KR101980954B1 - A composition for producing antibody against 53-kDa protein of Porphyromonas gingivalis and uses thereof - Google Patents

Abstract

The present invention relates to a composition for producing an antibody against 53-kDa protein of Porphyromonas gingivalis and its use, and specifically to a heavy chain of a specific antibody against 53-kDa protein of Porphyromonas gingivalis . And an antibody producing composition comprising an expression cassette comprising a light chain gene, an antibody producing kit comprising the composition, and an antibody producing method comprising culturing the transformed callus into which the composition is introduced, porphyromonas gingiva The present invention relates to a composition for preventing, treating or improving periodontal disease comprising the antibody against the 53-kDa protein of the lease, the transformed callus or the antibody.
The composition for producing an antibody against 53-kDa protein of Porphyromonas gingivalis according to the present invention and a method for producing an antibody using the same can be produced in large quantities at low cost because plants are used, and the antibody has a risk of contamination. It is low and does not induce an immune response, so it can be widely used for the treatment or improvement of periodontal disease.

Description

Composition for producing antibody against 53-kDa protein of Porphyromonas gingivalis and its use {A composition for producing antibody against 53-kDa protein of Porphyromonas gingivalis and uses}

The present invention Porphyromonas Gingivalis ( Porphyromonas) gingivalis ) relates to a composition for producing an antibody against the 53-kDa protein of the present invention and its use, specifically comprising an expression cassette comprising the heavy and light chain genes of specific antibodies to the 53-kDa protein of Porphyromonas gingivalis A composition for producing an antibody, an antibody producing kit comprising the composition, an antibody production method comprising culturing the transformed callus into which the composition is introduced, an antibody against 53-kDa protein of Porphyromonas gingivalis, The present invention relates to a composition for preventing, treating or improving periodontal disease, including a transformed callus or an antibody.

Periodontal disease, which is represented by periodontitis, involves the destruction of the tissue surrounding the teeth, ie, the cementum (C chalk), which constitutes the outer surface of the tooth root, as well as the bone (alveolar bone), the periodontal ligament that connects the tooth root and the alveolar bone, and the gums (gum). As a disease, it is a disease that ultimately leads to tooth loss. It is reported that 75% of adults worldwide suffer from periodontal disease, and more than 90% of the adult population by age 65 have or have experienced periodontal disease. In addition, the recurrence rate of more than 45% within five years, it is expected to be the most important factor causing the deterioration of quality of life in the aging age.

Since periodontal disease is a chronic inflammatory disease that begins with bacterial infection, it is a serious systemic disease caused by chronic inflammation, such as atherosclerosis and atherosclerosis-based cardiovascular disease and stroke, low birth weight premature infants, diabetes, and rheumatoid arthritis. It is reported that this may be a direct cause of aspiration respiratory infections, even pancreatic cancer and oral-digestive cancer, including Alzheimer's disease (NAgpal et al., Mediators Inflamm. 793898, 2015). Thus, systemic diseases caused by periodontal disease and periodontal disease will not only be accompanied by economic losses such as the cost of treatment, waste of time and labor reduction, and consequently will be a national economic burden.

Meanwhile, Porphyromonas gingivalis ) is a key pathogen of periodontal disease, which induces disturbances in our oral immune system, which helps the survival of other oral bacteria. As it plays a pivotal role in the pathogenesis of periodontal disease, ie, periodontal tissue inflammation and destruction, inhibition of Porphyromonas gingivalis is crucial for the prevention of periodontal disease and recurrence after treatment.

In general, a method of fundamentally suppressing an infection may include a prophylactic vaccine, which uses an active immune method that induces antibody formation by administering to a human body as a vaccine. However, some people may not develop antibodies when active immunization is performed, and sometimes active human vaccine may cause severe human side effects. In order to avoid side effects, it is necessary to develop a vaccine using only one target antigen of the infectious organism, and more than one target antigen, rather than the whole infectious organism, but the problem is that the smaller the vaccine immunogen, the more difficult it is to induce antibody formation. .

In this regard, passive immunization using the formed immune antibodies has been evaluated as an ideal strategy for suppressing periodontal infection, and a technique for preparing antibodies against the inoculation of algae in a mixed culture comprising porphyromonas gingivalis is known. It has been developed (Japanese Patent No. 4982629). However, there is a costly problem because a large amount of specific antibodies are required, and in addition, antibodies obtained from animals and humans are pathogens causing serious diseases such as hepatitis B, hepatitis C virus, and human immunodeficiency virus (HIV). Has a potential problem of contamination (Raab, Prim Care. 38: 681-691, 2011).

Thus, plant antibodies, ie antibodies obtained from plants, are considered new alternatives. Plant antibodies have the advantage of being able to fundamentally block pathogen contamination problems that may originate from animals or humans and are relatively safe because they do not induce an immune response because they are less immune than antibodies of animals or humans (De Jaeger et. al., Plant Mol Biol. 43: 419-428, 2000; Stoger et al., Curr Pharm Des. 11: 2439-2457, 2005). However, until now, no clinically applicable plant passive immune vaccine has been developed to prevent or treat periodontal pathogens.

Under these backgrounds, the present inventors have diligently researched to develop antibodies with high stability against the causative agent of periodontal disease. As a result, the present inventors have expressed expression cassettes and expressions encoding the antibodies against 53-kDa protein, the antigen of Porphyromonas gingivalis. A vector was prepared, and the antibody was produced by incorporating it into a callus of rice, and the antibody produced was confirmed to have high immune reactivity against 53-kDa protein, thereby completing the present invention.

One object of the invention is (a) a promoter; A heavy chain gene of the antibody, encoded by the nucleotide sequence of SEQ ID NO: 1 or 3; And a first expression cassette sequentially comprising 3′-UTR; And (b) a promoter; The light chain gene of the antibody, encoded by the nucleotide sequence of SEQ ID NO: 2 or 4; And a second expression cassette sequentially comprising a 3′-UTR.

Another object of the present invention to provide a kit for producing an antibody comprising the composition.

Another object of the present invention is to prepare a transgenic callus by (a) introducing the composition into the callus of the plant; And (b) culturing the obtained transformed callus, Porphyromonas gingivalis ( Porphyromonas). gingivalis ) provides an antibody production method for 53-kDa protein.

Another object of the present invention is 53-kDa of Porphyromonas gingivalis, consisting of a heavy chain expressed by the nucleotide sequence of SEQ ID NO: 1 or 3 and a light chain expressed by the nucleotide sequence of SEQ ID NO: 2 or 4 It provides an antibody against a protein.

Another object of the present invention is a heavy chain CDR1 of SEQ ID NO: 5; A heavy chain CDR2 of SEQ ID NO: 6; And a heavy chain variable region comprising the heavy chain CDR3 of SEQ ID NO: 7 and a light chain CDR1 of SEQ ID NO: 8; Light chain CDR2 of SEQ ID NO: 9; And a light chain variable region comprising the light chain CDR3 of SEQ ID NO: 10, to provide an antibody against 53-kDa protein of Porphyromonas gingivalis.

Another object of the present invention is a heavy chain CDR1 of SEQ ID NO: 11; A heavy chain CDR2 of SEQ ID NO: 12; And a heavy chain variable region comprising the heavy chain CDR3 of SEQ ID NO: 13, and a light chain CDR1 of SEQ ID NO: 14; Light chain CDR2 of SEQ ID NO: 15; And a light chain variable region comprising the light chain CDR3 of SEQ ID NO: 16, to provide an antibody against 53-kDa protein of Porphyromonas gingivalis.

Still another object of the present invention is to provide a pharmaceutical composition for preventing or treating periodontal disease, comprising the transformed callus, its culture, its culture, its extract, or its fraction.

Another object of the present invention to provide a pharmaceutical composition for the prevention or treatment of periodontal disease, comprising the antibody.

Still another object of the present invention is to provide a nutraceutical composition for the prevention or improvement of periodontal disease, comprising the transformed callus, its culture, its culture, its extract or a fraction of the extract.

Another object of the present invention to provide a health functional food composition for preventing or improving periodontal disease, comprising the antibody.

Another object of the present invention is to provide a quasi-drug composition for the prevention or improvement of periodontal disease, including the transformed callus, its culture, its culture, its extract or a fraction of the extract.

Another object of the present invention to provide a quasi-drug composition for the prevention or improvement of periodontal disease, comprising the antibody.

One object of the invention is (a) a promoter; A heavy chain gene of the antibody, encoded by the nucleotide sequence of SEQ ID NO: 1 or 3; And a first expression cassette sequentially comprising 3′-UTR; And (b) a promoter; The light chain gene of the antibody, encoded by the nucleotide sequence of SEQ ID NO: 2 or 4; And a second expression cassette sequentially comprising a 3′-UTR.

In the present invention, the antibody may be an antibody against 53-kDa protein of Porphyromonas gingivalis .

The term, " Porphyromonas gingivalis ( Porphyromonas) 53-kDa protein of " gingivalis " refers to one of the proteins that make up the fimbriae of Porphyromonas gingivalis , a major pathogen that causes periodontal disease. The bacterium disrupts the oral immune system of the human body. Induces the survival of other oral bacteria, causing inflammation and destruction of periodontal tissue.

For the purposes of the present invention, the 53-kDa protein of Porphyromonas gingivalis means an antigen that induces an immune response of the human body by the fungus, and may be interchangeably referred to herein as '53 -kDa protein '. have.

The term "antibody against Porphyromonas gingivalis 53-kDa protein" refers to a protein molecule immunologically immunogenic to the 53-kDa protein. Specifically, the antibody may specifically bind to the 53-kDa protein to cause an immune response, and consequently, to treat periodontal disease caused by the bacterium.

Specifically, the antibody may be a structure consisting of a heavy chain and a light chain, and more specifically, may be a structure consisting of two heavy chains and two light chains. More specifically, the heavy chain expressed by the nucleotide sequence of SEQ ID NO: 1 and the light chain expressed by the nucleotide sequence of SEQ ID NO: 2, or the heavy chain expressed by the nucleotide sequence of SEQ ID NO: 3 and It may be composed of a light chain expressed by the base sequence, but is not limited thereto.

The base sequence used in the present invention is to be construed to include a sequence showing substantial identity with the sequence described in the sequence list, in consideration of the biologically equivalent variation. The term 'substantial identity' means that if the alignment of the sequence of the present invention with any other sequence is maximally matched, the aligned sequence is analyzed using algorithms commonly used in the art. By 60% homology, more specifically 70% homology, even more specifically 80% homology, most specifically 90% homology.

Therefore, a base sequence having high homology with the base sequence represented by SEQ ID NOS: 1 to 4, for example, having a homology of 70% or more, specifically 80% or more, more specifically 90% or more. Base sequences should also be construed as being included in the scope of the present invention.

In the present invention, the heavy chain gene of the antibody encoded by the nucleotide sequence of SEQ ID NO: 1 or 3, or the light chain gene of the antibody encoded by the nucleotide sequence of SEQ ID NO: 2 or 4 may be included in the expression cassette.

The term 'expression cassette' refers to an expression construct capable of expressing a gene.

For the purposes of the present invention, the expression cassette can be used to express the heavy and light chains of an antibody against a 53-kDa protein, and the expression control sequences are operably linked to the heavy and light chain genes such that the heavy and light chains are expressed. It may include.

The term 'operably linked' refers to a state in which a nucleic acid expression control sequence and a nucleic acid sequence encoding a protein or peptide of interest are functionally linked to perform a general function. For example, promoters and nucleic acid sequences encoding proteins or peptides may be operably linked to affect expression of the coding sequences. Operative linkage with expression vectors can be prepared using genetic recombination techniques well known in the art, and site specific DNA cleavage and ligation can employ enzymes commonly known in the art.

Specifically, the expression control sequence may be a promoter, an operator, an initiation codon, a termination codon, a polyadenylation signal, an untranslated region (UTR) or an enhancer, and more specifically, a promoter and a 3'-UTR, but It is not limited.

As used herein, the term "promoter" refers to a region of DNA that regulates transcription of a gene. For the purposes of the present invention, such promoters can be used to modulate the transcription of the heavy and light chain coding sequences of an antibody against 53-kDa protein. Specifically, RAy3D promoter from rice ( Oryza sativa ) may be used, but is not limited thereto.

As used herein, the term “three prime untranslated region” refers to an untranslated mRNA region that appears immediately after the stop codon. Sequences related to interaction with proteins, transport to and from the cell nucleus, determination of mRNA length and secondary structure, and the like, which may result in polyadenylation, translation efficiency, localization, and It is involved in the regulation of translation by affecting stability. For the purposes of the present invention, the 3'-UTR can be used to improve the efficiency of translation of heavy and light chain coding sequences of antibodies to 53-kDa protein.

In the present invention, the first expression cassette and the second expression cassette may be inserted into one or more expression vectors.

As used herein, the term “expression vector” is a means for efficiently inducing the expression of a gene of interest by introducing DNA into a host cell. For the purposes of the present invention, the expression of heavy and light chains of an antibody against the 53-kDa protein is expressed. Genetic constructs comprising expression control elements operably linked to one another.

In addition, the expression vector may include a selectable marker in addition to the expression control element. Specifically, the hygromycin phosphotransferase (HPT) gene may be included as a selectable marker, and may include an expression control element operably linked to express the marker. As a specific example, p35S promoter derived from Cauliflower mosaic virus; HPT gene and 35S poly A terminator, more specifically the p35S promoter; HPT gene; And 35S poly A terminators sequentially.

In a specific embodiment of the present invention, an expression cassette was constructed in which the heavy and light chain genes of the antibody against the 53-kDa protein derived from the hybridoma cell line were subjected to regulation of the rice RAmy3D gene promoter and 3′-UTR. Thereafter, the expression cassette was inserted into a vector containing the HPT gene as a selection marker (FIG. 3), and the transgenic rice callus was prepared by injecting it into a blastocyst derived callus of rice (FIG. 4). The callus culture medium contained the heavy and light chains of the antibody against the 53-kDa protein, and it was confirmed that they bind to form one whole antibody (FIGS. 5 and 6). Also, the antibody was porphyromonas long. It was confirmed that binding to Kibalis 53-kDa protein through the antigen antibody reaction (Figs. 7 and 8).

This suggests that the composition of the present invention can be usefully used to produce antibodies against the 53-kDa protein of Porphyromonas gingivalis.

Another object of the present invention to provide a kit for producing an antibody comprising the composition.

The 'promoter' used in the kit, 'antibody against porphyromonas gingivalis 53-kDa protein', '3'-UTR', 'expression cassette' and 'expression vector' and the like are the same as described above.

The antibody production kit of the present invention may include not only the first and second expression cassettes, but also one or more other component compositions, solutions or devices suitable for introducing or expressing the expression cassettes.

As a specific example, the kit of the present invention may be a kit including essential elements necessary for carrying out the introduction of the expression cassettes. For example, test tubes or other suitable containers, reaction buffers (pH and buffer concentrations vary), plant culture vessels, plant culture media, sterile water and the like.

Another object of the present invention is to prepare a transgenic callus by (a) introducing the composition into the callus of the plant; And (b) culturing the obtained transformed callus, Porphyromonas gingivalis ( Porphyromonas). gingivalis ) provides an antibody production method for 53-kDa protein.

The 'promoter' used in the above production method, 'antibody against porphyromonas gingivalis 53-kDa protein', '3'-UTR', 'expression cassette' and 'expression vector' and the like are the same as described above .

As used herein, the term "plant" includes not only mature plants but also plant cells, plant tissues, and seeds of plants that can develop into mature plants. Specifically, it may be Arabidopsis, rice, wheat or barley, more specifically rice ( Oryza sativa ), but as long as it can produce the antibody of the present invention, it is not limited thereto.

As used herein, the term “callus” refers to an amorphous tissue or cell mass derived from a plant. By culturing tissues cut from plants, callus can be produced from any part of the leaves, stems, roots, etc., and it can also be passaged to produce callus continuously. In addition, by controlling the amount of phytohormone in the medium, differentiation of catheter, phloem, etc., callus root or complete individual can be formed from callus.

As used herein, the term “transformation” refers to a phenomenon in which genetic material is changed by introducing genetic material into living cells of another line.

In the present invention, the step of introducing the composition into the plant may be implemented by introducing the expression cassettes inserted into the expression vector into the callus, which may be performed by transformation techniques known in the art.

Specific examples include transformation methods using Agrobacterium , microprojectile bombardment, electroporation, PEG-mediated fusion, microinjection, and liposome mediation. Liposome-mediated method, In planta transformation, Vacuum infiltration method, floral meristem dipping method or Agrobacteria spraying method It may be used, and more specifically, a transformation method using microinjection may be used, but is not limited thereto.

In the present invention, the step of culturing the callus may be performed by a method known in the art. Specifically, the culturing may be performed for 1 day to 14 days, more specifically 6 to 10 days, but is not limited thereto.

Through the incubation, an antibody against 53-kDa protein of Porphyromonas gingivalis may be included in the obtained culture.

In addition, as a culture liquid used for the culture, inorganic nutrients such as C, H, O, N, P, K, S, Ca, Mg, Fe, Mn, Cu, Zn, B, and Mo; Organic nutrients such as carbohydrates, plant growth regulators and vitamins; Amino acids such as myo-inositol, glycine, and L-glutamine; Glucose, fructose, mannose, ribose, xylose, sucrose, melibiose, cellobiose, lactose, amylose, carbohydrates, raffinose, sorbitol, mannitol, glycerol, or the like, to which carbon sources such as glycerol are added or used Can be.

In a specific embodiment of the present invention, a transformed rice callus was prepared by injecting a vector containing the heavy and light chains of the antibody against the 53-kDa protein derived from a hybridoma cell line into a calli derived calli of rice (FIG. 5). And 6), the callus culture medium contains a heavy chain and a light chain of an antibody against 53-kDa protein, and one whole antibody formed by binding them binds to 53-kDa protein of Porphyromonas gingivalis. It was confirmed (FIGS. 7-8). In addition, the amount of the antibody was confirmed to be the maximum at 8 days callus culture (Fig. 10).

This suggests that the production method of the present invention can be usefully used to produce an antibody against 53-kDa protein of Porphyromonas gingivalis.

Another object of the present invention is 53-kDa of Porphyromonas gingivalis, consisting of a heavy chain expressed by the nucleotide sequence of SEQ ID NO: 1 or 3 and a light chain expressed by the nucleotide sequence of SEQ ID NO: 2 or 4 It provides an antibody against a protein.

In the present invention, the antibody may be composed of a heavy chain expressed by the nucleotide sequence of SEQ ID NO: 1 and a light chain expressed by the nucleotide sequence of SEQ ID NO: 2, or a heavy chain and sequence expressed by the nucleotide sequence of SEQ ID NO: It may be composed of a light chain expressed by the nucleotide sequence of No. 4, but is not limited thereto.

In addition, the antibody may include a heavy chain encoded by the nucleotide sequence of SEQ ID NO: 1 and a light chain encoded by the nucleotide sequence of SEQ ID NO: 2, or a heavy chain encoded by the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4 It may include a light chain encoded by the base sequence of, but is not limited thereto.

Another object of the present invention is a heavy chain CDR1 of SEQ ID NO: 5; A heavy chain CDR2 of SEQ ID NO: 6; And a heavy chain variable region comprising the heavy chain CDR3 of SEQ ID NO: 7 and a light chain CDR1 of SEQ ID NO: 8; Light chain CDR2 of SEQ ID NO: 9; And a light chain variable region comprising the light chain CDR3 of SEQ ID NO: 10, to provide an antibody against 53-kDa protein of Porphyromonas gingivalis.

Another object of the present invention is a heavy chain CDR1 of SEQ ID NO: 11; A heavy chain CDR2 of SEQ ID NO: 12; And a heavy chain variable region comprising the heavy chain CDR3 of SEQ ID NO: 13, and a light chain CDR1 of SEQ ID NO: 14; Light chain CDR2 of SEQ ID NO: 15; And a light chain variable region comprising the light chain CDR3 of SEQ ID NO: 16, to provide an antibody against 53-kDa protein of Porphyromonas gingivalis.

As used herein, the term "CDR" refers to a complementarity-determining region, which is part of variable chains of an antibody, and mainly serves to bind to the epitope of an antigen. The CDRs of each chain of heavy or light chain are typically named CDR1, CDR2, CDR3, starting from the N-terminus sequentially.

In the present invention, the antibody against the 53-kDa protein of Porphyromonas gingivalis is a heavy chain CDR1 of SEQ ID NO: 5; A heavy chain CDR2 of SEQ ID NO: 6; And a heavy chain variable region comprising the heavy chain CDR3 of SEQ ID NO: 7 and a light chain CDR1 of SEQ ID NO: 8; Light chain CDR2 of SEQ ID NO: 9; And a light chain variable region including the light chain CDR3 of SEQ ID NO: 10, but is not limited thereto.

In addition, the antibody may comprise a heavy chain CDR1 of SEQ ID NO: 11; A heavy chain CDR2 of SEQ ID NO: 12; And a heavy chain variable region comprising the heavy chain CDR3 of SEQ ID NO: 13, and a light chain CDR1 of SEQ ID NO: 14; Light chain CDR2 of SEQ ID NO: 15; And a light chain variable region comprising the light chain CDR3 of SEQ ID NO: 16, but is not limited thereto.

Since the base sequence used in the present invention is interpreted to include a sequence showing substantial identity with the sequence described in the sequence listing, a base sequence having high homology with the base sequence represented by SEQ ID NOs: 5 to 16, for example Base sequences having high homology of at least 70%, specifically at least 80%, more specifically at least 90%, should be construed as being within the scope of the present invention.

Still another object of the present invention is to provide a pharmaceutical composition for preventing or treating periodontal disease, comprising the transformed callus, its culture, its culture, its extract, or its fraction.

Another object of the present invention to provide a pharmaceutical composition for the prevention or treatment of periodontal disease, comprising the antibody.

The 'transformation callus' and 'antibody' used in the pharmaceutical composition are the same as described above. Since the transgenic callus can produce an antibody against 53-kDa protein of Porphyromonas gingivalis, the culture of the transgenic callus, the culture of the transgenic callus, the extract of the transgenic callus or a fraction of the extract It is apparent that antibodies to 53-kDa protein exist.

As used herein, the term "periodontal disease" is also referred to as a taste, and refers to a disease that damages the periodontal ligament and adjacent tissues by bacterial infection in the gap between the gingiva (gum) and teeth, depending on the degree of the disease as gingivitis and periodontitis Are distinguished. Inflammation progresses during the development of the periodontal disease, and more tissues are damaged and a periodontal pocket is formed, and as the periodontitis is severe, the depth of the periodontal sac becomes deeper. Is known to cause bone loss. Specifically, the periodontal disease may be gingivitis or periodontitis, but is not limited thereto.

As used herein, the term "prevention" means any action that inhibits or delays periodontal disease.

As used herein, the term "treatment" refers to any action in which symptoms of periodontal disease improve or benefit.

The pharmaceutical composition of the present invention may include 0.001 to 80, specifically 0.001 to 70, more specifically 0.001 to 60% by weight based on the total weight of the composition, but is not limited thereto.

In addition, the pharmaceutical composition may further comprise a pharmaceutically acceptable carrier, excipient or diluent commonly used in the manufacture of the pharmaceutical composition, the carrier may comprise a non-naturally occuring carrier (carrier) have. The carriers, excipients and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline Cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

In addition, the pharmaceutical compositions are tablets, pills, powders, granules, capsules, suspensions, solvents, emulsions, syrups, sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, transdermals, respectively, according to a conventional method. It can be formulated in the form of absorbents, gels, lotions, ointments, creams, patches, cataplasms, pastes, sprays, skin emulsions, skin suspensions, transdermal patches, drug containing bandages or suppositories. Specifically, when formulated, it may be prepared using diluents or excipients such as fillers, weights, binders, wetting agents, disintegrating agents, surfactants, etc. which are commonly used. Solid form preparations for oral administration include, but are not limited to, tablets, pills, powders, granules, capsules, and the like. Such solid preparations may be prepared by mixing at least one excipient such as starch, calcium carbonate, sucrose, lactose, gelatin and the like. In addition to simple excipients, lubricants such as magnesium stearate, talc and the like can also be used. It may be prepared by adding various excipients such as humectants, sweeteners, fragrances, preservatives and the like in addition to liquid oral liquids or liquid paraffin for oral use. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations and suppositories. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate and the like can be used. As the base of the suppository, utopsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.

The pharmaceutical composition of the invention may be administered to a subject in a pharmaceutically effective amount.

As used herein, the term 'administration' means introducing a composition containing the antibody to a subject in an appropriate manner, and the term 'individual' means all animals including rats, mice, and livestock, including humans who may or may have periodontal disease. It means, specifically, may be a mammal including a human.

The term `` pharmaceutically effective amount '' means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and an effective dose level may include the type of subject and severity, age, sex, activity of the drug, Sensitivity to drug, time of administration, route of administration and rate of release, duration of treatment, factors including concurrent use of drugs, and other factors well known in the medical arts. Specifically, the pharmaceutical composition may be administered in a dose of 0.01 to 500 mg / kg, more specifically 10 to 100 mg / kg per day, the administration may be administered once or several times a day.

The pharmaceutical compositions may be administered as individual therapeutic agents or in combination with other therapeutic agents and may be administered sequentially or simultaneously with conventional therapeutic agents. And single or multiple administrations. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect in a minimum amount without side effects, which can be easily determined by those skilled in the art.

In addition, the method of administration and dosage of the pharmaceutical composition vary depending on the condition and weight of the patient, the extent of the disease, the form of the drug, the route of administration and the time, and may be appropriately selected by those skilled in the art.

In one specific embodiment of the present invention, the antibody against the 53-kDa protein was confirmed to bind to the 53-kDa protein of Porphyromonas gingivalis (Figs. 7 and 8).

This suggests that the pharmaceutical composition of the present invention can inhibit the strain by reacting with the 53-kDa protein of Porphyromonas gingivalis, and thus can be usefully used for the prevention or treatment of periodontal disease.

Still another object of the present invention is to provide a nutraceutical composition for the prevention or improvement of periodontal disease, comprising the transformed callus, its culture, its culture, its extract or a fraction of the extract.

Another object of the present invention to provide a health functional food composition for preventing or improving periodontal disease, comprising the antibody.

'Transformation callus', 'antibody', 'periodontal disease' and 'prevention' used in the health functional food composition is the same as described above.

As used herein, the term " improvement " means any action that at least reduces the parameters associated with the condition to be treated by administration of a composition comprising the antibody, eg, the extent of symptoms.

Since the health functional food composition of the present invention can be consumed on a daily basis, since a high effect can be expected for the prevention or improvement of periodontal disease, it can be very usefully used.

As used herein, the term "health functional food" means a food prepared and processed using raw materials or ingredients having functional properties useful for a human body according to Act No. 6767 of the Health Functional Food Act. 'Means to obtain useful effects on health use, such as nutrient regulation or physiological effects on the structure and function of the human body. On the other hand, health food refers to foods that have active health maintenance or promotion effect compared to general foods, and health supplement food means foods for the purpose of health supplement, in some cases, the term functional health food, health food, health supplement food Can be used interchangeably.

The transformed callus, the culture thereof, the culture solution thereof, the extract thereof, the fraction of the extract or the antibody of the present invention may be added as it is or used with other food or food ingredients, and may be appropriately used according to a conventional method.

The health functional food of the present invention can be prepared by a method commonly used in the art, and the preparation can be prepared by adding raw materials and ingredients commonly added in the art. Specifically, the health functional food composition may further include a physiologically acceptable carrier, the type of carrier is not particularly limited and may be used as long as it is a carrier commonly used in the art. In addition, the health functional food composition is a food such as preservatives, fungicides, antioxidants, colorants, coloring agents, bleaches, seasonings, sweeteners, flavorings, swelling agents, reinforcing agents, emulsifiers, thickeners, coatings, gum herbicides, foam inhibitors, solvents, improvers May include additives. The additive may be selected according to the type of food and used in an appropriate amount.

In addition, the formulation of the health functional food can be prepared without limitation as long as the formulation is recognized as food. The health functional food composition of the present invention can be prepared in a variety of dosage forms, unlike the general medicine because it has the advantage that there is no side effect, such as may occur when taking a long-term use of the food as a raw material and excellent portability, The food of the present invention can be taken as an adjuvant for enhancing the effect of preventing or improving periodontal disease.

The transformed callus of the present invention, its culture, its culture, its extract, its extract or the antibody can be included in various dietary supplements in a dietary supplement if it can exhibit a preventive or ameliorating effect of periodontal disease. Specifically, it may include 0.00001 to 100% by weight or 0.01 to 80% by weight relative to the total weight of the dietary supplement composition, but is not limited thereto. In the case of long-term intake for health and hygiene purposes, it may include the content below the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount above the above range.

Another object of the present invention is to provide a quasi-drug composition for the prevention or improvement of periodontal disease, including the transformed callus, its culture, its culture, its extract or a fraction of the extract.

Another object of the present invention to provide a quasi-drug composition for the prevention or improvement of periodontal disease, comprising the antibody.

'Transformation callus', 'antibody', 'periodontal disease', 'prevention' and 'improvement' used in the quasi-drug composition is the same as described above.

As used herein, the term "quasi drug" refers to a fiber, rubber product or the like used for treating, alleviating, treating or preventing a disease of a human or animal, has a weak action on the human body or does not directly act on the human body, Or non-machinery and the like, or any of the agents used for sterilization, insecticide, and similar purposes for the prevention of infection, for the purpose of diagnosing, treating, reducing, treating or preventing human or animal diseases. Among articles to be used, which are not instruments, machines or devices, and articles which are used for the purpose of pharmacologically affecting the structure and function of humans or animals, except those which are not instruments, machines or devices. Also includes supplies.

The quasi-drug composition can be added as it is or the antibody of the present invention as it is, or with other quasi-drug components, the amount of the active ingredient can be easily determined by those skilled in the art according to the purpose of use.

The quasi-drug composition is not limited thereto, but may include personal hygiene products such as gargle, toothpaste, external skin preparation, or ointment, and specifically, an ointment, a spray, a patch, a cream, a powder, a suspension or a gel. Can be manufactured and used as, but is not limited thereto.

In addition, the quasi-drug composition may be appropriately used in accordance with conventional methods for the prevention or improvement of periodontal disease.

The composition for producing an antibody against 53-kDa protein of Porphyromonas gingivalis according to the present invention and a method for producing an antibody using the same can be produced in large quantities at low cost because plants are used, and the antibody has a risk of contamination. It is low and does not induce an immune response, so it can be widely used for the treatment or improvement of periodontal disease.

Figure 1 shows the sequence of the antibody to the 53-kDa protein of Porphyromonas gingivalis produced from the hybridoma cell line MAPg9, a is the heavy chain, b is the base sequence of the gene encoding the light chain. The nucleotide sequence of the heavy chain is composed of a signal sequence (1-54), CDR1 (complementarity determining region (130-159), CDR2 (202-249), CDR3 (346-390), and the base sequence of the light chain is a signal sequence ( 1-57), CDR1 (127-174), CDR2 (220-240), and CDR3 (337-363).
Figure 2 shows the sequence of the antibody to the 53-kDa protein of Porphyromonas gingivalis produced from the hybridoma cell line MAPg10, a is the nucleotide sequence of the gene encoding the heavy chain, b is light chain. The nucleotide sequence of the heavy chain consists of a signal sequence (1-51), CDR1 (148-162), CDR2 (205-262), CDR3 (349-369), and the base sequence of the light chain is the signal sequence (1-60) , CDR1 (130-162), CDR2 (208-228), CDR3 (325-348).
Figure 3 is a schematic diagram showing the configuration of the expression vector, prepared according to an embodiment of the present invention. Genes isolated from MAPg9 and MAPg10 hybridoma cells producing antibodies against the 53-kDa protein of porphyromonas gingivalis strain A7A1-28 were used for the production of expression cassettes and expression vectors. pRAmy3D is a promoter of rice alpha-amylase isozyme 3D ( RAmy3D ) gene, MAPg9H and MAPg9L are heavy and light chain genes derived from MAPg9 cells, MAPg10H and MAPg10L, respectively, heavy and light chain genes derived from MAPg10 cells, 3'-UTR is the 3'-untranslated site, p35S is the promoter of Cauliflower mosaic virus 35S, HPT is the hygromycin phosphotransferase gene, 35S polyA is the cauliflower mosaic virus 35S Means the terminator. MAPg9H, MAPg9L, MAPg10H and MAPg10L were inserted into different vectors of pTKP7, pTKP6, pTKP5, pTKP8, respectively.
Figure 4 is a photograph showing a PCR result confirming the antibody gene for the 53-kDa protein present in the transformed rice callus prepared according to an embodiment of the present invention. a relates to MAPg9H, b to MAPg9L, c to MAPg10H and d to MAPg10L. At this time, M is a 1kb DNA ladder, PC is a expression vector containing the cloned gene inserted as a positive control, NC is a wild type rice callus used as a negative control, 1-24 are MAPg9H, MAPg9L, Rice callus is expected to be transformed with MAPg10H or MAPg10L.
5 is a photograph showing Western blot results confirming the antibody to the 53-kDa protein present in the transformed rice callus culture prepared according to an embodiment of the present invention. a and b relate to heavy chains derived from MAPg9 cells, c and d relate to light chains derived from MAPg9 cells. In addition, a and c are the results confirmed in the state which did not reduce the culture liquid, and b and d are the results confirmed in the state which reduced the culture solution. M is a protein molecular weight marker, PC is a plant antibody (# 123) against porphyromonas gingivalis fimbriae (FimaA) used as a positive control, a culture of wild type callus using NC as a negative control, and 2, 3, 4 , 12, 14, 19 and 22 represent cultures of rice callus transformed with the MAPg9H or MAPg9L gene.
Figure 6 is a photograph showing the Western blot results confirming the antibody to the 53-kDa protein present in the transformed rice callus culture prepared according to an embodiment of the present invention. a and b relate to heavy chains derived from MAPg10 cells and c and d relate to light chains derived from MAPg10 cells. In addition, a and c are the results confirmed in the state which did not reduce the culture liquid, and b and d are the results confirmed in the state which reduced the culture solution. M is a protein molecular weight marker, PC is a plant antibody (# 123) against porphyromonas gingivalis fimbriae (FimaA) used as a positive control, a culture of wild type rice callus used as a negative control, and 1, 3, 5, 7, 15, 16, and 21 represent cultures of rice callus transformed with MAPg10H or MAPg10L genes.
Figure 7 is a photograph showing the results of Western blot confirming the immune response of the antibody to the 53-kDa protein prepared according to an embodiment of the present invention. The 53-kDa recombinant protein was obtained by expression and purification in Escherichia coli, and a reacted with the culture medium containing the antibody in a state in which the 53-kDa recombinant protein was reduced and b was reduced in the 53-kDa recombinant protein. I was. M is a protein molecular weight marker, PC is a 53-kDa recombinant protein used as a positive control, NC is a culture of wild-type rice callus using a negative control, 9 is a culture of rice callus transformed with MAPg9H or MAPg9L gene, and 10 is MAPg10H or Results are shown for the culture of rice callus transformed with MAPg10L gene.
Figure 8 is a photograph showing the Western blot results confirming the immune response of the antibody to 53-kDa protein prepared according to an embodiment of the present invention. a shows a culture of rice callus transformed with MAPg9H or MAPg9L gene, and b shows a culture of rice callus transformed with MAPg10H or MAPg10L gene. Ultrasonic crushes of Porphyromonas gingivalis strain A7A1-28 in reduced or non-reduced state were reacted with a culture containing the antibody. M is the protein molecular weight marker, PC is the 53-kDa recombinant protein using the positive control, 33 is the ultrasonic pulverization of Porphyromonas gingivalis strain ATCC33277 without the 53-kDa protein used as the negative control, A7 is the porphyromonas gingiva The results for the ultrasonic milling of Lys strain A7A1-28 are shown.
9 is a photograph showing Western blot results comparing the amounts of antibodies against 53-kDa protein present in MAPg9 or MAPg10 transformed rice callus culture prepared according to one embodiment of the present invention. M is the protein molecular weight marker, PC is the plant antibody against porphyromonas gingivalis fimbriae (FimaA) as a positive control (# 123), NC is a culture of wild type rice callus with a negative control, 2, 3, 14 and 19 Are cultures of rice callus transformed with MAPg9H or MAPg9L gene, and 1, 3, and 15 show results for cultures of rice callus transformed with MAPg10H or MAPg10L gene.
Figure 10 is a graph showing the ELISA results of measuring the expression of the antibody according to the culture time of rice callus transformed with MAPg9H or MAPg9L gene prepared according to an embodiment of the present invention. The amount of antibody contained in the culture was measured, and the measurement shows mean ± SD (n = 3).

Hereinafter, the present invention will be described in detail by the following examples. However, the following examples are only for illustrating the present invention, and the scope of the present invention is not limited by the following examples.

Example 1 Expression Vector Construction of Monoclonal Antibodies to 53-kDa Protein

In order to prepare a monoclonal antibody against the 53-kDa protein of P. gingivalis ( P. gingivalis ), an expression vector containing a gene encoding the monoclonal antibody was first prepared.

Specifically, whole cells of porphyromonas gingivalis strain A7A1-28 were injected into mice, and the B hybridoma cell lines MAPg4, MAPg9 and MAPg10 expressing monoclonal antibodies against 53-kDa protein were subjected to the conventional method (Microbiol Immunol 2011). 55: 199-210).

Total RNAs were extracted from the hybridoma cell line, and single-stranded DNA was synthesized using a high-capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA). Complementary DNA for the heavy and light chain genes of the monoclonal antibody was amplified by PCR using primer sets specific for that gene. At this time, the primers used are listed in Table 1 below.

primer Sequence (5 '→ 3') division MAPg9HCFX GCTCTAGAGCCACCATGATGGTGTTAAGT SEQ ID NO: 17 MAPg9HCRBG GCAGATCTCATTTACCCGGAGA SEQ ID NO: 18 MAPg9LCFX GCTCTAGAGCCACCATGAAGTTGCCTGT SEQ ID NO: 19 MAPg9LCRB GGATCCCTAACACTCATTCCT SEQ ID NO: 20 MAPg10HCFX GCTCTAGAGCCACCATGGGATGGAGCTGT SEQ ID NO: 21 MAPg10LCFX GCTCTAGAGCCACCATGGTGTCCTCAGCTT SEQ ID NO: 22

Then, the PCR product was introduced into the pGEM ^® T-Easy vector (Promega, Madison, Wis.) In order to identify the amplified PCR products, that is, the nucleotide sequences of the heavy and light chain gene fragments of the monoclonal antibody. The sequence was confirmed using a DNA sequence analyzer (Genotech, Seoul, Korea).

As a result, as shown in Figure 1, the heavy and light chain genes of the antibody derived from the MAPg9 cells could be confirmed, the nucleotide sequence of the heavy chain is shown by SEQ ID NO: 1, the light chain nucleotide sequence is shown by SEQ ID NO: 2. In addition, as shown in Figure 2, the heavy and light chain genes of the antibody derived from MAPg10 cells could be identified, the base sequence of the heavy chain is shown in SEQ ID NO: 3, the light chain of the base sequence is shown in SEQ ID NO: 4.

At this time, the cloned sequence was compared with a sequence of a known antibody gene in order to confirm whether the previously published gene.

As a result, as the gene derived from MAPg4 confirmed that one nucleotide was deleted, MAPg9 or MAPg10 except for MAPg4 was used for the preparation of the antibody.

In addition, for the production of the monoclonal antibody, the PCR product was introduced into the pMYV657 expression vector. It was performed using restriction enzymes of XbaI and BamHI, or BglII, and the heavy and light chain genes were promoter (pRAmy3D) and 3′-untranslated sites (3 ′) of rice alpha-amylase isozyme 3D ( RAmy3D ) gene. -UTR). The expression vector was designed to include a hygromycin phosphotransferase (HPT) gene as a selection marker of plant transformation, and the gene was a promoter (p35S) and terminator of Cauliflower mosaic virus 35S. (35S polyA) was configured to be controlled.

As a result, a vector construct as shown in FIG. 3 could be produced. Recombinant plant expression vectors comprising heavy or light chain genes derived from MAPg9 or MAPg10 hybridoma cells were named pTKP7, pTKP6, pTKP5, and pTKP8, respectively.

Example  2. 53- kDa  For protein Monoclonal  Construction of Antibodies

Example  2-1. Monoclonal  Construction of Transgenic Rice Containing Antibody Genes

In order to prepare monoclonal antibodies against 53-kDa protein of Porphyromonas gingivalis, the expression vector prepared in Example 1 was transformed into rice.

Specifically, Scutellum-derived callus tissues of mature rice seeds ( Oryza sativa L. cv. Dongjin) were transformed through particle bombardment gene transfer. First, 2 mg / L of 2,4-dichlorophenoxyalic acid (2,4-D), 30 g / L was sterilized by peeling rice seed to induce callus of rice. It was incubated for 7 days in N6 medium containing sucrose and sucrose and 0.2 mg / L of kinetin. Gold particles (0.6 μm) to be used for transformation were coated with 10 μg of each recombinant plant expression vector (pTKP6 and pTKP7 corresponding to MAPg9 and pTKP5 and pTKP8 corresponding to MAPg10). Impacting callus with the gold particles followed by 2 mg / L of 2,4-D, 30 g / L of sucrose, 0.2 mg / L of kinetin and 10 g / L of glucose, including antibiotics Cultured for 3 days in dark conditions using N6 co-culture medium, which was not used, was then transferred to N6 selection medium containing hygromycin B of antibiotic 50 mg / L for selection of transformed callus.

Subsequently, in the tentatively transformed rice callus, whether the light chain and heavy chain genes of the monoclonal antibody were integrated by the expression vector was confirmed through genomic DNA PCR analysis.

Specifically, genomic DNA was purified using the DNeasy Plant Mini kit (Qiagen, Valencia, CA) in the tentative transformation and callus of wild type rice, and used as a template for genomic DNA PCR analysis. The presence of the light and heavy chain genes of the monoclonal antibody was determined using the forward and reverse primer sets listed in Table 1 above. PCR mixtures were genomic DNA 100 ng, 10 pmol primer, 200 μM dNTPs, 1 × Taq polymerase, buffer (1 mM Tris-Cl, pH 8.8, 5 mM KCl and 0.01% Triton X-100), 1.5 mM MgCl ₂ and 2 U i- Taq P polymerase (iNtRON Biotechnology, Seoul, Korea) was included and the total reaction volume was 20 μl. Amplified PCR reactions were isolated on 1% agarose gel and visualized with EtBr (Ethidium Bromide).

As a result, as shown in a and b of FIG. 4, 16 callus among the callus of the 24 MAPg9-transformed rice obtained showed a band at the expected size (1.4 kb) of the heavy chain gene of the monoclonal antibody. It was confirmed that callus of all dogs showed a band at the expected size (0.7 kb) of the light chain gene of the monoclonal antibody.

In addition, as shown in c and d of FIG. 4, among the callus of 24 MAPg10-transformed rice obtained, 9 callus showed a band at the expected size (1.4 kb) of the heavy chain gene of the monoclonal antibody, and 23 Callus was confirmed to show a band at the expected size (0.7 kb) of the light chain gene of the monoclonal antibody. On the other hand, it was confirmed that the heavy or light chain gene was not detected in callus of wild type rice.

Through the above results, it was found that the callus of the transformed rice contains a monoclonal antibody gene against 53-kDa protein of Porphyromonas gingivalis.

Example  2-2. Transformed Rice Monoclonal  Construction of Antibodies

In order to prepare a monoclonal antibody against the 53-kDa protein of Porphyromonas gingivalis, the callus of the transformed rice prepared in Example 2-1 was used.

Specifically, the callus of the transformed rice showing a positive signal in genomic DNA PCR confirmed in Example 2-1 was cultured in a shaker having a rotational speed of 110 rpm, and cultured in 28 and dark conditions. At this time, 50 ml of N6 medium containing 2 mg / L 2,4-D, 0.02 mg / L kinetin and 3% sucrose in a 300 mL flask was used as a medium. 10 ml of inoculum was transferred to fresh medium.

Then, in order to induce the expression of the monoclonal antibody gene, the cultured transgenic rice callus was cultured in fresh N6 medium without sucrose. Since the RAmy3D promoter is expressed in sugar deficient conditions, a medium without sucrose was used, and the callus volume was adjusted to 10% of the total medium volume (volume of the callus / volume of the medium). After suspension culture for 7 days, cell suspension culture containing the protein secreted from the callus was obtained.

Then, to confirm whether the culture medium of the callus contains a monoclonal antibody, Western blot analysis using a heavy chain / light chain specific antibody was performed.

Specifically, the protein obtained from the suspension culture was isolated by SDS-PAGE in a reduced or non-reduced state, and Hybond ^TM C nitrocellulose was prepared using Trans-Blot ^® SD Semi-Dry Transfer Cell (Bio-Rad, Hercules, CA). The membrane was transferred to Amersham Pharmacia Biotech, Piscataway, NJ. Protein-blotting membranes were blocked with 5% skim milk contained in TBST (TBS with 0.05% Tween-20) solution and Goth anti-mouse with alkaline phosphatase (goat anti-mouse) IgG (whole molecule, Sigma A3562, St. Louis, MO), goat anti-mouse IgG (γ-chain specific, Sigma A3438) bound with alkaline phosphatase, Rat monoclonal anti-mouse kappa light chain (Sigma K2132) was used as the primary antibody. At this time, a goat anti-rat IgG (total molecule, Sigma A8438) bound to alkaline phosphatase was used as a secondary antibody of the membrane treated with rat monoclonal anti-mouse kappa light chain (Sigma K2132). The antibody was detected using BCIP / NBT color detection solution (Sigma B6404).

As a result, as can be seen in Figure 5 a and c, it was confirmed that the band of the heavy and light chain of both MAPg9 monoclonal antibody in the non-reduced state is observed at about 160 kDa. On the other hand, as shown in b and d of Figure 5, it was confirmed that the heavy chain band of the antibody in the reduced state is about 55 kDa, light chain band is about 25 kDa. Through the above results, it was found that the heavy and light chains of the MAPg9 monoclonal antibody were secreted into the culture medium in the callus of the transformed rice, and then the two heavy and two light chains combined to form one whole antibody.

In addition, it was confirmed that the MAPg10 monoclonal antibody also exhibited the same phenomenon as the MAPg9 monoclonal antibody. As can be seen in Figure 6 a and c, it was confirmed that the band of the heavy and light chain of the MAPg10 monoclonal antibody in both non-reduced state is observed at about 160 kDa. On the other hand, as shown in b and d of FIG. 6, it was confirmed that the heavy chain band of the antibody in the reduced state is about 55 kDa, the light chain band is about 25 kDa. Through the above results, it was found that the heavy and light chains of the MAPg10 monoclonal antibody were secreted into the culture medium in the callus of the transformed rice, and then the two heavy and two light chains combined to form one whole antibody.

Example  3. Monoclonal  Biological Activity of Antibodies

Example  3-1. Recombinant 53- kDa Immune Reactivity to Proteins  Confirm

In order to confirm the biological activity of the MAPg9 and MAPg10 monoclonal antibodies prepared in Examples 1 to 2, the immunoreactivity of the monoclonal antibody against 53-kDa protein of Porphyromonas gingivalis was confirmed.

Specifically, recombinant 53-kDa protein isolated from E. coli was used, and the MAPg9 and MAPg10 monoclonal antibodies were reacted with the protein in a reduced or non-reduced state. As a positive control, the plant antibody against porphyromonas gingivalis fimbriae (FimaA) produced by the present inventors (Kim BG, et al., Plant Cell Tissue Organ Cult (2014) 118: 293-304) 123).

As a result, as shown in Figure 7a, it was confirmed that the MAPg9 and MAPg10 monoclonal antibodies react with recombinant 53-kDa protein. In this case, the size of the protein reacting with the antibody is 53 kDa, but the 3 fusion vector fusion peptide present in the pRSET / B vector (Invitrogen, Carlsbad, CA) used to express the recombinant protein is confirmed to be detected at 56 kDa It was.

In addition, as can be seen in Figure 7b, it was confirmed that MAPg9 and MAPg10 monoclonal antibodies react with the 53-kDa protein of the strain. The 53-kDa protein is a major substance constituting the fimbriae of Porphyromonas gingivalis, and in nature, several of the proteins gather to form a polymer. For the reasons described above, the proteins were combined into polymers to show various sizes, and the MAPg9 and MAPg10 monoclonal antibodies were combined with the polymers to show a characteristic ladder pattern.

Through the above results, it was found that the monoclonal antibody of the present invention can react with the 53-kDa protein of Porphyromonas gingivalis present in the form of polymer in the natural state of nature, and inhibit the strain.

Example  3-2. 53- of strains kDa Immune Reactivity to Proteins  Confirm

In order to confirm the biological activity of the MAPg9 and MAPg10 monoclonal antibodies prepared in Examples 1 to 2, the immunoreactivity of the monoclonal antibody against 53-kDa protein of Porphyromonas gingivalis was confirmed.

Specifically, 53-kDa protein present in the ultrasonic pulverization of Porphyromonas gingivalis strain A7A1-28 was used, and the MAPg9 and MAPg10 monoclonal antibodies were reacted with the protein in a reduced or non-reduced state.

As a result, as shown in Figure 8a, it was confirmed that MAPg9 and MAPg10 monoclonal antibodies react with the 53-kDa protein of the strain.

In addition, as can be seen in Figure 8b, it was confirmed that MAPg9 and MAPg10 monoclonal antibodies react with the 53-kDa protein of the strain, the natural 53-kDa protein is more of a polymer form than the recombinant 53-kDa protein It was found to be well formed and present in the form of very large polymers.

Through the above results, it was found that the monoclonal antibody of the present invention can react with the 53-kDa protein of Porphyromonas gingivalis present in the form of polymer in the natural state of nature, and inhibit the strain.

Example  4. Monoclonal  Antibody Expression amount  compare

In order to select a callus that expresses the antibody in the transformed rice callus prepared in Examples 1 to 2, the expression amount of the monoclonal antibody produced in the callus was compared.

Specifically, callus was cultured by the method according to Example 2-2, expression of antibody genes were induced, and Western blot analysis was performed to confirm the amount of antibody contained in the callus culture. Thereafter, the expression level of each antibody was measured using a concentration meter.

As a result, as shown in FIG. 9, it was confirmed that MAPg9 and MAPg10 monoclonal antibodies were observed at the size expected to be one total antibody in which two heavy chains and two light chains were combined. However, it was confirmed that MAPg9 monoclonal antibody was expressed at an average concentration of 15 μg / ml and MAPg10 monoclonal antibody was 0.9 μg / ml.

These results indicate that both MAPg9 and MAPg10 monoclonal antibodies are against the same antigen, ie, the 53-kDa protein of Porphyromonas gingivalis, but as an antibody produced by callus, the MAPg9 monoclonal antibody is more suitable than the MAPg10 monoclonal antibody. Could know. It was also found that callus from MAPg9-transformed rice was more suitable for mass production of antibodies than callus from MAPg10-transformed rice.

Example  5. Monoclonal  Antibody Expression amount  Confirm

The expression levels of monoclonal antibodies produced in the transformed rice callus produced in Examples 1 to 2 were investigated. As the expression level of MAPg9 monoclonal antibody contained in the culture was superior to MAPg10, it was analyzed for MAPg9 monoclonal antibody.

Specifically, after inducing the expression of monoclonal antibody by culturing the transformed rice callus in sugar-deficient conditions, the expression of the antibody according to the culture time was analyzed using quantitative ELISA. Trace wells were coated with goth anti-mouse IgG2a (Sigma ISO2), then wells were washed three times with TBST and blocked for 2 hours at 37 ° C. with 1% bovine serum albumin (BSA) contained in PBS. . Thereafter, samples collected from the culture medium containing the MAPg9 monoclonal antibody at two-day intervals for 4 days were placed in the wells and placed at 37 for 2 hours. To create a standard curve of MAPg9 monoclonal antibody, the amount of mouse IgG2a isoform derived from mouse myeloma (M5409 Sigma) was used as a control. Each well of the plate was washed with TBST and reacted by adding anti-mouse (H + L) conjugated with horseradish peroxidase (HRP). 100 μl of TMB substrate L (PharMingen, Fallbrook, CA) was added to each well, and after being allowed to stand at room temperature for 30 minutes, the optical density of the product was measured at 405 nm using an ELISA reader (Packard Instrument Co, Downers Grove, IL).

As a result, as shown in Figure 10, the expression level of the MAPg9 monoclonal antibody in the callus suspension of transformed rice gradually increased until the 8th day of culture, the amount was confirmed to be the maximum as 14.9 ㎍ / mL.

Through the above results, it can be seen that the monoclonal antibody against the 53-kDa protein of Porphyromonas gingivalis of the present invention can be mass-produced in a relatively short period of time.

From the above description, those skilled in the art will appreciate that the present invention can be implemented in other specific forms without changing the technical spirit or essential features. In this regard, the embodiments described above are to be understood in all respects as illustrative and not restrictive. The scope of the present invention should be construed that all changes or modifications derived from the meaning and scope of the following claims and equivalent concepts rather than the detailed description are included in the scope of the present invention.

<110> University-Industry Cooperation Group of Kyung Hee University          INDUSTRIAL COOPERATION FOUNDATION CHONBUK NATIONAL UNIVERSITY <120> A composition for producing antibody against 53-kDa protein of          Porphyromonas gingivalis and uses <130> KPA161327-KR <160> 22 <170> KoPatentIn 3.0 <210> 1 <211> 1412 <212> DNA <213> Artificial Sequence <220> <223> MAPg9 heavy chain <400> 1 atgatggtgt taagtcttct gtacctgttg acagcccttc cgggtatcct gtcagaggtg 60 cagcttcagg agtcaggacc tggcctggca aaaccttctc agactctgtc cctcacctgt 120 tctgtcactg gctactccat caccagtgat tactggaact ggatccggaa attcccaggg 180 aataaacttg agtacatggg gtacataagc tacagtggta gaacttacta caatccatct 240 ctcaaaagtc gaatctccat cactcgagac acatccaaga accagtatta cctgcagttg 300 aattctgtga ctactgagga cacagccaca tattactgtg caagatggag ttactatagt 360 tacgacgtgg gttactatgc tatggactac tggggtcaag gaacctcagt caccgtctcc 420 tcagccaaaa caacagcccc atcggtctat ccactggccc ctgtgtgtgg agatacaagt 480 ggctcctcgg tgactctagg atgcctggtc aagggttatt tccctgagcc agtgaccttg 540 acctggaact ctggatccct gtccagtggt gtgcacacct tcccagctgt cctgcagtct 600 gacctctaca ccctcagcag ctcagtgact gtaacctcga gcacctggcc cagccagtcc 660 atcacctgca atgtggccca cccggcaagc agcaccaagg tggacaagaa aattgagccc 720 agagggccca caatcaagcc ctgtcctcca tgcaaatgcc cagcacctaa cctcttgggt 780 ggaccatccg tcttcatctt ccctccaaag atcaaggatg tactcatgat ctccctgagc 840 cccatagtca catgtgtggt ggtggatgtg agcgaggatg acccagatgt ccagatcagc 900 tggtttgtga acaacgtgga agtacacaca gctcagacac aaacccatag agaggattac 960 aacagtactc tccgggtggt cagtgccctc cccatccagc accaggactg gatgagtggc 1020 aaggagttca aatgcaaggt caacaacaaa gacctcccag cgcccatcga gagaaccatc 1080 tcaaaaccca aagggtcagt aagagctcca caggtatatg tcttgcctcc accagaagaa 1140 gagatgacta agaaacaggt cactctgacc tgcatggtca cagacttcat gcctgaagac 1200 atttacgtgg agtggaccaa caacgggaaa acagagctaa actacaagaa cactgaacca 1260 gtcctggact ctgatggttc ttacttcatg tacagcaagc tgagagtgga aaagaagaac 1320 tgggtggaaa gaaatagcta ctcctgttca gtggtccacg agggtctgca caatcaccac 1380 acgactaaga gcttctcccg gtctccgggt aa 1412 <210> 2 <211> 723 <212> DNA <213> Artificial Sequence <220> <223> MAPg9 light chain <400> 2 atgaagttgc ctgttaggct gttggtgctg atgttctgga ttcctgcttc cagcagtgat 60 gttgtgatga cccaaactcc actctccctg cctgtcagtc ttggagatca agcctccatc 120 tcttgcagat ctagtcagag ccttctacac agtaatggaa acacctattt acattggtac 180 ctgcagaagc caggcctgtc tccaaagctc ctggtctaca aagtttccaa ccgattttct 240 ggggtcccag acaggttcag tggcagtgga tcagggacag atttcacact caagatcagc 300 agagtggagg ctgaggatct gggactttat ttctgctctc aaagtacaca tgttcctccc 360 acgttcggtg ctgggaccaa gctggagctg aaacgggctg atgctgcacc aactgtatcc 420 atcttcccac catccagtga gcagttaaca tctggaggtg cctcagtcgt gtgcttcttg 480 aacaacttct accccaaaga catcaatgtc aagtggaaga ttgatggcag tgaacgacaa 540 aatggcgtcc tgaacagttg gactgatcag gacagcaaag acagcaccta cagcatgagc 600 agcaccctca cgttgaccaa ggacgagtat gaacgacata acagctatac ctgtgaggcc 660 actcacaaga catcaacttc acccattgtc aagagcttca acaggaatga gtgttaggga 720 tcc 723 <210> 3 <211> 1404 <212> DNA <213> Artificial Sequence <220> <223> MAPg10 heavy chain <400> 3 atggagctgt atcatcctct tcctcctctc aggaactgca ggtgtccact ctgagttcca 60 gctgcagcag tctggacctg agctggtgaa gcctggcgct tcagtgaaga tatcctgcaa 120 ggcttctggt tactcattca ctgacttcaa catgaactgg gtgaagcaga gcaatggaaa 180 gagccttgag tggattggag taatcaatcc taactatgct actagctaca gtcagaagtt 240 caagggcaag gccacattga ctgtagacca atcttccagc acagcctaca tgcagctcaa 300 cagcctgaca tctgaggact ctgcagtcta tttctgtgca agatggttac taccctttga 360 ctactggggc caaggcacca ctctcacagt ctcctcagcc aaaacaacac ccccatcagt 420 ctatccactg gcccctgggt gtggagatac aactggttcc tccgtgactc tgggatgcct 480 ggtcaagggc tacttccctg agtcagtgac tgtgacttgg aactctggat ccctgtccag 540 cagtgtgcac accttcccag ctctcctgca gtctggactc tacactatga gcagctcagt 600 gactgtcccc tccagcacct ggccaagtca gaccgtcacc tgcagcgttg ctcacccagc 660 cagcagcacc acggtggaca aaaaacttga gcccagcggg cccatttcaa caatcaaccc 720 ctgtcctcca tgcaaggagt gtcacaaatg cccagctcct aacctcgagg gtggaccatc 780 cgtcttcatc ttccctccaa atatcaagga tgtactcatg atctccctga cacccaaggt 840 cacgtgtgtg gtggtggatg tgagcgagga tgacccagac gtccagatca gctggtttgt 900 gaacaacgtg gaagtacaca cagctcagac acaaacccat agagaggatt acaacagtac 960 tatccgggtg gtcagcaccc tccccatcca gcaccaggac tggatgagtg gcaaggagtt 1020 caaatgcaag gtcgacaaca aagacctccc atcacccatc gagagaacca tctcaaaaat 1080 taaagggcta gtcagagctc cacaagtata catcttgccg ccaccagcag agcagttgtc 1140 caggaaagat gtcagtctca cttgcctggt cgtgggcttc aaccctggag acatcagtgt 1200 ggagtggacc agcaatgggc atacagtgga gaactacaag gacaccgcac cagtcctgga 1260 ctctgacggt tcttacttca tatatagcaa gctcaatatg aaaacaagca agtgggagaa 1320 aacagattcc ttctcatgca acgtgagaca cgagggtctg aaaaattact acctgaagaa 1380 gaccatctcc cggtctccgg gtaa 1404 <210> 4 <211> 701 <212> DNA <213> Artificial Sequence <220> <223> MAPg10 light chain <400> 4 atggtgtcct cagctcagtt ccttgggctc ttgttgttct ggcttcatgg tgctcagtgt 60 gacatccaga tgacacagtc tccatcctca ctgtctgcat ctctgggagg caaagtcacc 120 atcacttgca aggcaagcca agacattaac aagtatatag cttggtacca acacaagcct 180 ggaaaaggtc ctaggctgct catacattac acatctacgt tacagccagg catcccttca 240 aggttcagtg gaagtgggtc tgggagagat tattccttca gcatcagcaa cctggagcct 300 gaagatattg caacttatta ttgtctacag tatgataatc tgtacacgtt cggagggggg 360 accaagctgg agataaaacg ggctgatgct gcaccaactg tatccatctt cccaccatcc 420 agtgagcagt taacgtctgg aggtgcctca gtcgtgtgct tcttgaacaa cttctacccc 480 aaagacatca atgtcaagtg gaagattgat ggcagtgaac gacaaaatgg cgtcctgaac 540 agttggactg atcaggacag caaagacagc acctacagca tgagcagcac cctcacgttg 600 accaaggacg agtatgaacg acataacagc tatacctgtg aggccactca caagacatca 660 acttcaccca ttgtcaagag cttcaacagg aatgagtgtt a 701 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> CDR1 of MAPg9 heavy chain <400> 5 ggctactcca tcaccagtga ttactggaac 30 <210> 6 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> CDR2 of MAPg9 heavy chain <400> 6 tacataagct acagtggtag aacttactac aatccatctc tcaaaagt 48 <210> 7 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> CDR3 of MAPg9 heavy chain <400> 7 tggagttact atagttacga cgtgggttac tatgctatgg actac 45 <210> 8 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> CDR1 of MAPg9 light chain <400> 8 agatctagtc agagccttct acacagtaat ggaaacacct atttacat 48 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CDR2 of MAPg9 light chain <400> 9 aaagtttcca accgattttc t 21 <210> 10 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> CDR3 of MAPg9 light chain <400> 10 tctcaaagta cacatgttcc tcccacg 27 <210> 11 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> CDR1 of MAPg10 heavy chain <400> 11 caacatgaac tgggt 15 <210> 12 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> CDR2 of MAPg10 heavy chain <400> 12 caatcctaac tatgctacta gctacagtca gaagttca 38 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CDR3 of MAPg10 heavy chain <400> 13 actacccttt gactactggg g 21 <210> 14 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> CDR1 of MAPg10 light chain <400> 14 aaggcaagcc aagacattaa caagtatata gct 33 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CDR2 of MAPg10 light chain <400> 15 tacacatcta cgttacagcc a 21 <210> 16 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CDR3 of MAPg10 light chain <400> 16 ctacagtatg ataatctgta cacg 24 <210> 17 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> MAPg9HCFX primer <400> 17 gctctagagc caccatgatg gtgttaagt 29 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MAPg9HCRBG primer <400> 18 gcagatctca tttacccgga ga 22 <210> 19 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> MAPg9LCFX primer <400> 19 gctctagagc caccatgaag ttgcctgt 28 <210> 20 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MAPg9LCRB primer <400> 20 ggatccctaa cactcattcc t 21 <210> 21 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> MAPg10HCFX primer <400> 21 gctctagagc caccatggga tggagctgt 29 <210> 22 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> MAPg10LCFX primer <400> 22 gctctagagc caccatggtg tcctcagctt 30

Claims (14)

(a) a promoter; SEQ ID NO: 5 encoding heavy chain CDR1; SEQ ID NO: 6 encoding heavy chain CDR2; And a heavy chain variable region comprising SEQ ID NO: 7 encoding heavy chain CDR3; And
(b) a promoter; SEQ ID NO: 8 encoding light chain CDR1; SEQ ID NO: 9 encoding light chain CDR2; And a light chain variable region comprising SEQ ID NO: 10 encoding light chain CDR3. Composition for antibody production of 53-kDa protein of Porphyromonas gingivalis . The composition of claim 1, wherein the heavy chain variable region and the light chain variable region promoter are RAmy3D promoters derived from rice ( Oryza sativa ). The composition of claim 1, wherein the heavy chain gene of the antibody is SEQ ID NO: 1, and the light chain gene is SEQ ID NO: 2. delete delete An antibody production kit comprising the composition of any one of claims 1 to 3. An antibody against the 53-kDa protein of Porphyromonas gingivalis , consisting of a heavy chain expressed by the nucleotide sequence of SEQ ID NO: 1 and a light chain expressed by the nucleotide sequence of SEQ ID NO: 2. 6. SEQ ID NO: 5 encoding heavy chain CDR1; SEQ ID NO: 6 encoding heavy chain CDR2; And a heavy chain variable region comprising SEQ ID NO: 7 encoding heavy chain CDR3, and SEQ ID NO: 8 encoding light chain CDR1; SEQ ID NO: 9 encoding light chain CDR2; And a light chain variable region comprising SEQ ID NO: 10 encoding light chain CDR3. An antibody against a 53-kDa protein of Porphyromonas gingivalis . delete (a) introducing the composition of any one of claims 1 to 3 into a callus of a plant to obtain a transformed callus; And
(b) a method for producing an antibody against 53-kDa protein of Porphyromonas gingivalis , comprising culturing the obtained transformed callus. The method of claim 10, wherein the plant is rice ( Oryza sativa ). (a) the antibody of claim 7 or 8; Or (b) a transgenic callus comprising the antibody, a culture thereof, a culture solution thereof, an extract thereof or a fraction of the extract, wherein the periodontal disease prevention or treatment pharmaceutical composition. (a) the antibody of claim 7 or 8; Or (b) a transformed callus containing the antibody, a culture thereof, a culture solution thereof, an extract thereof, or a fraction of the extract, wherein the health functional food composition for preventing or improving periodontal disease. (a) the antibody of claim 7 or 8; Or (b) a transgenic callus containing the antibody, a culture thereof, a culture solution thereof, an extract thereof, or a fraction of the extract, wherein the quasi-drug composition for preventing or improving periodontal disease is included.

Images