KR101960382B1 - Variant Microorganism Producing Butanol in Aerobic Condition and Method for Preparing Butanol Using the Same - Google Patents

Abstract

The present invention provides a mutant microorganism having an ability to produce butanol from glucose under anaerobic conditions, wherein a gene encoding an alcohol dehydrogenase and a gene encoding a propionaldehyde dehydrogenase are substituted with an aerobic microorganism-derived gene, and a citrate synthase gene The present invention relates to a mutant microorganism whose expression is down-regulated and a method for producing butanol using the same. According to the invention, it is possible to produce butanol with high yield through aerobic fermentation using a low-cost culture medium, And the diversity of the butanol manufacturing process can be achieved without being dependent on the conventional anaerobic conditions.

Description

TECHNICAL FIELD The present invention relates to a mutant microorganism that produces butanol in an aerobic condition and a method for producing butanol using the same,

The present invention relates to a mutant microorganism having an ability to produce butanol in an aerobic condition, and more particularly to a mutant microorganism having an ability to produce butanol from glucose under anaerobic conditions and a gene encoding an alcohol dehydrogenase and a propionaldehyde dehydrogenase Wherein the gene is replaced by a gene derived from an aerobic microorganism, and the expression of the citrate synthase gene is down-regulated, and a method for producing butanol using the mutant microorganism.

n-Butanol is an alcohol with an energy density similar to that of gasoline and can be used as a biofuel by mixing with gasoline. It is well known that n-butanol is produced naturally by Clostridium species through acetone-butanol-ethanol fermentation, and many studies have been conducted. However, Clostridium species has a limited metabolic engineering approach and can be cultured only in anaerobic conditions. Thus, studies have been conducted on the production of n-butanol in microorganisms of various species including E. coli . For example, in order to produce n-butanol from E. coli , Coenzyme A-based metabolism circuits, reverse beta oxidative metabolism circuits and ACS-based metabolism circuits have been developed ( Lan, EI, and Liao, JC , Bioresour.Technol . 135: 339, 2013).

It has been reported that the by-product metabolism circuit of acetic acid, lactic acid, ethanol, succinic acid and the like has been removed from E. coli to produce more than 30 g / L of butanol. Also, controlling the degree of redox in the cells has been shown to be beneficial for the production of butanol (Lim, JH et al., Metab. Eng. 20:56, 2013, Sani, M. et al., Biotechnol. Biofuels 9:69, 2016).

 The use of plasmids to increase the expression of specific genes has been used as a metabolic engineering tool. However, the plasmid-based gene overexpression method is difficult to be industrially used due to the accompanying cost and instability problem. Therefore, there is a need for a technique for directly editing the genome of a microorganism other than a plasmid. Traditionally, knock-in methods have been used to insert target genes into microbial genomes or knock out methods to eliminate unnecessary genes. Recent development of gene manipulation tools has made it possible to efficiently control the expression of various genes, and the technology to predict and implement the degree of gene expression has been attracting attention. In this way, gene expression can be controlled to an appropriate level, not on-off, so that it can be effectively used for metabolic optimization. Studies have been made on the use of small RNA and Hfq proteins in Escherichia coli to regulate gene expression levels or to knock down genes using dCas9. The gene knockdown method using small RNA or dCas9 is disadvantageous to cell growth because of the necessity of expression of additional proteins such as hfq and dCas9 and is not accurate enough to target various sites in the cell to unexpected problems . Therefore, it is advantageous to control the expression of various genes without expressing the external protein by arbitrarily manipulating and replacing the genetic base sequence near the 5 'UTR. The method of manipulating the vicinity of the 5` UTR can be implemented by the GNOME editing method using CRISPR / Cas9.

The CRISPR / Cas system is an immune mechanism for bacteria or archaea to defend themselves from the attack of viruses or conjugated plasmids that are transmitted from other microorganisms. The foreign gene introduced into the cell is cleaved to about 30 bp by the endonuclease Cas protein, which is stored as a sequence in the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR), which is a region where several short nucleotide sequences are repeated in the bacterial genome . The DNA inserted into the CRISPR is called spacer, and plays a role in recognizing the DNA or RNA having the same nucleotide sequence when it invades again. The DNA sequence corresponding to CRISPR is first expressed as a precursor-crRNA (pre-crRNA) through a transcription mechanism, which is then transformed into a mature-crRNA (crRNA) by cas nuclease, . The CRISPR / Cas9 system has the advantage of allowing the experimenter to target the desired gene sequence with genetic editing scissors (Bikard, D et al. , Nucleic Acids Res. 41, 7429, 2013; Cleto, S et al . ACS Synth. Biol ., 5, 375, 2016).

By using the above system, it is possible to edit the nucleotide by making double strand break in the desired nucleotide sequence and utilizing the DNA repair mechanism of the cell. The cells can recover the damaged DNA without the template strand by utilizing the mechanism of the asymmetric terminal junction, resulting in insertion or deletion of the nucleotide sequence. In addition, homologous recombination allows repair of damaged DNA, and in the process, DNA sequences such as template DNA are inserted into the damaged region. In this way, it is possible not only to edit a rather long genetic sequence such as stigmatization, dropout, substitution, etc. of DNA using the CRISPR / Cas9 and the DNA repair mechanism of the cell, but also to short gene sequence such as ount mutation It is editable.

On the other hand, the butanol - producing strains studied so far have been produced under anaerobic conditions through the Coenzyme A metabolic pathway. Through the anaerobic fermentation of microorganisms, a high level of NADH in the cell can be expected, which is advantageous in meeting a large amount of NADH required for metabolic circuits. In addition, the enzymes used in metabolic circuits (alcohol dehydrogenase from Clostridium) are oxygen sensitive, so anaerobic fermentation has progressed. However, since anaerobic fermentation does not activate TCA and oxidative phosphorylation, low energy level in the cell may be a problem and it may inhibit microbial growth when expressing various proteins involved in metabolic circuits. For this reason, most of the butanol-producing strains have been carried out under high nutrient medium conditions including protein extracts such as yeast extract and tryptone. As described above, the biobutanol production process using the complex medium not only increases the cost of the culture medium used as a raw material, but also serves as an economically disadvantageous factor in the step of purifying impurities after cultivation.

Accordingly, the present inventors have made intensive efforts to develop a method for producing butanol in a low-cost medium through aerobic fermentation. As a result, it has been found that a mutant microorganism having an ability to produce butanol from glucose under anaerobic conditions, It was confirmed that when the gene coding for hydrogenase is replaced with an aerobic microorganism-derived gene and the expression of the citrate synthase gene is down-regulated, butanol can be produced in a high yield even under exhalation conditions, thereby completing the present invention .

It is an object of the present invention to provide a mutant microorganism having an ability to produce butanol under exhalation conditions.

Another object of the present invention is to provide a process for producing butanol using the mutant microorganism.

In order to achieve the above object, the present invention provides a mutant microorganism having a butanol-producing ability in an aerobic condition in which the following gene is introduced in a microorganism having a pathway for producing acetyl-CoA from glucose:

(a) a gene encoding an aerobic strain-derived alcohol dehydrogenase;

(b) a gene encoding a propionaldehyde dehydrogenase derived from an aerobic strain;

(c) a gene encoding butyl-CoA dehydrogenase;

(d) a gene encoding crotonase;

(e) a gene encoding hydroxybutyryl-CoA dehydrogenase; And

(f) a gene encoding thiolase.

The present invention also provides a microorganism having the pathway for producing acetyl-CoA from glucose, wherein the following gene is introduced in the microorganism and the expression of the gene coding for citrate synthase is down-regulated, The branch provides mutant microorganisms:

(a) a gene encoding an aerobic strain-derived alcohol dehydrogenase;

(b) a gene encoding a propionaldehyde dehydrogenase derived from an aerobic strain;

(c) a gene encoding butyl-CoA dehydrogenase;

(d) a gene encoding crotonase;

(e) a gene encoding hydroxybutyryl-CoA dehydrogenase; And

(f) a gene encoding thiolase.

(A) culturing the mutant microorganism to produce butanol; And (b) obtaining the produced butanol.

According to the present invention, butanol can be produced at a high yield through aerobic fermentation using an inexpensive culture medium, and it is possible to obtain the effect of reducing the cost of raw materials, and the variety of butanol manufacturing process .

Figure 1 shows the butanol metabolism circuit of the EMJ40 strain.
Figure 2 shows the butanol-versus-society of the EMJ50 strain.
FIG. 3 (a) shows the results of confirming the growth and butanol productivity of EMJ40 under aerobic and anaerobic conditions, and (b) shows the results of comparing butanol production and yield of EMJ40 and EMJ50.
Figure 4 shows the 5'UTR and predicted expression levels of citrate synthase substituted with an artificial nucleotide sequence.
5a shows the results of comparing the growth curves of EMJ50 to EMJ55, b shows the results of comparing activity of citrate synthase of EMJ50 to EMJ55, and c shows the yield and yield of butanol productivity of EMJ50 to EMJ55 .

Conventionally, butanol was produced through anaerobic fermentation and cultivation was carried out using a high nutrient medium to overcome the energy shortage in anaerobic conditions. In the present invention, butanol was produced from minimal nutrient medium and the experiment was carried out under aerobic conditions to satisfy the insufficient energy through oxidative phosphorylation. In addition, CoA-dependent propionaldehyde dehydrogenase (pduP) derived from Salmonella, which is an alcohol dehydrogenase (adhE2) derived from Clostridium and whose activity is lowered under aerobic conditions among the enzymes involved in the conventional butanol metabolism circuit, And an alcoholic dihydrogenase (adhA) derived from lactococcus, thereby constructing a metabolic circuit having an activity under aerobic conditions. In addition, to overcome the problem of acetyl-CoA, which is a precursor of butanol in aerobic condition, to TCA circuit, we controlled the expression of citrate synthase (gltA), the first enzyme involved in the TCA cycle. The genomic sequence of the 5 'untranslated region (UTR) of gltA on the E. coli genome was modified by a genome editing technique utilizing the CRISPR / Cas9 system. A variety of artificial UTR sequences were synthesized to manipulate the 5'UTR region of gltA and developed a strain in which the production of the strain and the production of the target butanol were optimized.

Accordingly, in one aspect, the present invention relates to a mutant microorganism having a butanol-producing ability in an aerobic condition in which the following gene is introduced in a microorganism having a pathway for producing acetyl-CoA from glucose:

(a) a gene (adhA) encoding an aerobic strain-derived alcohol dehydrogenase;

(b) a gene (pduP) encoding a pathogenic strain-derived propionaldehyde dehydrogenase;

(c) a gene (ter) encoding a butyl-CoA dehydrogenase;

(d) a gene (crt) encoding crotonase;

(e) a gene (hbd) encoding hydroxybutyryl-CoA dehydrogenase; And

(f) a gene (atoB) that codes for thiolase.

 In the present invention, try to produce butanol under exhalation conditions to maintain a high level of energy level in the cell even under the condition of not being high nutrient medium. In the aerobic condition, oxidative phosphorylation of the NADH produced from the corresponding process and the TCA circuit is converted to ATP, which leads to formation of high ATP in the cell. However, in order to achieve this, it is necessary to solve the problem of inactivation of enzymes which may occur in the exhalation condition as mentioned above. For this purpose, an enzyme capable of replacing oxygen-sensitive alcohol dehydrogenase was introduced. In addition, since acetyl-CoA, which is a precursor of butanol, may be excessively introduced into the TCA circuit in the aerobic condition, butanol productivity may be impaired, it is essential to operate the TCA circuit in which the cell growth and the butanol productivity are both optimized. The optimal TCA circuit speed can be determined by finely adjusting the expression level of the enzyme involved in the first step of the TCA circuit using a genome editing tool.

The mutant microorganism of the present invention may be characterized in that a gene coding for an enzyme involved in biosynthesis of a by-product selected from the group consisting of succinic acid, lactate, ethanol and acetate is deleted. Preferably, the mutant microorganism is fumarate reductase , Lactate dehydrogenase, phosphate acetyltransferase and acetaldehyde / alcohol dehydrogenase are deleted from the gene encoding the enzyme.

In the present invention, the gene coding for the alcohol dehydrogenase may be characterized by being derived from Salmonella, and the gene encoding the propionaldehyde dehydrogenase may be characterized in that the gene encoding the alcohol dehydrogenase is derived from Lactococcus.

In the present invention, a gene (fdh) encoding polmate dihydrogenase may be further introduced for supplying NADH.

In one embodiment of the present invention, the EMJ40 strain is Escherichia coli having a metabolic pathway for producing butanol production from glucose. The Escherichia coli strain, EMJ40, is a mutant strain in which a production gene of succinic acid, lactic acid, ethanol, (Fig. 1). The EMJ50 strain is a strain in which the last two steps of the butanol metabolism circuit are replaced with adhA derived from salmonella, which is not clostridium-derived, but from pduP and lactococcus derived from salmonella. Since adhE2 from clostridium is an oxygen-sensitive enzyme, it was replaced with pduP and adhA for aerobic fermentation (Fig. 2).

EMJ40 was cultivated under anaerobic conditions and aerobic conditions, indicating that butanol productivity in anaerobic conditions was 3.6 times higher than in aerobic conditions. However, it was confirmed that the growth of the strain in the aerobic condition was 46 times higher than that in the anaerobic condition (Fig. 3A). When the EMJ50 strain, which introduced a metabolic pathway resistant to oxygen, was cultured under aerobic conditions, it was confirmed that 59 - fold more butanol was produced than EMJ40 cultured under aerobic conditions. It can be deduced that the metabolic circuit introduced into EMJ50 has resistance to oxygen. However, despite the increased productivity of butanol, the butanol yield in still aerobic conditions was still lower than the yield of the anaerobic cases (FIG. 3b). This suggests that acetyl-CoA, a precursor of butanol, is abundantly introduced into the TCA circuit rather than the butanol metabolism circuit, in view of biological theory that TCA circuit is activated under exhalation conditions.

 Therefore, we aimed to increase the metabolite flow to the butanol metabolism circuit by decreasing the amount of acetyl-CoA introduced into the TCA circuit by controlling the expression level of citrate synthase (gltA), the first step of the TCA circuit.

In another aspect, the present invention relates to a method for producing a microorganism having a pathway for producing acetyl-CoA from glucose, wherein the following gene is introduced and the expression of a gene encoding citrate synthase is down-regulated Lt; RTI ID = 0.0 > butanol-producing < / RTI >

(a) a gene encoding an aerobic strain-derived alcohol dehydrogenase;

(b) a gene encoding a propionaldehyde dehydrogenase derived from an aerobic strain;

(c) a gene encoding butyl-CoA dehydrogenase;

(d) a gene encoding crotonase;

(e) a gene encoding hydroxybutyryl-CoA dehydrogenase; And

(f) a gene encoding thiolase.

In the present invention, the down-regulation of the expression of the gene coding for citrate synthase may be performed by the CRISPR / Cas9 system. The 5'-UTR portion of the gene coding for citrate synthase may be substituted with an oligonucleotide represented by any one of SEQ ID NOS: 1 to 4.

 One method of regulating protein expression in bacteria is known to manipulate the 5'UTR sequence of the gene of interest. When the expression intensity of 5 'UTR of gltA was predicted by using a tool called "UTR designer", it was confirmed that the value was 273860, and artificial UTR nucleotide sequence for lower intensity expression was prepared and introduced into the strain . Through the genome editing technology utilizing the CRISPR / Cas9 system, four artificial UTR nucleotide sequences were substituted for the gltA 5 'UTR sequence of the EMJ50 strain and named EMJ51, 52, 53 and 54 according to the expression level. In addition, a glutA-deleted mutant was produced and named EMJ55 (Figure 4)

In another aspect, the present invention provides a method for producing butanol, comprising: (a) culturing the mutant microorganism to produce butanol; And (b) obtaining the produced butanol.

 In one embodiment of the present invention, when six strains of EMJ50 to EMJ55 were cultured under aerobic conditions and the growth curves, citrate synthase expression, butanol productivity and yield of the strains were measured, EMJ50 expression level of citrate synthase (Fig. 5B), 74%, 54%, 45%, 33%, and 17% of the activity of the citrate synthase was observed in the EMJ55. About EMJ50-EMJ55 growth line EMJ50-EMJ53 did not inhibit growth during cultivation, but EMJ54 showed about 33% less growth than EMJ50 and 89% reduction in EMJ55 5A). For the butanol productivity of EMJ50-55, an arcuate graph was obtained and EMJ52 showed the highest butanol productivity. As to the butanol yield, citrate synthase increased as the concentration of the citrate synthase decreased (FIG. 5c).

In the present invention, the term " vector " means a DNA product containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in an appropriate host. The vector may be a plasmid, phage particle, or simply a potential genome insert. Once transformed into the appropriate host, the vector may replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. Because the plasmid is the most commonly used form of the current vector, the terms " plasmid " and " vector " are sometimes used interchangeably in the context of the present invention. However, the present invention includes other forms of vectors having functions equivalent to those known or known in the art. Typical expression vectors for mammalian cell culture expression are based on, for example, pRK5 (EP 307,247), pSV16B (WO 91/08291) and pVL1392 (Pharmingen).

The expression " expression control sequence " means a DNA sequence that is essential for the expression of a coding sequence operably linked to a particular host organism. Such regulatory sequences include promoters for carrying out transcription, any operator sequences for regulating such transcription, sequences encoding suitable mRNA ribosome binding sites, and sequences controlling the termination of transcription and translation. For example, regulatory sequences suitable for prokaryotes include promoters, optionally operator sequences, and ribosome binding sites. Eukaryotic cells include promoters, polyadenylation signals and enhancers. The most influential factor on the expression level of the gene in the plasmid is the promoter. As the promoter for high expression, SRα promoter and cytomegalovirus-derived promoter are preferably used.

In order to express the DNA sequences of the present invention, any of a wide variety of expression control sequences may be used in the vector. Examples of useful expression control sequences include, for example, early and late promoters of SV40 or adenovirus, lac system, trp system, TAC or TRC system, T3 and T7 promoters, major operator and promoter regions of phage lambda, fd A regulatory region of a coding protein, a promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, a promoter of said phosphatase, such as Pho5, a promoter of yeast alpha-mating system and a prokaryotic or eukaryotic cell or a virus And other sequences known to modulate the expression of the gene of < RTI ID = 0.0 > SEQ ID < / RTI > The T7 RNA polymerase promoter < RTI ID = 0.0 > 10 < / RTI > Can be useful for expressing protein NSP in E. coli.

A nucleic acid is " operably linked " when placed in a functional relationship with another nucleic acid sequence. This may be the gene and regulatory sequence (s) linked in such a way that the appropriate molecule (e. G., Transcriptional activator protein) is capable of gene expression when bound to the regulatory sequence (s). For example, DNA for a pre-sequence or secretory leader is operably linked to DNA for a polypeptide when expressed as a whole protein participating in the secretion of the polypeptide; A promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; Or the ribosome binding site is operably linked to a coding sequence if it affects the transcription of the sequence; Or a ribosome binding site is operably linked to a coding sequence if positioned to facilitate translation. Generally, " operably linked " means that the linked DNA sequences are in contact and, in the case of a secretory leader, are in contact and present in the reading frame. However, the enhancer need not be in contact. The linkage of these sequences is carried out by ligation (linkage) at convenient restriction sites. If such a site does not exist, a synthetic oligonucleotide adapter or a linker according to a conventional method is used.

As used herein, the term " expression vector " is usually a recombinant carrier into which a fragment of different DNA is inserted, and generally means a fragment of double-stranded DNA. Herein, the heterologous DNA means a heterologous DNA that is not naturally found in the host cell. Once an expression vector is in a host cell, it can replicate independently of the host chromosomal DNA, and several copies of the vector and its inserted (heterologous) DNA can be generated.

As is well known in the art, to increase the level of expression of a transfected gene in a host cell, the gene must be operably linked to a transcriptional and detoxification regulatory sequence that functions in the selected expression host. Preferably the expression control sequence and the gene are contained within an expression vector containing a bacterial selection marker and a replication origin. If the expression host is a eukaryotic cell, the expression vector should further comprise a useful expression marker in the eukaryotic expression host.

A wide variety of expression host / vector combinations can be used to express the gene of the enzyme introduced in the present invention. Suitable expression vectors for eukaryotic hosts include, for example, expression control sequences derived from SV40, cow papilloma virus, anenovirus, adeno-associated virus, cytomegalovirus and retrovirus. Expression vectors that can be used for bacterial hosts include bacterial plasmids, such as those obtained from E. coli, such as pBluescript, pGEX2T, pUC vector, col E1, pCR1, pBR322, pMB9 and derivatives thereof, , Phage DNAs that can be exemplified by a wide variety of phage lambda derivatives such as lambda gt10 and lambda gt11, NM989, and other DNA phages such as M13 and filamentous single stranded DNA fragments. A useful expression vector for yeast cells is the 2 [mu] plasmid and its derivatives. The vector useful for insect cells is pVL 941.

Host cells transformed or transfected with the above expression vectors constitute another aspect of the present invention. As used herein, the term " transformation " means introducing DNA into a host and allowing the DNA to replicate as an extrachromosomal factor or by chromosomal integration. As used herein, the term " transfection " means that an expression vector, whether or not any coding sequence is actually expressed, is accepted by the host cell.

The host cell of the invention may be a prokaryotic or eukaryotic cell. In addition, a host having high efficiency of introduction of DNA and high efficiency of expression of the introduced DNA is usually used. this. Known eukaryotic and prokaryotic hosts such as E. coli, Pseudomonas, Bacillus, Streptomyces, fungi, and yeast, insect cells such as Spodoptera prougiperata (SF9), animal cells such as CHO and mouse cells, COS 1, COS 7, BSC 1, BSC 40 and BMT 10, and tissue cultured human cells are examples of host cells that can be used. When the cDNA encoding the NSP protein of the present invention is cloned, the animal cell is preferably used as a host. In the present invention, CHSE-214, FHM, RTG-2 and EPC of fish origin are exemplified, but the present invention is not limited thereto. When COS cells are used, SV40 large T antigen is expressed in COS cells. Therefore, the plasmid having the replication origin of SV40 is present as a multiple copy episome in the cells, Higher expression can be expected. The introduced DNA sequence may be obtained from the same species as the host cell, or it may be of a different species from the host cell, or it may be a hybrid DNA sequence comprising any heterologous or homologous DNA.

Of course, it should be understood that not all vectors and expression control sequences function equally well in expressing the DNA sequences of the present invention. Likewise, not all hosts function identically for the same expression system. However, those skilled in the art will be able to make appropriate selections among a variety of vectors, expression control sequences, and hosts without undue experimentation and without departing from the scope of the present invention. For example, in selecting a vector, the host should be considered because the vector must be replicated within it. The number of copies of the vector, the ability to control the number of copies, and the expression of other proteins encoded by the vector, such as antibiotic markers, must also be considered. In selecting the expression control sequence, a number of factors must be considered. For example, the relative strength of the sequence, controllability and compatibility with the DNA sequences of the present invention should be considered in relation to particularly possible secondary structures. The single cell host may be selected from a selected vector, the toxicity of the product encoded by the DNA sequence of the present invention, the secretion characteristics, the ability to fold the protein correctly, the culture and fermentation requirements, the product encoded by the DNA sequence of the invention And ease of purification. Within the scope of these variables, one skilled in the art can select various vector / expression control sequences / host combinations that can express the DNA sequences of the invention in fermentation or in large animal cultures. A binding method, a panning method, a film emulsion method, or the like can be applied as a screening method for cloning cDNA of NSP protein by expression cloning.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for illustrating the present invention and that the scope of the present invention is not construed as being limited by these embodiments.

Example 1: Production of a strain having a butanol-producing ability from glucose

Escherichia coli strain DSM101 (Baek, JM et al. (2001)) in which frd gene, ldhA gene, pta gene and adhE gene were deleted in Escherichia coli MG1655 (DE3) in order to inhibit the production of succinic acid, lactic acid ethanol and acetic acid as byproducts in producing butanol from glucose al, Biotechnol Bioeng .110:.. 2790-2794, 2013) by introducing the fdh gene for atoB gene, hbd gene crt genes, ter gene, adhE2 gene and NADH feed, was produced EMJ 40 strain.

Table 1 shows the characteristics of the strains and plasmids prepared in the present invention.

As shown in Fig. 1, the strain EMJ40 is a strain into which a biosynthetic pathway for producing butanol from glucose is introduced.

Escherichia coli-derived genes were introduced into the atoB gene, adhE2, crt and hbd were introduced into Clostridium acetobutylicum- derived gene, and ter-phosphatidylserine Treponema denticola ), and fdh1 introduced the gene derived from Candida boidinii .

The fragments obtained by amplifying the genomes of the respective strains by PCR using corresponding primers (SEQ ID NOS: 6 to 11) were introduced into pACYCDuet (Novagen, USA) pACYC-AEF was prepared and introduced.

The gene coding for the scaffold protein (GBD1SH31PDZ2) was inserted into pJD758 to enhance the efficiency of the metabolic pathway (Dueber, JE et al ., Nat. Biotechnol. 27: 753, 2009).

ter (SEQ ID NO: 44), crt (SEQ ID NO: 43) and hbd (SEQ ID NO: 42) were introduced in the form of pCDF-HCT (Baek, JM et al. , Biotechnol. Bioeng. 110: 2790-2794, 2013).

atoB-F tatagtcgacaaggagatataATGAAAAATTGTGTCATCGTC (SEQ ID NO: 6)

atoB-R tatagcggccgcTTAATTCAACCGTTCAATCA (SEQ ID NO: 7)

adhE2-F ggagatatacatatggcaATGAAAGTTACAAATCAAAAAGAAC (SEQ ID NO: 8)

adhE2-R atatctccttTTAAAATGATTTATATAGATATCCTTAAG (SEQ ID NO: 9)

fdh1-F aatcattttaaaaggagatataATGAAGATCGTTTTAGTCTTATATG (SEQ ID NO: 10)

fdh1-R cggtttctttaccagacTTATTTCTTATCGTGTTTACCG (SEQ ID NO: 11)

The EMJ50 strain is a strain in which the last two steps of the butanol metabolism circuit are replaced by adhA derived from pduP and lactococcus derived from Salmonella enterica, but not adhE2 derived from Clostridium to increase butanol production under aerobic conditions. AdhE2 from Clostridium acetobutyrylchum was replaced with pduP (SEQ ID NO: 41) and adhA (SEQ ID NO: 40) for aerobic fermentation because it is an oxygen sensitive enzyme (FIG. 2).

The pduP, adhA, atoB and fdh1 genes were amplified by PCR using the respective primers (SEQ ID NOS: 6 to 15) in the genome of each strain and introduced into pACUCDuet vector (Novagen, USA) to obtain pACYC-APAF 35). EMJ 50 was prepared by introducing pACYC-APAF, pJD758 (SEQ ID NO: 37) and pCDF-HCT (SEQ ID NO: 36) into the DSM101 strain.

pduP-F tataggatccaaggagatataATGAATACTTCTGAACTCGAAACC (SEQ ID NO: 12)

pduP-R tatagagctcTTAGCGAATAGAAAAGCCGTTG (SEQ ID NO: 13)

adhA-F tataagaaggagatatacaATGAAAGCAGCAGTAGTAAGAC (SEQ ID NO: 14)

adhA-R gatcttcattatatctccttTTATTTAGTAAAATCAATGACCATTC (SEQ ID NO: 15)

Example 2 Production of Butanol Using EMJ40 and EMJ50 Strains

 To confirm the butanol production ability of EJM 40, the cells were cultured overnight in 5 mL of M9G medium and then cultured in 50 mL of M9G medium in a 250 mL flask. The flask was incubated at 37 ° C, 250 rpm under aerobic or anaerobic conditions with 0.05 mM IPTG and 108 nM anhydrotetracycline (aTc) for 6 hours

The composition of the M9G medium is as follows:

_{12.8 g / L Na 2 HPO 4} , 3 g / L KH 2 PO 4, 0.5 g / L NaCl, 1 g / L NH4Cl, 1 mM MgSO 4, 0.1 mM CaCl 2, 10 mg / L thiamine, 25 g / L glucose, 0.5 g / L yeast extract, and 1000 X trace elements (27 g / L FeCl ₃ .6H ₂ O, 2 g / L ZnCl ₂ .4H ₂ O, 2 g / L CaCl ₂ .2H ₂ O, / L Na ₂ MoO ₄ .2H ₂ O, 1.9 g / L CuSO ₄ .5H ₂ O, and 0.5 g / LH ₃ BO ₃ )) 50 μg / mL ampicillin, 50 μg / mL chloramphenicol and 100 μg / mL spectinomycin.

As shown in FIG. 3 (a), when the EMJ40 strain was cultured under anaerobic conditions and aerobic conditions, the butanol productivity in the anaerobic condition was 3.6 times higher than in the aerobic condition.

However, it was confirmed that the growth of the strain in the aerobic condition was 46 times higher than that in the anaerobic condition.

When the EMJ50 strain which introduced the metabolic pathway resistant to oxygen was cultured under aerobic conditions, 59-fold higher amount of butanol was produced than EMJ40 cultured under aerobic conditions (FIG. 3 b).

It can be deduced that the metabolic circuit introduced into EMJ50 has resistance to oxygen. However, despite the increased productivity of butanol, the butanol yield in still aerobic conditions is still low compared to the yield of the anaerobic cases (FIG. 3b).

Example 3: Production of TCA-regulated mutants using CRISPR / Cas9 system

Based on the biological theory that the TCA circuit is activated under exhalation conditions, it can be inferred that acetyl-CoA, the precursor of butanol, is introduced into the TCA circuit more than the butanol metabolism circuit.

Therefore, the amount of acetyl-CoA introduced into the TCA circuit was reduced by controlling the expression level of citrate synthase (gltA), the first step of the TCA circuit, to increase the metabolite flow to the butanol metabolism circuit.

One method of regulating protein expression in bacteria is known to manipulate the 5'UTR sequence of the gene of interest. When the expression intensity of 5 'UTR of gltA was predicted by using a tool called "UTR designer", it was confirmed that the value was 273860, and artificial UTR nucleotide sequence for the expression of lower intensity was prepared and introduced into the strain .

The cas9, crRNA and tracrRNA sites of pCas9 plasmid (Addgene, Cambridge, MA, USA) were amplified by PCR using primers and sacB was amplified using Bacillus subtilis genomic DNA. The PCR products of cas9 and sacB were inserted into pZA31MCS (EXPRESSSYS) using Gibson assembly (New England Biolabs, USA) and named pZA-Cas9 (Table 1).

Similarly, crRNA, tracrRNA and sacB were inserted into pZS21MCS and designated pZS-CRISPR (Table 1). Both strands of gltA 5'-UTR sequence (gltA crRNA-S and gltA crRNA-A) were synthesized to insert gltA into gltA targeting-cRNA sequence (Bioneer Inc., Korea). The synthesized DNA was annealed to pZS-CRISPR After ligation and digestion with BsaI, pZS-CRISPRgltA containing crRNA targeting gltA-5'-UTR was prepared.

Rescue DNA for homologous recombination after degradation by Cas9 nuclease

Oligomer DNA with 22 overlapping sequences was synthesized and the oligomer pairs were as follows: gltA Rescue F and 0.6R, gltA Rescue F and 0.3R, gltA

Rescue F2 and 0.5R, gltA Rescue F2 and 0.4R.

The synthesized oligomer was denatured at 96 ° C, annealed slowly by cooling, and elongated using Klenow fragment (Takara Bio, Japan) to synthesize DNA.

As a host cell, the DSM01 strain was used. First, pKD46 (Red recombinase expression vector, Datsenko, KA and Wanner, BL. Proc. Natl. Acad Sci. pZA-Cas9 were sequentially introduced into DSM01. The strain was transformed with gltA Rescue DNA and pZS-CRISPRgltA together and screened in LB solid medium containing kanamycin (50 μg / mL) and chloramphenicol (50 μg / Respectively.

 The screened mutant strains containing the plasmid for CRISPR / Cas9 were plated on LB medium containing 40 g / L sucrose and incubated overnight at 37 ° C to select colonies resistant to both antibiotics . The genomic variation of the selected strains was confirmed by performing PCR using gltA-5'-F and gltA-5'-R primers (SEQ ID NOS: 32 and 32), and then PCR products were isolated from CosmoGenetech (Seoul, Korea) And confirmed by sequencing.

cas9 F aaaagtcgacATGGATAAGAAATACTCAATAGGCT (SEQ ID NO: 16)

cas9 R aaaactgcagTCAGTCACCTCCTAGCTGAC (SEQ ID NO: 17)

tracrRNA F ataaaagcttTTACGAAATCATCCTGTGGAG (SEQ ID NO: 18)

tracrRNA R taatggatccTTTTGCCTCCTAAAATAAAAAGTT (SEQ ID NO: 19)

crRNA F aattggtaccAGTATATTTTAGATGAAGATTATTTCTTA (SEQ ID NO: 20)

crRNA R attaaagcttATCACACTACTCTTCTTTTGCCTA (SEQ ID NO: 21)

gltA crRNA S aaacAGGTTGATGTGCGAAGGCAAATTTAAGTTCg (SEQ ID NO: 22)

gltA < / RTI > crRNA AaaacGAACTTAAATTTGCCTTCGCACATCAACCT (SEQ ID NO: 23)

sacB F ataagcagcatcgcctgtTACCTGCCGTTCACTATTATTTAG (SEQ ID NO: 24)

sacB R cacatagacagcctgaATCGGCATTTTCTTTTGC (SEQ ID NO: 25)

gltA Rescue Uni F

ccaaataacaaacgggtaaagccaggttgatgtgcgaaggcaaatttaagttcccgcagtcttacgctgtaggttaaaaggagcat (SEQ ID NO: 26)

gltA Rescue 0.6 R

tcaacagctgtgtccccgttgagggtgagttttgcttttgtatcagccatctctgatgctccttttaacctacagcg (SEQ ID NO: 27)

gltA Rescue 0.3 R

tcaacagctgtgtccccgttgagggtgagttttgcttttgtatcagccatcaacgatgctccttttaacctacagcg (SEQ ID NO: 28)

gltA Rescue Uni F2

ccaaataacaaacgggtaaagccaggttgatgtgcgaaggcaaatttaagttcccgcagtcttacgcggctggtgtaaaggagcat (SEQ ID NO: 29)

gltA Rescue 0.5 R

tcaacagctgtgtccccgttgagggtgagttttgcttttgtatcagccatggccgatgctcctttacaccagccgcg (SEQ ID NO: 30)

gltA Rescue 0.4 R

tcaacagctgtgtccccgttgagggtgagttttgcttttgtatcagccatctcagatgctcctttacaccagccgcg (SEQ ID NO: 31)

gltA-5'-F AAAGTTGTTACAAACATTACCAGGAA (SEQ ID NO: 32)

gltA-5'-R TTCACCATTCAGCAGGATGTA (SEQ ID NO: 33)

gltA-5'-seq TACCCAGGTTTTCCCCTCTT (SEQ ID NO: 34)

Four artificial UTR sequences (SEQ ID NOS: 1 to 4) were substituted for the gltA 5'UTR nucleotide sequence (SEQ ID NO: 5) of the EMJ50 strain through the genome editing technology utilizing the CRISPR / Cas9 system, EMJ51, EMJ52, EMJ53 and EMJ54, respectively. In addition, a glutA-deleted mutant was produced and named EMJ55 (Figure 4)

Example 4: Determination of the ability of genomic editing strain to produce butanol

Six strains of EMJ50-55 prepared in Example 3 were cultured under the same aerobic conditions as in Example 2, and the growth curves, citrate synthase expression levels, butanol productivity and yield were measured.

74%, 54%, 45%, 33% and 17% of citrate synthase activity was observed in EMJ51, EMJ52, EMJ53, EMJ54 and EMJ55, respectively, based on the amount of citrate synthase expressed in EMJ50 (FIG. As a result of confirming the growth line of EMJ50 to EMJ55, it was found that EMJ50 to EMJ53 did not inhibit growth during cultivation, but EMJ54 showed a decrease of about 33% compared to EMJ50, and EMJ55 showed a decrease of 89% (Fig. 5A). For the butanol productivity of EMJ50 to EMJ55, an arcuate graph was obtained and EMJ52 showed the highest butanol productivity. As to the butanol yield, citrate synthase increased as the concentration of the citrate synthase decreased (FIG. 5c).

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> Korea University Research & Business Foundation <120> Variant Microorganism Producing Butanol in Aerobic Condition and          Method for Preparing Butanol Using the Same &Lt; 130 > P16-B294 <160> 44 <170> Kopatentin 2.0 <210> 1 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> 5`UTR of EMJ51 <400> 1 atttaagttc cggcagtctt acgctgtagg ttaaaaggag catcagag 48 <210> 2 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> 5`UTR of EMJ52 <400> 2 atttaagttc cggcagtctt acgctgtagg ttaaaaggag catcgttg 48 <210> 3 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> 5`UTR of EMJ53 <400> 3 atttaagttc cggcagtctt acgcggctgg tgtaaaggag catctgag 48 <210> 4 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> 5`UTR of EMJ54 <400> 4 atttaagttc cggcagtctt acgcggctgg tgtaaaggag catcggcc 48 <210> 5 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> 5`UTR of EMJ50 <400> 5 atttaagttc cggcagtctt acgcaataag gcgctaagga gacctta 47 <210> 6 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 tatagtcgac aaggagatat aatgaaaaat tgtgtcatcg tc 42 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 tatagcggcc gcttaattca accgttcaat ca 32 <210> 8 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 ggagatatac atatggcaat gaaagttaca aatcaaaaag aac 43 <210> 9 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 atatctcctt ttaaaatgat tttatataga tatccttaag 40 <210> 10 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 aatcatttta aaaggagata taatgaagat cgttttagtc ttatatg 47 <210> 11 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 cggtttcttt accagactta tttcttatcg tgtttaccg 39 <210> 12 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 tataggatcc aaggagatat aatgaatact tctgaactcg aaacc 45 <210> 13 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 tatagagctc ttagcgaata gaaaagccgt tg 32 <210> 14 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 tataagaagg agatatacaa tgaaagcagc agtagtaaga c 41 <210> 15 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 gatcttcatt atatctcctt ttatttagta aaatcaatga ccattc 46 <210> 16 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 aaaagtcgac atggataaga aatactcaat aggct 35 <210> 17 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 aaaactgcag tcagtcacct cctagctgac 30 <210> 18 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 ataaaagctt ttacgaaatc atcctgtgga g 31 <210> 19 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 taatggatcc ttttgcctcc taaaataaaa agtt 34 <210> 20 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 aattggtacc agtatatttt agatgaagat tatttctta 39 <210> 21 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 attaaagctt atcacactac tcttcttttg ccta 34 <210> 22 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 aaacaggttg atgtgcgaag gcaaatttaa gttcg 35 <210> 23 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 aaaacgaact taaatttgcc ttcgcacatc aacct 35 <210> 24 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 ataagcagca tcgcctgtta cctgccgttc actattattt ag 42 <210> 25 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 cacatagaca gcctgaatcg gcattttctt ttgc 34 <210> 26 <211> 86 <212> DNA <213> Artificial Sequence <220> <223> gltA Rescue oligomer <400> 26 ccaaataaca aacgggtaaa gccaggttga tgtgcgaagg caaatttaag ttcccgcagt 60 cttacgctgt aggttaaaag gagcat 86 <210> 27 <211> 77 <212> DNA <213> Artificial Sequence <220> <223> gltA Rescue oligomer <400> 27 tcaacagctg tgtccccgtt gagggtgagt tttgcttttg tatcagccat ctctgatgct 60 ccttttaacc tacagcg 77 <210> 28 <211> 77 <212> DNA <213> Artificial Sequence <220> <223> gltA Rescue oligomer <400> 28 tcaacagctg tgtccccgtt gagggtgagt tttgcttttg tatcagccat caacgatgct 60 ccttttaacc tacagcg 77 <210> 29 <211> 86 <212> DNA <213> Artificial Sequence <220> <223> gltA Rescue oligomer <400> 29 ccaaataaca aacgggtaaa gccaggttga tgtgcgaagg caaatttaag ttcccgcagt 60 cttacgcggc tggtgtaaag gagcat 86 <210> 30 <211> 77 <212> DNA <213> Artificial Sequence <220> <223> gltA Rescue oligomer <400> 30 tcaacagctg tgtccccgtt gagggtgagt tttgcttttg tatcagccat ggccgatgct 60 cctttacacc agccgcg 77 <210> 31 <211> 77 <212> DNA <213> Artificial Sequence <220> <223> gltA Rescue oligomer <400> 31 tcaacagctg tgtccccgtt gagggtgagt tttgcttttg tatcagccat ctcagatgct 60 cctttacacc agccgcg 77 <210> 32 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 aaagttgtta caaacattac caggaa 26 <210> 33 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 33 ttcaccattc agcaggatgt a 21 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 34 tacccaggtt ttcccctctt 20 <210> 35 <211> 8677 <212> DNA <213> Artificial Sequence <220> <223> pACYC APAF <400> 35 cgccagggtg gtttttcttt tcaccagtga gacgggcaac agctgattgc ccttcaccgc 60 ctggccctga gagagttgca gcaagcggtc cacgctggtt tgccccagca ggcgaaaatc 120 ctgtttgatg gtggttaacg gcgggatata acatgagctg tcttcggtat cgtcgtatcc 180 cactaccgag atgtccgcac caacgcgcag cccggactcg gtaatggcgc gcattgcgcc 240 cagcgccatc tgatcgttgg caaccagcat cgcagtggga acgatgccct cattcagcat 300 ttgcatggtt tgttgaaaac cggacatggc actccagtcg ccttcccgtt ccgctatcgg 360 ctgaatttga ttgcgagtga gatatttatg ccagccagcc agacgcagac gcgccgagac 420 agaacttaat gggcccgcta acagcgcgat ttgctggtga cccaatgcga ccagatgctc 480 cacgcccagt cgcgtaccgt cttcatggga gaaaataata ctgttgatgg gtgtctggtc 540 agagacatca agaaataacg ccggaacatt agtgcaggca gcttccacag caatggcatc 600 ctggtcatcc agcggatagt taatgatcag cccactgacg cgttgcgcga gaagattgtg 660 caccgccgct ttacaggctt cgacgccgct tcgttctacc atcgacacca ccacgctggc 720 acccagttga tcggcgcgag atttaatcgc cgcgacaatt tgcgacggcg cgtgcagggc 780 cagactggag gtggcaacgc caatcagcaa cgactgtttg cccgccagtt gttgtgccac 840 gcggttggga atgtaattca gctccgccat cgccgcttcc actttttccc gcgttttcgc 900 agaaacgtgg ctggcctggt tcaccacgcg ggaaacggtc tgataagaga caccggcata 960 ctctgcgaca tcgtataacg ttactggttt cacattcacc accctgaatt gactctcttc 1020 cgggcgctat catgccatac cgcgaaaggt tttgcgccat tcgatggtgt ccgggatctc 1080 gacgctctcc cttatgcgac tcctgcatta ggaaattaat acgactcact ataggggaat 1140 tgtgagcgga taacaattcc cctgtagaaa taattttgtt taactttaat aaggagatat 1200 accatgggca gcagccatca ccatcatcac cacagccagg atccaaggag atataatgaa 1260 gatcgtttta gtcttatatg atgctggtaa gcacgctgct gatgaagaaa aattatatgg 1320 ttgtactgaa aataaattag gtattgctaa ttggttaaaa gatcaaggtc atgaactaat 1380 tactacttct gataaagaag gtgaaacaag tgaattggat aaacatatcc cagatgctga 1440 tattatcatc accactcctt tccatcctgc ttatatcact aaggaaagac ttgacaaggc 1500 taagaactta aaatcagtcg ttgtcgctgg tgttggttct gatcacattg atttagatta 1560 tattaatcaa acaggtaaga aaatctcagt cctggaagtt acaggttcta atgttgtctc 1620 tgttgctgaa cacgttgtca tgaccatgct tgtcttggtt agaaatttcg ttccagcaca 1680 tgaacaaatt attaaccacg attgggaggt tgctgctatc gctaaggatg cttacgatat 1740 cgaaggtaaa actatcgcta ccattggtgc tggtagaatt ggttacagag tcttggaaag 1800 attactccca tttaatccaa aagaattatt atactacgat tatcaagctt taccaaaaga 1860 agctgaagaa aaagttggtg ctagaagagt tgaaaatatt gaagaattag ttgctcaagc 1920 tgatatcgtt acagttaatg ctccattaca cgcaggtaca aaaggtttaa ttaataagga 1980 attattatct aaatttaaaa aaggtgcttg gttagtcaat accgcaagag gtgctatttg 2040 tgttgctgaa gatgttgcag cagctttaga atctggtcaa ttaagaggtt acggtggtga 2100 tgtttggttc ccacaaccag ctccaaagga tcacccatgg agagatatga gaaataaata 2160 tggtgctggt aatgccatga ctcctcacta ctctggtact actttagacg ctcaaacaag 2220 atacgctgaa ggtactaaaa atattttgga atcattcttt accggtaaat ttgattacag 2280 accacaagat attatcttat taaatggtga atacgttact aaagcttacg gtaaacacga 2340 taagaaataa gagctcggcg cgcctgcagg tcgacaagga gatataatga aaaattgtgt 2400 catcgtcagt gcggtacgta ctgctatcgg tagttttaac ggttcactcg cttccaccag 2460 cgccatcgac ctgggggcga cagtaattaa agccgccatt gaacgtgcaa aaatcgattc 2520 acaacacgtt gatgaagtga ttatgggtaa cgtgttacaa gccgggctgg ggcaaaatcc 2580 ggcgcgtcag gcactgttaa aaagcgggct ggcagaaacg gtgtgcggat tcacggtcaa 2640 taaagtatgt ggttcgggtc ttaaaagtgt ggcgcttgcc gcccaggcca ttcaggcagg 2700 tcaggcgcag agcattgtgg cggggggtat ggaaaatatg agtttagccc cctacttact 2760 cgatgcaaaa gcacgctctg gttatcgtct tggagacgga caggtttatg acgtaatcct 2820 gcgcgatggc ctgatgtgcg ccacccatgg ttatcatatg gggattaccg ccgaaaacgt 2880 ggctaaagag tacggaatta cccgtgaaat gcaggatgaa ctggcgctac attcacagcg 2940 taaagcggca gccgcaattg agtccggtgc ttttacagcc gaaatcgtcc cggtaaatgt 3000 tgtcactcga aagaaaacct tcgtcttcag tcaagacgaa ttcccgaaag cgaattcaac 3060 ggctgaagcg ttaggtgcat tgcgcccggc cttcgataaa gcaggaacag tcaccgctgg 3120 gaacgcgtct ggtattaacg acggtgctgc cgctctggtg attatggaag aatctgcggc 3180 gctggcagca ggccttaccc ccctggctcg cattaaaagt tatgccagcg gtggcgtgcc 3240 ccccgcattg atgggtatgg ggccagtacc tgccacgcaa aaagcgttac aactggcggg 3300 gctgcaactg gcggatattg atctcattga ggctaatgaa gcatttgctg cacagttcct 3360 tgccgttggg aaaaacctgg gctttgattc tgagaaagtg aatgtcaacg gcggggccat 3420 cgcgctcggg catcctatcg gtgccagtgg tgctcgtatt ctggtcacac tattacatgc 3480 catgcaggca cgcgataaaa cgctggggct ggcaacactg tgcattggcg gcggtcaggg 3540 aattgcgatg gtgattgaac ggttgaatta agcggccgca taatgcttaa gtcgaacaga 3600 aagtaatcgt attgtacacg gccgcataat cgaaattaat acgactcact ataggggaat 3660 tgtgagcgga taacaattcc ccatcttagt atattagtta agtataagaa ggagatatac 3720 aatgaaagca gcagtagtaa gacacaatcc agatggttat gcggaccttg ttgaaaagga 3780 acttcgagca atcaaaccta atgaagcttt gcttgacatg gagtattgtg gagtctgtca 3840 taccgatttg cacgttgcag caggtgatta tggcaacaaa gcagggactg ttcttggtca 3900 tgaaggaatt ggaattgtca aagaaattgg aactgatgta agctcgcttc aagttggtga 3960 tcgggtttca gtggcttggt tctttgaagg atgtggtcac tgtgaatact gtgtatctgg 4020 taatgaaact ttttgtcgag aagttaaaaa tgcaggatat tcagttgatg gcggaatggc 4080 tgaagaagca attgttgttg ccgattatgc tgtcaaagtt cctgacggac ttgacccaat 4140 tgaagctagc tcaattactt gtgctggagt aacaacttac aaagcaatca aagtatcagg 4200 agtaaaacct ggtgattggc aagtaatttt tggtgctgga ggacttggaa atttagcaat 4260 tcaatatgct aaaaatgttt ttggagcaaa agtaattgct gttgatatta atcaagataa 4320 attaaattta gctaaaaaaa ttggagctga tgtgattatc aattctggtg atgtaaatcc 4380 agttgatgaa attaaaaaaa taactggcgg cttaggagca caaagtgcaa tagtttgtgc 4440 tgttgcaagg attgcttttg aacaagcggt tgcttctttg aaacctatgg gcaaaatggt 4500 tgctgtggca cttcccaata ctgagatgac tttatcagtt ccaacagttg tttttgacgg 4560 agtggaggtt gcaggttcac ttgtcggaac aagacttgac ttggcagaag cttttcaatt 4620 tggagcagag ggtaaggtaa aaccaattgt tgcgacacgc aaactggaag aaatcaatga 4680 tattattgat gaaatgaagg caggaaaaat tgaaggccga atggtcattg attttactaa 4740 ataaaaggag atataatgaa tacttctgaa ctcgaaacat taatcagaac cattcttagc 4800 gagcagttaa ccacgccggc acaaacgccg gtccagcctc aaggcaaagg gatttttcag 4860 tccgttagcg aggccatcga tgccgcccac caagcgtttt tacgttatca gcagtgtccg 4920 ctaaaaactc gtagtgctat aataagcgcg atgagacaag agctgacgcc tctgctggcg 4980 cccctggcgg aagaaagtgc caatgaaacg gggatgggca acaaagaaga taagtttctc 5040 aaaaacaagg ctgcattgga caatacaccg ggggtagaag atctcaccac aacagctctt 5100 accggcgacg gcggtatggt tctgtttgag tactcaccgt ttggagttat aggttcggtc 5160 gcccctagca ccaaccccac tgaaactata atcaataaca gtatctctat gctagcagcg 5220 ggcaatagta tttatttttc ccctcatccg ggagctaaaa aagtttctct gaagctgatt 5280 agcttgattg aagaaatagc cttcaggtgc tgtggaatcc gcaatttagt ggtgaccgtg 5340 gcggaaccaa ccttcgaggc tacccagcag atgatggccc atccacgaat cgcagtactt 5400 gccattacag gcggcccggg cattgttgca atgggaatga aaagcggtaa gaaagtgata 5460 ggagctggtg cgggtaatcc gccatgtatc gttgacgaga cggcggacct ggtgaaagcg 5520 gcggaagaca tcatcaacgg ggcttcattc gattacaatc tgccctgcat tgccgaaaag 5580 agccttattg ttgtggagag tgtagcagaa cggctggtgc agcaaatgca aacatttggt 5640 gcactgttgt tatcacctgc agataccgat aaattacgcg ctgtctgcct gcctgaagga 5700 caggcaaata aaaaacttgt cggcaaaagt ccatcggcaa tgctggaagc cgcaggaatt 5760 gctgtccctg caaaagcgcc gcgtctttta attgctctgg ttaacgctga tgatccgtgg 5820 gtcacaagcg aacagttgat gcctatgctg ccagtggtaa aagtttcaga tttcgattcc 5880 gcactggcgc tggccttgaa ggttgaagag gggctgcatc atactgctat tatgcactcg 5940 cagaacgtgt cacgcctgaa tctcgcggca cgcactttac aaacatctat tttcgtaaaa 6000 aatggtccct catatgccgg gattggtgtt ggcggcgaag gctttaccac cttcactatt 6060 gcaacgccaa caggtgaagg gacaacatct gcgcgtactt ttgctcgttc ccggcgctgt 6120 gtactgacga atggtttttc tattcgttaa gtaccctcga gtctggtaaa gaaaccgctg 6180 ctgcgaaatt tgaacgccag cacatggact cgtctactag cgcagcttaa ttaacctagg 6240 ctgctgccac cgctgagcaa taactagcat aaccccttgg ggcctctaaa cgggtcttga 6300 ggggtttttt gctgaaacct caggcatttg agaagcacac ggtcacactg cttccggtag 6360 tcaataaacc ggtaaaccag caatagacat aagcggctat ttaacgaccc tgccctgaac 6420 cgacgaccgg gtcgaatttg ctttcgaatt tctgccattc atccgcttat tatcacttat 6480 tcaggcgtag caccaggcgt ttaagggcac caataactgc cttaaaaaaa ttacgccccg 6540 ccctgccact catcgcagta ctgttgtaat tcattaagca ttctgccgac atggaagcca 6600 tcacagacgg catgatgaac ctgaatcgcc agcggcatca gcaccttgtc gccttgcgta 6660 taatatttgc ccatagtgaa aacgggggcg aagaagttgt ccatattggc cacgtttaaa 6720 tcaaaactgg tgaaactcac ccagggattg gctgagacga aaaacatatt ctcaataaac 6780 cctttaggga aataggccag gttttcaccg taacacgcca catcttgcga atatatgtgt 6840 agaaactgcc ggaaatcgtc gtggtattca ctccagagcg atgaaaacgt ttcagtttgc 6900 tcatggaaaa cggtgtaaca agggtgaaca ctatcccata tcaccagctc accgtctttc 6960 attgccatac ggaactccgg atgagcattc atcaggcggg caagaatgtg aataaaggcc 7020 ggataaaact tgtgcttatt tttctttacg gtctttaaaa aggccgtaat atccagctga 7080 acggtctggt tataggtaca ttgagcaact gactgaaatg cctcaaaatg ttctttacga 7140 tgccattggg atatatcaac ggtggtatat ccagtgattt ttttctccat tttagcttcc 7200 ttagctcctg aaaatctcga taactcaaaa aatacgcccg gtagtgatct tatttcatta 7260 tggtgaaagt tggaacctct tacgtgccga tcaacgtctc attttcgcca aaagttggcc 7320 cagggcttcc cggtatcaac agggacacca ggatttattt attctgcgaa gtgatcttcc 7380 gtcacaggta tttattcggc gcaaagtgcg tcgggtgatg ctgccaactt actgatttag 7440 tgtatgatgg tgtttttgag gtgctccagt ggcttctgtt tctatcagct gtccctcctg 7500 ttcagctact gacggggtgg tgcgtaacgg caaaagcacc gccggacatc agcgctagcg 7560 gagtgtatac tggcttacta tgttggcact gatgagggtg tcagtgaagt gcttcatgtg 7620 gcaggagaaa aaaggctgca ccggtgcgtc agcagaatat gtgatacagg atatattccg 7680 cttcctcgct cactgactcg ctacgctcgg tcgttcgact gcggcgagcg gaaatggctt 7740 acgaacgggg cggagatttc ctggaagatg ccaggaagat acttaacagg gaagtgagag 7800 ggccgcggca aagccgtttt tccataggct ccgcccccct gacaagcatc acgaaatctg 7860 acgctcaaat cagtggtggc gaaacccgac aggactataa agataccagg cgtttcccct 7920 ggcggctccc tcgtgcgctc tcctgttcct gcctttcggt ttaccggtgt cattccgctg 7980 ttatggccgc gtttgtctca ttccacgcct gacactcagt tccgggtagg cagttcgctc 8040 caagctggac tgtatgcacg aaccccccgt tcagtccgac cgctgcgcct tatccggtaa 8100 ctatcgtctt gagtccaacc cggaaagaca tgcaaaagca ccactggcag cagccactgg 8160 taattgattt agaggagtta gtcttgaagt catgcgccgg ttaaggctaa actgaaagga 8220 caagttttgg tgactgcgct cctccaagcc agttacctcg gttcaaagag ttggtagctc 8280 agagaacctt cgaaaaaccg ccctgcaagg cggttttttc gttttcagag caagagatta 8340 cgcgcagacc aaaacgatct caagaagatc atcttattaa tcagataaaa tatttctaga 8400 tttcagtgca atttatctct tcaaatgtag cacctgaagt cagccccata cgatataagt 8460 tgtaattctc atgttagtca tgccccgcgc ccaccggaag gagctgactg ggttgaaggc 8520 tctcaagggc atcggtcgag atcccggtgc ctaatgagtg agctaactta cattaattgc 8580 gttgcgctca ctgcccgctt tccagtcggg aaacctgtcg tgccagctgc attaatgaat 8640 cggccaacgc gcggggagag gcggtttgcg tattggg 8677 <210> 36 <211> 6590 <212> DNA <213> Artificial Sequence <220> <223> pCDF HCT <400> 36 taatacgact cactataggg gaattgtgag cggataacaa ttcccctcta gaaataattt 60 tgtttaactt taagaaggag atataccatg gaactaaaca atgtcatcct tgaaaaggaa 120 ggtaaagttg ctgtagttac cattaacaga cctaaagcat taaatgcgtt aaatagtgat 180 acactaaaag aaatggatta tgttataggt gaaattgaaa atgatagcga agtacttgca 240 gtaattttaa ctggagcagg agaaaaatca tttgtagcag gagcagatat ttctgagatg 300 aaggaaatga ataccattga aggtagaaaa ttcgggatac ttggaaataa agtgtttaga 360 agattagaac ttcttgaaaa gcctgtaata gcagctgtta atggttttgc tttaggaggc 420 ggatgcgaaa tagctatgtc ttgtgatata agaatagctt caagcaacgc aagatttggt 480 caaccagaag taggtctcgg aataacacct ggttttggtg gtacacaaag actttcaaga 540 ttagttggaa tgggcatggc aaagcagctt atatttactg cacaaaatat aaaggcagat 600 gaagcattaa gaatcggact tgtaaataag gtagtagaac ctagtgaatt aatgaataca 660 gcaaaagaaa ttgcaaacaa aattgtgagc aatgctccag tagctgttaa gttaagcaaa 720 caggctatta atagaggaat gcagtgtgat attgatactg ctttagcatt tgaatcagaa 780 gcatttggag aatgcttttc aacagaggat caaaaggatg caatgacagc tttcatagag 840 aaaagaaaaa ttgaaggctt caaaaataga taggaggtaa ggatccgaat tcaaggagct 900 gtttaatgaa aaaggtatgt gttataggtg caggtactat gggttcagga attgctcagg 960 catttgcagc taaaggattt gaagtagtat taagagatat taaagatgaa tttgttgata 1020 gaggattaga ttttatcaat aaaaatcttt ctaaattagt taaaaaagga aagatagaag 1080 aagctactaa agttgaaatc ttaactagaa tttccggaac agttgacctt aatatggcag 1140 ctgattgcga tttagttata gaagcagctg ttgaaagaat ggatattaaa aagcagattt 1200 ttgctgactt agacaatata tgcaagccag aaacaattct tgcatcaaat acatcatcac 1260 tttcaataac agaagtggca tcagcaacta aaagacctga taaggttata ggtatgcatt 1320 tctttaatcc agctcctgtt atgaagcttg tagaggtaat aagaggaata gctacatcac 1380 aagaaacttt tgatgcagtt aaagagacat ctatagcaat aggaaaagat cctgtagaag 1440 tagcagaagc accaggattt gttgtaaata gaatattaat accaatgatt aatgaagcag 1500 ttggtatatt agcagaagga atagcttcag tagaagacat agataaagct atgaaacttg 1560 gagctaatca cccaatggga ccattagaat taggtgattt tataggtctt gatatatgtc 1620 ttgctataat ggatgtttta tactcagaaa ctggagattc taagtataga ccacatacat 1680 tacttaagaa gtatgtaaga gcaggatggc ttggaagaaa atcaggaaaa ggtttctacg 1740 attattcaaa ataagagctc ggcgcgcctg caggtcgaca agcttgcggc cgcataatgc 1800 ttaagtcgaa cagaaagtaa tcgtattgta cacggccgca taatcgaaat taatacgact 1860 cactataggg gaattgtgag cggataacaa ttccccatct tagtatatta gttaagtata 1920 agaaggagat atacatatga ttgtaaaacc aatggttagg aacaatattt gtctaaacgc 1980 tcatccgcaa ggatgcaaaa aaggcgttga ggatcaaata gagtacacaa aaaagagaat 2040 taccgctgag gtaaaagccg gagcaaaagc ccctaaaaac gtgctggttc tcggctgctc 2100 gaacggttac ggacttgcaa gccggataac ggcagcattc ggctatgggg ccgccactat 2160 cggcgtttcc tttgaaaaag ccggaagcga aacaaagtac ggcacacccg gctggtacaa 2220 caacctggcc tttgacgagg ctgccaaaag ggaaggcctt tattccgtaa ctatagacgg 2280 agacgccttt tccgatgaaa tcaaggcaca agtaatcgaa gaagccaaaa agaaaggaat 2340 taaattcgat cttatagttt acagcttggc aagccctgta agaaccgatc ccgacacagg 2400 cataatgcac aagtccgtct taaaaccctt cggtaaaaca tttacaggca agacagtcga 2460 tccctttacg ggagaactaa aagaaatctc cgccgaacct gcaaacgatg aagaagccgc 2520 tgcaaccgtt aaggttatgg gaggagaaga ctgggaacgc tggataaagc agctttcaaa 2580 agaaggtctt ttagaagaag gctgcattac cctagcctat tcctatatcg gccctgaggc 2640 cactcaagcc ctctaccgaa agggcaccat aggaaaggca aaagaacacc ttgaagcaac 2700 tgcccaccgc ctaaacaaag aaaacccgtc aatacgggcc ttcgtttcgg tgaacaaggg 2760 cttggtaaca agggcaagtg cggtaatccc cgtaattccc ctatacctcg cttccttgtt 2820 taaggttatg aaagaaaaag gaaaccacga gggctgtatc gagcagatta cccgccttta 2880 tgccgaaaga ctctaccgta aagacggcac catccccgtc gatgaagaaa acagaatccg 2940 tatcgacgac tgggagcttg aagaagacgt tcaaaaggcg gtttcggctt taatggaaaa 3000 agtaaccggc gaaaatgccg aaagcctaac cgaccttgca ggctaccgcc acgacttttt 3060 agcctcaaac ggctttgatg tagaaggcat caactacgaa gccgaggtag aaaggttcga 3120 caggatttaa agatctcaat tggatatcgg ccggccacgc gatcgctgac gtcggtaccc 3180 tcgagtctgg taaagaaacc gctgctgcga aatttgaacg ccagcacatg gactcgtcta 3240 ctagcgcagc ttaattaacc taggctgctg ccaccgctga gcaataacta gcataacccc 3300 ttggggcctc taaacgggtc ttgaggggtt ttttgctgaa acctcaggca tttgagaagc 3360 acacggtcac actgcttccg gtagtcaata aaccggtaaa ccagcaatag acataagcgg 3420 ctatttaacg accctgccct gaaccgacga ccgggtcatc gtggccggat cttgcggccc 3480 ctcggcttga acgaattgtt agacattatt tgccgactac cttggtgatc tcgcctttca 3540 cgtagtggac aaattcttcc aactgatctg cgcgcgaggc caagcgatct tcttcttgtc 3600 caagataagc ctgtctagct tcaagtatga cgggctgata ctgggccggc aggcgctcca 3660 ttgcccagtc ggcagcgaca tccttcggcg cgattttgcc ggttactgcg ctgtaccaaa 3720 tgcgggacaa cgtaagcact acatttcgct catcgccagc ccagtcgggc ggcgagttcc 3780 atagcgttaa ggtttcattt agcgcctcaa atagatcctg ttcaggaacc ggatcaaaga 3840 gttcctccgc cgctggacct accaaggcaa cgctatgttc tcttgctttt gtcagcaaga 3900 tagccagatc aatgtcgatc gtggctggct cgaagatacc tgcaagaatg tcattgcgct 3960 gccattctcc aaattgcagt tcgcgcttag ctggataacg ccacggaatg atgtcgtcgt 4020 gcacaacaat ggtgacttct acagcgcgga gaatctcgct ctctccaggg gaagccgaag 4080 tttccaaaag gtcgttgatc aaagctcgcc gcgttgtttc atcaagcctt acggtcaccg 4140 taaccagcaa atcaatatca ctgtgtggct tcaggccgcc atccactgcg gagccgtaca 4200 aatgtacggc cagcaacgtc ggttcgagat ggcgctcgat gacgccaact acctctgata 4260 gttgagtcga tacttcggcg atcaccgctt ccctcatact cttccttttt caatattatt 4320 gaagcattta tcagggttat tgtctcatga gcggatacat atttgaatgt atttagaaaa 4380 ataaacaaat agctagctca ctcggtcgct acgctccggg cgtgagactg cggcgggcgc 4440 tgcggacaca tacaaagtta cccacagatt ccgtggataa gcaggggact aacatgtgag 4500 gcaaaacagc agggccgcgc cggtggcgtt tttccatagg ctccgccctc ctgccagagt 4560 tcacataaac agacgctttt ccggtgcatc tgtgggagcc gtgaggctca accatgaatc 4620 tgacagtacg ggcgaaaccc gacaggactt aaagatcccc accgtttccg gcgggtcgct 4680 ccctcttgcg ctctcctgtt ccgaccctgc cgtttaccgg atacctgttc cgcctttctc 4740 ccttacggga agtgtggcgc tttctcatag ctcacacact ggtatctcgg ctcggtgtag 4800 gtcgttcgct ccaagctggg ctgtaagcaa gaactccccg ttcagcccga ctgctgcgcc 4860 ttatccggta actgttcact tgagtccaac ccggaaaagc acggtaaaac gccactggca 4920 gcagccattg gtaactggga gttcgcagag gatttgttta gctaaacacg cggttgctct 4980 tgaagtgtgc gccaaagtcc ggctacactg gaaggacaga tttggttgct gtgctctgcg 5040 aaagccagtt accacggtta agcagttccc caactgactt aaccttcgat caaaccacct 5100 ccccaggtgg ttttttcgtt tacagggcaa aagattacgc gcagaaaaaa aggatctcaa 5160 gaagatcctt tgatcttttc tactgaaccg ctctagattt cagtgcaatt tatctcttca 5220 aatgtagcac ctgaagtcag ccccatacga tataagttgt aattctcatg ttagtcatgc 5280 cccgcgccca ccggaaggag ctgactgggt tgaaggctct caagggcatc ggtcgagatc 5340 ccggtgccta atgagtgagc taacttacat taattgcgtt gcgctcactg cccgctttcc 5400 agtcgggaaa cctgtcgtgc cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg 5460 gtttgcgtat tgggcgccag ggtggttttt cttttcacca gtgagacggg caacagctga 5520 ttgcccttca ccgcctggcc ctgagagagt tgcagcaagc ggtccacgct ggtttgcccc 5580 agcaggcgaa aatcctgttt gatggtggtt aacggcggga tataacatga gctgtcttcg 5640 gtatcgtcgt atcccactac cgagatgtcc gcaccaacgc gcagcccgga ctcggtaatg 5700 gcgcgcattg cgcccagcgc catctgatcg ttggcaacca gcatcgcagt gggaacgatg 5760 ccctcattca gcatttgcat ggtttgttga aaaccggaca tggcactcca gtcgccttcc 5820 cgttccgcta tcggctgaat ttgattgcga gtgagatatt tatgccagcc agccagacgc 5880 agacgcgccg agacagaact taatgggccc gctaacagcg cgatttgctg gtgacccaat 5940 gcgaccagat gctccacgcc cagtcgcgta ccgtcttcat gggagaaaat aatactgttg 6000 atgggtgtct ggtcagagac atcaagaaat aacgccggaa cattagtgca ggcagcttcc 6060 acagcaatgg catcctggtc atccagcgga tagttaatga tcagcccact gacgcgttgc 6120 gcgagaagat tgtgcaccgc cgctttacag gcttcgacgc cgcttcgttc taccatcgac 6180 accaccacgc tggcacccag ttgatcggcg cgagatttaa tcgccgcgac aatttgcgac 6240 ggcgcgtgca gggccagact ggaggtggca acgccaatca gcaacgactg tttgcccgcc 6300 agttgttgtg ccacgcggtt gggaatgtaa ttcagctccg ccatcgccgc ttccactttt 6360 tcccgcgttt tcgcagaaac gtggctggcc tggttcacca cgcgggaaac ggtctgataa 6420 gagacaccgg catactctgc gacatcgtat aacgttactg gtttcacatt caccaccctg 6480 aattgactct cttccgggcg ctatcatgcc ataccgcgaa aggttttgcg ccattcgatg 6540 gtgtccggga tctcgacgct ctcccttatg cgactcctgc attaggaaat 6590 <210> 37 <211> 7316 <212> DNA <213> Artificial Sequence <220> <223> pJD758 <400> 37 tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accacgcttt tcaattcaat tcatcatttt ttttttattc ttttttttga tttcggtttc 240 tttgaaattt ttttgattcg gtaatctccg aacagaagga agaacgaagg aaggagcaca 300 gacttagatt ggtatatata cgcatatgta gtgttgaaga aacatgaaat tgcccagtat 360 tcttaaccca actgcacaga acaaaaacct gcaggaaacg aagataaatc atgtcgaaag 420 ctacatataa ggaacgtgct gctactcatc ctagtcctgt tgctgccaag ctatttaata 480 tcatgcacga aaagcaaaca aacttgtgtg cttcattgga tgttcgtacc accaaggaat 540 tactggagtt agttgaagca ttaggtccca aaatttgttt actaaaaaca catgtggata 600 tcttgactga tttttccatg gagggcacag ttaagccgct aaaggcatta tccgccaagt 660 acaatttttt actcttcgaa gacagaaaat ttgctgacat tggtaataca gtcaaattgc 720 agtactctgc gggtgtatac agaatagcag aatgggcaga cattacgaat gcacacggtg 780 tggtgggccc aggtattgtt agcggtttga agcaggcggc agaagaagta acaaaggaac 840 ctagaggcct tttgatgtta gcagaattgt catgcaaggg ctccctatct actggagaat 900 atactaaggg tactgttgac attgcgaaga gcgacaaaga ttttgttatc ggctttattg 960 ctcaaagaga catgggtgga agagatgaag gttacgattg gttgattatg acacccggtg 1020 tgggtttaga tgacaaggga gacgcattgg gtcaacagta tagaaccgtg gatgatgtgg 1080 tctctacagg atctgacatt attattgttg gaagaggact atttgcaaag ggaagggatg 1140 ctaaggtaga gggtgaacgt tacagaaaag caggctggga agcatatttg agaagatgcg 1200 gccagcaaaa ctaaaaaact gtattataag taaatgcatg tatactaaac tcacaaatta 1260 gagcttcaat ttaattatat cagttattac cctgcggtgt gaaataccgc acagatgcgt 1320 aaggagaaaa taccgcatca ggaaattgta aacgttaata ttttgttaaa attcgcgtta 1380 aattcggcaa aatcctctc attattttaac caataggccg aaatcggcaa aatcccttat 1440 aaatcaaaag aatagaccga gatagggttg agtgttgttc cagtttggaa caagagtcca 1500 ctattaaaga acgtggactc caacgtcaaa gggcgaaaaa ccgtctatca gggcgatggc 1560 ccactacgtg aaccatcacc ctaatcaagt tttttggggt cgaggtgccg taaagcacta 1620 aatcggaacc ctaaagggag cccccgattt agagcttgac ggggaaagcc ggcgaacgtg 1680 gcgagaaagg aagggaagaa agcgaaagga gcgggcgcta gggcgctggc aagtgtagcg 1740 gtcacgctgc gcgtaaccac cacacccgcc gcgcttaatg cgccgctaca gggcgcgtcc 1800 attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 1860 tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 1920 tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt gtaatacgac tcactatagg 1980 gcgaattgga gctccaccgc ggtggcggcc gctctagaac tagtggatcc actagttcta 2040 gagcggccga aagatgccga tttgggcgcg aatcctttat tttggcttca ccctcatact 2100 attatcaggg ccagaaaaag gaagtgtttc cctccttctt gaattgatgt taccctcata 2160 aagcacgtgg cctcttatcg agaaagaaat taccgtcgct cgtgatttgt ttgcaaaaag 2220 aacaaaactg aaaaaaccca gacacgctcg acttcctgtc ttcctattga ttgcagcttc 2280 caatttcgtc acacaacaag gtcctagcga cggctcacag gttttgtaac aagcaatcga 2340 aggttctgga atggcgggaa agggtttagt accacatgct atgatgccca ctgtgatctc 2400 cagagcaaag ttcgttcgat cgtactgtta ctctctctct ttcaaacaga attgtccgaa 2460 tcgtgtgaca acaacagcct gttctcacac actcttttct tctaaccaag ggggtggttt 2520 agtttagtag aacctcgtga aacttacatt tacatatata taaacttgca taaattggtc 2580 aatgcaagaa atacatattt ggtcttttct aattcgtagt ttttcaagtt cttagatgct 2640 ttctttttct cttttttaca gatcatcaag gaagtaatta tctacttttt acaacaaata 2700 taaaacaatg tctttatctt caaagttgtc tgtccaagat ttggacttga aggacaagcg 2760 tgtcttcatc agagttgact tcaacgtccc attggacggt aagaagatca cttctaacca 2820 aagaattgtt gctgctttgc caaccatcaa gtacgttttg gaacaccacc caagatacgt 2880 tgtcttggct tctcacttgg gtagaccaaa cggtgaaaga aacgaaaaat actctttggc 2940 tccagttgct aaggaattgc aatcattgtt gggtaaggat gtcaccttct tgaacgactg 3000 tgtcggtcca gaagttgaag ccgctgtcaa ggcttctgcc ccaggttccg ttattttgtt 3060 ggaaaacttg cgttaccaca tcgaagaaga aggttccaga aaggtcgatg gtcaaaaggt 3120 caaggcttcc aaggaagatg ttcaaaagtt cagacacgaa ttgagctctt tggctgatgt 3180 ttacatcaac gatgccttcg gtacctcgtt cgttgagcga gttctcaaaa atgaacaaat 3240 gtcgacgggc acgatgagag aaagtagttt taactctttt ttaggagatt catcgggtat 3300 ttcctttgcg aaattagtct tcacggcaac taattttcgt caagattccg gagatgacgt 3360 tctggatgaa gatattaaac aaagggaaca gaaatacaat ggatatgcag aggctgaaaa 3420 caatccagga tcccccgggg agctcatgga agacgccggt accgctcaca gagctcactc 3480 ttctatggtc ggtttcgact tgccacaacg tgctgccggt ttcttgttgg aaaaggaatt 3540 gaagtacttc ggtaaggctt tggagaaccc aaccagacca ttcttggcca tcttaggtgg 3600 tgccaaggtt gctgacaaga ttcaattgat tgacaacttg ttggacaagg tcgactctat 3660 catcattggt ggtggtatgg ctttcacctt caagaaggtt ttggaaaaca ctgaaatcgg 3720 tgactccatc ttcgacaagg ctggtgctga aatcgttcca aagttgatgg aaaaggccaa 3780 ggccaagggt gtcgaagtcg tcttgccagt cgacttcatc attgctgatg ctttctctgc 3840 tgatgccaac accaagactg tcactgacaa ggaaggtatt ccagctggct ggcaagggtt 3900 ggacaatggt ccagaatcta gaaagttgtt tgctgctact gttgcaaagg ctaagaccat 3960 tgtctggaac ggtccaccag gtgttttcga attcgaaaag ttcgctgctg gtactaaggc 4020 tttgttagac gaagttgtca agagctctgc tgctggtaac accgtcatca ttggtggtgg 4080 tgacactgcc actgtcgcta agaagtacgg tgtcactgac aagatctccc atgtctctac 4140 tggtggtggt gcttctttgg aattattgga aggtaaggaa ttgccaggtg ttgctttctt 4200 atccgaaaag aaataaattg aattgaattg aaatcgatag atcaattttt ttcttttctc 4260 tttccccatc ctttacgcta aaataatagt ttattttatt ttttgaatat tttttattta 4320 tatacgtata tatagactat tattatatctt ttaatgatta ttaagatttt tattaaaaaa 4380 aaattcgctc ctcttttaat gcctttatgc agtttttttt tcccattcga tatttctatg 4440 ttcgggttca gcgtatttta agtttaataa ctcgaaaatt ctgcgttcgt taaagcttat 4500 cgataccgtc gacctcgagg gggggcccgc agcttttgtt ccctttagtg agggttaatt 4560 ccgagcttgg cgtaatcatg gtcatagctg tttcctgtgt gaaattgtta tccgctcaca 4620 attccacaca acataggagc cggaagcata aagtgtaaag cctggggtgc ctaatgagtg 4680 aggtaactca cattaattgc gttgcgctca ctgcccgctt tccagtcggg aaacctgtcg 4740 tgccagctgc attaatgaat cggccaacgc gcggggagag gcggtttgcg tattgggcgc 4800 tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta 4860 tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa cgcaggaaag 4920 aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg 4980 tttttccata ggctcggccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg 5040 tggcgaaacc cgacaggact ataaagatac caggcgttcc cccctggaag ctccctcgtg 5100 cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga 5160 agcgtggcgc tttctcaatg ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc 5220 tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt 5280 aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact 5340 ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg 5400 cctaactacg gctacactag aaggacagta tttggtatct gcgctctgct gaagccagtt 5460 accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt 5520 ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct 5580 ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg 5640 gtcatgagat tatcaaaaag gatcttcacc tagatccttt taaattaaaa atgaagtttt 5700 aaatcaatct aaagtatata tgagtaaact tggtctgaca gttaccaatg cttaatcagt 5760 gaggcaccta tctcagcgat ctgtctattt cgttcatcca tagttgcctg actgcccgtc 5820 gtgtagataa ctacgatacg ggagggctta ccatctggcc ccagtgctgc aatgataccg 5880 cgagacccac gctcaccggc tccagattta tcagcaataa accagccagc cggaagggcc 5940 gagcgcagaa gtggtcctgc aactttatcc gcctccatcc agtctattaa ttgttgccgg 6000 gaagctagag taagtagttc gccagttaat agtttgcgca acgttgttgc cattgctaca 6060 ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat tcagctccgg ttcccaacga 6120 tcaaggcgag ttacatgatc ccccatgttg tgaaaaaaag cggttagctc cttcggtcct 6180 ccgatcgttg tcagaagtaa gttggccgca gtgttatcac tcatggttat ggcagcactg 6240 cataattctc ttactgtcat gccatccgta agatgctttt ctgtgactgg tgagtactca 6300 accaagtcat tctgagaata gtgtatgcgg cgaccgagtt gctcttgccc ggcgtcaata 6360 cgggataata ccgcgccaca tagcagaact ttaaaagtgc tcatcattgg aaaacgttct 6420 tcggggcgaa aactctcaag gatcttaccg ctgttgagat ccagttcgat gtaacccact 6480 cgtgcaccca actgatcttc agcatctttt actttcacca gcgtttctgg gtgagcaaaa 6540 acaggaaggc aaaatgccgc aaaaaaggga ataagggcga cacggaaatg ttgaatactc 6600 atactcttcc tttttcaata ttattgaagc atttatcagg gttattgtct catgagcgga 6660 tacatatttg aatgtattta gaaaaataaa caaatagggg ttccgcgcac atttccccga 6720 aaagtgccac ctgggtcctt ttcatcacgt gctataaaaa taattataat ttaaattttt 6780 taatataaat atataaatta aaaatagaaa gtaaaaaaag aaattaaaga aaaaatagtt 6840 tttgttttcc gaagatgtaa aagactctag ggggatcgcc aacaaatact accttttatc 6900 ttgctcttcc tgctctcagg tattaatgcc gaattgtttc atcttgtctg tgtagaagac 6960 cacacacgaa aatcctgtga ttttacattt tacttatcgt taatcgaatg tatatctatt 7020 taatctgctt ttcttgtcta ataaatatat atgtaaagta cgctttttgt tgaaattttt 7080 taaacctttg tttatttttt tttcttcatt ccgtaactct tctaccttct ttatttactt 7140 tctaaaatcc aaatacaaaa cataaaaata aataaacaca gagtaaattc ccaaattatt 7200 ccatcattaa aagatacgag gcgcgtgtaa gttacaggca agcgatccgt cctaagaaac 7260 cattattatc atgacattaa cctataaaaa taggcgtatc acgaggccct ttcgtc 7316 <210> 38 <211> 1095 <212> DNA <213> Artificial Sequence <220> <223> Fdh1 from C. boidinii <400> 38 atgaagatcg ttttagtctt atatgatgct ggtaagcacg ctgctgatga agaaaaatta 60 tatggttgta ctgaaaataa attaggtatt gctaattggt taaaagatca aggtcatgaa 120 ctaattacta cttctgataa agaaggtgaa acaagtgaat tggataaaca tatcccagat 180 gctgatatta tcatcaccac tcctttccat cctgcttata tcactaagga aagacttgac 240 aaggctaaga acttaaaatc agtcgttgtc gctggtgttg gttctgatca cattgattta 300 gattatatta atcaaacagg taagaaaatc tcagtcctgg aagttacagg ttctaatgtt 360 gtctctgttg ctgaacacgt tgtcatgacc atgcttgtct tggttagaaa tttcgttcca 420 gcacatgaac aaattattaa ccacgattgg gaggttgctg ctatcgctaa ggatgcttac 480 gatatcgaag gtaaaactat cgctaccatt ggtgctggta gaattggtta cagagtcttg 540 gaaagattac tcccatttaa tccaaaagaa ttattatact acgattatca agctttacca 600 aaagaagctg aagaaaaagt tggtgctaga agagttgaaa atattgaaga attagttgct 660 caagctgata tcgttacagt taatgctcca ttacacgcag gtacaaaagg tttaattaat 720 aaggaattat tatctaaatt taaaaaaggt gcttggttag tcaataccgc aagaggtgct 780 atttgtgttg ctgaagatgt tgcagcagct ttagaatctg gtcaattaag aggttacggt 840 ggtgatgttt ggttcccaca accagctcca aaggatcacc catggagaga tatgagaaat 900 aaatatggtg ctggtaatgc catgactcct cactactctg gtactacttt agacgctcaa 960 acaagatacg ctgaaggtac taaaaatatt ttggaatcat tctttaccgg taaatttgat 1020 tacagaccac aagatattat cttattaaat ggtgaatacg ttactaaagc ttacggtaaa 1080 cacgataaga aataa 1095 <210> 39 <211> 1185 <212> DNA <213> Artificial Sequence <220> <223> atoB from E. coli <400> 39 atgaaaaatt gtgtcatcgt cagtgcggta cgtactgcta tcggtagttt taacggttca 60 ctcgcttcca ccagcgccat cgacctgggg gcgacagtaa ttaaagccgc cattgaacgt 120 gcaaaaatcg attcacaaca cgttgatgaa gtgattatgg gtaacgtgtt acaagccggg 180 ctggggcaaa atccggcgcg tcaggcactg ttaaaaagcg ggctggcaga aacggtgtgc 240 ggattcacgg tcaataaagt atgtggttcg ggtcttaaaa gtgtggcgct tgccgcccag 300 gccattcagg caggtcaggc gcagagcatt gtggcggggg gtatggaaaa tatgagttta 360 gccccctact tactcgatgc aaaagcacgc tctggttatc gtcttggaga cggacaggtt 420 tatgacgtaa tcctgcgcga tggcctgatg tgcgccaccc atggttatca tatggggatt 480 accgccgaaa acgtggctaa agagtacgga attacccgtg aaatgcagga tgaactggcg 540 ctacattcac agcgtaaagc ggcagccgca attgagtccg gtgcttttac agccgaaatc 600 gtcccggtaa atgttgtcac tcgaaagaaa accttcgtct tcagtcaaga cgaattcccg 660 aaagcgaatt caacggctga agcgttaggt gcattgcgcc cggccttcga taaagcagga 720 acagtcaccg ctgggaacgc gtctggtatt aacgacggtg ctgccgctct ggtgattatg 780 gaagaatctg cggcgctggc agcaggcctt acccccctgg ctcgcattaa aagttatgcc 840 agcggtggcg tgccccccgc attgatgggt atggggccag tacctgccac gcaaaaagcg 900 ttacaactgg cggggctgca actggcggat attgatctca ttgaggctaa tgaagcattt 960 gctgcacagt tccttgccgt tgggaaaaac ctgggctttg attctgagaa agtgaatgtc 1020 aacggcgggg ccatcgcgct cgggcatcct atcggtgcca gtggtgctcg tattctggtc 1080 acactattac atgccatgca ggcacgcgat aaaacgctgg ggctggcaac actgtgcatt 1140 ggcggcggtc agggaattgc gatggtgatt gaacggttga attaa 1185 <210> 40 <211> 1023 <212> DNA <213> Artificial Sequence <220> <223> adhA from L. lactis <400> 40 atgaaagcag cagtagtaag acacaatcca gatggttatg cggaccttgt tgaaaaggaa 60 cttcgagcaa tcaaacctaa tgaagctttg cttgacatgg agtattgtgg agtctgtcat 120 accgatttgc acgttgcagc aggtgattat ggcaacaaag cagggactgt tcttggtcat 180 gaaggaattg gaattgtcaa agaaattgga actgatgtaa gctcgcttca agttggtgat 240 cgggtttcag tggcttggtt ctttgaagga tgtggtcact gtgaatactg tgtatctggt 300 aatgaaactt tttgtcgaga agttaaaaat gcaggatatt cagttgatgg cggaatggct 360 gaagaagcaa ttgttgttgc cgattatgct gtcaaagttc ctgacggact tgacccaatt 420 gaagctagct caattacttg tgctggagta acaacttaca aagcaatcaa agtatcagga 480 gtaaaacctg gtgattggca agtaattttt ggtgctggag gacttggaaa tttagcaatt 540 caatatgcta aaaatgtttt tggagcaaaa gtaattgctg ttgatattaa tcaagataaa 600 ttaaatttag ctaaaaaaat tggagctgat gtgattatca attctggtga tgtaaatcca 660 gttgatgaaa ttaaaaaaat aactggcggc ttaggagcac aaagtgcaat agtttgtgct 720 gttgcaagga ttgcttttga acaagcggtt gcttctttga aacctatggg caaaatggtt 780 gctgtggcac ttcccaatac tgagatgact ttatcagttc caacagttgt ttttgacgga 840 gtggaggttg caggttcact tgtcggaaca agacttgact tggcagaagc ttttcaattt 900 ggagcagagg gtaaggtaaa accaattgtt gcgacacgca aactggaaga aatcaatgat 960 attattgatg aaatgaaggc aggaaaaatt gaaggccgaa tggtcattga ttttactaaa 1020 taa 1023 <210> 41 <211> 1395 <212> DNA <213> Artificial Sequence <220> <223> pduP from S. enterica <400> 41 atgaatactt ctgaactcga aacattaatc agaaccattc ttagcgagca gttaaccacg 60 ccggcacaaa cgccggtcca gcctcaaggc aaagggattt ttcagtccgt tagcgaggcc 120 atcgatgccg cccaccaagc gtttttacgt tatcagcagt gtccgctaaa aactcgtagt 180 gctataataa gcgcgatgag acaagagctg acgcctctgc tggcgcccct ggcggaagaa 240 agtgccaatg aaacggggat gggcaacaaa gaagataagt ttctcaaaaa caaggctgca 300 ttggacaata caccgggggt agaagatctc accacaacag ctcttaccgg cgacggcggt 360 atggttctgt ttgagtactc accgtttgga gttataggtt cggtcgcccc tagcaccaac 420 cccactgaaa ctataatcaa taacagtatc tctatgctag cagcgggcaa tagtatttat 480 ttttcccctc atccgggagc taaaaaagtt tctctgaagc tgattagctt gattgaagaa 540 atagccttca ggtgctgtgg aatccgcaat ttagtggtga ccgtggcgga accaaccttc 600 gaggctaccc agcagatgat ggcccatcca cgaatcgcag tacttgccat tacaggcggc 660 ccgggcattg ttgcaatggg aatgaaaagc ggtaagaaag tgataggagc tggtgcgggt 720 aatccgccat gtatcgttga cgagacggcg gacctggtga aagcggcgga agacatcatc 780 aacggggctt cattcgatta caatctgccc tgcattgccg aaaagagcct tattgttgtg 840 gagagtgtag cagaacggct ggtgcagcaa atgcaaacat ttggtgcact gttgttatca 900 cctgcagata ccgataaatt acgcgctgtc tgcctgcctg aaggacaggc aaataaaaaa 960 cttgtcggca aaagtccatc ggcaatgctg gaagccgcag gaattgctgt ccctgcaaaa 1020 gcgccgcgtc ttttaattgc tctggttaac gctgatgatc cgtgggtcac aagcgaacag 1080 ttgatgccta tgctgccagt ggtaaaagtt tcagatttcg attccgcact ggcgctggcc 1140 ttgaaggttg aagaggggct gcatcatact gctattatgc actcgcagaa cgtgtcacgc 1200 ctgaatctcg cggcacgcac tttacaaaca tctattttcg taaaaaatgg tccctcatat 1260 gccgggattg gtgttggcgg cgaaggcttt accaccttca ctattgcaac gccaacaggt 1320 gaagggacaa catctgcgcg tacttttgct cgttcccggc gctgtgtact gacgaatggt 1380 ttttctattc gttaa 1395 <210> 42 <211> 789 <212> DNA <213> Artificial Sequence <220> <223> HBD from C. acetobutyricum with GBD tag <400> 42 aactaaacaa tgtcatcctt gaaaaggaag gtaaagttgc tgtagttacc attaacagac 60 ctaaagcatt aaatgcgtta aatagtgata cactaaaaga aatggattat gttataggtg 120 aaattgaaaa tgatagcgaa gtacttgcag taattttaac tggagcagga gaaaaatcat 180 ttgtagcagg agcagatatt tctgagatga aggaaatgaa taccattgaa ggtagaaaat 240 tcgggatact tggaaataaa gtgtttagaa gattagaact tcttgaaaag cctgtaatag 300 cagctgttaa tggttttgct ttaggaggcg gatgcgaaat agctatgtct tgtgatataa 360 gaatagcttc aagcaacgca agatttggtc aaccagaagt aggtctcgga ataacacctg 420 gtttggtgg tacacaaaga ctttcaagat tagttggaat gggcatggca aagcagctta 480 tatttactgc acaaaatata aaggcagatg aagcattaag aatcggactt gtaaataagg 540 tagtagaacc tagtgaatta atgaatacag caaaagaaat tgcaaacaaa attgtgagca 600 atgctccagt agctgttaag ttaagcaaac aggctattaa tagaggaatg cagtgtgata 660 ttgatactgc tttagcattt gaatcagaag catttggaga atgcttttca acagaggatc 720 aaaaggatgc aatgacagct ttcatagaga aaagaaaaat tgaaggcttc aaaaatagat 780 aggaggtaa 789 <210> 43 <211> 862 <212> DNA <213> Artificial Sequence <220> <223> crt from C acetobutyricum with SH3 tag <400> 43 aaggagctgt ttaatgaaaa aggtatgtgt tataggtgca ggtactatgg gttcaggaat 60 tgctcaggca tttgcagcta aaggatttga agtagtatta agagatatta aagatgaatt 120 tgttgataga ggattagatt ttatcaataa aaatctttct aaattagtta aaaaaggaaa 180 gatagaagaa gctactaaag ttgaaatctt aactagaatt tccggaacag ttgaccttaa 240 tatggcagct gattgcgatt tagttataga agcagctgtt gaaagaatgg atattaaaaa 300 gcagattttt gctgacttag acaatatatg caagccagaa acaattcttg catcaaatac 360 atcatcactt tcaataacag aagtggcatc agcaactaaa agacctgata aggttatagg 420 tatgcatttc tttaatccag ctcctgttat gaagcttgta gaggtaataa gaggaatagc 480 tacatcacaa gaaacttttg atgcagttaa agagacatct atagcaatag gaaaagatcc 540 tgtagaagta gcagaagcac caggatttgt tgtaaataga atattaatac caatgattaa 600 tgaagcagtt ggtatattag cagaaggaat agcttcagta gaagacatag ataaagctat 660 gaaacttgga gctaatcacc caatgggacc attagaatta ggtgatttta taggtcttga 720 tatatgtctt gctataatgg atgttttata ctcagaaact ggagattcta agtatagacc 780 acatacatta cttaagaagt atgtaagagc aggatggctt ggaagaaaat caggaaaagg 840 tttctacgat tattcaaaat aa 862 <210> 44 <211> 1191 <212> DNA <213> Artificial Sequence <220> <223> Ter from T. denticola with PDZ tag <400> 44 attgtaaaac caatggttag gaacaatatt tgtctaaacg ctcatccgca aggatgcaaa 60 aaaggcgttg aggatcaaat agagtacaca aaaaagagaa ttaccgctga ggtaaaagcc 120 ggagcaaaag cccctaaaaa cgtgctggtt ctcggctgct cgaacggtta cggacttgca 180 agccggataa cggcagcatt cggctatggg gccgccacta tcggcgtttc ctttgaaaaa 240 gccggaagcg aaacaaagta cggcacaccc ggctggtaca acaacctggc ctttgacgag 300 gctgccaaaa gggaaggcct ttattccgta actatagacg gagacgcctt ttccgatgaa 360 atcaaggcac aagtaatcga agaagccaaa aagaaaggaa ttaaattcga tcttatagtt 420 tagertaggg caagccctgt aagaaccgat cccgacacag gcataatgca caagtccgtc 480 ttaaaaccct tcggtaaaac atttacaggc aagacagtcg atccctttac gggagaacta 540 aaagaaatct ccgccgaacc tgcaaacgat gaagaagccg ctgcaaccgt taaggttatg 600 ggaggagaag actgggaacg ctggataaag cagctttcaa aagaaggtct tttagaagaa 660 ggctgcatta ccctagccta ttcctatatc ggccctgagg ccactcaagc cctctaccga 720 aagggcacca taggaaaggc aaaagaacac cttgaagcaa ctgcccaccg cctaaacaaa 780 gaaaacccgt caatacgggc cttcgtttcg gtgaacaagg gcttggtaac aagggcaagt 840 gcggtaatcc ccgtaattcc cctatacctc gcttccttgt ttaaggttat gaaagaaaaa 900 ggaaaccacg agggctgtat cgagcagatt acccgccttt atgccgaaag actctaccgt 960 aaagacggca ccatccccgt cgatgaagaa aacagaatcc gtatcgacga ctgggagctt 1020 gaagaagacg ttcaaaaggc ggtttcggct ttaatggaaa aagtaaccgg cgaaaatgcc 1080 gaaagcctaa ccgaccttgc aggctaccgc cacgactttt tagcctcaaa cggctttgat 1140 gtagaaggca tcaactacga agccgaggta gaaaggttcg acaggattta a 1191

Claims (11)

delete A mutant microorganism having the ability to produce butanol in an aerobic condition in which the following gene is introduced in a microorganism having a pathway for producing acetyl-CoA from glucose and the expression of a gene encoding citrate synthase is down-regulated;
(a) a gene encoding an aerobic strain-derived alcohol dehydrogenase;
(b) a gene encoding a propionaldehyde dehydrogenase derived from an aerobic strain;
(c) a gene encoding butyl-CoA dehydrogenase;
(d) a gene encoding crotonase;
(e) a gene encoding hydroxybutyryl-CoA dehydrogenase; And
(f) a gene encoding thiolase.
3. The mutant microorganism according to claim 2, wherein a gene encoding an enzyme involved in biosynthesis of a by-product selected from the group consisting of succinic acid, lactate, ethanol and acetate is deleted.
3. The method according to claim 2, characterized in that a gene encoding an enzyme selected from the group consisting of fumarate reductase, lactate dehydrogenase, phosphate acetyl transferase and acetaldehyde / alcohol dehydrogenase is deleted Mutated microorganisms.
3. The mutant microorganism according to claim 2, wherein the gene encoding the alcohol dehydrogenase is derived from Salmonella.
3. The mutant microorganism according to claim 2, wherein the gene encoding the propionaldehyde dehydrogenase is derived from lactococus.
3. The mutant microorganism according to claim 2, wherein a gene encoding formate dehydrogenase is further introduced.
3. The mutant microorganism according to claim 2, wherein the down-regulation of gene expression encoding citrate synthase is carried out by the CRISPR / Cas system.
3. The method according to claim 2, wherein the down-regulation of gene expression encoding citrate synthase is carried out in such a manner that the 5'-UTR portion of the gene encoding citrate synthase is at least one of SEQ ID NOS: Wherein the oligonucleotide is substituted with an oligonucleotide represented by one.
A process for preparing butanol, comprising the steps of:
(a) culturing the mutant microorganism of any one of claims 2 to 9 to produce butanol; And
(b) obtaining the resulting butanol.
11. The method of claim 10, wherein the culturing is performed under aerobic or micro-aerobic conditions.

Images