CN113201517B - Cytosine single base editor tool and application thereof - Google Patents

Abstract

The invention belongs to the technical field of biological engineering and gene editing, and particularly relates to a cytosine single-base editor tool and application thereof. The cytosine single-base editor contains a polynucleotide sequence for coding fusion protein, the fusion protein comprises Cas9 nicase homologous protein SgoCas9D9A nicase which is derived from Streptococcus gordonae and optimized by codons, the cytosine single-base editor can identify NNAAAG to serve as PAM, can edit window cytosine at 8-14 positions in a gRNA targeting sequence range, can realize the conversion of specific bases C-to-T, and widens the targeting range and application range of base editing.

Description

Cytosine single base editor tool and application thereof

Technical Field

The invention belongs to the technical field of biological engineering and gene editing, and particularly relates to a cytosine single-base editor tool and application thereof.

Background

The development and application of the CRISPR/Cas9 system makes a significant contribution to the development of biology and medicine, which as the most classical gene editing system consists of two parts: a gRNA (guide RNA) sequence that recognizes a target genomic target and Cas9 with endonuclease activity. The latter utilizes self-PID (PAM) domain to recognize the adjacent motif of the pre-spacer sequence of the target genome under the guidance of gRNA (PAM, protospacer ad jacent motif; specific base on the target genome, such as NGG), and further cuts double-stranded DNA through RuvC and HNH domains which have endonuclease activity (Anders, C., et al, structural basis of PAM-dependent target DNA recognition by the Cas9 end-structure, 2014.513 (7519): p.569-73), DNA damage repair response mechanism of organism, connects the broken sequences through homologous recombination repair or non-homologous recombination repair, realizes the knockout or insertion of target gene in cells (Lin, S., enhand. Homologous-directed gene cloning site), and CRISPR/modifying Cas.049.766.15.

The editing efficiency of CRISPR/Cas9 system is high, however, cutting double-stranded DNA causes relatively more insertions and deletions of gene fragments and fails to accurately control their repair bases. Thus, scientists have invented a single base editing tool based on the CRISPR/Cas9 system, including a single base editor ABE (Adenine base editor) (Gaudelli, N.M., et al., programming base editing of A T to G C in genomic DNA without DNA deletion. Nature,2017.551 (7681): p.464-471) for realizing the replacement of the target site base A/T with G/C (A/T-to-G/C) and a single base editor CBE (Cytidine base editor) (Komor, A.C., et al., programming edge of a target base in genomic DNA without DNA deletion DNA, nature 533.03-2016 (2016): 420-2016).

The single base editing tool is mainly a base editing tool which is formed by fusing cytidine deaminase or adenosine deaminase and Cas9 nickase (D10A mutation, active domain RuvC domain inactivation) and can accurately replace a single base. CBE was first reported by David Liu laboratory, harvard university, using a single base editor BE3 (APOBEC-XTEN-Cas 9n (D10A) -UGI) formed by fusion of rat-derived cytosine deaminase (APOBEC 1) with nCas9 (Komor, A.C., et al, programeble editing of a target base in genomic DNA without out double-stranded DNA clean. Nature,2016.533 (7603): p.420-4). BE3 has high editing efficiency, can realize accurate C-to-T conversion, and has deletion and insertion proportion far lower than that of a CRISPR/Cas9 knockout system. BE4 (APOBEC-XTEN-Cas 9n (D10A) -2. Times. UGI-SV40 NLS) was subsequently developed on the basis of BE3, i.e.a Uracil DNA glycosylase inhibitor (UGI) and a Nuclear Localization Signal (NLS) were added on the basis of BE3, as well as a change in linker length (Komor, A.C., et al, improved base expression replication and bacterial phase Mu peptide amplification C: G-to-T: A base indices with high efficiency and product purity. Sci Adv,2017.3 (8): p.eaao4774). On the basis of BE4, deaminase APOBEC1 is replaced by an Anc689 APOBEC and a nuclear localization signal is added to evolve AncBE4max (SV 40NLS-Anc689 APOBEC-XTEN-Cas9n (D10A) -2 UGI-SV40 NLS) (Koblan, L.W., et al, improving cycle and adenosine base indexes by expression timing and processed recovery. Nat Biotechnology, 2018.36 (9): p.843-846), and the like, so that the most efficient editing efficiency and the lowest proportion of byproducts are obtained. The PAM recognized by ancBE4max is NGG, the corresponding editing window is 4-8 sites of 5' end in the gRNA range, and Cas9n is derived from Streptococcus pyogenes (SpCas 9; total 1369 amino acids). However, the targeting window and PAM restriction of ancBE4max (PAM which primarily recognizes NGG sequences) greatly limits the range in the genome that can be targeted.

In view of the above problems, scientists developed a series of SpCas9 protein mutants obtained by protein engineering and directed evolution, such as SpCas9-NG, spRY (Walton, R.T., et al, unconstrained gene targeting with near-PAMless Engineered CRISPR-Cas9 variants. Science,2020.368 (6488): p.290-296), spCas9-VQR, spCas 9-2015R (Kleinverter, B.P., et al, engineered CRISPR-Cas9 nucleic acids with altered PAM specificity. Nature, 523 (7561): p.481-5), spCas9-HF1 (Kleinverter, B.P., et al, high-fidelity-nucleic acid-No. 9 nucleic acids), CRISPR 9 gene with gene-5, etc. (752016.2016.2016.2016); scientists have also sought new Cas9 protein homologues, such as Nme2Cas9 (Edraki, a., et al, a Compact, high-Accuracy Cas9 with a digital PAM for In Vivo Genome edition, mol Cell,2019.73 (4): p.714-726.e 4), saCas9 (Nishimasu, h., et al, crystalline Structure of Staphylococcus aureus aureous case 9.Cell,2015.162 (5): p.1113-26), st1Cas9 (Zhang, y., catalytic-state and engineering of Staphylococcus aureus 9. Natural Catalysis,2020.3 (10): p.823), calcium 9 (huas 9. H., 2019. Wo 9. H., 9. Tissue, and others. Based on this, a series of base editors with various targeting properties and recognition of PAM based on these variants were developed. The editing windows of the classical editors are mainly 4-8 bits, and PAM preference or low partial site targeting efficiency exists in all editors. Moreover, the size of the expression plasmid of the classical base editor far exceeds the packaging range of adenovirus, which is not beneficial to clinical research and application.

Therefore, the development of novel base editors with different editing windows, different identification PAMs and smaller expression plasmids is the key of the current gene editing application research and clinical application.

Disclosure of Invention

Aiming at the problems of the existing base editor, the invention aims to provide a cytosine single base editor tool and application thereof, which can efficiently induce the conversion of C-to-T at the 5' end 8-14 of an editing window, and the identified PAM is NNAAAG, so that the genome targeting range of base editing is enlarged, the size of the gene editing tool is reduced, the gene editing tool is more suitable for the packaging range of adenovirus, and the cytosine single base editor tool has a good application prospect.

Based on the purpose, the invention adopts the following technical scheme:

in a first aspect, the invention provides a fusion protein comprising a codon-optimized Cas9 nicase homologous protein derived from streptococcus gordonae, a cytosine deaminase, and a uracil glycosylase inhibitor protein;

wherein, the amino acid sequence of the Cas9 nickase homologous protein is as follows:

a) The method comprises the following steps The 2 nd to 1136 th amino acid sequences of the N end of SgoCas9D9A nickase shown in SEQ ID NO. 1;

or b): has more than 90 percent of sequence consistency with SEQ ID NO.1 and has the function of amino acid shown in SEQ ID NO. 1;

or c): has the function of obtaining the complete fusion protein by shearing and splicing the amino acid sequence of the intron sequence with the SEQ ID NO.1 or has the partial same amino acid sequence with the SEQ ID NO.1 and the function of the amino acid shown in the SEQ ID NO. 1.

The DNA coding sequence for the codon optimized Cas9 nicakase homologous protein derived from streptococcus gordonae is:

i) The method comprises the following steps The DNA coding sequence corresponding to SgoCas9D9A nickase shown in SEQ ID NO.2 is a DNA coding sequence which is suitable for eukaryotic expression after codon optimization;

or ii): a DNA coding sequence corresponding to an amino acid having a sequence identity of 90% or more with the amino acid sequence shown in SEQ ID No.1, and having the function of the amino acid shown in SEQ ID No. 1;

or iii): a DNA sequence having synonymous codons with the DNA sequence shown in SEQ ID NO. 2.

Further, the fusion protein also comprises N-terminal BPNLS-ancAPEC 1 polypeptide and C-terminal 2 x UGI-BPNLS polypeptide; wherein, the BPNLS-ancAPECE 1 polypeptide is formed by fusing BPNLS polypeptide and ancAPECE 1 polypeptide; 2 UGI-BPNLS polypeptide is formed by fusing UGI polypeptide and BPNLS polypeptide;

the amino acid sequence of the BPNLS-ancAPBEC 1 polypeptide is as follows:

d) The method comprises the following steps An amino acid sequence shown as SEQ ID NO. 3;

or e): has more than 90 percent of sequence consistency with SEQ ID NO.3 and has the function of amino acid shown in SEQ ID NO. 3;

2 the amino acid sequence of ugi-BPNLS polypeptide is:

f) The method comprises the following steps An amino acid sequence shown as SEQ ID NO. 4;

or g): has more than 90 percent of sequence consistency with SEQ ID NO.4 and has the amino acid sequence with the function of the amino acid shown in SEQ ID NO. 4.

Further, the N-terminal comprises 2-1136 th amino acid sequences of BPNLS polypeptide, ancAPEC 1 polypeptide, 32aa linker, sgoCas9D9A nickase, 10aa linker, 2 × UGI polypeptide and BPNLS polypeptide from the N terminal to the C terminal in sequence;

the complete amino acid sequence of the fusion protein is as follows:

h) The method comprises the following steps An amino acid sequence shown as SEQ ID NO. 5;

or i): the 6 elements of BPNLS polypeptide, ancAPEC 1 polypeptide, 32aa linker, sgoCas9D9A nickase, amino acid sequence from 2 th to 1136 th sites of N end, 10aa linker and 2 × UGI polypeptide are rearranged or increased or decreased to realize the function of editing cytosine base into thymine.

Or j): has more than 90 percent of sequence consistency with the amino acid sequence shown in SEQ ID NO.5, and has the amino acid sequence which can identify NNAAAG as PAM and edit cytosine base into thymine.

Further, the fusion protein recognizes nnaaaag as PAM, wherein N represents an arbitrary base; the fusion protein edits the cytosine base to thymine at positions 8-14 of the editing window.

Further, the fusion protein also comprises a nucleic acid positioning signal polypeptide fragment, and the amino acid sequence of the nucleic acid positioning signal polypeptide fragment is shown as SEQ ID NO. 8.

In a second aspect, the present invention provides a polynucleotide sequence, wherein the polynucleotide sequence is a polynucleotide sequence encoding the above fusion protein, and the polynucleotide sequence is shown in SEQ ID No. 6.

In a third aspect, the present invention provides a cytosine single base editor obtained by integrating a polynucleotide sequence encoding the above fusion protein into an expression vector.

Furthermore, the expression vector is derived from a gRNA scaffold formed by a Gordon streptococcus tandem repeat sequence, and the nucleotide sequence of the expression vector is shown as SEQ ID No. 7.

In a fourth aspect, the present invention provides a cell expression system comprising a cytosine single base editor of claim 7 or claim 8; the cell is a host cell, and the host cell is a eukaryotic cell or a prokaryotic cell.

Further, the cell is a mouse brain neuroma cell, a human embryonic kidney cell or a human colon cancer cell.

Furthermore, the mouse brain neuroma cell is an N2a cell, the human embryonic kidney cell is an HEK293T cell, and the human colon cancer cell is an HCT116 cell.

Compared with the prior art, the invention has the following beneficial effects:

according to the invention, cas9n protein is replaced by SgoCas9n on the basis of AncBE4max, potential target-identified PAM is NNAAAG, meanwhile, scaffold of a gRNA expression vector is replaced by gRNA scaffold which is designed from a Gordon streptococcus tandem repeat sequence, a novel efficient single-base editor Sgo-ancBE4max is formed together, the editing range is 8-14 th cytosine at the 5' end of a target sequence, an editing system can convert cytosine into thymine (C-to-T), the target range of base editing is widened, and the protein size of the base editing tool can be suitable for the packaging requirement of adenovirus.

Drawings

FIG. 1 is a schematic of the domain of Sgo protein;

FIG. 2 is a schematic diagram of the domain of the protein of Sgo-ancBE4 max;

FIG. 3 is a schematic diagram of the plasmid structure of Sgo-ancBE4 max;

FIG. 4 is a schematic diagram of the plasmid structure of gRNA of the Sgo-ancBE4max system;

fig. 5 is a schematic diagram of Sgo-ancBE4max showing the experimental results of embodiment 3 of the present invention, wherein Sanger sequencing results after HEK293T cells are transfected by Sgo-ancBE4max + gRNA together, a schematic diagram of targeting DNA sequences and PAM sequences are shown above the diagram, and a statistical diagram of editing results efficiency of 4 corresponding targeting sites is shown in the right of the diagram;

FIG. 6 is a heat map of the editing efficiency statistics of the Sgo-ancBE4max editing system in HEK293T cells;

FIG. 7 is a histogram of the editing efficiency statistical chart of Sgo-ancBE4max editing system in HEK293T cells, after normalization processing, with the dashed line box being the schematic diagram of the editing window;

FIG. 8 is a statistical chart of the editing efficiency of the Sgo-ancBE4max editing system in HCT116 cells;

FIG. 9 is a graph of the editing efficiency of the SgoCas9-ancBE4max system in N2A cells.

Detailed Description

To better illustrate the objects, aspects and advantages of the present invention, the present invention will be further described with reference to the following examples. It will be understood by those skilled in the art that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

The test methods used in the examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are commercially available unless otherwise specified.

Example 1 construction of the SgoCas9-ancBE4max plasmid

The embodiment provides a construction method of an SgoCas9-ancBE4max plasmid, which comprises the following specific steps:

firstly, the amino acid sequence alignment tool ClustalW2 is used to align the amino acid sequence of Cas9 protein homolog SgoCas9 from Gordonia (Streptococcus _ gordonii _ str. _ Challis _ substr. _ CH1; sgo for short) with spCas9 to divide the functional domain of SgoCas9 (as shown in FIG. 1), and find out the functional sites of SgoCas9 and the RuvC domain of SpCas9, wherein the 10 th position of the functional site of the RuvC domain of SpCas9 is aspartic acid D10, the 10 th position of the functional site of the RuvC domain of SgoCas9 is aspartic acid D9, and aspartic acid D9 is mutated into alanine (A), thus obtaining the SgoCas 9A nickase, the amino acid sequences 2 to 1136 of SgoCas 9A nickase are shown in SEQ ID NO. 1.

And secondly, carrying out eukaryotic optimization on prokaryotic codons of the SgoCas9D9A of the streptococcus gordonae so as to obtain a coding DNA sequence of the SgoCas9D9A suitable for eukaryotic cell expression, wherein the sequence is shown as SEQ ID NO. 2. Optimized SgoCas9D9A business company complete gene synthesis.

The construction strategy is to replace SpCas 9D 10A of the ancBE4max with SgoCas9D9A on the basis of the ancBE4max, wherein the ancBE4max is synthesized by a commercial company through the whole gene. To reduce PCR-introduced point mutations, a portion of ancBE4max, 32aa linker-SpCas 9D 10A-10aa linker-UGI, was excised by endonuclease BamHI, and then supplemented with the excised portion of ancBE4max, 32aa linker-SgoCas 9D 9A-10aa linker-UGI, when SgoCas9D9A was synthesized by commercial companies, the nucleotide sequence of the sequences being shown in SEQ ID NO.9, and the linker of the sequences containing the endonuclease BamHI site.

The plasmid AncBE4max (vector pCMV) was digested with restriction enzyme BamHI (R0136L) in a water bath at 37 ℃ for 2h, and the digestion system (50. Mu.L) was: 10xBuffer:5 μ L, vector: 5 μ g, bamHI enzyme: 3 μ L, ddH₂O: adding to 50 μ L; identifying whether the enzyme digestion is complete through gel electrophoresis; after the completion of the digestion, the linearized vector was purified using clean up kit (AxyPrep PCR clean kit) using 15. Mu.L ddH₂And (4) eluting by using oxygen. Carrying out PCR amplification on the synthesized 32aa linker-SgoCas 9D 9A-10aa linker-UGI, introducing protective bases outside enzyme cutting sites at two ends, and carrying out PCR reaction amplification on a carrier fragment by using a PCR primer synthesized by Jinzhi Biotechnology Limited, wherein the sequence of the Sgo PCR forward primer is as follows: agcggatcctggcagcgagacacca; the sequence of the Sgo PCR reverse primer is as follows: cctccgggatctccgctcagcatcttgatctta. And purified using clean up kit (AxyPrep PCR clean-up kit). And carrying out BamH1 enzyme digestion reaction on the purified PCR product, wherein the enzyme digestion system refers to the system.

The purified 32aa linker-SgoCas 9D 9A-10aa linker-UGI was enzymatically ligated to the BamH1 linearization vector pCMV _ AncBE4max to obtain the primary ligation product.

Ligation system (10 μ L): purification of the linearized vector pCMV _ AncBE4max: mu.L (50 ng), 32aa linker-SgoCas 9D 9A-10aa linker-UGI BamH1 cleavage product: 1 μ L (100 ng), T4 DNA Ligase Buffer: 1. Mu.L, T4 DNA Ligase:1 μ L, ddH₂O:6 μ L. Enzyme-linked conditions: ligation was carried out at 16 ℃ for 2h.

And (3) after the enzyme-linked product is converted, coating a plate, selecting a monoclonal shake bacteria for sequencing and cloning and identifying, and constructing to obtain the SgoCas9-ancBE4max protein, namely the fusion protein, wherein the whole amino acid sequence of the fusion protein is shown as SEQ ID NO.5, and the DNA sequence of the fusion protein is shown as SEQ ID NO. 6. The structural schematic diagram of the constructed fusion protein is shown in figure 2, and the fusion protein sequentially comprises a polypeptide fragment consisting of the N-terminal 2-1136 amino acids of BPNLS, an ancAPECEC 1 polypeptide fragment, a 32aa linker, an SgoCas9D9A nickase, a 10aa linker, 2 × UGI polypeptide and a BPNLS polypeptide sequence); the SgoCas9-ancBE4max plasmid structure map is shown in FIG. 3, and includes a plasmid domain (i.e., a fusion protein) and an ampicillin polypeptide sequence.

The monoclonal bacterial liquid which is identified as positive by clone is enlarged and cultured, and Plasmid (TIANGEN: TIANPure Midi Plasmid Kit) is extracted according to the Kit steps and the concentration is measured, so that the sufficient dosage and no impurity pollution such as salt, protein and the like are ensured during transfection.

Example 2 construction of gRNA plasmid for the SgoCas9-ancBE4max System

The embodiment provides a construction method of a gRNA plasmid of an SgoCas9-ancBE4max system, which comprises the following steps:

2.1 Vector construction of gRNA plasmid of SgoCas9-ancBE4max system

pGL3-U6-sgRNA (Addgene # 51133) is used as an expression framework to construct a gRNA expression vector suitable for an SgoCas9 gRNA editing system. According to a tandem repeat sequence from a Gordonia streptococcus, a scaffold sequence suitable for an SgoCas9 gRNA action system is designed, scaffold (suitable for SpCas 9) of pGL3-U6-sgRNA (Addgene # 51133) is replaced by SgoCas9 gRNA scaffold, a successfully constructed complete plasmid is shown as SEQ ID NO.7 and named as pGL3-U6-Sgo gRNA, and a plasmid structure schematic diagram is shown in figure 4. The restriction sites for ligation into the targeted gRNA sequence were two BsaI, and the plasmid was synthesized from the whole gene of commercial company.

2.2 Construction of targeting gRNA plasmid of SgoCas9-ancBE4max system

Grnas were designed and two complementarily paired oligos were synthesized, with the upstream sequence: 5'-accg-24nt-3', the downstream sequence is: 5'-aaac-24nt-3' (the 24nt alternative sequence is complementary paired with the upstream sequence), the upstream sequence is 24nt-NNAAAG (DNA chain where PAM is located), the upstream and downstream sequences are annealed by a program (95 ℃,5min, 95 ℃ -85 ℃, at-2 ℃/s;85 ℃ -25 ℃, at-0.1 ℃/s; hold at 4 ℃) and connected to a pGL3-U6-SgRNA vector linearized by BsaI (NEB: R0539L).

The linearized digestion system is shown below: pGL3-U6-Sgo gRNA 2 ug; buffer (NEB: R0539L) 6. Mu.L; bsaI 2. Mu.L; ddH₂The amount of O was adjusted to 60. Mu.L. The digestion was carried out overnight at 37 ℃. The linking system is as follows: t4 is connected to buffer (NEB: M0202L) 1 uL, linearly20ng of vector, 5. Mu.L of annealed oligo fragment (10. Mu.M), 0.5. Mu.L of T4 DNA ligase (NEB: M0202L), ddH₂The amount of O was made up to 10. Mu.L. Ligation was carried out overnight at 16 ℃. The linked vector is transformed, selected and identified. The positive clones were amplified to extract the plasmid (Axygene: AP-MN-P-250G) and the concentration was determined.

Example 3 Gene editing Effect test of Gene editing tool SgoCas9-ancBE4max

Human endogenous genes EMX1, FANCF, CDKN2A, CFTR, DNMT1, DYRK1A, RUNX1, VEGFA and the like are selected, 10 gRNAs are designed in total, and 20 Oligos are synthesized, wherein the sequences are shown in Table 1.

TABLE 120 Oligos synthesized on the basis of EMX1, FANCF, CDKN2A, CFTR, DNMT1, DYRK1A, RUNX1 and VEGFA, respectively

HEK293T cells were transfected using a base editing system consisting of the SgoCas9-ancBE4max plasmid constructed in example 1 and example 2 and pGL3-U6-Sgo gRNA plasmids (20 oligo's synthesized in sequence Listing 1 were annealed and enzymatically ligated to linearized pGL3-U6-Sgo gRNA vectors: sgo-1, sgSgo-2, sgSgo-3, sgSgo-4, sgSgo-5, sgSgo-6, sgSgo-7, sgSgo-8, sgSgo-9 and sgSgo-10) as follows:

3.1HEK293T cells (from ATCC) were recovered and cultured in 10cm dishes (Corning, 430167) in DMEM (HyClone, SH 30243.01) mixed with 10% fetal bovine serum (HyClone, SV 30087). The culture temperature was 37 ℃ and the carbon dioxide concentration was 5%. After multiple passages when the cell density was 90%, the cells were plated to 24-well plates (gerbil).

3.2HEK293T cells are recovered for three generations and then the cell state is observed, the cells with good state are paved into a 24-hole plate, after the paved cells are cultured for 18-24 h, the cells are transfected when the cell concentration is 80%, and the dosage of each component in the transfection process is as follows: 1 ug of SgoCas9-ancBE4max plasmid, pGL3-U6-Sgo gRNA plasmid: mu.g, EZTrans transfection reagent (Liji organism) 4.5. Mu.L.

3.3 the specific transfection procedure (as high efficiency version procedure of EZ Trans transfection reagent for Prunus hainanensis organisms) is:

3.3.1 configuration reagent a: for each well of cells, 1.5. Mu.g of plasmid DNA (1. Mu.g of SgoCas9-ancBE4max plasmid + 0.5. Mu.g of pGL3-U6-Sgo gRNA plasmid) was diluted to 50. Mu.L of serum-free double-antibody-free high-glucose DMEM medium (or OPTI-MEM medium) and mixed well.

3.3.2 configuration B reagent: for each well of cells, 4.5. Mu.L of EZ Trans transfection reagent (EZ Trans: plasmid DNA = 2. (cannot use serum medium dilution plasmid and EZ Trans transfection reagent, because the serum contains a large amount of negatively charged proteins, may interfere with transfection reagent on nucleic acid adsorption, thereby affecting transfection efficiency)

3.3.3 the A reagent and the B reagent are simultaneously kept stand for 5min, and the B reagent is added into the A reagent as soon as possible and is gently mixed evenly. (the order of mixing cannot be reversed)

3.3.4 standing at room temperature for 15min to form EZ Trans-DNA complexes. The EZ Trans-DNA transfection complex prepared is dropped into a culture dish containing cells evenly, and the culture dish is shaken or shaken slightly to disperse the EZ Trans-DNA complex evenly.

3.3.5% CO at 37 ℃%₂Culturing for 4-6 h in an incubator, removing the culture solution containing the EZ Trans-DNA compound, replacing the new culture solution, and culturing for 3 days.

3.4 transfected cells were cultured for 3 days, then the cells were digested with trypsin to obtain GFP-positive cells (FITC fluorescence intensity top 15%) and further flow-sorted to obtain GFP-positive cells, and the genomic DNA was extracted from the collected cells by phenol chloroform method.

3.5 designing and synthesizing PCR primers by 100-130 bp respectively at the upstream and downstream of the selected endogenous gene targeting site, and adding water to dilute to 10 mu M. Each genomic targeting site fragment was PCR amplified using the Novozam high fidelity enzyme kit (Vazyme, p501-d 2). PCR product samples were recovered by using AxyPrep DNA gel recovery kit (Axygen, AP-GX-250G) as tapping gel to remove non-specific bands. The PCR primer sequences are shown in Table 2.

TABLE 2 PCR primer sequence Listing

3.6 preliminarily identifying whether the target fragment is successfully amplified through gel electrophoresis, carrying out Sanger sequencing on the successfully amplified target fragment, and analyzing a sequencing result to observe whether a specific base point mutation (C-to-T or G-to-A) exists in a target site. The sequencing result is shown in figure 5, the first row of the left figure is a schematic diagram of the target DNA sequence; second behavior targeting gene editing experimental results, arrows indicate C-to-T editing positions; the right panel shows the statistical results of the editing efficiency of C-to-T at different positions in the gRNA range. The figure shows the editing results of 4 editing sites in total, and as can be seen from figure 5, the gene editing tool SgoCas9-ancBE4max obtained by the invention can cause efficient C-to-T conversion.

Example 4

4.1 transfection of HEK293T cells by the base editing system composed of the SgoCas9-ancBE4max plasmid and the pGL3-U6-Sgo gRNA plasmid constructed in example 1 and example 2, the editing efficiency of the SgoCas9-ancBE4max at 10 human genomic sites was co-detected, the statistics of the editing efficiency are shown in FIG. 6, and the results show that the SgoCas9-ancBE4max base editing system realizes the conversion of C-to-T at positions 1-24 of the 5' end to different degrees.

4.2 the editing efficiency in each gRNA range is normalized, that is, the point with the highest editing efficiency is normalized to be 1, the editing efficiency of other cytosine bases is counted, all points in the gRNA range are counted, and the high-efficiency editing window of the SgoCas9-ancBE4max base editing system in the gRNA range is counted as shown in FIG. 7. The results show that the editing range of the SgoCas9-ancBE4max base editing system obtained in the example is 8-14 bits of the 5' end of the gRNA, the possibility of constructing a novel base editing tool and system by searching for a Cas9 homologous protein is proved, and a cytosine base editor with different targeting ranges (PAM is NNAAAG) and editing windows for endogenous gene editing is obtained efficiently.

Example 5

Human colon carcinoma HCT116 cells and murine neuroma N2A cells were transfected with the base editing system consisting of the SgoCas9-ancBE4max plasmid and pGL3-U6-Sgo gRNA plasmid constructed in examples 1 and 2 as follows:

N2A cells (from ATCC) were recovered and cultured in 10cm dishes (Corning, 430167) in DMEM (HyClone, SH 30243.01) mixed with 10% fetal bovine serum (HyClone, SV 30087). The culture temperature was 37 ℃ and the carbon dioxide concentration was 5%. After multiple passages when the cell density was 90%, the cells were plated into 24-well plates.

HCT116 cells (from ATCC) were recovered and cultured in 10cm dishes (Corning, 430167) in RIPM1640 medium (Gibco, 11875093) mixed with 10% fetal bovine serum (HyClone, SV 30087). The culture temperature was 37 ℃ and the carbon dioxide concentration was 5%. After multiple passages when the cell density was 90%, the cells were plated to 24-well plates. Cell transfection protocol, cell sorting protocol, editing efficiency protocol were the same as in example 3 and example 4 above.

The editing efficiency of the SgoCas9-ancBE4max system in HCT116 cells is shown in FIG. 8, with the targeting sequences: sgo-1/-2/-3/-6/-8 (see attached Table 1). The editing efficiency of the SgoCas9-ancBE4max system in N2A cells is shown in fig. 9, with the targeting sequence: ggaaactcgatcgcattcattgcatg. As can be seen from fig. 8 and 9, the SgoCas9-ancBE4max base editing system can also lead to a highly efficient C-to-T transition in HCT116 and N2A cells; FIG. 8 shows the base positions with the highest editing efficiency of 5 human genomic loci on the abscissa, and the conversion efficiency of C-to-T on the ordinate; FIG. 9 shows arrows indicating the editing sites at positions N2A, and the efficient C-to-T transition can be seen by the peak plot.

In conclusion, the invention effectively overcomes the limitation of the application range of the base editing tool in the prior art, including PAM and editing window limitation, and the size of the cytosine base editor related to the invention is smaller than that of the classic SpCas 9-mediated base editor (total 1710 amino acids), so that the cytosine base editor is possibly suitable for packaging and application of lentiviruses or adenoviruses and has high industrial utilization value.

Finally, it should be noted that the above embodiments are only used for illustrating the technical solutions of the present invention and not for limiting the protection scope of the present invention, and although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

SEQUENCE LISTING

<110> Guangzhou university

<120> cytosine single-base editor tool and application thereof

<130> PZS215311-

<160> 9

<170> PatentIn version 3.5

<210> 1

<211> 1135

<212> PRT

<213> SgoCas9 D9A nickase

<400> 1

Asn Gly Leu Val Leu Gly Leu Ala Ile Gly Ile Ala Ser Val Gly Val

1 5 10 15

Gly Ile Leu Glu Lys Asp Thr Gly Lys Ile Ile His Ala Ser Ser Arg

20 25 30

Leu Phe Pro Ala Ala Thr Ala Asp Asn Asn Val Glu Arg Arg Ser Asn

35 40 45

Arg Gln Gly Arg Arg Leu Asn Arg Arg Lys Lys His Arg Ser Val Arg

50 55 60

Leu Gln Asp Leu Phe Glu Gly Tyr Gly Leu Leu Thr Asp Phe Ser Lys

65 70 75 80

Val Ser Met Asn Leu Asn Pro Tyr Gln Leu Arg Val Gln Gly Met Glu

85 90 95

Asn Gln Leu Thr Asn Glu Glu Leu Phe Val Ala Leu Lys Asn Ile Val

100 105 110

Lys Arg Arg Gly Ile Ser Tyr Leu Asp Asp Ala Ser Glu Asp Gly Gly

115 120 125

Thr Val Ser Ser Asp Tyr Gly Lys Ala Val Glu Glu Asn Arg Lys Leu

130 135 140

Leu Ala Glu Lys Thr Pro Gly Gln Ile Gln Leu Glu Arg Phe Glu Lys

145 150 155 160

Tyr Gly Gln Leu Arg Gly Asp Phe Thr Val Glu Glu Asn Gly Glu Lys

165 170 175

His Arg Leu Ile Asn Val Phe Ser Thr Ser Ala Tyr Arg Lys Glu Ala

180 185 190

Glu Arg Ile Leu Arg Lys Gln Gln Glu Phe Asn Ser Lys Ile Thr Asp

195 200 205

Glu Phe Ile Glu Asp Tyr Leu Ile Ile Leu Thr Gly Lys Arg Lys Tyr

210 215 220

Tyr His Gly Pro Gly Asn Glu Lys Ser Arg Thr Asp Tyr Gly Arg Phe

225 230 235 240

Arg Thr Asp Gly Thr Thr Leu Asp Asn Ile Phe Gly Ile Leu Ile Gly

245 250 255

Lys Cys Thr Phe Tyr Thr Glu Glu Tyr Arg Ala Ser Lys Ala Ser Tyr

260 265 270

Thr Ala Gln Glu Phe Asn Leu Leu Asn Asp Leu Asn Asn Leu Thr Val

275 280 285

Pro Thr Glu Thr Lys Lys Leu Ser Glu Glu Gln Lys Lys Leu Ile Ile

290 295 300

Glu Tyr Ala Lys Ser Ala Lys Thr Leu Gly Ala Ser Thr Leu Leu Lys

305 310 315 320

Tyr Ile Ala Lys Met Ile Asp Ala Ser Val Asp Gln Ile Arg Gly Tyr

325 330 335

Arg Val Asp Val Asn Asn Lys Pro Glu Met His Thr Phe Glu Val Tyr

340 345 350

Arg Lys Met Gln Ser Leu Glu Thr Ile Lys Val Glu Glu Leu Pro Arg

355 360 365

Lys Val Leu Asp Glu Leu Ala His Ile Leu Thr Leu Asn Thr Glu Arg

370 375 380

Glu Gly Ile Glu Glu Ala Ile Asn Ser Lys Leu Lys Asp Ile Phe Asn

385 390 395 400

Arg Asp Gln Val Leu Glu Leu Val Gln Phe Arg Lys Asn Asn Ser Ser

405 410 415

Leu Phe Ser Lys Gly Trp His Asn Phe Ser Ile Lys Leu Met Met Glu

420 425 430

Leu Ile Pro Glu Leu Tyr Glu Thr Ser Glu Glu Gln Met Thr Ile Leu

435 440 445

Thr Arg Leu Gly Lys Gln Arg Ser Lys Glu Thr Ser Lys Arg Thr Lys

450 455 460

Tyr Ile Asp Glu Lys Glu Leu Thr Glu Glu Ile Tyr Asn Pro Val Val

465 470 475 480

Ala Lys Ser Val Arg Gln Ala Ile Lys Ile Ile Asn Glu Ala Thr Lys

485 490 495

Lys Tyr Gly Ile Phe Asp Asn Ile Val Ile Glu Met Ala Arg Glu Asn

500 505 510

Asn Glu Glu Asp Ala Lys Lys Asp Tyr Ile Lys Arg Gln Lys Ala Asn

515 520 525

Gln Asp Glu Lys Asn Ala Ala Met Glu Lys Ala Ala Phe Gln Tyr Asn

530 535 540

Gly Lys Lys Glu Leu Pro Asp Asn Ile Phe His Gly His Lys Glu Leu

545 550 555 560

Thr Thr Lys Ile Arg Leu Trp His Gln Gln Gly Glu Lys Cys Leu Tyr

565 570 575

Thr Gly Lys Asn Ile Pro Ile Ser Asp Leu Ile His Asn Gln Tyr Lys

580 585 590

Tyr Glu Ile Asp His Ile Leu Pro Leu Ser Leu Ser Phe Asp Asp Ser

595 600 605

Leu Ser Asn Lys Val Leu Val Leu Ala Thr Ala Asn Gln Glu Lys Gly

610 615 620

Gln Arg Thr Pro Phe Gln Ala Leu Asp Ser Met Asp Asp Ala Trp Ser

625 630 635 640

Tyr Arg Glu Phe Lys Ser Tyr Val Lys Asp Ser Lys Leu Leu Ser Asn

645 650 655

Lys Lys Lys Asp Tyr Leu Leu Thr Glu Glu Asp Ile Ser Lys Ile Glu

660 665 670

Val Lys Gln Lys Phe Ile Glu Arg Asn Leu Val Asp Thr Arg Tyr Ser

675 680 685

Ser Arg Val Val Leu Asn Ala Leu Gln Asp Phe Tyr Lys Ser His Gln

690 695 700

Leu Asp Thr Thr Ile Ser Val Val Arg Gly Gln Phe Thr Ser Gln Leu

705 710 715 720

Arg Arg Lys Trp Gly Ile Glu Lys Ser Arg Glu Thr Tyr His His His

725 730 735

Ala Val Asp Ala Leu Ile Ile Ala Ala Ser Ser Gln Leu Arg Leu Trp

740 745 750

Lys Lys His Ser Asn Pro Leu Ile Ala Tyr Lys Glu Gly Gln Phe Val

755 760 765

Asp Ser Glu Thr Gly Glu Ile Val Ser Leu Ser Asp Glu Glu Tyr Lys

770 775 780

Glu Leu Val Phe Lys Ala Pro Tyr Asp His Phe Val Asp Thr Leu Arg

785 790 795 800

Ser Lys Lys Phe Glu Asp Ser Ile Leu Phe Ser Tyr Gln Val Asp Ser

805 810 815

Lys Tyr Asn Arg Lys Ile Ser Asp Ala Thr Ile Tyr Ala Thr Arg Lys

820 825 830

Ala Lys Leu Asp Lys Glu Lys Lys Glu Tyr Thr Tyr Thr Leu Gly Lys

835 840 845

Ile Lys Asp Ile Tyr Ala Leu Gly Thr Lys Thr Pro Ser Lys Thr Gly

850 855 860

Phe Tyr Lys Phe Leu Asp Leu Tyr Lys Thr Asp Lys Ser Gln Phe Leu

865 870 875 880

Met Tyr Gln Lys Asp Arg Lys Thr Trp Asp Glu Val Ile Glu Lys Ile

885 890 895

Ile Glu Gln Tyr Arg Pro Phe Lys Glu Tyr Asp Lys Asn Gly Lys Glu

900 905 910

Val Asp Phe Asn Pro Phe Glu Lys Tyr Arg Ile Gly Asn Gly Pro Ile

915 920 925

Arg Lys Tyr Ser Lys Lys Gly Asn Gly Pro Glu Ile Lys Ser Leu Lys

930 935 940

Tyr Tyr Asp Ile Leu Leu Gly Lys His Lys Asn Ile Thr Pro Asp Gly

945 950 955 960

Ser Arg Asn Thr Val Ala Leu Leu Ser Leu Asn Pro Trp Arg Thr Asp

965 970 975

Val Tyr Tyr Asn Ser Glu Thr Lys Lys Tyr Glu Phe Leu Gly Leu Lys

980 985 990

Tyr Ala Asp Leu Cys Phe Glu Glu Gly Gly Ala Tyr Gly Ile Ser Glu

995 1000 1005

Val Lys Tyr Lys Lys Ile Arg Glu Lys Glu Gly Ile Gly Lys Asn

1010 1015 1020

Ser Glu Phe Lys Phe Thr Leu Tyr Lys Asn Asp Leu Ile Leu Ile

1025 1030 1035

Lys Asp Thr Glu Thr Asn Cys Gln Gln Phe Phe Arg Phe Trp Ser

1040 1045 1050

Arg Thr Gly Lys Asp Asn Pro Lys Ser Phe Glu Lys His Lys Ile

1055 1060 1065

Glu Leu Lys Pro Tyr Glu Lys Ala Lys Phe Glu Lys Gly Glu Glu

1070 1075 1080

Leu Lys Val Leu Gly Lys Val Pro Pro Ser Ser Asn Gln Phe Gln

1085 1090 1095

Lys Asn Met Gln Ile Glu Asn Leu Ser Ile Tyr Lys Val Lys Thr

1100 1105 1110

Asp Ile Leu Gly Asn Lys His Phe Ile Lys Lys Glu Gly Asp Glu

1115 1120 1125

Pro Lys Leu Lys Phe Lys Lys

1130 1135

<210> 2

<211> 3405

<212> DNA

<213> SgoCas9 D9A nickase

<400> 2

aacggcctgg tgctgggcct ggccatcggc atcgcctctg tgggcgtggg catcctggag 60

aaagacactg gcaagatcat tcacgcttcg agcagactgt tcccagccgc cacagccgac 120

aacaatgtgg agagacggag caatagacag ggcagacggc taaaccggcg gaaaaagcac 180

agatccgtgc ggctgcagga cctgtttgaa ggatacggcc tgctgacaga cttcagcaag 240

gtgtccatga acctgaatcc ctaccagctg cgggtgcagg gaatggaaaa ccagctgacc 300

aacgaggagc tgttcgtggc cctgaagaat atcgtgaaga gaagaggcat cagctacctg 360

gacgatgcca gcgaggacgg cggcaccgtg agtagcgact acggcaaggc tgtggaagaa 420

aacagaaaac tgctggcgga aaagacgccc ggccaaatcc agctggaacg cttcgagaag 480

tatggccagc tgagaggcga cttcaccgtg gaagaaaatg gcgagaagca tagactgatc 540

aacgtgttca gcaccagcgc ctacagaaag gaagctgaac ggatcctgcg gaagcagcag 600

gagttcaaca gcaagatcac agacgagttt attgaggact acctgatcat cctgacagga 660

aaacggaagt actaccacgg acctggcaac gagaagagca gaaccgacta cggcagattc 720

agaaccgacg gcaccaccct ggacaacatc ttcggcatcc tgattggaaa gtgtacattc 780

tacaccgaag agtatcgggc ctctaaggcc agctacacag cccaggagtt caacctgctc 840

aacgatctga acaacctgac cgtgcctacc gagacaaaga aactgagcga ggagcagaag 900

aagctgatca tcgagtacgc caaatctgcc aagaccctcg gcgccagcac cctgctgaaa 960

tatatcgcca aaatgatcga cgccagcgtc gaccagatca gaggctaccg ggtggacgtg 1020

aacaacaagc ccgagatgca caccttcgag gtctaccgaa agatgcagag cctggaaaca 1080

atcaaggtgg aagaactgcc tagaaaggtc ctggatgaac tggcccacat cctcaccctg 1140

aataccgaga gagagggcat cgaggaggcc atcaacagca agctgaagga catcttcaac 1200

cgcgaccagg tgctggagct ggtgcagttc agaaagaaca acagcagtct gttctccaag 1260

ggatggcaca acttcagcat caagctgatg atggaactga tcccagagct gtatgaaaca 1320

tccgaagaac agatgaccat cctgacaaga ctgggcaaac agcgttctaa ggagacctct 1380

aagcggacca aatacatcga tgagaaagaa ctgaccgagg agatctataa ccccgtggtg 1440

gccaaaagcg tccggcaggc catcaagatc atcaacgagg ccactaagaa gtacggcatt 1500

ttcgacaaca tcgtgatcga gatggccaga gaaaacaacg aagaagatgc caagaaagat 1560

tatattaaaa ggcaaaaagc taatcaagat gaaaagaacg ccgccatgga aaaggctgca 1620

ttccagtaca atggcaagaa ggaactgcct gataatatct ttcacggcca caaggagctg 1680

acaacaaaaa ttcggctgtg gcaccagcag ggagaaaagt gcctgtacac cggaaagaat 1740

atccctatct ctgatcttat tcacaaccag tacaagtacg agatcgacca catcctgccc 1800

ctgtccctga gctttgacga ctctctgagc aacaaggttc tggttctggc caccgccaac 1860

caggagaagg gccaaagaac tcctttccag gccctggaca gcatggacga cgcctggagc 1920

tacagagagt tcaagagcta cgtgaaagac tctaaactgc tgtctaacaa gaagaaagac 1980

tacctgttga cagaggagga tatctccaag atcgaggtca agcagaaatt catcgagaga 2040

aatctggtgg ataccagata cagctccaga gtggttctga atgcccttca agacttctac 2100

aagagccacc agctggacac caccatctca gtggtgcggg gccagtttac cagccagctg 2160

cggagaaagt ggggcatcga gaaaagcagg gaaacctacc accaccatgc cgtagacgct 2220

cttatcattg ctgcctctag ccagctgcgg ctgtggaaga agcacagcaa ccctctgatc 2280

gcctataagg agggccagtt tgtggacagc gagacaggcg agatcgtgtc tctgtccgac 2340

gaagaataca aggaactggt gtttaaggcc ccttacgatc actttgtgga taccctgaga 2400

agcaagaaat tcgaagatag catcctgttt agctatcaag tggattctaa gtacaacaga 2460

aagatctccg atgcaacaat ctacgcgacc aggaaggcta agctggataa ggaaaagaag 2520

gagtacacat acaccctcgg aaagatcaaa gatatctacg ccctgggcac aaagacccct 2580

tccaagaccg gattctacaa gttcctggac ctgtacaaga ccgataagag ccagttcctg 2640

atgtaccaaa aggatagaaa gacctgggac gaggtgatcg agaaaatcat cgagcagtac 2700

cggcctttta aggagtacga caagaacggc aaagaggtgg atttcaaccc cttcgagaag 2760

tacagaatcg gcaatggccc catccggaaa tacagcaaga agggcaacgg acctgagatc 2820

aagagtctga aatattacga catcctgctg ggcaaacaca agaacatcac tcctgacgga 2880

tctagaaaca ccgtggccct gctgagcctg aacccttgga gaacagacgt gtactacaac 2940

agcgaaacaa agaagtacga gttcctggga ctcaagtacg ccgacctgtg cttcgaagag 3000

ggcggagcct acggcatcag cgaggtgaag tacaagaaga tcagagaaaa ggagggcatc 3060

ggcaagaata gcgagttcaa gttcaccctg tacaagaacg acctgattct gatcaaggac 3120

accgaaacca actgccagca gttcttcaga ttctggagca gaaccggtaa ggacaaccct 3180

aaatctttcg aaaagcataa gatcgagctg aagccttacg agaaagccaa gttcgagaaa 3240

ggcgaggagc taaaagtgct gggcaaggtg ccaccttctt ccaaccagtt tcagaagaac 3300

atgcaaatcg agaacttgag catctacaag gtcaagacag acatcctggg taacaaacac 3360

tttatcaaaa aggagggaga tgaacccaag ctcaagttca agaag 3405

<210> 3

<211> 235

<212> PRT

<213> BPNLS-ancAPOBEC1

<400> 3

Pro Lys Lys Lys Arg Lys Val Ser Ser Glu Thr Gly Pro Val Ala Val

1 5 10 15

Asp Pro Thr Leu Arg Arg Arg Ile Glu Pro His Glu Phe Glu Val Phe

20 25 30

Phe Asp Pro Arg Glu Leu Arg Lys Glu Thr Cys Leu Leu Tyr Glu Ile

35 40 45

Lys Trp Gly Thr Ser His Lys Ile Trp Arg His Ser Ser Lys Asn Thr

50 55 60

Thr Lys His Val Glu Val Asn Phe Ile Glu Lys Phe Thr Ser Glu Arg

65 70 75 80

His Phe Cys Pro Ser Thr Ser Cys Ser Ile Thr Trp Phe Leu Ser Trp

85 90 95

Ser Pro Cys Gly Glu Cys Ser Lys Ala Ile Thr Glu Phe Leu Ser Gln

100 105 110

His Pro Asn Val Thr Leu Val Ile Tyr Val Ala Arg Leu Tyr His His

115 120 125

Met Asp Gln Gln Asn Arg Gln Gly Leu Arg Asp Leu Val Asn Ser Gly

130 135 140

Val Thr Ile Gln Ile Met Thr Ala Pro Glu Tyr Asp Tyr Cys Trp Arg

145 150 155 160

Asn Phe Val Asn Tyr Pro Pro Gly Lys Glu Ala His Trp Pro Arg Tyr

165 170 175

Pro Pro Leu Trp Met Lys Leu Tyr Ala Leu Glu Leu His Ala Gly Ile

180 185 190

Leu Gly Leu Pro Pro Cys Leu Asn Ile Leu Arg Arg Lys Gln Pro Gln

195 200 205

Leu Thr Phe Phe Thr Ile Ala Leu Gln Ser Cys His Tyr Gln Arg Leu

210 215 220

Pro Pro His Ile Leu Trp Ala Thr Gly Leu Lys

225 230 235

<210> 4

<211> 197

<212> PRT

<213> 2*UGI-BPNLS

<400> 4

Thr Asn Leu Ser Asp Ile Ile Glu Lys Glu Thr Gly Lys Gln Leu Val

1 5 10 15

Ile Gln Glu Ser Ile Leu Met Leu Pro Glu Glu Val Glu Glu Val Ile

20 25 30

Gly Asn Lys Pro Glu Ser Asp Ile Leu Val His Thr Ala Tyr Asp Glu

35 40 45

Ser Thr Asp Glu Asn Val Met Leu Leu Thr Ser Asp Ala Pro Glu Tyr

50 55 60

Lys Pro Trp Ala Leu Val Ile Gln Asp Ser Asn Gly Glu Asn Lys Ile

65 70 75 80

Lys Met Leu Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Thr Asn Leu

85 90 95

Ser Asp Ile Ile Glu Lys Glu Thr Gly Lys Gln Leu Val Ile Gln Glu

100 105 110

Ser Ile Leu Met Leu Pro Glu Glu Val Glu Glu Val Ile Gly Asn Lys

115 120 125

Pro Glu Ser Asp Ile Leu Val His Thr Ala Tyr Asp Glu Ser Thr Asp

130 135 140

Glu Asn Val Met Leu Leu Thr Ser Asp Ala Pro Glu Tyr Lys Pro Trp

145 150 155 160

Ala Leu Val Ile Gln Asp Ser Asn Gly Glu Asn Lys Ile Lys Met Leu

165 170 175

Ser Gly Gly Ser Lys Arg Thr Ala Asp Gly Ser Glu Phe Glu Pro Lys

180 185 190

Lys Lys Arg Lys Val

195

<210> 5

<211> 1609

<212> PRT

<213> SgoCas9-acnBE4max

<400> 5

Pro Lys Lys Lys Arg Lys Val Ser Ser Glu Thr Gly Pro Val Ala Val

1 5 10 15

Asp Pro Thr Leu Arg Arg Arg Ile Glu Pro His Glu Phe Glu Val Phe

20 25 30

Phe Asp Pro Arg Glu Leu Arg Lys Glu Thr Cys Leu Leu Tyr Glu Ile

35 40 45

Lys Trp Gly Thr Ser His Lys Ile Trp Arg His Ser Ser Lys Asn Thr

50 55 60

Thr Lys His Val Glu Val Asn Phe Ile Glu Lys Phe Thr Ser Glu Arg

65 70 75 80

His Phe Cys Pro Ser Thr Ser Cys Ser Ile Thr Trp Phe Leu Ser Trp

85 90 95

Ser Pro Cys Gly Glu Cys Ser Lys Ala Ile Thr Glu Phe Leu Ser Gln

100 105 110

His Pro Asn Val Thr Leu Val Ile Tyr Val Ala Arg Leu Tyr His His

115 120 125

Met Asp Gln Gln Asn Arg Gln Gly Leu Arg Asp Leu Val Asn Ser Gly

130 135 140

Val Thr Ile Gln Ile Met Thr Ala Pro Glu Tyr Asp Tyr Cys Trp Arg

145 150 155 160

Asn Phe Val Asn Tyr Pro Pro Gly Lys Glu Ala His Trp Pro Arg Tyr

165 170 175

Pro Pro Leu Trp Met Lys Leu Tyr Ala Leu Glu Leu His Ala Gly Ile

180 185 190

Leu Gly Leu Pro Pro Cys Leu Asn Ile Leu Arg Arg Lys Gln Pro Gln

195 200 205

Leu Thr Phe Phe Thr Ile Ala Leu Gln Ser Cys His Tyr Gln Arg Leu

210 215 220

Pro Pro His Ile Leu Trp Ala Thr Gly Leu Lys Ser Gly Gly Ser Ser

225 230 235 240

Gly Gly Ser Ser Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr

245 250 255

Pro Glu Ser Ser Gly Gly Ser Ser Gly Gly Ser Asn Gly Leu Val Leu

260 265 270

Gly Leu Ala Ile Gly Ile Ala Ser Val Gly Val Gly Ile Leu Glu Lys

275 280 285

Asp Thr Gly Lys Ile Ile His Ala Ser Ser Arg Leu Phe Pro Ala Ala

290 295 300

Thr Ala Asp Asn Asn Val Glu Arg Arg Ser Asn Arg Gln Gly Arg Arg

305 310 315 320

Leu Asn Arg Arg Lys Lys His Arg Ser Val Arg Leu Gln Asp Leu Phe

325 330 335

Glu Gly Tyr Gly Leu Leu Thr Asp Phe Ser Lys Val Ser Met Asn Leu

340 345 350

Asn Pro Tyr Gln Leu Arg Val Gln Gly Met Glu Asn Gln Leu Thr Asn

355 360 365

Glu Glu Leu Phe Val Ala Leu Lys Asn Ile Val Lys Arg Arg Gly Ile

370 375 380

Ser Tyr Leu Asp Asp Ala Ser Glu Asp Gly Gly Thr Val Ser Ser Asp

385 390 395 400

Tyr Gly Lys Ala Val Glu Glu Asn Arg Lys Leu Leu Ala Glu Lys Thr

405 410 415

Pro Gly Gln Ile Gln Leu Glu Arg Phe Glu Lys Tyr Gly Gln Leu Arg

420 425 430

Gly Asp Phe Thr Val Glu Glu Asn Gly Glu Lys His Arg Leu Ile Asn

435 440 445

Val Phe Ser Thr Ser Ala Tyr Arg Lys Glu Ala Glu Arg Ile Leu Arg

450 455 460

Lys Gln Gln Glu Phe Asn Ser Lys Ile Thr Asp Glu Phe Ile Glu Asp

465 470 475 480

Tyr Leu Ile Ile Leu Thr Gly Lys Arg Lys Tyr Tyr His Gly Pro Gly

485 490 495

Asn Glu Lys Ser Arg Thr Asp Tyr Gly Arg Phe Arg Thr Asp Gly Thr

500 505 510

Thr Leu Asp Asn Ile Phe Gly Ile Leu Ile Gly Lys Cys Thr Phe Tyr

515 520 525

Thr Glu Glu Tyr Arg Ala Ser Lys Ala Ser Tyr Thr Ala Gln Glu Phe

530 535 540

Asn Leu Leu Asn Asp Leu Asn Asn Leu Thr Val Pro Thr Glu Thr Lys

545 550 555 560

Lys Leu Ser Glu Glu Gln Lys Lys Leu Ile Ile Glu Tyr Ala Lys Ser

565 570 575

Ala Lys Thr Leu Gly Ala Ser Thr Leu Leu Lys Tyr Ile Ala Lys Met

580 585 590

Ile Asp Ala Ser Val Asp Gln Ile Arg Gly Tyr Arg Val Asp Val Asn

595 600 605

Asn Lys Pro Glu Met His Thr Phe Glu Val Tyr Arg Lys Met Gln Ser

610 615 620

Leu Glu Thr Ile Lys Val Glu Glu Leu Pro Arg Lys Val Leu Asp Glu

625 630 635 640

Leu Ala His Ile Leu Thr Leu Asn Thr Glu Arg Glu Gly Ile Glu Glu

645 650 655

Ala Ile Asn Ser Lys Leu Lys Asp Ile Phe Asn Arg Asp Gln Val Leu

660 665 670

Glu Leu Val Gln Phe Arg Lys Asn Asn Ser Ser Leu Phe Ser Lys Gly

675 680 685

Trp His Asn Phe Ser Ile Lys Leu Met Met Glu Leu Ile Pro Glu Leu

690 695 700

Tyr Glu Thr Ser Glu Glu Gln Met Thr Ile Leu Thr Arg Leu Gly Lys

705 710 715 720

Gln Arg Ser Lys Glu Thr Ser Lys Arg Thr Lys Tyr Ile Asp Glu Lys

725 730 735

Glu Leu Thr Glu Glu Ile Tyr Asn Pro Val Val Ala Lys Ser Val Arg

740 745 750

Gln Ala Ile Lys Ile Ile Asn Glu Ala Thr Lys Lys Tyr Gly Ile Phe

755 760 765

Asp Asn Ile Val Ile Glu Met Ala Arg Glu Asn Asn Glu Glu Asp Ala

770 775 780

Lys Lys Asp Tyr Ile Lys Arg Gln Lys Ala Asn Gln Asp Glu Lys Asn

785 790 795 800

Ala Ala Met Glu Lys Ala Ala Phe Gln Tyr Asn Gly Lys Lys Glu Leu

805 810 815

Pro Asp Asn Ile Phe His Gly His Lys Glu Leu Thr Thr Lys Ile Arg

820 825 830

Leu Trp His Gln Gln Gly Glu Lys Cys Leu Tyr Thr Gly Lys Asn Ile

835 840 845

Pro Ile Ser Asp Leu Ile His Asn Gln Tyr Lys Tyr Glu Ile Asp His

850 855 860

Ile Leu Pro Leu Ser Leu Ser Phe Asp Asp Ser Leu Ser Asn Lys Val

865 870 875 880

Leu Val Leu Ala Thr Ala Asn Gln Glu Lys Gly Gln Arg Thr Pro Phe

885 890 895

Gln Ala Leu Asp Ser Met Asp Asp Ala Trp Ser Tyr Arg Glu Phe Lys

900 905 910

Ser Tyr Val Lys Asp Ser Lys Leu Leu Ser Asn Lys Lys Lys Asp Tyr

915 920 925

Leu Leu Thr Glu Glu Asp Ile Ser Lys Ile Glu Val Lys Gln Lys Phe

930 935 940

Ile Glu Arg Asn Leu Val Asp Thr Arg Tyr Ser Ser Arg Val Val Leu

945 950 955 960

Asn Ala Leu Gln Asp Phe Tyr Lys Ser His Gln Leu Asp Thr Thr Ile

965 970 975

Ser Val Val Arg Gly Gln Phe Thr Ser Gln Leu Arg Arg Lys Trp Gly

980 985 990

Ile Glu Lys Ser Arg Glu Thr Tyr His His His Ala Val Asp Ala Leu

995 1000 1005

Ile Ile Ala Ala Ser Ser Gln Leu Arg Leu Trp Lys Lys His Ser

1010 1015 1020

Asn Pro Leu Ile Ala Tyr Lys Glu Gly Gln Phe Val Asp Ser Glu

1025 1030 1035

Thr Gly Glu Ile Val Ser Leu Ser Asp Glu Glu Tyr Lys Glu Leu

1040 1045 1050

Val Phe Lys Ala Pro Tyr Asp His Phe Val Asp Thr Leu Arg Ser

1055 1060 1065

Lys Lys Phe Glu Asp Ser Ile Leu Phe Ser Tyr Gln Val Asp Ser

1070 1075 1080

Lys Tyr Asn Arg Lys Ile Ser Asp Ala Thr Ile Tyr Ala Thr Arg

1085 1090 1095

Lys Ala Lys Leu Asp Lys Glu Lys Lys Glu Tyr Thr Tyr Thr Leu

1100 1105 1110

Gly Lys Ile Lys Asp Ile Tyr Ala Leu Gly Thr Lys Thr Pro Ser

1115 1120 1125

Lys Thr Gly Phe Tyr Lys Phe Leu Asp Leu Tyr Lys Thr Asp Lys

1130 1135 1140

Ser Gln Phe Leu Met Tyr Gln Lys Asp Arg Lys Thr Trp Asp Glu

1145 1150 1155

Val Ile Glu Lys Ile Ile Glu Gln Tyr Arg Pro Phe Lys Glu Tyr

1160 1165 1170

Asp Lys Asn Gly Lys Glu Val Asp Phe Asn Pro Phe Glu Lys Tyr

1175 1180 1185

Arg Ile Gly Asn Gly Pro Ile Arg Lys Tyr Ser Lys Lys Gly Asn

1190 1195 1200

Gly Pro Glu Ile Lys Ser Leu Lys Tyr Tyr Asp Ile Leu Leu Gly

1205 1210 1215

Lys His Lys Asn Ile Thr Pro Asp Gly Ser Arg Asn Thr Val Ala

1220 1225 1230

Leu Leu Ser Leu Asn Pro Trp Arg Thr Asp Val Tyr Tyr Asn Ser

1235 1240 1245

Glu Thr Lys Lys Tyr Glu Phe Leu Gly Leu Lys Tyr Ala Asp Leu

1250 1255 1260

Cys Phe Glu Glu Gly Gly Ala Tyr Gly Ile Ser Glu Val Lys Tyr

1265 1270 1275

Lys Lys Ile Arg Glu Lys Glu Gly Ile Gly Lys Asn Ser Glu Phe

1280 1285 1290

Lys Phe Thr Leu Tyr Lys Asn Asp Leu Ile Leu Ile Lys Asp Thr

1295 1300 1305

Glu Thr Asn Cys Gln Gln Phe Phe Arg Phe Trp Ser Arg Thr Gly

1310 1315 1320

Lys Asp Asn Pro Lys Ser Phe Glu Lys His Lys Ile Glu Leu Lys

1325 1330 1335

Pro Tyr Glu Lys Ala Lys Phe Glu Lys Gly Glu Glu Leu Lys Val

1340 1345 1350

Leu Gly Lys Val Pro Pro Ser Ser Asn Gln Phe Gln Lys Asn Met

1355 1360 1365

Gln Ile Glu Asn Leu Ser Ile Tyr Lys Val Lys Thr Asp Ile Leu

1370 1375 1380

Gly Asn Lys His Phe Ile Lys Lys Glu Gly Asp Glu Pro Lys Leu

1385 1390 1395

Lys Phe Lys Lys Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Thr

1400 1405 1410

Asn Leu Ser Asp Ile Ile Glu Lys Glu Thr Gly Lys Gln Leu Val

1415 1420 1425

Ile Gln Glu Ser Ile Leu Met Leu Pro Glu Glu Val Glu Glu Val

1430 1435 1440

Ile Gly Asn Lys Pro Glu Ser Asp Ile Leu Val His Thr Ala Tyr

1445 1450 1455

Asp Glu Ser Thr Asp Glu Asn Val Met Leu Leu Thr Ser Asp Ala

1460 1465 1470

Pro Glu Tyr Lys Pro Trp Ala Leu Val Ile Gln Asp Ser Asn Gly

1475 1480 1485

Glu Asn Lys Ile Lys Met Leu Ser Gly Gly Ser Gly Gly Ser Gly

1490 1495 1500

Gly Ser Thr Asn Leu Ser Asp Ile Ile Glu Lys Glu Thr Gly Lys

1505 1510 1515

Gln Leu Val Ile Gln Glu Ser Ile Leu Met Leu Pro Glu Glu Val

1520 1525 1530

Glu Glu Val Ile Gly Asn Lys Pro Glu Ser Asp Ile Leu Val His

1535 1540 1545

Thr Ala Tyr Asp Glu Ser Thr Asp Glu Asn Val Met Leu Leu Thr

1550 1555 1560

Ser Asp Ala Pro Glu Tyr Lys Pro Trp Ala Leu Val Ile Gln Asp

1565 1570 1575

Ser Asn Gly Glu Asn Lys Ile Lys Met Leu Ser Gly Gly Ser Lys

1580 1585 1590

Arg Thr Ala Asp Gly Ser Glu Phe Glu Pro Lys Lys Lys Arg Lys

1595 1600 1605

Val

<210> 6

<211> 4827

<212> DNA

<213> SgoCas9-acnBE4max

<400> 6

ccaaagaaga agcggaaagt cagcagtgaa accggaccag tggcagtgga cccaaccctg 60

aggagacgga ttgagcccca tgaatttgaa gtgttctttg acccaaggga gctgaggaag 120

gagacatgcc tgctgtacga gatcaagtgg ggcacaagcc acaagatctg gcgccacagc 180

tccaagaaca ccacaaagca cgtggaagtg aatttcatcg agaagtttac ctccgagcgg 240

cacttctgcc cctctaccag ctgttccatc acatggtttc tgtcttggag cccttgcggc 300

gagtgttcca aggccatcac cgagttcctg tctcagcacc ctaacgtgac cctggtcatc 360

tacgtggccc ggctgtatca ccacatggac cagcagaaca ggcagggcct gcgcgatctg 420

gtgaattctg gcgtgaccat ccagatcatg acagccccag agtacgacta ttgctggcgg 480

aacttcgtga attatccacc tggcaaggag gcacactggc caagataccc acccctgtgg 540

atgaagctgt atgcactgga gctgcacgca ggaatcctgg gcctgcctcc atgtctgaat 600

atcctgcgga gaaagcagcc ccagctgaca tttttcacca ttgctctgca gtcttgtcac 660

tatcagcggc tgcctcctca tattctgtgg gctacaggcc tgaagtctgg aggatctagc 720

ggaggatcct ctggcagcga gacaccagga acaagcgagt cagcaacacc agagagcagt 780

ggcggcagca gcggcggcag caacggcctg gtgctgggcc tggccatcgg catcgcctct 840

gtgggcgtgg gcatcctgga gaaagacact ggcaagatca ttcacgcttc gagcagactg 900

ttcccagccg ccacagccga caacaatgtg gagagacgga gcaatagaca gggcagacgg 960

ctaaaccggc ggaaaaagca cagatccgtg cggctgcagg acctgtttga aggatacggc 1020

ctgctgacag acttcagcaa ggtgtccatg aacctgaatc cctaccagct gcgggtgcag 1080

ggaatggaaa accagctgac caacgaggag ctgttcgtgg ccctgaagaa tatcgtgaag 1140

agaagaggca tcagctacct ggacgatgcc agcgaggacg gcggcaccgt gagtagcgac 1200

tacggcaagg ctgtggaaga aaacagaaaa ctgctggcgg aaaagacgcc cggccaaatc 1260

cagctggaac gcttcgagaa gtatggccag ctgagaggcg acttcaccgt ggaagaaaat 1320

ggcgagaagc atagactgat caacgtgttc agcaccagcg cctacagaaa ggaagctgaa 1380

cggatcctgc ggaagcagca ggagttcaac agcaagatca cagacgagtt tattgaggac 1440

tacctgatca tcctgacagg aaaacggaag tactaccacg gacctggcaa cgagaagagc 1500

agaaccgact acggcagatt cagaaccgac ggcaccaccc tggacaacat cttcggcatc 1560

ctgattggaa agtgtacatt ctacaccgaa gagtatcggg cctctaaggc cagctacaca 1620

gcccaggagt tcaacctgct caacgatctg aacaacctga ccgtgcctac cgagacaaag 1680

aaactgagcg aggagcagaa gaagctgatc atcgagtacg ccaaatctgc caagaccctc 1740

ggcgccagca ccctgctgaa atatatcgcc aaaatgatcg acgccagcgt cgaccagatc 1800

agaggctacc gggtggacgt gaacaacaag cccgagatgc acaccttcga ggtctaccga 1860

aagatgcaga gcctggaaac aatcaaggtg gaagaactgc ctagaaaggt cctggatgaa 1920

ctggcccaca tcctcaccct gaataccgag agagagggca tcgaggaggc catcaacagc 1980

aagctgaagg acatcttcaa ccgcgaccag gtgctggagc tggtgcagtt cagaaagaac 2040

aacagcagtc tgttctccaa gggatggcac aacttcagca tcaagctgat gatggaactg 2100

atcccagagc tgtatgaaac atccgaagaa cagatgacca tcctgacaag actgggcaaa 2160

cagcgttcta aggagacctc taagcggacc aaatacatcg atgagaaaga actgaccgag 2220

gagatctata accccgtggt ggccaaaagc gtccggcagg ccatcaagat catcaacgag 2280

gccactaaga agtacggcat tttcgacaac atcgtgatcg agatggccag agaaaacaac 2340

gaagaagatg ccaagaaaga ttatattaaa aggcaaaaag ctaatcaaga tgaaaagaac 2400

gccgccatgg aaaaggctgc attccagtac aatggcaaga aggaactgcc tgataatatc 2460

tttcacggcc acaaggagct gacaacaaaa attcggctgt ggcaccagca gggagaaaag 2520

tgcctgtaca ccggaaagaa tatccctatc tctgatctta ttcacaacca gtacaagtac 2580

gagatcgacc acatcctgcc cctgtccctg agctttgacg actctctgag caacaaggtt 2640

ctggttctgg ccaccgccaa ccaggagaag ggccaaagaa ctcctttcca ggccctggac 2700

agcatggacg acgcctggag ctacagagag ttcaagagct acgtgaaaga ctctaaactg 2760

ctgtctaaca agaagaaaga ctacctgttg acagaggagg atatctccaa gatcgaggtc 2820

aagcagaaat tcatcgagag aaatctggtg gataccagat acagctccag agtggttctg 2880

aatgcccttc aagacttcta caagagccac cagctggaca ccaccatctc agtggtgcgg 2940

ggccagttta ccagccagct gcggagaaag tggggcatcg agaaaagcag ggaaacctac 3000

caccaccatg ccgtagacgc tcttatcatt gctgcctcta gccagctgcg gctgtggaag 3060

aagcacagca accctctgat cgcctataag gagggccagt ttgtggacag cgagacaggc 3120

gagatcgtgt ctctgtccga cgaagaatac aaggaactgg tgtttaaggc cccttacgat 3180

cactttgtgg ataccctgag aagcaagaaa ttcgaagata gcatcctgtt tagctatcaa 3240

gtggattcta agtacaacag aaagatctcc gatgcaacaa tctacgcgac caggaaggct 3300

aagctggata aggaaaagaa ggagtacaca tacaccctcg gaaagatcaa agatatctac 3360

gccctgggca caaagacccc ttccaagacc ggattctaca agttcctgga cctgtacaag 3420

accgataaga gccagttcct gatgtaccaa aaggatagaa agacctggga cgaggtgatc 3480

gagaaaatca tcgagcagta ccggcctttt aaggagtacg acaagaacgg caaagaggtg 3540

gatttcaacc ccttcgagaa gtacagaatc ggcaatggcc ccatccggaa atacagcaag 3600

aagggcaacg gacctgagat caagagtctg aaatattacg acatcctgct gggcaaacac 3660

aagaacatca ctcctgacgg atctagaaac accgtggccc tgctgagcct gaacccttgg 3720

agaacagacg tgtactacaa cagcgaaaca aagaagtacg agttcctggg actcaagtac 3780

gccgacctgt gcttcgaaga gggcggagcc tacggcatca gcgaggtgaa gtacaagaag 3840

atcagagaaa aggagggcat cggcaagaat agcgagttca agttcaccct gtacaagaac 3900

gacctgattc tgatcaagga caccgaaacc aactgccagc agttcttcag attctggagc 3960

agaaccggta aggacaaccc taaatctttc gaaaagcata agatcgagct gaagccttac 4020

gagaaagcca agttcgagaa aggcgaggag ctaaaagtgc tgggcaaggt gccaccttct 4080

tccaaccagt ttcagaagaa catgcaaatc gagaacttga gcatctacaa ggtcaagaca 4140

gacatcctgg gtaacaaaca ctttatcaaa aaggagggag atgaacccaa gctcaagttc 4200

aagaagagcg gcgggagcgg cgggagcggg gggagcacta atctgagcga catcattgag 4260

aaggagactg ggaaacagct ggtcattcag gagtccatcc tgatgctgcc tgaggaggtg 4320

gaggaagtga tcggcaacaa gccagagtct gacatcctgg tgcacaccgc ctacgacgag 4380

tccacagatg agaatgtgat gctgctgacc tctgacgccc ccgagtataa gccttgggcc 4440

ctggtcatcc aggattctaa cggcgagaat aagatcaaga tgctgagcgg aggatccgga 4500

ggatctggag gcagcaccaa cctgtctgac atcatcgaga aggagacagg caagcagctg 4560

gtcatccagg agagcatcct gatgctgccc gaagaagtcg aagaagtgat cggaaacaag 4620

cctgagagcg atatcctggt ccataccgcc tacgacgaga gtaccgacga aaatgtgatg 4680

ctgctgacat ccgacgcccc agagtataag ccctgggctc tggtcatcca ggattccaac 4740

ggagagaaca aaatcaaaat gctgtctggc ggctcaaaaa gaaccgccga cggcagcgaa 4800

ttcgagccca agaagaagag gaaagtc 4827

<210> 7

<211> 4941

<212> DNA

<213> pGL3-U6-Sgo gRNA insert site-scaffold

<400> 7

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg tgagaccgag agagggtctc agtttttgta ctctcaagga aacttgcaga 300

agctacaaag ataaggcttc atgccgaatt caacaccctg tcatttatgg cggggtgttt 360

ttttttttaa agaattctcg acctcgagac aaatggcagt attcatccac aattttaaaa 420

gaaaaggggg gattgggggg tacagtgcag gggaaagaat agtagacata atagcaacag 480

acatacaaac taaagaatta caaaaacaaa ttacaaaaat tcaaaatttt cgggtttatt 540

acagggacag cagagatcca ctttggccgc ggctcgaggg ggttggggtt gcgccttttc 600

caaggcagcc ctgggtttgc gcagggacgc ggctgctctg ggcgtggttc cgggaaacgc 660

agcggcgccg accctgggac tcgcacattc ttcacgtccg ttcgcagcgt cacccggatc 720

ttcgccgcta cccttgtggg ccccccggcg acgcttcctg ctccgcccct aagtcgggaa 780

ggttccttgc ggttcgcggc gtgccggacg tgacaaacgg aagccgcacg tctcactagt 840

accctcgcag acggacagcg ccagggagca atggcagcgc gccgaccgcg atgggctgtg 900

gccaatagcg gctgctcagc agggcgcgcc gagagcagcg gccgggaagg ggcggtgcgg 960

gaggcggggt gtggggcggt agtgtgggcc ctgttcctgc ccgcgcggtg ttccgcattc 1020

tgcaagcctc cggagcgcac gtcggcagtc ggctccctcg ttgaccgaat caccgacctc 1080

tctccccagg gggatccatg gtgagcaagg gcgaggagct gttcaccggg gtggtgccca 1140

tcctggtcga gctggacggc gacgtaaacg gccacaagtt cagcgtgtcc ggcgagggcg 1200

agggcgatgc cacctacggc aagctgaccc tgaagttcat ctgcaccacc ggcaagctgc 1260

ccgtgccctg gcccaccctc gtgaccaccc tgacctacgg cgtgcagtgc ttcagccgct 1320

accccgacca catgaagcag cacgacttct tcaagtccgc catgcccgaa ggctacgtcc 1380

aggagcgcac catcttcttc aaggacgacg gcaactacaa gacccgcgcc gaggtgaagt 1440

tcgagggcga caccctggtg aaccgcatcg agctgaaggg catcgacttc aaggaggacg 1500

gcaacatcct ggggcacaag ctggagtaca actacaacag ccacaacgtc tatatcatgg 1560

ccgacaagca gaagaacggc atcaaggtga acttcaagat ccgccacaac atcgaggacg 1620

gcagcgtgca gctcgccgac cactaccagc agaacacccc catcggcgac ggccccgtgc 1680

tgctgcccga caaccactac ctgagcaccc agtccgccct gagcaaagac cccaacgaga 1740

agcgcgatca catggtcctg ctggagttcg tgaccgccgc cgggatcact ctcggcatgg 1800

acgagctgta caagtaaagc ggccgcgact ctagatcata atcagccata ccacatttgt 1860

agaggtttta cttgctttaa aaaacctccc acacctcccc ctgaacctga aacataaaat 1920

gaatgcaatt gttgttgtta acttgtttat tgcagcttat aatggttaca aataaagcaa 1980

tagcatcaca aatttcacaa ataaagcatt tttttcactg cattctagtt gtggtttgtc 2040

caaactcatc aatgtatctt agtcgaccga tgcccttgag agccttcaac ccagtcagct 2100

ccttccggtg ggcgcggggc atgactatcg tcgccgcact tatgactgtc ttctttatca 2160

tgcaactcgt aggacaggtg ccggcagcgc tcttccgctt cctcgctcac tgactcgctg 2220

cgctcggtcg ttcggctgcg gcgagcggta tcagctcact caaaggcggt aatacggtta 2280

tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc 2340

aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc ccctgacgag 2400

catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact ataaagatac 2460

caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct gccgcttacc 2520

ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcatag ctcacgctgt 2580

aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc 2640

gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa cccggtaaga 2700

cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc gaggtatgta 2760

ggcggtgcta cagagttctt gaagtggtgg cctaactacg gctacactag aagaacagta 2820

tttggtatct gcgctctgct gaagccagtt accttcggaa aaagagttgg tagctcttga 2880

tccggcaaac aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg 2940

cgcagaaaaa aaggatctca agaagatcct ttgatctttt ctacggggtc tgacgctcag 3000

tggaacgaaa actcacgtta agggattttg gtcatgagat tatcaaaaag gatcttcacc 3060

tagatccttt taaattaaaa atgaagtttt aaatcaatct aaagtatata tgagtaaact 3120

tggtctgaca gttaccaatg cttaatcagt gaggcaccta tctcagcgat ctgtctattt 3180

cgttcatcca tagttgcctg actccccgtc gtgtagataa ctacgatacg ggagggctta 3240

ccatctggcc ccagtgctgc aatgataccg cgggacccac gctcaccggc tccagattta 3300

tcagcaataa accagccagc cggaagggcc gagcgcagaa gtggtcctgc aactttatcc 3360

gcctccatcc agtctattaa ttgttgccgg gaagctagag taagtagttc gccagttaat 3420

agtttgcgca acgttgttgc cattgctaca ggcatcgtgg tgtcacgctc gtcgtttggt 3480

atggcttcat tcagctccgg ttcccaacga tcaaggcgag ttacatgatc ccccatgttg 3540

tgcaaaaaag cggttagctc cttcggtcct ccgatcgttg tcagaagtaa gttggccgca 3600

gtgttatcac tcatggttat ggcagcactg cataattctc ttactgtcat gccatccgta 3660

agatgctttt ctgtgactgg tgagtactca accaagtcat tctgagaata gtgtatgcgg 3720

cgaccgagtt gctcttgccc ggcgtcaata cgggataata ccgcgccaca tagcagaact 3780

ttaaaagtgc tcatcattgg aaaacgttct tcggggcgaa aactctcaag gatcttaccg 3840

ctgttgagat ccagttcgat gtaacccact cgtgcaccca actgatcttc agcatctttt 3900

actttcacca gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga 3960

ataagggcga cacggaaatg ttgaatactc atactcttcc tttttcaata ttattgaagc 4020

atttatcagg gttattgtct catgagcgga tacatatttg aatgtattta gaaaaataaa 4080

caaatagggg ttccgcgcac atttccccga aaagtgccac ctgacgcgcc ctgtagcggc 4140

gcattaagcg cggcgggtgt ggtggttacg cgcagcgtga ccgctacact tgccagcgcc 4200

ctagcgcccg ctcctttcgc tttcttccct tcctttctcg ccacgttcgc cggctttccc 4260

cgtcaagctc taaatcgggg gctcccttta gggttccgat ttagtgcttt acggcacctc 4320

gaccccaaaa aacttgatta gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg 4380

gtttttcgcc ctttgacgtt ggagtccacg ttctttaata gtggactctt gttccaaact 4440

ggaacaacac tcaaccctat ctcggtctat tcttttgatt tataagggat tttgccgatt 4500

tcggcctatt ggttaaaaaa tgagctgatt taacaaaaat ttaacgcgaa ttttaacaaa 4560

atattaacgc ttacaatttg ccattcgcca ttcaggctgc gcaactgttg ggaagggcga 4620

tcggtgcggg cctcttcgct attacgccag cccaagctac catgataagt aagtaatatt 4680

aaggtacggg aggtacttgg agcggccgca ataaaatatc tttattttca ttacatctgt 4740

gtgttggttt tttgtgtgaa tcgatagtac taacatacgc tctccatcaa aacaaaacga 4800

aacaaaacaa actagcaaaa taggctgtcc ccagtgcaag tgcaggtgcc agaacatttc 4860

tctatcgata ggtaccgatt agtgaacgga tctcgacggt atcgatcacg agactagcct 4920

cgagcggccg cccccttcac c 4941

<210> 8

<211> 7

<212> PRT

<213> nucleic acid localization signal polypeptide

<400> 8

Pro Lys Lys Lys Arg Lys Val

1 5

<210> 9

<211> 3785

<212> DNA

<213> 32aa linker-SgoCas9 D9A-10aa linker-UGI

<400> 9

agcggaggat cctctggcag cgagacacca ggaacaagcg agtcagcaac accagagagc 60

agtggcggca gcagcggcgg cagcaacggc ctggtgctgg gcctggccat cggcatcgcc 120

tctgtgggcg tgggcatcct ggagaaagac actggcaaga tcattcacgc ttcgagcaga 180

ctgttcccag ccgccacagc cgacaacaat gtggagagac ggagcaatag acagggcaga 240

cggctaaacc ggcggaaaaa gcacagatcc gtgcggctgc aggacctgtt tgaaggatac 300

ggcctgctga cagacttcag caaggtgtcc atgaacctga atccctacca gctgcgggtg 360

cagggaatgg aaaaccagct gaccaacgag gagctgttcg tggccctgaa gaatatcgtg 420

aagagaagag gcatcagcta cctggacgat gccagcgagg acggcggcac cgtgagtagc 480

gactacggca aggctgtgga agaaaacaga aaactgctgg cggaaaagac gcccggccaa 540

atccagctgg aacgcttcga gaagtatggc cagctgagag gcgacttcac cgtggaagaa 600

aatggcgaga agcatagact gatcaacgtg ttcagcacca gcgcctacag aaaggaagct 660

gaacggatcc tgcggaagca gcaggagttc aacagcaaga tcacagacga gtttattgag 720

gactacctga tcatcctgac aggaaaacgg aagtactacc acggacctgg caacgagaag 780

agcagaaccg actacggcag attcagaacc gacggcacca ccctggacaa catcttcggc 840

atcctgattg gaaagtgtac attctacacc gaagagtatc gggcctctaa ggccagctac 900

acagcccagg agttcaacct gctcaacgat ctgaacaacc tgaccgtgcc taccgagaca 960

aagaaactga gcgaggagca gaagaagctg atcatcgagt acgccaaatc tgccaagacc 1020

ctcggcgcca gcaccctgct gaaatatatc gccaaaatga tcgacgccag cgtcgaccag 1080

atcagaggct accgggtgga cgtgaacaac aagcccgaga tgcacacctt cgaggtctac 1140

cgaaagatgc agagcctgga aacaatcaag gtggaagaac tgcctagaaa ggtcctggat 1200

gaactggccc acatcctcac cctgaatacc gagagagagg gcatcgagga ggccatcaac 1260

agcaagctga aggacatctt caaccgcgac caggtgctgg agctggtgca gttcagaaag 1320

aacaacagca gtctgttctc caagggatgg cacaacttca gcatcaagct gatgatggaa 1380

ctgatcccag agctgtatga aacatccgaa gaacagatga ccatcctgac aagactgggc 1440

aaacagcgtt ctaaggagac ctctaagcgg accaaataca tcgatgagaa agaactgacc 1500

gaggagatct ataaccccgt ggtggccaaa agcgtccggc aggccatcaa gatcatcaac 1560

gaggccacta agaagtacgg cattttcgac aacatcgtga tcgagatggc cagagaaaac 1620

aacgaagaag atgccaagaa agattatatt aaaaggcaaa aagctaatca agatgaaaag 1680

aacgccgcca tggaaaaggc tgcattccag tacaatggca agaaggaact gcctgataat 1740

atctttcacg gccacaagga gctgacaaca aaaattcggc tgtggcacca gcagggagaa 1800

aagtgcctgt acaccggaaa gaatatccct atctctgatc ttattcacaa ccagtacaag 1860

tacgagatcg accacatcct gcccctgtcc ctgagctttg acgactctct gagcaacaag 1920

gttctggttc tggccaccgc caaccaggag aagggccaaa gaactccttt ccaggccctg 1980

gacagcatgg acgacgcctg gagctacaga gagttcaaga gctacgtgaa agactctaaa 2040

ctgctgtcta acaagaagaa agactacctg ttgacagagg aggatatctc caagatcgag 2100

gtcaagcaga aattcatcga gagaaatctg gtggatacca gatacagctc cagagtggtt 2160

ctgaatgccc ttcaagactt ctacaagagc caccagctgg acaccaccat ctcagtggtg 2220

cggggccagt ttaccagcca gctgcggaga aagtggggca tcgagaaaag cagggaaacc 2280

taccaccacc atgccgtaga cgctcttatc attgctgcct ctagccagct gcggctgtgg 2340

aagaagcaca gcaaccctct gatcgcctat aaggagggcc agtttgtgga cagcgagaca 2400

ggcgagatcg tgtctctgtc cgacgaagaa tacaaggaac tggtgtttaa ggccccttac 2460

gatcactttg tggataccct gagaagcaag aaattcgaag atagcatcct gtttagctat 2520

caagtggatt ctaagtacaa cagaaagatc tccgatgcaa caatctacgc gaccaggaag 2580

gctaagctgg ataaggaaaa gaaggagtac acatacaccc tcggaaagat caaagatatc 2640

tacgccctgg gcacaaagac cccttccaag accggattct acaagttcct ggacctgtac 2700

aagaccgata agagccagtt cctgatgtac caaaaggata gaaagacctg ggacgaggtg 2760

atcgagaaaa tcatcgagca gtaccggcct tttaaggagt acgacaagaa cggcaaagag 2820

gtggatttca accccttcga gaagtacaga atcggcaatg gccccatccg gaaatacagc 2880

aagaagggca acggacctga gatcaagagt ctgaaatatt acgacatcct gctgggcaaa 2940

cacaagaaca tcactcctga cggatctaga aacaccgtgg ccctgctgag cctgaaccct 3000

tggagaacag acgtgtacta caacagcgaa acaaagaagt acgagttcct gggactcaag 3060

tacgccgacc tgtgcttcga agagggcgga gcctacggca tcagcgaggt gaagtacaag 3120

aagatcagag aaaaggaggg catcggcaag aatagcgagt tcaagttcac cctgtacaag 3180

aacgacctga ttctgatcaa ggacaccgaa accaactgcc agcagttctt cagattctgg 3240

agcagaaccg gtaaggacaa ccctaaatct ttcgaaaagc ataagatcga gctgaagcct 3300

tacgagaaag ccaagttcga gaaaggcgag gagctaaaag tgctgggcaa ggtgccacct 3360

tcttccaacc agtttcagaa gaacatgcaa atcgagaact tgagcatcta caaggtcaag 3420

acagacatcc tgggtaacaa acactttatc aaaaaggagg gagatgaacc caagctcaag 3480

ttcaagaaga gcggcgggag cggcgggagc ggggggagca ctaatctgag cgacatcatt 3540

gagaaggaga ctgggaaaca gctggtcatt caggagtcca tcctgatgct gcctgaggag 3600

gtggaggaag tgatcggcaa caagccagag tctgacatcc tggtgcacac cgcctacgac 3660

gagtccacag atgagaatgt gatgctgctg acctctgacg cccccgagta taagccttgg 3720

gccctggtca tccaggattc taacggcgag aataagatca agatgctgag cggaggatcc 3780

ggagg 3785

Claims (5)

1. A fusion protein comprising a codon-optimized Cas9 nicakase homologous protein derived from streptococcus gordonae, a cytosine deaminase, and a uracil glycosylase inhibiting protein;

the amino acid sequence of the Cas9 nicase homologous protein is the amino acid sequence at the 2 nd to 1136 th sites of the N end of the SgoCas9D9A nicase shown in SEQ ID NO. 1;

the fusion protein also comprises N-terminal BPNLS-ancAPEC 1 polypeptide and C-terminal 2 x UGI-BPNLS polypeptide; wherein, the BPNLS-ancAPECE 1 polypeptide is formed by fusing BPNLS polypeptide and ancAPECE 1 polypeptide; 2 UGI-BPNLS polypeptide is formed by fusing UGI polypeptide and BPNLS polypeptide;

the amino acid sequence of the BPNLS-ancAPECC 1 polypeptide is the amino acid sequence shown in SEQ ID NO. 3;

the amino acid sequence of the 2-UGI-BPNLS polypeptide is the amino acid sequence shown in SEQ ID NO. 4;

the fusion protein also comprises a nucleic acid positioning signal polypeptide segment, and the amino acid sequence of the nucleic acid positioning signal polypeptide segment is shown as SEQ ID NO. 8;

the fusion protein sequentially comprises BPNLS polypeptide, ancAPECC 1 polypeptide, 32aa linker, amino acid sequences from 2 th to 1136 th sites of the N end of SgoCas9D9A nickase, 10aa linker, 2 x UGI polypeptide and BPNLS polypeptide from the N end to the C end;

the amino acid complete sequence of the fusion protein is an amino acid sequence shown in SEQ ID NO. 5;

the fusion protein recognizes NNAAAG as PAM, wherein N represents an arbitrary base; the fusion protein edits cytosine base into thymine at 8-14 sites of the 5' end of the gRNA of the editing window.

2. A polynucleotide sequence, wherein the polynucleotide sequence encodes the fusion protein of claim 1; the polynucleotide sequence is shown in SEQ ID NO. 6.

3. A cytosine single base editor obtained by integrating a polynucleotide sequence encoding the fusion protein of claim 1 into an expression vector; the cytosine single base editor recognizes NNAAAG as PAM, where N represents an arbitrary base; the cytosine single base editor edits cytosine base into thymine at 8-14 sites of the 5' end of the gRNA of the editing window.

4. The cytosine single-base editor of claim 3, wherein the expression vector comprises a gRNA scaffold derived from a concatemeric repeat sequence of Gordonia streptococcus, and the nucleotide sequence of the expression vector is shown in SEQ ID NO. 7.

5. A cell expression system comprising the cytosine single base editor of claim 3 or 4; the cell is a host cell which is a eukaryotic cell; the eukaryotic cell is a mouse brain neuroma cell, a human embryonic kidney cell or a human colon cancer cell.

Images