM0029B according to one embodiment of the present invention And Fig. CrRHP1 represents the cDNA of the gene encoding the RHP1 protein derived from Clamidomonas reinhidhtii, and 29B RHP1 represents the cDNA of the gene encoding the RHP1 protein derived from the genus Polar Chlorella.
Figure 2 is a graph showing the activity of the transformed Nanocloprosis Salina (upper: CrRHP1 < RTI ID = 0.0 > And at the bottom: 29B RPH1 ), the presence of the transgene containing the RHP1 gene was confirmed by PCR. NC is a wild type (WT), PC is a positive group, and 1 to 10 of the upper gel are CrRHP1 Transformant lines 1 to 14 of the bottom gel are 29B RPH1 Transformant lines.
FIG. 3 is a result of Southern blot analysis for the insertion of a transfection vector containing the RHP1 gene in transformed Nanoproloxis salina ( CrRHP1 ) according to an embodiment of the present invention. M is a molecular marker, NC is wild type (WT), 1 to 24 is CrRHP1 Transformant lines.
FIG. 4 is a result of Northern blot analysis for the insertion of a transfection vector containing the RHP1 gene in transformed hanococcalopsis salina ( CrRHP1 ) according to an embodiment of the present invention. NC is wild type (WT), 1 to 24 is CrRHP1 Transformant lines.
FIG. 5 is a graph showing the effect of the CrRHP1 transformant (A) and the 29B RPH1 transformant (B) when CO ₂ and bicarbonate (BicA) were treated at various concentrations in the F2 / N solid medium according to an embodiment of the present invention. Of the growth of the plant. WT is wild type, 1, 19, 3 and 4 are CrRHP1 transformant lines, and 4 and 5 represent 29B RPH1 transformant lines.
FIG. 6 shows the results of culturing CrRHP1 transformant (A) and 29B RPH1 transformant (B) under high-concentration CO ₂ conditions in an F2 / N liquid medium according to an embodiment of the present invention. to be. WT is wild type.
FIG. 7 is a graph illustrating the concentration of high CO ₂ (A) and ambient CO ₂ (B) in accordance with an embodiment of the present invention. After culturing the transformants under conditions CrRHP1, a result obtained by measuring the intracellular Ci (inorganic carbon) content of CrRHP1 transformants. WT is wild type.

In order to accomplish the object of the present invention, the present invention provides a method for the treatment of chlamydomonas which comprises the step of over-expressing the RHP1 gene by transforming a microalgae of Nannochloropsis sp. with a recombinant vector containing a gene encoding a RHP1 (Rhesus protein 1) protein derived from a reinhardtii , Thereby increasing the biomass of the microalgae.

The range of the RHP1 protein according to the present invention may be selected from the group consisting of Chlamydomonas 2 and a functional equivalent of the protein of SEQ ID NO: 2 derived from E. reinhardtii . Is at least 70% or more, preferably 80% or more, more preferably 90% or more, still more preferably 90% or more, more preferably 90% or more, Quot; refers to a protein having a homology of at least 95% with a physiological activity substantially equivalent to that of the protein represented by SEQ ID NO: 2. "Substantially homogenous bioactivity" means the biomass increasing activity of microalgae from the nanochlrobroscite. The present invention also includes fragments, derivatives and analogues of the RHP1 protein. As used herein, the terms "fragments", "derivatives" and "analogs" refer to polypeptides having substantially the same biological function or activity as the RHP1 polypeptides of the present invention.

The term "recombinant" refers to a cell in which a cell replicates a new, heterologous or homologous recombinant nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, heterologous peptide or heterologous nucleic acid. The recombinant cell can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. In addition, the recombinant cell can express a gene found in a cell in its natural state, but the gene has been modified and reintroduced intracellularly by an artificial means.

The term "vector" is used to refer to a DNA fragment (s), nucleic acid molecule, which is transferred into a cell. The vector replicates the DNA, and the expression cassette (promoter, enhancer, termination signal, and polyadenylation signal) in the host cell can be independently regenerated.

The term "expression vector" means a recombinant DNA molecule comprising a desired coding sequence and a suitable nucleic acid sequence necessary for expressing a coding sequence operably linked in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.

In a method according to an embodiment of the present invention, the Nannochloropsis sp.) The microalgae were Nannochloropsis salina , Nannochloropsis nana gaditana , Nannochloropsis < RTI ID = 0.0 > granulata , Nannochloropsis limnetica , Nannochloropsis oceanica , Nannochloropsis < RTI ID = 0.0 > oculata ), and the like, preferably, but not limited to, Nannochloropsis salina .

The present invention also relates to a method for transforming a microalgae of Nannochloropsis sp. With a recombinant vector comprising a gene encoding RHP1 (Rhesus protein 1) protein derived from Chlamydomonas reinhardtii The present invention also provides a method for producing microorganisms of transformed cyno-chloroplast with increased biomass compared to a wild type strain comprising overexpressing the RHP1 gene.

In the process according to one embodiment of the invention, the protein and RHP1 nanno claw drop in cis (Nannochloropsis sp.) Microalgae are as described above.

In addition, the present invention provides microalgae transformed with increased biomass produced by the above method.

The present invention also relates to a method for producing biomass of a microorganism belonging to the genus Chlamydomonas reinhardtii comprising the gene coding for the RHP1 (Rhesus protein 1) protein comprising the amino acid sequence of SEQ ID NO: 2 / RTI > and a pharmaceutically acceptable carrier.

The above composition preferably contains a gene encoding RHP1 (Rhesus protein 1) protein consisting of the amino acid sequence of SEQ ID NO: 2 derived from Chlamydomonas reinhardtii as an active ingredient, By transforming the microalgae in the cisterns, the biomass of the microalgae of the nanochlo- roboc system can be increased.

In addition,

Culturing the transformed cynoopsis microalgae;

Separating the lipid from the culture liquid;

Transesterifying the lipid to produce a fatty acid ester; And

And converting the produced fatty acid ester into biodiesel.

In the method according to an embodiment of the present invention, the method of converting the produced lipid into biodiesel can use any method known in the art, and is not particularly limited to a specific method.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are merely illustrative of the present invention and that the scope of the present invention is not limited thereto.

Materials and methods

One. Nanochlorobosis  Salina ( Nannochloropsis salina ) Culture conditions

In the present invention, the microalgae, Nannochloropsis saline ) CCMP 1776 strain was used, which was inoculated into a F2 / N medium (15 g / L of sea salt (Sigma-Aldrich, USA), 10 mM Tris-HCl (pH 7.6), 427.5 mg / L NaNO ₃ , 30 mg / L NaH ₂ PO ₄ .2H ₂ O, 5 mL / L trace metal mixture, 4.36 g / L Na ₂ EDTA.H ₂ O, 3.15 g / L FeCl ₃ .6H ₂ O, 10 mg / L CoCl ₂ H ₂ O, 22 mg / L ZnSO ₄ .7H ₂ O, 180 mg / L MnCl ₂ .4H ₂ O, 9.8 mg / L CuSO ₄ .5H ₂ O, 6.3 mg / L Na ₂ MoO ₄ 2H ₂ O and 2.5㎖ / L vitamin stock (1mg / L of vitamin B _12, 1mg / L of biotin, 200mg / thiamin · HCl of L)) 25 ℃ in the high-concentration CO _2, photons of 50-80μmol / m ² · s And 50 rpm.

2. Transgenic vectors for gene overexpression

The Chlamydomonas The RHP1 gene ( CrRHP1 ; SEQ ID NO: 1) of reinhardtii was synthesized by commissioning of bioneer . RHP1 Polar Chlorella (Chlorella sp. ArM0029B) The gene ( 29B RHP1 ; SEQ ID NO: 3, amino acid sequence; SEQ ID NO: 4) was amplified by PCR using a gene-specific primer (Table 1). The CrRHP1 gene is a BamH I and Sac I restriction enzyme, and the 29B RPH1 gene is Nco I and Sac I restriction enzymes, respectively, to prepare respective vectors for transformation (FIG. 1).

The primers used in the present invention gene primer The base sequence (5'-3 ') purpose prediction
Size (bp)

CrRHP1
RHP_F3 CGTGGTGACCATGGGCATCGCAAT
(SEQ ID NO: 5) gDNA PCR

347 Tub ter_R1 CCGCCGCCTCGCGTTCTTTA
(SEQ ID NO: 6) RHP1_F2 GGCACGCTGGTGGCTGGCCT
(SEQ ID NO: 7) Souther blot and Northern blot Probe 300 RHP1_R4 CCCTCGCGAATGGGGTTGAGCT
(SEQ ID NO: 8)


29B RHP1

RHP1_F AACCATGGATGCTGAAGCCGCGGCT
(SEQ ID NO: 9)
Cloning 1300 RHP1_R GCGAGCTCTCATTCCTCCTTCTCCACCT
(SEQ ID NO: 10) HSP70P_F1 GCGGAGGACGCACGCCCTTGA
(SEQ ID NO: 11) gDNA PCR
905 RHP1_R1 CCCCAAAGGCGTGGATCGTGATGGA
(SEQ ID NO: 12) RHP1_F (probe) CTTTGCCGCCTCGGCAGCTA
(SEQ ID NO: 13) Souther blot and Northern blot Probe 307 RHP1_R (probe) CAGGGCCGCATTTGCTGGGTA
(SEQ ID NO: 14)

3. Transformation

Nannochloropsis salina ) CCMP 1776 strain was cultured at 25 ° C, high concentration CO ₂ , 50-80 μmol photon / m ² · s And 50 rpm for 3 days. Then, the cells recovered from the culture were mixed with the transformation vector and transformed by electroporation using ECM 830 (BTX, USA). Subsequently, the cells were cultured under dim light conditions for 1 day, and lines having resistance to bleomycin (Zeocin ( ^TM ), USA) were selected after transformation. Colonies of the selected lines were transferred to 2.5 mg / L of bleomycin-added F2 / N solid medium and cultured.

4. Genomic DNA extraction, PCR  And Southern Blot (Southern blot)

Nannochloropsis resistant to resistant media with bleomycin salina ) colonies were cultured in F2 / N liquid medium at 25 ° C, high concentration CO ₂ , 50-80 μmol photons / m ² · s and 50 rpm. Genomic DNA was isolated from the harvested cells by culturing for 3 days and PCR was performed. For PCR analysis, a specific primer (Table 1) was used for the RHP1 gene and a transformant was identified with and without PCR amplification. The extracted 15 의 DNA was digested with Xho I (NEB, USA) for 16 hours and electrophoresed on 0.8% agarose gel at 35 volts for 16 hours. The DNA on agarose gel was transferred to an amersham hybond N + membrane (GE healthcare, USA) using 10X SSC (Stacked Switched Capacitor) buffer, and 300 bp of CrRHP1 labeled with [? - 32P] dCTP and 29B RHP1 probe and subjected to Southern blotting. The membrane was exposed to an image plate (Fujifilm, Japan) for 2 days, and the signal was confirmed with an image analyzer (BAS-1800, Fujifilm, Japan).

5. RNA Extraction and Northern Blot (Northern blot)

1 ml of NucleoZoL (Machery-Nagel, Germany) was added to the recovered Nannochloropsis salina cells, and the supernatant was recovered by centrifugation at 13,000 rpm for 10 minutes . The sterilized water was added to the recovered supernatant and centrifuged at 13,000 rpm for 10 minutes to remove the supernatant, leaving only the pellet. The supernatant was removed with 75% ethanol, and the pellet was dissolved in 0.1% of diethyl pyrocarbonate (DEPC) The RNA was dissolved in the tertiary sterilized water and extracted. For Northern blot analysis, the extracted 15 의 of RNA was electrophoresed in 100% vol for 3 hours on 1% agarose gel containing 5% formaldehyde. RNA on agarose gels was transferred to an Amersham hybond N + membrane (GE healthcare, USA) and fixed. The procedure from the probe fabrication process to the signal check process was carried out in the same manner as described in the Southern blot.

6. Growth rate measurement

In order to compare the growth rates of wild type and transformants, NANOCHLOROPSIS salina ) at 25 ° C, high concentration CO ₂ , 50-80 μmol photons / m ² · s And 50 rpm. Cells with OD ₇₅₀ values of 0.7, 0.07 and 0.007 were plated in solid media of F / 2, F / 2N and F / 2 + 10 mM sodium bicarbonate (Shinyo Pure Cheminal, Japan) Growth rates were determined after 6 days of incubation at high CO ₂ and ambient CO ₂ conditions.

In addition, in the liquid medium, Nannochloropsis salina ) were cultured at 25 ° C, high concentration CO ₂ , 50-80 μmol photon / m ² · s and 50 rpm for 24 hours, and then inoculated with an OD ₇₅₀ value of 0.1. The growth rate was measured by absorbance at OD ₇₅₀ wavelength using UV-visible spectrophotometry (UV-2450, Shimadzu, Japan), taking 1 ml each while culturing Nanocloprosis salina.

7. Ci Inorganic carbon content measurement

Measurements of Ci content were performed with slight modifications of the reference (Park, Karlsson et al. 1999, FEBS letters, 444 (1), 102-5). Specifically, in the F2 / N medium, high concentration CO ₂ or ambient CO ₂ 25 ℃, photons / m ² · s of 50-80μmol for 24 hours under conditions And Nanocholoropsis salina incubated at 50 rpm for 3 days. The OD ₇₅₀ value of the nanochlo- robus salina cells was adjusted to 5 and washed 3 times with CO ₂ -free 20 mM MES (pH 5.3). The amount of oxygen produced in the cells was measured using OxyLab (Hansatech, United Kingdom).

8. Analysis of Fatty Acids by Gas Chromatography

Nanocloprosis Salina was cultured in F2 / N medium at 25 ℃, high concentration CO ₂ , 50-80 μmol photon / m ² · s And 50 rpm for 7 days, lyophilized for 2 days and then used for lipid content analysis. To extract the fatty acid from the dried cells, 1.5 ml of 2.5% sulfuric acid, 400 쨉 l of toluene and 100 쨉 l of pentadecanoic acid (10 mg / ml) were added and vortexed and treated at 90 째 C for 90 minutes. 1 ml of NaCl and 1.5 ml of hexane were added and vortexed and centrifuged at 760 rpm for 5 minutes to extract fatty acids. Gas chromatography (YL 6100 GC, Young Lin) was used. The inlet capillary temperature was set at 250 ° C and nitrogen was injected at 5.0 ml / min. The oven was allowed to rise at an initial temperature of 140 ° C every 5 minutes by 1 ° C. The detector was a flame ionization detector (FID), and the detection conditions were 250 ° C, 300 ml / min air and 30 ml / min H ₂ , and the signal was measured at 20.00 Hz.

Example  One. RHP1  Over-expressing transformant production

Each of the transforming vectors (FIG. 1) into which the CrRHP1 and 29B RPH1 genes were inserted was transformed into Nannochloropsis salina ) CCMP 1776 strain was transformed and cultured in F2 / N medium supplemented with 2.5 mg / L of bleomycin to select a colony having bleomycin resistance. PCR was carried out using gene-specific primers as shown in Table 1 to confirm whether or not the selected colonies were inserted into the genes. As a result, the RHP1 band was not detected in the wild type (NC) as shown in Fig. 2, and in the CrRHP1 transformant of the present invention including the positive control, the 347 bp size Clamidomonas lane hard The RHP1 band from Chlamydomonas reinhardtii was detected, and 29B RPH1 The RHP1 band derived from the polarized chlorella ( Chlorella sp. ArM0029B) of 905 bp size was also detected in the transformant. From these results, it was confirmed that the RHP1 gene was introduced into the selected transformants.

In addition, the above-identified CrRHP1 Southern blots were performed using the RHP1 probe (Table 1) to confirm the introduction and copy number of the RHP1 gene in the genome of the transformant. As a result, the RHP1 band was not detected in the wild type, and more than one band was detected in the transformant. This indicates that the RHP1 gene was stably introduced into the genome, and an independent line was selected through bands at other positions. Through Southern blot, CrRHP1 Independent lines 1, 2, 3, 4, 5, 17, 19, 21, 22, 23 and 24 for the transformants were obtained from 29B RPH1 4 and 5 lines were selected for the transformant (data not shown) (Fig. 3).

Northern blots were performed using the RHP1 probe to confirm RHP1 gene expression at the RNA level of the transformants selected through the Southern blot. As a result, the RHP1 band was not detected in wild type (NC) as shown in Fig. 4, and CrRHP1 RHP1 band was detected in the transformant. From these results, it was confirmed that the RHP1 gene, which is not expressed in the wild type, is stably expressed in the transformant. CrRHP1 In the case of the transformants, 1, 3, 4 and 19 line ( CrRHP1 ) exhibiting high expression in this was expressed as 29B RPH1 For the transformant (data not shown), lines 4 and 5 were selected and used in the following examples.

Example  2. RHP1  Growth analysis of overexpressed transformants

To determine the effect of overexpression of the RHP1 gene on the growth rate of Nannochloropsis salina , the growth rate was compared by culturing the same amount of cells in various media and culture conditions. As a result, in the case of F2 which is the basic culture medium in the solid medium, there was no significant difference between the wild type and the transformant when cultured in ambient CO ₂ and high concentration CO ₂ , respectively. When the bicarbonate was added to the F2 medium, there was no significant difference in the growth rates of the wild type and the transformant in both ambient CO ₂ and high concentration CO ₂ conditions as in the F2 medium. In the case of F2 / N, the optimal culture medium for nanocholorobsys salinas, ambient CO ₂ The terms wild-type; showed a faster growth rate than the (wt wild type) and there was no significant difference between transgenic, high-concentration CO ₂ conditions, the transgenic body surrounding (ambient) CO ₂ conditions. In addition, when bicarbonate was added to the F2 / N medium, there was no significant difference between the wild type and the transformant when cultured under ambient CO ₂ conditions as in the F2 / N medium, but in the high CO ₂ condition, The body showed faster growth rate than the wild type, and overall, CrRHP1 When the transformant was 29B RPH1 (Fig. 5).

Growth rates were also compared by liquid culture in order to determine whether the increase in growth rate observed when cultured in the solid medium occurred when cultured in a liquid medium. As a result, as shown in FIG. 6, there was no significant difference between the wild type (WT) and the transformant until the 4th day of culture, but the growth rate began to appear between the wild type and the transformant from the 7th day of culture, The maximum OD value increased by 1.5 at 10 days. The difference in the OD value of 1.5 indicates a 1.5-fold difference in cell number, indicating that the growth rate was increased by 150%. In the case of liquid culture, CrRHP1 When the transformant was 29B RPH1 It was confirmed that the growth rate was better than that of the transformant (Fig. 6). In addition, since the difference in growth rate between wild type and transformant increases with time, it is expected that the difference in growth rate between wild type and transformant is larger when cultured for a longer time using continuous culture method or the like. From the above results, it was confirmed that the growth rate was increased by overexpression of RHP1 gene in Nannochloropsis salina .

Example  3. CrRHP1  Over-expressing transformant cells Ci  Content analysis

The intracellular Ci content was measured in order to confirm the change in the absorption of Ci (inorganic carbon) in the cells of the CrRHP1 overexpressing transformant having the excellent growth rate in Example 2 above. As a result, in the cells cultured under high CO ₂ conditions as shown in FIG. 7, CrRHP1 transformants (# 1, # 3 and # 4) had an intracellular Ci concentration of 35% , 83% and 100%, respectively. In the case of cells cultured in ambient CO ₂ , the intracellular Ci concentration was also increased by 57 to 100% as compared to the wild type (FIG. 7).

These results indicate that the expression of RHP1 gene increases CO ₂ uptake, resulting in an increase in the amount of Ci in the cell than in the wild type, and the intracellular Ci content of the transformant is high in both ambient CO ₂ and high CO ₂ conditions However, the increase in the growth only when cultured in high-concentration CO ₂ may be attributed to an increase in the absolute amount of CO ₂ used for cell growth. That is, in the ambient CO ₂ condition, the amount of CO ₂ that can be used for cell growth is limited, so that the intracellular Ci content is increased but it is not enough to increase the growth through the increase of photosynthesis efficiency. However, in the case of high concentration CO ₂ , it was assumed that CO ₂ was absorbed from the periphery and the photosynthesis was increased, so that the growth rate was accelerated.

Example  4. CrRHP1  Fatty acid analysis of overexpressing transformants

In order to investigate the changes in fatty acid composition and total content due to the increase of growth rate of CrRHP1 transformant under high concentration CO ₂ condition, it was analyzed by gas chromatography. Cells cultured in high concentration CO ₂ were analyzed by 7 And the analysis was carried out. As a result, there was no significant difference in the total fatty acid content per unit biomass between the wild type and the transformation as shown in Table 2, but in the case of C16: 3n3 and C18: 3n3 in the fatty acid, the CrRHP1 transformant And it was confirmed that it is produced more. These results indicate that the biomass increased 150% and the lipid productivity also increased 150%.

<110> Korea Research Institute of Bioscience and Biotechnology <120> Method for producing transgenic Nannochloropsis salina with          increased biomass using RHP1 gene from Chlamydomonas reinhardtii <130> PN17290 <160> 14 <170> KoPatentin 3.0 <210> 1 <211> 1725 <212> DNA <213> Chlamydomonas reinhardtii <400> 1 atgcaggcac ttcctcccaa gattcccgct tccgtatcgg gccacggaac ccagtcccgg 60 cgtcacagcc tggactggtc gcatattggc cttccctctc gcgagacgca gctgcgggct 120 ggctttgtgc cctcggctgc tgtggtgatt gtgattttcg tcggcctgtt tttcggcttg 180 acccagtaca ccgagttggg cacaaatgcg caggaggagg tcgatcgctt ttacaaatac 240 ctggtcgatg tcaacatcat ggtgtggatc ggtttcggct tcctgatgac cttcatgcgc 300 cgctacggct acggcgctgt ggccctgaac tactttgcct cggcgctcat gttcctggag 360 gccatcctca tgatcggcgc cacgcagcaa gtgttctgga actaccatcg caccaagatc 420 cagatcgaca tcgccttgct gatcgactgc gccttctgcg ccgcctctgg tatgattgcc 480 ttcggcgcca tcatcggcaa ggccacgccc acgcagttgc tgtggctgct cttttggcag 540 gttccgctgt acgctctcaa ccagcagctg gtgatccaca cattcaaggc gctggacatg 600 ggcggcacca tcgtcatcca cctgttcgga gcctactacg gattggcagc ctcgctcatg 660 atcagccgca agcagccgct gcacggcctg gacaacccca agaactcggg cgcctacctg 720 aacgacatct tctccatgat cggaaccatc ttcctcttca tctactggcc cagcttcaac 780 ggcgccctgg cgtccgtgtc ggctggccac atggaggagg cgaccgatgc caagaaggcc 840 gcccaattcc tgtccatcgt caacacgctg ctgtcgctgc tgggcgccgg gctatcggtg 900 ttcgccacct cggccctggt gggcggccgc ttcaacatgg tgcacatcca gaacagcacc 960 ctggccggtg gcgtggcgat gggcgccgcc tgcacgctgc gcctgacgcc cggtggcgcg 1020 ctggctgtgg gcctgggcgc gggagccatc agcaccctgg gcttccagta cctcatgccc 1080 ttcctggacc gcaccatcgg actgggcgac acctgcggtg tgcacaacct gcacggcatc 1140 cccgccatcg tcggcacgct ggtggctggc ctggcggctc tgggccagca ccccgactac 1200 ctggagcacg acaccggccg ccagcagctg ggctaccagg tgcttgcggg cgtggtgacc 1260 atgggcatcg caatcgccgg cggcctgcta ggcggcttcg tggtgtcgtg gttcaacccc 1320 cgtggcgacg acccgctgac cgtgcccgag ctgttcgacg atgggccctg gtgggagcac 1380 cagcgcgtgg agcccatgcc catctccacc tccatccacc tcagcaacat gagcgcacac 1440 ggcaagagcc accacaacca gtccgtcagc gtgggccagc tcaaccccat tcgcgagggc 1500 cgcgagatcg ctgtgtcagg cgtgcctgcc accggccagc gctccgtggg cgagatcgcc 1560 gtgaccatgc aggccgcgcc cgtgatggcc tcctcagcgc ccgtgatggg catgcacgcc 1620 gccgccgcca cccccatcga tacgccgctg ttcgcggacg gtcacgccat ggagaacgcc 1680 gcgcgcccgg tgcagcccat ggtggccggc gccggcaacg tgtag 1725 <210> 2 <211> 574 <212> PRT <213> Chlamydomonas reinhardtii <400> 2 Met Gln Ala Leu Pro Pro Lys Ile Pro Ala Ser Val Ser Gly His Gly   1 5 10 15 Thr Gln Ser Arg Arg His Ser Leu Asp Trp Ser His Ile Gly Leu Pro              20 25 30 Ser Arg Glu Thr Gln Leu Arg Ala Gly Phe Val Ser Ser Ala Ala Val          35 40 45 Val Ile Val Ile Phe Val Gly Leu Phe Phe Gly Leu Thr Gln Tyr Thr      50 55 60 Glu Leu Gly Thr Asn Ala Gln Glu Glu Val Asp Arg Phe Tyr Lys Tyr  65 70 75 80 Leu Val Asp Val Asn Ile Met Val Trp Ile Gly Phe Gly Phe Leu Met                  85 90 95 Thr Phe Met Arg Arg Tyr Gly Tyr Gly Ala Val Ala Leu Asn Tyr Phe             100 105 110 Ala Ser Ala Leu Met Phe Leu Glu Ala Ile Leu Met Ile Gly Ala Thr         115 120 125 Gln Gln Val Phe Trp Asn Tyr His Arg Thr Lys Ile Gln Ile Asp Ile     130 135 140 Ala Leu Leu Ile Asp Cys Ala Phe Cys Ala Ala Ser Gly Met Ile Ala 145 150 155 160 Phe Gly Ala Ile Ile Gly Lys Ala Thr Pro Thr Gln Leu Leu Trp Leu                 165 170 175 Leu Phe Trp Gln Val Pro Leu Tyr Ala Leu Asn Gln Gln Leu Val Ile             180 185 190 His Thr Phe Lys Ala Leu Asp Met Gly Gly Thr Ile Val Ile His Leu         195 200 205 Phe Gly Ala Tyr Tyr Gly Leu Ala Ala Ser Leu Met Ile Ser Arg Lys     210 215 220 Gln Pro Leu His Gly Leu Asp Asn Pro Lys Asn Ser Gly Ala Tyr Leu 225 230 235 240 Asn Asp Ile Phe Ser Ile Gly Thr Ile Phe Leu Phe Ile Tyr Trp                 245 250 255 Pro Ser Phe Asn Gly Ala Leu Ala Ser Val Ser Ala Gly His Met Glu             260 265 270 Glu Ala Thr Asp Ala Lys Lys Ala Ala Gln Phe Leu Ser Ile Val Asn         275 280 285 Thr Leu Leu Ser Leu Gly Ala Gly Leu Ser Val Phe Ala Thr Ser     290 295 300 Ala Leu Val Gly Gly Arg Phe Asn Met Val His Ile Gln Asn Ser Thr 305 310 315 320 Leu Ala Gly Gly Val Ala Met Gly Ala Ala Cys Thr Leu Arg Leu Thr                 325 330 335 Pro Gly Aly Gly Ala Gly Aly Gly Aly Gly Aly Gly Aly Ile Ser Thr             340 345 350 Leu Gly Phe Gln Tyr Leu Met Pro Phe Leu Asp Arg Thr Ile Gly Leu         355 360 365 Gly Asp Thr Cys Gly Val His Asn Leu His Gly Ile Pro Ala Ile Val     370 375 380 Gly Thr Leu Val Ala Gly Leu Ala Ala Leu Gly Gln His Pro Asp Tyr 385 390 395 400 Leu Glu His Asp Thr Gly Arg Gln Gln Leu Gly Tyr Gln Val Leu Ala                 405 410 415 Gly Val Val Thr Met Gly Ile Ale Ile Ala Gly Gly Leu Leu Gly Gly             420 425 430 Phe Val Val Ser Trp Phe Asn Pro Arg Gly Asp Asp Pro Leu Thr Val         435 440 445 Pro Glu Leu Phe Asp Asp Gly Pro Trp Trp Glu His Gln Arg Val Glu     450 455 460 Pro Met Pro Ile Ser Thr Ser Ile His Leu Ser Asn Met Ser Ala His 465 470 475 480 Gly Lys Ser His His Asn Gln Ser Val Ser Val Gly Gln Leu Asn Pro                 485 490 495 Ile Arg Glu Gly Arg Glu Ile Ala Val Ser Gly Val Pro Ala Thr Gly             500 505 510 Gln Arg Ser Val Gly Glu Ile Ala Val Thr Met Gln Ala Ala Pro Val         515 520 525 Met Ala Ser Ser Ala Pro Val Met Gly Met Ala Ala Ala Ala Thr     530 535 540 Pro Ile Asp Thr Pro Leu Phe Ala Asp Gly His Ala Met Glu Asn Ala 545 550 555 560 Ala Arg Pro Val Gln Pro Met Val Ala Gly Ala Gly Asn Val                 565 570 <210> 3 <211> 1299 <212> DNA <213> Chlorella sp. <400> 3 atggatgctg aagccgcggc tcctctgctg gcgggcacca gccacgccgg cacgtcatgg 60 gacctgcgcg gcacttttgc cgcctccctg gcgggcctca ccaccctcct gctcgtcctg 120 cttgctctgt ttggccagta cgccgccgac ctcacagatg ccaacgtgga tcgttactac 180 gcctggctgt ccgatgtgta cgtgatggtc tttttgggtt ttggcttcct catgaccttc 240 ctccgccgct actcctactc cgccgtctcc ctcaacttcg tctgctcctg tctggtcatc 300 ctggaagccc tgctggccat cggctgggtg cagcagggct ggggcaccgt gtctgtggac 360 ctccccttgc tcatcgacgc cgccttctgc gcgggcgccg ccatgatttc ctttggggcg 420 gtgctgggca aagcctcccc cgcccagctg ctctggctgc tggccctgga ggtgcccctc 480 tacgccctca acgcccaggt tgtgacaggc cgctgggggg cgctggacgt gggaggctcc 540 atcacgatcc acgcctttgg ggcggtctac gggctggcgg cctccgtgtg gctgtctccc 600 aagggggcgg gcagcgggca ccccaaaaac ggggcctcct acgcgtcaga catgacggcc 660 atgctgggca cgctcttcct cttcatctac tggccctctt tcaacggcgc actggccaca 720 gcgcccggca ccgacgcgca gccgcgcgcc ttttgcgtga tgaacaccgt cttggcgctc 780 ctgggggcct gcctggccgg ctttgccgcc tcggcagcta ccgggcagct ggacatggtg 840 cacgtgcaga acgccacgct ggcagggggt gtcgccatcg gctccgctgc caacctcgtc 900 atgccgcccg cctgcgccct ggcagtcggc atcgccgccg gggccctctc cacctgcggc 960 tacctgtggc tgtcccccgc cctggagcgc acctgcgggg tcaccgacac ctgcggagtg 1020 gccaaccttc acggcatgcc cggcgtgctg ggcggactcg catccgccct cttcgcccac 1080 ctcttctacc cagcaaatgc ggccctggtt gcgcacggcg ccaaggggca gcccggggtc 1140 cagctggcgg ggctggggtg cacgctggcg gcggcggcgg tgggcggggc gtgtgctggc 1200 tgggcggtga gcagggccag ccctgcgggg cagagcctgg cagcagagga catgttcgag 1260 gatgcacact tttggcacga ggtggagaag gaggaatga 1299 <210> 4 <211> 432 <212> PRT <213> Chlorella sp. <400> 4 Met Asp Ala Glu Ala Ala Pro Leu Leu Ala Gly Thr Ser His Ala   1 5 10 15 Gly Thr Ser Trp Asp Leu Arg Gly Thr Phe Ala Ala Ser Leu Ala Gly              20 25 30 Leu Thr Thr Leu Leu Leu Val Leu Leu Ala Leu Phe Gly Gln Tyr Ala          35 40 45 Ala Asp Leu Thr Asp Ala Asn Val Asp Arg Tyr Tyr Ala Trp Leu Ser      50 55 60 Asp Val Tyr Val Met Val Phe Leu Gly Phe Gly Phe Leu Met Thr Phe  65 70 75 80 Leu Arg Arg Tyr Ser Tyr Ser Ala Val Ser Leu Asn Phe Val Cys Ser                  85 90 95 Cys Leu Val Ile Leu Glu Ala Leu Leu Ala Ile Gly Trp Val Gln Gln             100 105 110 Gly Trp Gly Thr Val Ser Val Asp Leu Pro Leu Leu Ile Asp Ala Ala         115 120 125 Phe Cys Ala Gly Ala Ala Met Ile Ser Phe Gly Ala Val Leu Gly Lys     130 135 140 Ala Ser Pro Ala Gln Leu Leu Trp Leu Leu Ala Leu Glu Val Pro Leu 145 150 155 160 Tyr Ala Leu Asn Ala Gln Val Val Thr Gly Arg Trp Gly Ala Leu Asp                 165 170 175 Val Gly Gly Ser Ile Thr Ile His Ala Phe Gly Ala Val Tyr Gly Leu             180 185 190 Ala Ala Ser Val Trp Leu Ser Pro Lys Gly Ala Gly Ser Gly His Pro         195 200 205 Lys Asn Gly Ala Ser Tyr Ala Ser Asp Met Thr Ala Met Leu Gly Thr     210 215 220 Leu Phe Leu Phe Ile Tyr Trp Pro Ser Phe Asn Gly Ala Leu Ala Thr 225 230 235 240 Ala Pro Gly Thr Asp Ala Gln Pro Arg Ala Phe Cys Val Met Asn Thr                 245 250 255 Val Leu Ala Leu Leu Gly Ala Cys Leu Ala Gly Phe Ala Ala Ser Ala             260 265 270 Ala Thr Gly Gln Leu Asp Met Val His Val Gln Asn Ala Thr Leu Ala         275 280 285 Gly Gly Val Ala Ile Gly Ser Ala Ala Asn Leu Val Met Pro Ala     290 295 300 Cys Ala Leu Ala Val Gly Ile Ala Ala Gly Ala Leu Ser Thr Cys Gly 305 310 315 320 Tyr Leu Trp Leu Ser Pro Ala Leu Glu Arg Thr Cys Gly Val Thr Asp                 325 330 335 Thr Cys Gly Val Ala Asn Leu His Gly Met Pro Gly Val Leu Gly Gly             340 345 350 Leu Ala Ser Ala Leu Phe Ala His Leu Phe Tyr Pro Ala Asn Ala Ala         355 360 365 Leu Val Ala His Gly Ala Lys Gly Gln Pro Gly Val Gln Leu Ala Gly     370 375 380 Leu Gly Cys Thr Leu Ala Ala Ala Val Gly Gly Ala Cys Ala Gly 385 390 395 400 Trp Ala Val Ser Arg Ala Ser Pro Ala Gly Gln Ser Leu Ala Ala Glu                 405 410 415 Asp Met Phe Glu Asp Ala His Phe Trp His Glu Val Glu Lys Glu Glu             420 425 430 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 cgtggtgacc atgggcatcg caat 24 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 ccgccgcctc gcgttcttta 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 ggcacgctgg tggctggcct 20 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 ccctcgcgaa tggggttgag ct 22 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 aaccatggat gctgaagccg cggct 25 <210> 10 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 gcgagctctc attcctcctt ctccacct 28 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 gcggaggacg cacgcccttg a 21 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 ccccaaaggc gtggatcgtg atgga 25 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 ctttgccgcc tcggcagcta 20 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 cagggccgca tttgctgggt a 21

Claims (7)

Nannochloropsis salina is transformed with a recombinant vector comprising a gene encoding RHP1 (Rhesus protein 1) protein derived from Chlamydomonas reinhardtii , which is composed of the amino acid sequence of SEQ ID NO: 2 Wherein the method comprises the step of overexpressing the RHP1 gene to increase the content of biomass, hexadecatrienoic acid and linolenic acid of nanocholoropsis salina. delete delete Nannochloropsis salina is transformed with a recombinant vector comprising a gene encoding RHP1 (Rhesus protein 1) protein derived from Chlamydomonas reinhardtii , which is composed of the amino acid sequence of SEQ ID NO: 2 Wherein the method comprises the step of overexpressing the RHP1 gene, wherein the amount of biomass, hexadecatrienoic acid and linolenic acid is increased compared to the wild type. 4. A transformed Nanocrobrotopsis salina produced by the method of claim 4, wherein the content of biomass, hexadecatrienoic acid and linolenic acid is increased compared to the wild type. A gene encoding a RHP1 (Rhesus protein 1) protein derived from Chlamydomonas reinhardtii consisting of the amino acid sequence of SEQ ID NO: 2 and a gene coding for a protein of Rhesus protein 1 (HCP) acid and linolenic acid. Culturing the transformed Nanocloprosis Salina of claim 5;
Separating the lipid from the culture obtained by culturing the Nanocoplopysis salina;
Transesterifying the lipid to produce a fatty acid ester; And
And converting the produced fatty acid ester to biodiesel.

Images