KR101959020B1 - Peptides Having Activity for Wrinkle Relief and Uses Thereof - Google Patents

Peptides Having Activity for Wrinkle Relief and Uses Thereof Download PDF

Info

Publication number
KR101959020B1
KR101959020B1 KR1020190004868A KR20190004868A KR101959020B1 KR 101959020 B1 KR101959020 B1 KR 101959020B1 KR 1020190004868 A KR1020190004868 A KR 1020190004868A KR 20190004868 A KR20190004868 A KR 20190004868A KR 101959020 B1 KR101959020 B1 KR 101959020B1
Authority
KR
South Korea
Prior art keywords
seq
amino acid
acid sequence
peptide
present
Prior art date
Application number
KR1020190004868A
Other languages
Korean (ko)
Other versions
KR20190024915A (en
Inventor
정용지
김은미
이응지
Original Assignee
(주)케어젠
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)케어젠 filed Critical (주)케어젠
Priority to KR1020190004868A priority Critical patent/KR101959020B1/en
Publication of KR20190024915A publication Critical patent/KR20190024915A/en
Application granted granted Critical
Publication of KR101959020B1 publication Critical patent/KR101959020B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K5/00Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
    • C07K5/04Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
    • C07K5/10Tetrapeptides
    • C07K5/1002Tetrapeptides with the first amino acid being neutral
    • C07K5/1005Tetrapeptides with the first amino acid being neutral and aliphatic
    • C07K5/1008Tetrapeptides with the first amino acid being neutral and aliphatic the side chain containing 0 or 1 carbon atoms, i.e. Gly, Ala
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/17Amino acids, peptides or proteins
    • A23L33/18Peptides; Protein hydrolysates
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64Proteins; Peptides; Derivatives or degradation products thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • A61Q19/02Preparations for care of the skin for chemically bleaching or whitening the skin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • A61Q19/08Anti-ageing preparations
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K7/00Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04Linear peptides containing only normal peptide links
    • C07K7/06Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K7/00Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04Linear peptides containing only normal peptide links
    • C07K7/08Linear peptides containing only normal peptide links having 12 to 20 amino acids
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00Food compositions, function of food ingredients or processes for food or foodstuffs
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00Function of food ingredients
    • A23V2200/30Foods, ingredients or supplements having a functional effect on health
    • A23V2200/318Foods, ingredients or supplements having a functional effect on health having an effect on skin health and hair or coat

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Dermatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Gerontology & Geriatric Medicine (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • Nutrition Science (AREA)
  • Mycology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Birds (AREA)
  • Cosmetics (AREA)
  • Peptides Or Proteins (AREA)

Abstract

본 발명은 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드, 상기 펩타이드를 포함하는 피부 질환 예방 또는 치료용 약제학적 조성물, 상기 펩타이드를 포함하는 피부 상태 개선용 화장품 조성물, 상기 펩타이드를 포함하는 피부 상태 개선용 식품 조성물, 상기 펩타이드를 이용한 피부 질환 예방 또는 치료 방법 및 상기 펩타이드의 피부 상태 개선 용도에 관한 것이다.The present invention relates to a peptide comprising the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4, a pharmaceutical composition for preventing or treating skin diseases containing the peptide, a cosmetic composition for improving skin condition comprising the peptide, A method for preventing or treating skin diseases using the peptide, and a use of improving the skin condition of the peptide.

Description

주름 개선 활성을 나타내는 펩타이드 및 이의 용도{Peptides Having Activity for Wrinkle Relief and Uses Thereof}Peptides having activity for wrinkle relief and uses thereof {Peptides Having Activity for Wrinkle Relief and Uses Thereof}

본 발명은 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드, 상기 펩타이드를 포함하는 피부 질환 예방 또는 치료용 약제학적 조성물, 상기 펩타이드를 포함하는 피부 상태 개선용 화장품 조성물, 상기 펩타이드를 포함하는 피부 상태 개선용 식품 조성물, 상기 펩타이드를 이용한 피부 질환 예방 또는 치료 방법 및 상기 펩타이드의 피부 상태 개선 용도에 관한 것이다.The present invention comprises a peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4, a pharmaceutical composition for preventing or treating skin diseases comprising the peptide, a cosmetic composition for improving skin conditions comprising the peptide, and the peptide It relates to a food composition for improving skin conditions, a method for preventing or treating skin diseases using the peptide, and a use of the peptide for improving skin conditions.

인간의 피부는 끊임없이 변화를 겪게 되며, 그 중 가장 대표적인 것이 노화에 의한 피부의 기능 저하 및 시각적인 아름다움의 감소이다. 피부의 노화는 크게 유전적 요소에 따른 내인성 노화와 태양광선 등의 외부 환경적 요소에 따른 외인성 노화로 구분된다. Human skin is constantly undergoing changes, the most representative of which is the decline in skin function and visual beauty due to aging. Skin aging is largely divided into endogenous aging according to genetic factors and exogenous aging according to external environmental factors such as sunlight.

노화는 피부의 주름을 형성시키며, 대표적인 주름 형성의 인자로서 활성 산소, 자외선 및 콜라겐의 생합성 감소 등을 들 수 있다. 피부의 내인성 노화의 경우 인위적인 조절이 불가능하나, 외인성 노화의 경우 활성산소 제거, 섬유아세포의 증식 및 콜라겐의 생합성 촉진 등을 통하여 노화를 예방, 치료 또는 지연시킬 수 있다.Aging forms wrinkles in the skin, and representative factors for wrinkle formation include reduced biosynthesis of active oxygen, ultraviolet rays, and collagen. In the case of endogenous aging of the skin, artificial control is not possible, but in the case of exogenous aging, aging can be prevented, treated or delayed through the removal of active oxygen, proliferation of fibroblasts, and promotion of collagen biosynthesis.

본 발명자들은 생물학적으로 유효한 활성을 갖는 우수한 펩타이드를 개발하고자 노력한 결과, 서열번호 1, 2, 3 또는 4의 아미노산 서열을 포함하는 펩타이드가 피부 주름 개선에 유용하게 이용될 수 있다는 것을 규명함으로써, 본 발명을 완성하게 되었다. As a result of trying to develop an excellent peptide having biologically effective activity, the present inventors found out that a peptide containing the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4 can be usefully used for skin wrinkle improvement, the present invention Was completed.

이에, 본 발명의 목적은 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드를 제공하는 것이다.Accordingly, an object of the present invention is to provide a peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4.

본 발명의 다른 목적은 서열번호 1 또는 2의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 포함하는 피부 질환 예방 또는 치료용 약제학적 조성물을 제공하는 것이다. Another object of the present invention is to provide a pharmaceutical composition for preventing or treating skin diseases comprising one or more peptides selected from the group consisting of peptides consisting of the amino acid sequence of SEQ ID NO: 1 or 2.

본 발명의 또 다른 목적은 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 포함하는 피부 상태 개선용 화장품 조성물을 제공하는 것이다.Another object of the present invention is to provide a cosmetic composition for improving skin condition comprising at least one peptide selected from the group consisting of peptides consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4.

본 발명의 또 다른 목적은 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 포함하는 피부 상태 개선용 식품 조성물을 제공하는 것이다.Another object of the present invention is to provide a food composition for improving skin condition comprising at least one peptide selected from the group consisting of peptides consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4.

본 발명의 또 다른 목적은 서열번호 1 또는 2의 아미노산 서열로 이루어진 펩타이드를 이용한 피부 질환 예방 또는 치료 방법을 제공하는 것이다.Another object of the present invention is to provide a method for preventing or treating skin diseases using a peptide consisting of the amino acid sequence of SEQ ID NO: 1 or 2.

본 발명의 또 다른 목적은 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드의 피부 상태 개선 용도에 관한 것이다.Another object of the present invention relates to the use of a peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4 to improve skin conditions.

본 발명의 또 다른 목적은 서열번호 1 또는 2의 아미노산 서열로 이루어진 펩타이드의 피부 질환 예방 또는 치료 용도에 관한 것이다.Another object of the present invention relates to the use of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 or 2 to prevent or treat skin diseases.

본 발명은 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드, 상기 펩타이드를 포함하는 피부 질환 예방 또는 치료용 약제학적 조성물, 상기 펩타이드를 포함하는 피부 상태 개선용 화장품 조성물, 상기 펩타이드를 포함하는 피부 상태 개선용 식품 조성물, 상기 펩타이드를 이용한 피부 질환 예방 또는 치료 방법 및 상기 펩타이드의 피부 상태 개선 용도에 관한 것이다.The present invention comprises a peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4, a pharmaceutical composition for preventing or treating skin diseases comprising the peptide, a cosmetic composition for improving skin conditions comprising the peptide, and the peptide It relates to a food composition for improving skin conditions, a method for preventing or treating skin diseases using the peptide, and a use of the peptide for improving skin conditions.

피부 주름 부위의 대표적 특징은 진피를 구성하는 세포외 기질 단백질(extracellular matrix protein; 이하, ECM)인 콜라겐(collagen), 엘라스틴(elastin), 파이브로넥틴(fibronectin) 수준(level) 저해이다. A typical feature of the skin wrinkle area is the inhibition of the level of collagen, elastin, and fibronectin, which are extracellular matrix proteins (ECM) constituting the dermis.

피부 주름 개선 효과를 나타내기 위해서는, 진피를 구성하는 주요 세포인 섬유아세포의 증식 촉진 및 활성 촉진에 따른 ECM 분자 발현 증가 효능을 보여야 하며, 본 펩타이드들의 효능 확인을 위해 MTT 어세이, MAPK, AKT 인산화 수준 테스트 (세포 증식과 관련된 주요 신호전달 물질(signaling molecules)로써 인산화 형태가 활성 형태임), 콜라겐, 엘라스틴, 파이브로넥틴 발현 테스트(RT-PCR을 이용한 mRNA 수준 확인 및 ELISA를 통한 단백질 수준 확인)를 진행 하였고, 이들에 대한 긍정적인 효과를 확인하였다. In order to show the effect of improving skin wrinkles, the effect of increasing the expression of ECM molecules by promoting proliferation and activation of fibroblasts, which are major cells constituting the dermis, should be shown.In order to confirm the efficacy of these peptides, MTT assay, MAPK, AKT phosphorylation Level test (phosphorylated form is the active form as a major signaling molecule related to cell proliferation), collagen, elastin, fibronectin expression test (checking the mRNA level using RT-PCR and checking the protein level through ELISA) Was carried out, and positive effects on them were confirmed.

또한, 표피 구성 세포인 각질세포의 증식 촉진 및 HA, AQP3, SIRT1 발현 증가 효과를 관찰함으로써, 장벽 강화에 의한 외부 자극 저해 효과도 본 펩타이드가 가지고 있음을 확인하였다.In addition, by observing the effects of promoting proliferation of keratinocytes, which are epidermal cells, and increasing the expression of HA, AQP3, and SIRT1, it was confirmed that the peptide also has an effect of inhibiting external stimulation by strengthening the barrier.

이하 본 발명을 더욱 자세히 설명하고자 한다.Hereinafter, the present invention will be described in more detail.

본 발명의 일 양태는 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드에 관한 것이다.One aspect of the present invention relates to a peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4.

상기 펩타이드는 아미노산 서열의 일부 부위를 선정하고 그 활성을 증가시키기 위해 N-말단 및/또는 C-말단 변형이 유도된 것일 수 있다. 이러한 N-말단 및/또는 C-말단 변형을 통해 본 발명의 펩타이드의 안정성을 현저하게 향상시킬 수 있으며, 예를 들어, 펩타이드의 생체 내 투여 시 반감기를 증가시킬 수 있다.The peptide may be one in which N-terminal and/or C-terminal modifications are induced in order to select a portion of the amino acid sequence and increase its activity. Through such N-terminal and/or C-terminal modification, the stability of the peptide of the present invention can be remarkably improved, and, for example, the half-life can be increased when the peptide is administered in vivo.

상기 N-말단 변형은 펩타이드의 N-말단에 아세틸기(acetyl group), 플루오레닐메톡시카르보닐기(fluoreonylmethoxycarbonyl group), 포르밀기(formyl group), 팔미토일기(palmitoyl group), 미리스틸기(myristyl group), 스테아릴기(stearyl group) 및 폴리에틸렌글리콜(polyethylene glycol; PEG)로 이루어진 군으로부터 선택된 보호기가 결합한 것일 수 있다. The N-terminal modification is an acetyl group, a fluorenylmethoxycarbonyl group, a formyl group, a palmitoyl group, and a myristyl group at the N-terminus of the peptide. ), a stearyl group, and a protecting group selected from the group consisting of polyethylene glycol (PEG).

상기 C-말단 변형은 펩타이드의 C-말단에 히드록시기(hydroxyl group, -OH), 아미노기(amino group, -NH2), 아자이드(azide, -NHNH2) 등이 결합한 것일 수 있으나, 이에 한정되는 것은 아니다.The C-terminal modification may be a combination of a hydroxy group (-OH), an amino group (amino group, -NH 2 ), azide (-NHNH 2 ), etc. at the C-terminus of the peptide, but is limited thereto. It is not.

상기 보호기는 생체 내의 단백질 절단효소의 공격으로부터 본 발명의 펩타이드를 보호하는 작용을 한다.The protecting group acts to protect the peptide of the present invention from attack by protein cleavage enzymes in vivo.

본 발명의 다른 일 양태는 서열번호 1 또는 2의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 포함하는 피부 질환 예방 또는 치료용 약제학적 조성물에 관한 것이다.Another aspect of the present invention relates to a pharmaceutical composition for preventing or treating skin diseases comprising at least one peptide selected from the group consisting of peptides consisting of the amino acid sequence of SEQ ID NO: 1 or 2.

상기 피부 질환은 건선, 아토피성 피부염, 비(非)알러지성 피부염 및 피부 건조증인 것일 수 있으나, 이에 한정되는 것은 아니다.The skin disease may be psoriasis, atopic dermatitis, non-allergic dermatitis, and dry skin, but is not limited thereto.

상기 약제학적 조성물은 서열번호 1 또는 2의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드의 약제학적 유효량을 포함하는 것일 수 있다.The pharmaceutical composition may contain a pharmaceutically effective amount of one or more peptides selected from the group consisting of peptides consisting of the amino acid sequence of SEQ ID NO: 1 or 2.

또한, 상기 약제학적 조성물은 약제학적으로 허용되는 담체를 추가적으로 포함하는 것일 수 있다.In addition, the pharmaceutical composition may additionally include a pharmaceutically acceptable carrier.

상기 약제학적으로 허용되는 담체는 제제 시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences (19th ed., 1995)에 상세히 기재되어 있다.The pharmaceutically acceptable carrier is commonly used in the formulation, lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, Polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, and the like, but are not limited thereto. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있으나, 이에 한정되는 것은 아니다. The pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components, but is not limited thereto.

상기 약제학적 조성물은 경구 또는 비경구, 바람직하게는 비경구로 투여할 수 있고, 비경구 투여인 경우에는 근육 주입, 정맥 내 주입, 피하 주입, 복강 주입, 국소 투여, 경피 투여 등으로 투여할 수 있으나, 이에 한정되는 것은 아니다.The pharmaceutical composition may be administered orally or parenterally, preferably parenterally, and in the case of parenteral administration, it may be administered by intramuscular injection, intravenous injection, subcutaneous injection, intraperitoneal injection, topical administration, transdermal administration, etc. , Is not limited thereto.

상기 약제학적 조성물의 투여량은 1일당 0.0001 내지 1000 ug(마이크로그램, 0.001 내지 1000 ug, 0.01 내지 1000 ug, 0.1 내지 1000 ug, 또는 1.0 내지 1000 ug일 수 있으나, 이에 한정되는 것은 아니며, 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다.The dosage of the pharmaceutical composition may be 0.0001 to 1000 ug per day (micrograms, 0.001 to 1000 ug, 0.01 to 1000 ug, 0.1 to 1000 ug, or 1.0 to 1000 ug, but is not limited thereto, and formulation method , Administration mode, patient's age, weight, sex, pathological condition, food, administration time, route of administration, excretion rate, and response sensitivity.

상기 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다.The pharmaceutical composition is prepared in a unit dosage form by formulating using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily carried out by a person having ordinary knowledge in the art, or It can be manufactured by placing it in a multi-volume container.

상기 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나, 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 및/또는 안정화제를 추가적으로 포함할 수 있다.The formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, granule, tablet or capsule, and may additionally include a dispersant and/or a stabilizer.

본 발명의 또 다른 일 양태는 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 유효성분으로 포함하는 피부 상태 개선용 식품 조성물에 관한 것이다.Another aspect of the present invention relates to a food composition for improving skin condition comprising as an active ingredient at least one peptide selected from the group consisting of peptides consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4.

상기 피부 상태 개선은 주름개선, 피부재생, 피부탄력 개선, 피부노화 억제, 상처 재생, 여드름 개선, 피부 재생 또는 피부 미백인 것일 수 있으나, 이에 한정되는 것은 아니다.The improvement of the skin condition may be wrinkle improvement, skin regeneration, skin elasticity improvement, skin aging suppression, wound regeneration, acne improvement, skin regeneration, or skin whitening, but is not limited thereto.

상기 식품은 각종 식품, 음료, 식품 첨가제 등일 수 있다.The food may be various foods, drinks, food additives, and the like.

상기 식품 조성물에 함유된 유효성분으로서의 펩타이드의 함량은 식품의 형태, 소망하는 용도 등에 따라 적절하게 특별한 제한이 없으며, 예를 들어, 전체 식품 중량의 0.01 내지 15 중량%로 가할 수 있으며, 건강 음료 조성물은 100 ml를 기준으로 0.02 내지 10 g, 바람직하게는 0.3 내지 1 g의 비율로 가할 수 있다.The content of the peptide as an active ingredient contained in the food composition is not particularly limited appropriately depending on the form of the food, the desired use, etc., and may be added, for example, in 0.01 to 15% by weight of the total food weight, and a health beverage composition Silver may be added in a ratio of 0.02 to 10 g, preferably 0.3 to 1 g, based on 100 ml.

상기 식품이 음료인 경우에는 지시된 비율로 필수 성분으로서 상기 펩타이드를 함유하는 것 외에 액체성분에는 특별한 제한점은 없으며 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다.When the food is a beverage, there is no particular limitation on the liquid component, in addition to containing the peptide as an essential component in the indicated ratio, and as an ordinary beverage, various flavoring agents or natural carbohydrates may be included as an additional component.

상기 천연 탄수화물은 모노사카라이드, 예를 들어, 포도당, 과당 등의 디사카라이드, 예를 들어 말토스, 슈크로스 등, 및 폴리사카라이드, 예를 들어 덱스트린, 시클로덱스트린 등과 같은 통상적인 당 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. The natural carbohydrates are monosaccharides, such as disaccharides such as glucose and fructose, such as maltose, sucrose, and the like, and polysaccharides such as dextrin, cyclodextrin, and the like, and conventional sugars and xylitol. , Sugar alcohols such as sorbitol and erythritol.

상술한 것 이외의 향미제로서 천연 향미제(타우마틴, 스테비아 추출물(예를 들어 레바우디오시드 A, 글리시르히진 등) 및 합성 향미제(사카린, 아스파르탐 등)를 유리하게 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100 ㎖당 일반적으로 약 1 내지 20g, 바람직하게는 약 5 내지 12g이다. As flavoring agents other than those described above, natural flavoring agents (taumatin, stevia extract (for example, rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used. The ratio of the natural carbohydrate is generally about 1 to 20 g, preferably about 5 to 12 g per 100 ml of the composition of the present invention.

상기 외에 본 발명의 식품 조성물은 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제(치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산음료에 사용되는 탄산화제 등을 함유할 수 있다. In addition to the above, the food composition of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring and natural flavoring agents, coloring agents and heavy weight agents (cheese, chocolate, etc.), pectic acid and salts thereof, alginic acid, and It may contain salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonates used in carbonated beverages, and the like.

그밖에 본 발명의 식품 조성물은 천연 과일 쥬스 및 과일 쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 그렇게 중요하진 않지만 본 발명의 조성물 100 중량부 당 0 내지 약 20 중량부의 범위에서 선택되는 것이 일반적이다. In addition, the food composition of the present invention may contain flesh for the production of natural fruit juice and fruit juice beverages and vegetable beverages. These components may be used independently or in combination. The proportion of these additives is not so critical, but is generally selected in the range of 0 to about 20 parts by weight per 100 parts by weight of the composition of the present invention.

본 발명의 또 다른 양태는 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상을 포함하는 피부 상태 개선용 화장품 조성물에 관한 것이다.Another aspect of the present invention relates to a cosmetic composition for improving skin condition comprising at least one selected from the group consisting of peptides consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4.

상기 피부 상태 개선은 주름개선, 피부재생, 피부탄력 개선, 피부노화 억제, 상처 재생, 여드름 개선, 피부 재생 또는 피부 미백인 것일 수 있으나, 이에 한정되는 것은 아니다.The improvement of the skin condition may be wrinkle improvement, skin regeneration, skin elasticity improvement, skin aging suppression, wound regeneration, acne improvement, skin regeneration, or skin whitening, but is not limited thereto.

상기 화장품 조성물은 (a) 상술한 본 발명의 펩타이드의 화장품학적 유효량(cosmetically effective amount); 및/또는 (b) 화장품학적으로 허용되는 담체를 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.The cosmetic composition comprises (a) a cosmetically effective amount of the peptide of the present invention described above; And/or (b) a cosmetically acceptable carrier, but is not limited thereto.

본 명세서에서 용어 "화장품학적 유효량"은 상술한 본 발명의 조성물의 피부상태 개선 효능을 달성하는 데 충분한 양을 의미한다.As used herein, the term "cosmetically effective amount" means an amount sufficient to achieve the effect of improving the skin condition of the composition of the present invention described above.

상기 화장품 조성물은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 예를 들어, 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클린싱, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이 등으로 제형화될 수 있으나, 이에 한정되는 것은 아니다. 보다 상세하게는, 유연 화장수, 영양 화장수, 영양 크림, 마사지 크림, 에센스, 아이 크림, 클렌징 크림, 클렌징 포옴, 클렌징 워터, 팩, 스프레이 또는 파우더의 제형으로 제조될 수 있다.The cosmetic composition may be prepared in any formulation conventionally prepared in the art, for example, solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleansing, oil , Powder foundation, emulsion foundation, wax foundation, and spray may be formulated, but are not limited thereto. In more detail, it may be prepared in the form of a flexible lotion, nutritional lotion, nutritional cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray or powder.

본 발명의 화장품의 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물성유, 식물성유, 왁스, 파라핀, 전분, 트라칸트, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 이용될 수 있다.When the formulation of the cosmetic product of the present invention is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tracant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, or zinc oxide, etc. are used as carrier components. Can be used.

본 발명의 화장품의 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 이용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진체를 포함할 수 있다.When the formulation of the cosmetic product of the present invention is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. In particular, in the case of a spray, additional chlorofluorohydrocarbons , Propane/butane or dimethyl ether.

본 발명의 화장품의 제형이 용액 또는 유탁액인 경우에는 담체 성분으로서 용매, 용해화제 또는 유탁화제가 이용되고, 예컨대 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌 글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 또는 소르비탄의 지방산 에스테르가 있다.When the cosmetic formulation of the present invention is a solution or emulsion, a solvent, a solubilizing agent or an emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol , 1,3-butylglycol oil, glycerol aliphatic ester, polyethylene glycol or fatty acid ester of sorbitan.

본 발명의 화장품의 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌 글리콜과 같은 액상의 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라칸트 등이 이용될 수 있다.When the formulation of the cosmetic product of the present invention is a suspension, as a carrier component, a liquid diluent such as water, ethanol or propylene glycol, an ethoxylated isostearyl alcohol, a suspending agent such as polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Microcrystalline cellulose, aluminum metahydroxide, bentonite, agar or tracant, and the like may be used.

본 발명의 화장품의 제형이 계면-활성제 함유 클린징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르 설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 라놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.When the cosmetic formulation of the present invention is a surfactant containing cleansing, as carrier components, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, Fatty acid amide ether sulfates, alkylamidobetaines, fatty alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters may be used.

본 발명의 화장품 조성물에 포함되는 성분은 유효 성분으로서의 펩타이드와 담체 성분 이외에, 화장품 조성물에 통상적으로 이용되는 성분들을 포함하며, 예를 들어, 항산화제, 안정화제, 용해화제, 비타민, 안료 및 향료와 같은 통상적인 보조제를 포함할 수 있다.Ingredients included in the cosmetic composition of the present invention include ingredients commonly used in cosmetic compositions, in addition to peptides and carrier ingredients as active ingredients, for example, antioxidants, stabilizers, solubilizers, vitamins, pigments and perfumes, and Such conventional adjuvants may be included.

본 발명의 용어 "피부상태 개선"이란, 피부의 내재적 요인 또는 외인적인 요인에 의하여 유발되는 피부의 손상을 치료, 경감, 완화시키는 과정 또는 그의 효과 등을 포괄적으로 의미하며, 예를 들어, 피부에서 발생되는 염증의 완화, 개선 등의 효과를 나타내는 것으로 해석될 수 있으나, 이에 한정되는 것은 아니다.The term "improving skin condition" of the present invention comprehensively refers to a process of treating, alleviating, or alleviating damage to the skin caused by an intrinsic factor or an exogenous factor of the skin, or an effect thereof. For example, in the skin It can be interpreted as showing an effect of alleviating or improving the inflammation that occurs, but is not limited thereto.

본 발명의 또 다른 양태는 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드의 피부 상태 개선 용도에 관한 것이다.Another aspect of the present invention relates to the use of a peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4 to improve skin condition.

상기 피부 상태 개선은 주름개선, 피부재생, 피부탄력 개선, 피부노화 억제, 상처 재생, 여드름 개선, 피부 재생 또는 피부 미백인 것일 수 있으나, 이에 한정되는 것은 아니다.The improvement of the skin condition may be wrinkle improvement, skin regeneration, skin elasticity improvement, skin aging suppression, wound regeneration, acne improvement, skin regeneration, or skin whitening, but is not limited thereto.

본 발명의 또 다른 양태는 서열번호 1 또는 2의 아미노산 서열로 이루어진 펩타이드의 피부 질환 예방 또는 치료 용도에 관한 것이다.Another aspect of the present invention relates to the use of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 or 2 to prevent or treat skin diseases.

상기 피부 질환은 건선, 아토피성 피부염, 비(非)알러지성 피부염 및 피부 건조증인 것일 수 있으나, 이에 한정되는 것은 아니다.The skin disease may be psoriasis, atopic dermatitis, non-allergic dermatitis, and dry skin, but is not limited thereto.

상기 서열번호 1 또는 2의 아미노산 서열로 이루어진 펩타이드는 기설명한 바와 동일하다.The peptide consisting of the amino acid sequence of SEQ ID NO: 1 or 2 is the same as previously described.

본 명세서의 용어 "펩타이드"는 펩타이드 결합에 의해 아미노산 잔기들이 서로 결합되어 형성된 선형의 분자를 의미한다. 본 발명의 펩타이드는 당업계에 공지된 화학적 합성 방법, 특히 고상 합성 기술(solid-phase synthesis techniques; Merrifield, J. Amer. Chem. Soc. 85:2149-54(1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd. ed., Pierce Chem. Co.: Rockford, 111(1984)) 또는 액상 합성 기술(US 등록특허 제5,516,891호)에 따라 제조될 수 있다.The term "peptide" as used herein refers to a linear molecule formed by bonding of amino acid residues to each other by peptide bonds. The peptides of the present invention are chemically synthesized methods known in the art, in particular solid-phase synthesis techniques; Merrifield, J. Amer. Chem. Soc. 85:2149-54 (1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd.ed., Pierce Chem. Co.: Rockford, 111 (1984)) or liquid phase synthesis technology (US Patent No. 5,516,891).

본 명세서의 용어 "안정성"은 인 비보 안정성뿐만 아니라, 저장 안정성(예컨대, 상온 저장 안정성)도 의미한다.The term "stability" as used herein means not only in vivo stability, but also storage stability (eg, room temperature storage stability).

본 명세서에서 용어 "약제학적 유효량"은 상술한 펩타이드의 효능 또는 활성을 달성하는 데 충분한 양을 의미한다.As used herein, the term "pharmaceutically effective amount" means an amount sufficient to achieve the efficacy or activity of the above-described peptide.

본 발명은 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드, 상기 펩타이드를 포함하는 피부 질환 예방 또는 치료용 약제학적 조성물, 상기 펩타이드를 포함하는 피부 상태 개선용 화장품 조성물, 상기 펩타이드를 포함하는 피부 상태 개선용 식품 조성물, 상기 펩타이드를 이용한 피부 질환 예방 또는 치료 방법 및 상기 펩타이드의 피부 상태 개선 용도에 관한 것이다.The present invention comprises a peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4, a pharmaceutical composition for preventing or treating skin diseases comprising the peptide, a cosmetic composition for improving skin conditions comprising the peptide, and the peptide It relates to a food composition for improving skin conditions, a method for preventing or treating skin diseases using the peptide, and a use of the peptide for improving skin conditions.

도 1은 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 섬유아세포의 증식 촉진 평가 결과를 보여주는 그래프이다.
도 2는 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 섬유아세포의 증식 촉진 평가 결과를 보여주는 그래프이다.
도 3은 본 발명의 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드의 섬유아세포의 증식 촉진 평가 결과를 보여주는 그래프이다.
도 4는 본 발명의 실시예에 따른 서열번호 4의 아미노산 서열로 이루어진 펩타이드의 섬유아세포의 증식 촉진 평가 결과를 보여주는 그래프이다.
도 5는 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 각질 형성 세포의 증식 촉진 평가 결과를 보여주는 그래프이다.
도 6은 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 각질 형성 세포의 증식 촉진 평가 결과를 보여주는 그래프이다.
도 7은 본 발명의 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드의 각질 형성 세포의 증식 촉진 평가 결과를 보여주는 그래프이다.
도 8은 본 발명의 실시예에 따른 서열번호 4의 아미노산 서열로 이루어진 펩타이드의 각질 형성 세포의 증식 촉진 평가 결과를 보여주는 그래프이다.
도 9는 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 섬유아세포에서의 MAPK (AKT 제거)의 인산화 수준 측정 결과를 보여주는 사진이다.
도 10은 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 섬유아세포에서의 MAPK (AKT 제거)의 인산화 수준 측정 결과를 보여주는 사진이다.
도 11은 본 발명의 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드의 섬유아세포에서의 MAPK 및 AKT의 인산화 수준 측정 결과를 보여주는 사진이다.
도 12는 본 발명의 실시예에 따른 서열번호 4의 아미노산 서열로 이루어진 펩타이드의 섬유아세포에서의 MAPK 및 AKT의 인산화 수준 측정 결과를 보여주는 사진이다.
도 13은 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 각질 형성 세포에서의 MAPK (AKT 제거)의 인산화 수준 측정 결과를 보여주는 사진이다.
도 14는 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 각질 형성 세포에서의 MAPK (AKT 제거)의 인산화 수준 측정 결과를 보여주는 사진이다.
도 15는 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 콜라겐1a, 파이브로넥틴 및 엘라스틴 RT-PCR 결과를 보여주는 사진이다.
도 16은 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 콜라겐1a, 파이브로넥틴 및 엘라스틴 RT-PCR 결과를 보여주는 사진이다.
도 17은 본 발명의 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드의 콜라겐1a, 파이브로넥틴 및 엘라스틴 RT-PCR 결과를 보여주는 사진이다.
도 18은 본 발명의 실시예에 따른 서열번호 4의 아미노산 서열로 이루어진 펩타이드의 콜라겐1a, 파이브로넥틴 및 엘라스틴 RT-PCR 결과를 보여주는 사진이다.
도 19는 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 AQP3(Aquaporin3) RT-PCR 결과를 보여주는 사진이다.
도 20은 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 SIRT1 RT-PCR 결과를 보여주는 사진이다.
도 21은 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 AQP3(Aquaporin3) RT-PCR 결과를 보여주는 사진이다.
도 22는 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 콜라겐1a 발현량 측정 결과를 보여주는 사진이다.
도 23은 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 파이브로넥틴 발현량 측정 결과를 보여주는 사진이다.
도 24는 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 엘라스틴 발현량 측정 결과를 보여주는 사진이다.
도 25는 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 콜라겐1a 발현량 측정 결과를 보여주는 사진이다.
도 26은 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 파이브로넥틴 발현량 측정 결과를 보여주는 사진이다.
도 27은 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 엘라스틴 발현량 측정 결과를 보여주는 사진이다.
도 28은 본 발명의 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 Procollagen1a ELISA 결과를 보여주는 사진이다.
도 29는 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 Procollagen1a ELISA 결과를 보여주는 사진이다.
도 30은 본 발명의 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드의 Procollagen1a ELISA 결과를 보여주는 사진이다.
도 31은 본 발명의 실시예에 따른 서열번호 4의 아미노산 서열로 이루어진 펩타이드의 Procollagen1a ELISA 결과를 보여주는 사진이다.
도 32는 본 발명의 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 HA ELISA 결과를 보여주는 사진이다.
1 is a graph showing the results of evaluation of promoting proliferation of fibroblasts of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
2 is a graph showing the results of evaluation of proliferation promotion of fibroblasts of a peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
3 is a graph showing the results of evaluation of proliferation promotion of fibroblasts of a peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present invention.
4 is a graph showing the results of evaluation of proliferation promotion of fibroblasts of a peptide consisting of the amino acid sequence of SEQ ID NO: 4 according to an embodiment of the present invention.
5 is a graph showing the results of evaluation of proliferation promotion of keratinocytes of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
6 is a graph showing the results of evaluation of proliferation promotion of keratinocytes of a peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
7 is a graph showing the results of evaluation of proliferation promotion of keratinocytes of a peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present invention.
8 is a graph showing the results of evaluation of proliferation promotion of keratinocytes of a peptide consisting of the amino acid sequence of SEQ ID NO: 4 according to an embodiment of the present invention.
9 is a photograph showing the result of measuring the phosphorylation level of MAPK (AKT removal) in fibroblasts of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
10 is a photograph showing the result of measuring the phosphorylation level of MAPK (AKT removal) in fibroblasts of a peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
11 is a photograph showing the results of measuring the phosphorylation levels of MAPK and AKT in fibroblasts of a peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present invention.
12 is a photograph showing the result of measuring the phosphorylation level of MAPK and AKT in fibroblasts of the peptide consisting of the amino acid sequence of SEQ ID NO: 4 according to an embodiment of the present invention.
13 is a photograph showing the result of measuring the phosphorylation level of MAPK (AKT removal) in keratinocytes of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
14 is a photograph showing the result of measuring the phosphorylation level of MAPK (AKT removal) in keratinocytes of a peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
15 is a photograph showing collagen 1a, fibronectin, and elastin RT-PCR results of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
FIG. 16 is a photograph showing collagen 1a, fibronectin, and elastin RT-PCR results of a peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
FIG. 17 is a photograph showing collagen 1a, fibronectin, and elastin RT-PCR results of a peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present invention.
18 is a photograph showing collagen 1a, fibronectin, and elastin RT-PCR results of a peptide consisting of the amino acid sequence of SEQ ID NO: 4 according to an embodiment of the present invention.
19 is a photograph showing AQP3 (Aquaporin3) RT-PCR results of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
20 is a photograph showing the SIRT1 RT-PCR results of the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
Figure 21 is a photograph showing the AQP3 (Aquaporin3) RT-PCR results of the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
22 is a photograph showing the result of measuring the expression level of collagen 1a of the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
23 is a photograph showing a result of measuring the expression level of fibronectin of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
24 is a photograph showing the result of measuring the elastin expression level of the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
25 is a photograph showing the result of measuring the expression level of collagen 1a of the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
26 is a photograph showing a result of measuring the expression level of fibronectin of a peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
27 is a photograph showing the result of measuring the elastin expression level of the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
28 is a photograph showing the results of Procollagen1a ELISA of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
29 is a photograph showing a Procollagen1a ELISA result of a peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
30 is a photograph showing the results of Procollagen1a ELISA of a peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present invention.
31 is a photograph showing the results of Procollagen1a ELISA of a peptide consisting of the amino acid sequence of SEQ ID NO: 4 according to an embodiment of the present invention.
32 is a photograph showing the results of HA ELISA of a peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.

이하, 본 발명을 하기의 실시예에 의하여 더욱 상세히 설명한다. 그러나 이들 실시예는 본 발명을 예시하기 위한 것일 뿐이며, 본 발명의 범위가 이들 실시예에 의하여 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail by the following examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited by these examples.

합성예 1: 펩타이드의 합성Synthesis Example 1: Synthesis of Peptide

클로로 트리틸 클로라이드 레진(Chloro trityl chloride resin; CTC resin, Nova biochem Cat No. 01-64-0021) 70g을 반응용기에 넣고 메틸렌 클로라이드(MC) 490ml를 가하여 3분간 교반하였다. 그 다음, 용액을 제거하고 디메틸포름 아마이드(DMF) 490 ml를 넣어 3분간 교반한 후 다시 용매를 제거하였다. 그 다음, 반응기에 700 ml의 디클로로메탄용액을 넣고 Fmoc-Tyr(tBu)-OH (Bachem, Swiss) 200 mmole 및 디이소프로필 에틸아민(DIEA) 400 mmole을 넣은 후 교반하여 잘 녹이고, 1시간 동안 교반하면서 반응시켰다. 그 다음, 세척하고 메탄올과 DIEA(2:1)를 DCM(dechloromethane)에 녹여 10분간 반응시키고 과량의 DCM/DMF(1:1)로 세척하였다. 그 다음, 용액을 제거하고 디메틸포름 아마이드(DMF)를 490 ml 넣어 3분간 교반한 후 다시 용매를 제거하였다. 탈보호 용액(20%의 피페리딘(Piperidine)/DMF) 700ml를 반응 용기에 넣고 10분간 상온에서 교반한 후 용액을 제거하였다. 동량의 탈보호 용액을 넣고 다시 10분간 반응을 유지한 후 용액을 제거하고 각각 3분씩 DMF로 2회, MC로 1회, DMF로 1회 세척하여 Tyr(tBu)-CTC 레진(Resin)을 제조하였다.70 g of chloro trityl chloride resin (CTC resin, Nova biochem Cat No. 01-64-0021) was placed in a reaction vessel, and 490 ml of methylene chloride (MC) was added, followed by stirring for 3 minutes. Then, the solution was removed, 490 ml of dimethylformamide (DMF) was added, stirred for 3 minutes, and the solvent was removed again. Then, 700 ml of dichloromethane solution was added to the reactor, 200 mmole of Fmoc-Tyr(tBu)-OH (Bachem, Swiss) and 400 mmole of diisopropyl ethylamine (DIEA) were added, followed by stirring to dissolve well, and for 1 hour. It was reacted while stirring. Then, it was washed, and methanol and DIEA (2:1) were dissolved in DCM (dechloromethane), reacted for 10 minutes, and washed with an excess of DCM/DMF (1:1). Then, the solution was removed, 490 ml of dimethylformamide (DMF) was added, stirred for 3 minutes, and the solvent was removed again. 700 ml of a deprotection solution (20% piperidine/DMF) was added to the reaction vessel and stirred at room temperature for 10 minutes, and then the solution was removed. After adding the same amount of deprotection solution and maintaining the reaction for 10 minutes, the solution was removed and washed twice with DMF, once with MC, and once with DMF for 3 minutes each to prepare Tyr(tBu)-CTC resin. I did.

새로운 반응기에 700ml의 DMF 용액을 넣고 Fmoc-Arg(Pbf)-OH (Bachem, Swiss) 200 mmole, HoBt 200 mmole 및 HBTu 200 mmole을 넣은 후 교반하여 잘 녹였다. 반응기에 400 mmole DIEA를 분획으로 2번에 걸쳐 넣은 후 모든 고체가 녹을 때까지 최소한 5분간 교반하였다. 녹인 아미노산 혼합용액을 탈보호된 레진이 있는 반응용기에 넣고 1시간 동안 상온에서 교반하면서 반응시켰다. 반응액을 제거하고 DMF 용액으로 3회 5분씩 교반한 후 제거하였다. 반응 레진을 소량 취하여 카이저 테스트(Nihydrin Test)를 이용하여 반응 정도를 점검하였다. 탈보호 용액으로 상기와 같이 동일하게 2번 탈보호 반응시켜 Arg(Pbf)-Tyr(tBu)-CTC Resin을 제조하였다. DMF와 MC로 충분히 세척하고 다시 한 번 카이저 테스트를 수행한 다음 상기와 동일하게 아래의 아미노산 부착 실험을 수행하였다. 선정된 아미노산 서열에 의거하여 Fmoc-Gly-OH, Fmoc-Gly-OH, Fmoc-Gly-OH, Fmoc-Trp-OH, Fmoc-Lys(Boc)-OH 순으로 연쇄반응을 시켰다. Fmoc-보호기를 탈보호 용액으로 10분씩 2번 반응시킨 후 잘 세척하여 제거하였다. 펩티딜 레진을 DMF, MC 및 메탄올로 각각 3번을 세척하고, 질소 공기를 천천히 흘려 건조한 후, P2O5 하에서 진공으로 감압하여 완전히 건조한 뒤 탈루 용액[트리플로로화 초산(Trifluroacetic acid) 81.5%, 증류수 5.0%, 티오아니졸(Thioanisole) 5.0%, 패놀(Phenol) 5.0%, 이디티(EDT, Ethanedithiol) 2.5%, 티아에스(TIS, Triisopropylsilane) 1.0%] 1,900 ml을 넣은 후 상온에서 흔들어주며 2 시간 반응을 유지하였다. 필터링을 하여 레진을 거르고, 레진을 소량의 TFA 용액으로 세척한 후 모액과 합하였다. 합친 모액 2,090ml는 차가운 에테르를 가하여 침전을 유도한 후, 원심분리하여 침전을 모으고, 2번 더 차가운 에테르로 세척하였다. 모액을 제거하고 질소 하에서 충분히 건조하여 정제 전 서열번호 1로 이루어진 펩타이드 79.8g을 합성하였다(수율: 97.0%). 분자량 측정기를 이용하여 분자량 측정 시 분자량 822.9 (이론 값: 822.9)를 얻을 수 있었다. 700ml of DMF solution was added to a new reactor, 200 mmole of Fmoc-Arg(Pbf)-OH (Bachem, Swiss), 200 mmole of HoBt, and 200 mmole of HBTu were added, followed by stirring to dissolve well. After adding 400 mmole DIEA to the reactor twice as a fraction, the mixture was stirred for at least 5 minutes until all solids were dissolved. The dissolved amino acid mixture solution was placed in a reaction vessel with a deprotected resin and reacted with stirring at room temperature for 1 hour. The reaction solution was removed, and the mixture was stirred 3 times for 5 minutes with a DMF solution, and then removed. A small amount of reaction resin was taken and the degree of reaction was checked using a Kaiser test (Nihydrin Test). Arg(Pbf)-Tyr(tBu)-CTC Resin was prepared by performing a deprotection reaction twice in the same manner as above with a deprotection solution. After sufficiently washing with DMF and MC, performing the Kaiser test again, the following amino acid adhesion experiment was performed in the same manner as above. Based on the selected amino acid sequence, a chain reaction was carried out in the order of Fmoc-Gly-OH, Fmoc-Gly-OH, Fmoc-Gly-OH, Fmoc-Trp-OH, Fmoc-Lys(Boc)-OH. The Fmoc-protecting group was reacted twice with a deprotection solution for 10 minutes each, and then washed well and removed. Wash the peptidyl resin three times with DMF, MC and methanol, dry with nitrogen air slowly , and vacuum under P 2 O 5 to completely dry it, and then remove the solution [Trifluroacetic acid 81.5]. %, distilled water 5.0%, Thioanisole 5.0%, Phenol 5.0%, EDT (Ethanedithiol) 2.5%, TIS (Triisopropylsilane) 1.0%] 1,900 ml and shake at room temperature And maintained the reaction for 2 hours. The resin was filtered by filtering, and the resin was washed with a small amount of TFA solution and then combined with the mother liquor. 2,090 ml of the combined mother liquor was added cold ether to induce precipitation, then centrifuged to collect the precipitate, and washed with cold ether twice. The mother liquor was removed and sufficiently dried under nitrogen to synthesize 79.8 g of a peptide consisting of SEQ ID NO: 1 (yield: 97.0%) before purification. When measuring the molecular weight using a molecular weight analyzer, a molecular weight of 822.9 (theoretical value: 822.9) could be obtained.

서열번호 2, 서열번호 3 또는 서열번호 4의 아미노산 서열로 이루어진 펩타이드도 상기와 같은 방법으로 합성을 진행하였다.A peptide consisting of the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 was also synthesized in the same manner as described above.

서열 번호Sequence number 서열 목록Sequence list 분석값(질량분석기)Analysis value (mass spectrometer) 분석치Analysis value 이론치Theoretical value 1One KWGGGRYKWGGGRY 822.9822.9 822.9822.9 22 ILGRWCGILGRWCG 803.9803.9 803.9803.9 33 GPVHGPVH 408.4408.4 408.4408.4 44 EDEFKPPAAGREDEFKPPAAGR 1216.31216.3 1216.31216.3

실시예 1. 섬유아세포의 증식 촉진 평가Example 1. Evaluation of proliferation promotion of fibroblasts

마우스 섬유아세포 NIH3T3를 5x103 cells/well의 밀도로 96-웰 플레이트에 시딩 후 하룻밤 동안 배양하였다. 그 다음, 0.05% 혈청 첨가 배지(serum-containing media)로 바꿔준 후 양성 대조군 100nM bFGF 및 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드를 10uM 또는 50uM 처리하여 3일간 배양하고, 4mg/ml MTT 솔루션(solution)을 처리하여 4시간 반응시켰다. 그 다음, 생성된 포마잔을 다이메틸설폭사이드(dimethyl sulfoxide; 이하, DMSO) 처리를 통해 녹여낸 후 마이크로플래이트 리더(microplate reader)를 사용하여 560nm에서의 흡광도를 측정하여, 그 결과를 도 1 내지 4 및 표 2에 나타내었다.Mouse fibroblasts NIH3T3 were seeded in a 96-well plate at a density of 5×10 3 cells/well and incubated overnight. Then, after changing to a 0.05% serum-containing media, a positive control 100 nM bFGF and a peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4 were treated with 10 uM or 50 uM and cultured for 3 days, and 4 mg /ml MTT solution (solution) was treated and reacted for 4 hours. Then, the generated formazan was dissolved through dimethyl sulfoxide (DMSO) treatment, and then the absorbance at 560 nm was measured using a microplate reader, and the results are shown in FIGS. 1 to 4 And shown in Table 2.

Fibroblast proliferation (%)Fibroblast proliferation (%) 도 1Fig. 1 ControlControl SEQ ID NO: 1SEQ ID NO: 1 bFGF
(100nM)
bFGF
(100nM)
10uM10uM 50uM50uM 100100 170170 194194 279279 도 2Fig. 2 ControlControl SEQ ID NO: 2SEQ ID NO: 2 bFGF
(100nM)
bFGF
(100nM)
10uM10uM 50uM50uM 100100 188188 253253 400400 도 3Figure 3 ControlControl SEQ ID NO: 3SEQ ID NO: 3 bFGF
(100nM)
bFGF
(100nM)
10uM10uM 50uM50uM 100100 194194 261261 386386 도 4Fig. 4 ControlControl SEQ ID NO: 4SEQ ID NO: 4 bFGF
(100nM)
bFGF
(100nM)
10uM10uM 50uM50uM 100100 114114 193193 386386

도 1 내지 4 및 표 2에서 확인할 수 있듯이, 서열번호 1, 서열번호 2, 서열번호 3 또는 서열번호 4의 아미노산 서열로 이루어진 펩타이드의 섬유아세포 증식 촉진 효능을 확인하였다. As can be seen in FIGS. 1 to 4 and Table 2, the effect of promoting fibroblast proliferation of the peptide consisting of the amino acid sequence of SEQ ID NO.

실시예 2. 각질 형성 세포의 증식 촉진 평가Example 2. Evaluation of proliferation promotion of keratinocytes

인간 각질 형성 세포인 HaCaT을 3x105 cells/well의 밀도로 6-웰 플레이트에 시딩 후 하룻밤 동안 배양하였다. 그 다음, 0.05% 혈청 첨가 배지(serum-containing media)로 바꿔준 후 양성 대조군 10nM EGF 및 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드를 10uM 또는 50uM 처리하여 3일간 배양하고, 4mg/ml MTT 솔루션(solution)을 처리하여 4시간 반응시켰다. 그 다음, 생성된 포마잔을 다이메틸설폭사이드(dimethyl sulfoxide; 이하, DMSO) 처리를 통해 녹여낸 후 마이크로플래이트 리더(microplate reader)를 사용하여 560nm에서의 흡광도를 측정하여, 그 결과를 도 5 내지 8 및 표 3에 나타내었다.Human keratinocytes, HaCaT, were seeded in a 6-well plate at a density of 3×10 5 cells/well and incubated overnight. Then, after changing to a 0.05% serum-containing media, a positive control 10 nM EGF and a peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4 were treated with 10 uM or 50 uM and cultured for 3 days, and 4 mg /ml MTT solution (solution) was treated and reacted for 4 hours. Then, the generated formazan was dissolved through dimethyl sulfoxide (DMSO) treatment, and then the absorbance at 560 nm was measured using a microplate reader, and the results are shown in FIGS. 5 to 8 And shown in Table 3.

keratinocyte proliferation (%)keratinocyte proliferation (%) 도 5Fig. 5 ControlControl SEQ ID NO: 1SEQ ID NO: 1 EGF
(10nM)
EGF
(10nM)
10uM10uM 50uM50uM 100100 120120 136136 142142 도 6Fig. 6 ControlControl SEQ ID NO: 2SEQ ID NO: 2 EGF
(10nM)
EGF
(10nM)
10uM10uM 50uM50uM 100100 111111 119119 152152 도 7Fig. 7 ControlControl SEQ ID NO: 3SEQ ID NO: 3 EGF
(10nM)
EGF
(10nM)
10uM10uM 50uM50uM 100100 183183 197197 187187 도 8Fig. 8 ControlControl SEQ ID NO: 4SEQ ID NO: 4 EGF
(10nM)
EGF
(10nM)
10uM10uM 50uM50uM 100100 113113 142142 187187

실시예 3. MAPK 및 AKT의 인산화 수준 측정Example 3. Measurement of phosphorylation levels of MAPK and AKT

3-1. 섬유아세포3-1. Fibroblast

마우스 섬유아세포 NIH3T3를 5x103 cells/well의 밀도로 6-웰 플레이트에 시딩 후 하룻밤 동안 배양하였다. 그 다음, 0.05% FBS 함유 배지(FBS-containing media)로 바꿔준 후, 양성 대조군 100nM bFGF 및 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드를 10uM 또는 50uM 처리하여 30분 배양하고 세포를 회수하여 세포 용해물(Cell lysate)을 준비하였다. 그 다음, P-MAPK(p-Erk, p-JNK, p-p38), p-Akt 또는 Actin 항체(santacruz biotechnology, USA)를 이용하여 웨스턴 블랏(western blotting)을 수행하여 인산화 양상을 비교하여, 그 결과를 도 9 내지 12에 나타내었다. Mouse fibroblasts NIH3T3 were seeded in a 6-well plate at a density of 5×10 3 cells/well and incubated overnight. Then, after changing to 0.05% FBS-containing media, a positive control 100 nM bFGF and a peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4 were treated with 10 uM or 50 uM, followed by incubation for 30 minutes. Was recovered to prepare a cell lysate. Then, Western blotting was performed using P-MAPK (p-Erk, p-JNK, p-p38), p-Akt or Actin antibody (santacruz biotechnology, USA) to compare phosphorylation patterns, The results are shown in Figs. 9 to 12.

도 9 내지 12에서 확인할 수 있듯이, 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드는 섬유아세포의 증식에 관련된 신호 전달 인자인 MAPK (ERK, p38, JNK) 및 AKT의 활성화를 통해 증식을 촉진하는 효능을 보임을 확인하였다.As can be seen in Figures 9 to 12, the peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4 proliferates through activation of MAPK (ERK, p38, JNK) and AKT, signaling factors related to the proliferation of fibroblasts. It was confirmed that it shows the efficacy of promoting.

3-2. 각질 형성 세포3-2. Keratinocytes

인간 각질 형성 세포인 HaCaT을 3x105 cells/well의 밀도로 6-웰 플레이트에 시딩 후 하룻밤 동안 배양하였다. 그 다음, 0.05% FBS 함유 배지(FBS-containing media)로 바꿔준 후, 양성 대조군 10nM EGF 및 서열번호 1 또는 2의 아미노산 서열로 이루어진 펩타이드를 10uM 또는 50uM 처리하여 30분 배양하고 세포를 회수하여 세포 용해물(Cell lysate)을 준비하였다. 그 다음, P-MAPK(p-Erk, p-JNK, p-p38), p-Akt 항체 (santacruz biotechnology, USA)를 이용하여 웨스턴 블랏(western blotting)을 수행하여 인산화 양상을 비교하여, 그 결과를 도 13 및 14에 나타내었다. Human keratinocytes, HaCaT, were seeded in a 6-well plate at a density of 3×10 5 cells/well and incubated overnight. Then, after changing to 0.05% FBS-containing media, the positive control 10 nM EGF and the peptide consisting of the amino acid sequence of SEQ ID NO: 1 or 2 were treated with 10 uM or 50 uM, incubated for 30 minutes, and the cells were recovered. A lysate (Cell lysate) was prepared. Then, Western blotting was performed using P-MAPK (p-Erk, p-JNK, p-p38) and p-Akt antibody (santacruz biotechnology, USA) to compare phosphorylation patterns, and the results Is shown in Figures 13 and 14.

도 13 및 14에서 확인할 수 있듯이, 서열번호 1 또는 2의 아미노산 서열로 이루어진 펩타이드는 인간 각질 형성 세포 증식에 관련된 신호 전달 인자인 ERK 및 p38의 활성화를 통해 증식을 촉진하는 효능을 보임을 확인하였다.As can be seen in FIGS. 13 and 14, it was confirmed that the peptide consisting of the amino acid sequence of SEQ ID NO: 1 or 2 exhibits an effect of promoting proliferation through activation of ERK and p38, signal transduction factors related to human keratinocyte proliferation.

실시예 4. 콜라겐1a, 파이브로넥틴 및 엘라스틴 RT-PCR Example 4. Collagen 1a, fibronectin and elastin RT-PCR

마우스 섬유아세포 NIH3T3를 5x103 cells/well의 밀도로 6-웰 플레이트에 시딩 후 하룻밤 동안 배양하였다. 그 다음, 0.05% FBS 함유 배지로 바꿔주고 4시간 동안 배양한 후, 양성 대조군 100nM IGF-1 및 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드를 10uM 또는 50uM 처리하여 24시간 동안 배양하고 세포를 회수하여 RNA를 분리하였다. RNA 정량 후 cDNA 합성 키트(Intron, Korea)을 이용하여 cDNA를 합성하고 PCR premix(Intron, Korea) 및 하기 표 4의 콜라겐1a(collagen1a), 파이브로넥틴(fibronectin), 엘라스틴(elastin), GAPDH 각각의 프라이머를 이용하여 PCR 진행하였다. 그 다음, 5% 아가로즈 겔에 러닝하여 각 펩타이드 처리 조건에서 상기 성장인자들의 mRNA 발현 정도를 비교하여, 그 결과를 도 15 내지 18에 나타내었다.Mouse fibroblasts NIH3T3 were seeded in a 6-well plate at a density of 5×10 3 cells/well and incubated overnight. Then, after changing to a medium containing 0.05% FBS and incubating for 4 hours, a positive control 100 nM IGF-1 and a peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4 were treated with 10 uM or 50 uM and cultured for 24 hours. Then, the cells were recovered and RNA was isolated. After RNA quantification, cDNA was synthesized using a cDNA synthesis kit (Intron, Korea) and PCR premix (Intron, Korea) and collagen 1a (collagen1a), fibronectin, elastin, and GAPDH in Table 4 below, respectively. PCR was performed using the primers of. Then, it was run on a 5% agarose gel to compare the mRNA expression levels of the growth factors under each peptide treatment condition, and the results are shown in FIGS. 15 to 18.

서열번호Sequence number 프라이머primer 서열(5'-3')Sequence (5'-3') 55 Collagen1a_FCollagen1a_F CACCCTCAAGAGCCTGAGTCCACCCTCAAGAGCCTGAGTC 66 Collagen1a_RCollagen1a_R AGACGGCTGAGTAGGGAACAAGACGGCTGAGTAGGGAACA 77 Fibronectin_FFibronectin_F CCAGGAACCGAGTACACCATCCAGGAACCGAGTACACCAT 88 Fibronectin_RFibronectin_R ATACCCAGGTTGGGTGATGAATACCCAGGTTGGGTGATGA 99 Elastin_FElastin_F GGACCCCTGACTCGCGACCTGGACCCCTGACTCGCGACCT 1010 Elastin_RElastin_R GGGGAGGTGGGACTGCCCAAGGGGAGGTGGGACTGCCCAA 1111 GAPDH_FGAPDH_F GGTGTGAACGGATTTGGCCGTATTGGGTGTGAACGGATTTGGCCGTATTG 1212 GAPDH_RGAPDH_R CCGTTGAATTTGCCGTGAGTGGAGTCCGTTGAATTTGCCGTGAGTGGAGT

도 15 내지 18에서 확인할 수 있듯이, 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드는 섬유아세포 활성 촉진을 통해 ECM 구성 성분인 콜라겐, 파이브로넥틴, 엘라스틴 mRNA의 발현 증가 효과를 나타냄을 확인하였다.As can be seen in Figures 15 to 18, the peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4 exhibits an effect of increasing the expression of collagen, fibronectin, and elastin mRNA, which are components of ECM by promoting fibroblast activity. Confirmed.

실시예 5. AQP3(Aquaporin3) 및 SIRT1 RT-PCR Example 5. AQP3 (Aquaporin3) and SIRT1 RT-PCR

인간 각질 형성 세포인 HaCaT을 3x105 cells/well의 밀도로 6-웰 플레이트에 시딩 후 하룻밤 동안 배양하였다. 그 다음, 0.05% FBS-포함 배지로 바꿔주고 4시간 동안 배양한 후 양성 대조군 100nM EGF 및 각각 서열번호 1 또는 2의 아미노산 서열로 이루어진 펩타이드 10uM, 50uM을 처리하여 24시간 동안 배양하고 세포를 회수하여 RNA를 분리하였다. RNA 정량 후 cDNA 합성 키트(Intron, Korea)을 이용하여 cDNA를 합성하고, PCR premix(Intron, Korea) 및 하기 표 5의 AQP3, SIRT1, GAPDH 각각의 프라이머를 이용하여 PCR 진행하였다. 그 다음, 5% 아가로즈 겔에 러닝하여 각 펩타이드 처리 조건에서 상기 성장인자들의 mRNA 발현 정도를 비교하여, 그 결과를 도 19 내지 21에 나타내었다. Human keratinocytes, HaCaT, were seeded in a 6-well plate at a density of 3×10 5 cells/well and incubated overnight. Then, it was changed to 0.05% FBS-containing medium and cultured for 4 hours, and then treated with a positive control 100 nM EGF and peptides consisting of the amino acid sequence of SEQ ID NO. RNA was isolated. After RNA quantification, cDNA was synthesized using a cDNA synthesis kit (Intron, Korea), and PCR was performed using a PCR premix (Intron, Korea) and primers of AQP3, SIRT1, and GAPDH in Table 5 below. Then, it was run on a 5% agarose gel to compare the mRNA expression levels of the growth factors under each peptide treatment condition, and the results are shown in FIGS. 19 to 21.

서열번호Sequence number 프라이머primer 서열(5'-3')Sequence (5'-3') 1313 AQP3_FAQP3_F CCTTCTTGGGTGCTGGAATACCTTCTTGGGTGCTGGAATA 1414 AQP3_RAQP3_R ACACGATAAGGGAGGCTCTGACACGATAAGGGAGGCTCTG 1515 SIRT1_FSIRT1_F TCAGTGGCTGGAACAGTGAGTCAGTGGCTGGAACAGTGAG 1616 SIRT1_RSIRT1_R TCTGGCATGTCCCACTATCATCTGGCATGTCCCACTATCA

도 19 내지 21에서 확인할 수 있듯이, 서열번호 1 또는 2의 아미노산 서열로 이루어진 펩타이드는 각질세포 활성 촉진을 통해 피부 장벽 강화와 관련된 단백질인 AQP3의 발현을 증가시킴을 확인하였다.As can be seen in FIGS. 19 to 21, it was confirmed that the peptide consisting of the amino acid sequence of SEQ ID NO: 1 or 2 increased the expression of AQP3, a protein related to skin barrier strengthening, through the promotion of keratinocyte activity.

실시예 6. 콜라겐1a, 파이브로넥틴 및 엘라스틴 발현량 측정Example 6. Measurement of expression levels of collagen 1a, fibronectin and elastin

마우스 섬유아세포 NIH3T3를 5x103 cells/well의 밀도로 6-웰 플레이트에 시딩 후 하룻밤 동안 배양하였다. 그 다음, 무혈청배지(Serum-free media)로 바꿔준 후, 양성 대조군 100nM bFGF, 및 서열번호 1 또는 2의 아미노산 서열로 이루어진 펩타이드를 처리하여 24시간 동안 배양하고, 4% 파라폼알데히드(paraformaldehyde)로 30분간 고정하였다. 그 다음, 3번 세척 후 0.5% Triton X-100에 15분간 반응시키고 다시 3번 세척하였다. 그 다음, 3% BSA에 1시간 블록킹(blocking)하고 Collagen 1a, Fibronectin 및 Elastin에 대한 1차 항체(1:100)를 4℃에서 하루밤 동안 반응시켰다. 그 다음, 2차 항체(1:500)를 실온에서 2시간 반응시킨 후, 다피 염색법(DAPI staining)으로 염색하여 형광 현미경(Fluorescent microscope)으로 관찰하여, 그 결과를 도 22 내지 27에 나타내었다. Mouse fibroblasts NIH3T3 were seeded in a 6-well plate at a density of 5×10 3 cells/well and incubated overnight. Then, after changing to serum-free media, a positive control 100 nM bFGF and a peptide consisting of the amino acid sequence of SEQ ID NO: 1 or 2 were treated and cultured for 24 hours, followed by 4% paraformaldehyde. ) Was fixed for 30 minutes. Then, after washing 3 times, reacted with 0.5% Triton X-100 for 15 minutes, and washed again 3 times. Then, blocking was performed in 3% BSA for 1 hour, and the primary antibodies (1:100) against Collagen 1a, Fibronectin, and Elastin were reacted at 4° C. overnight. Then, after reacting the secondary antibody (1:500) at room temperature for 2 hours, it was stained by DAPI staining and observed with a fluorescence microscope, and the results are shown in FIGS. 22 to 27.

도 22 내지 27에서 확인할 수 있듯이, 서열번호 1 또는 2의 아미노산 서열로 이루어진 펩타이드는 섬유아세포 활성 촉진을 통해 ECM 구성 성분인 콜라겐, 파이브로넥틴, 엘라스틴 단백질의 발현 증가 효과를 나타냄을 확인하였다.As can be seen in Figures 22 to 27, it was confirmed that the peptide consisting of the amino acid sequence of SEQ ID NO: 1 or 2 exhibited an effect of increasing the expression of the ECM constituents collagen, fibronectin, and elastin proteins by promoting fibroblast activity.

실시예 7. Procollagen1a ELISA Example 7. Procollagen1a ELISA

마우스 섬유아세포 NIH3T3를 5x103 cells/well의 밀도로 6-웰 플레이트에 시딩 후 하룻밤 동안 배양하였다. 그 다음, 0.05% FBS-containing media로 바꿔주고 4시간 동안 배양한 후 양성 대조군 100nM IGF-1 및 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드를 처리하여 72시간 동안 배양하고 배지를 회수한다. Procollagen1a ELISA kit (Usbiological lifescience, USA)을 이용하여 배지 내 함량을 측정하여, 그 결과를 도 28 내지 31 및 표 6에 나타내었다.Mouse fibroblasts NIH3T3 were seeded in a 6-well plate at a density of 5×10 3 cells/well and incubated overnight. Then, after changing to 0.05% FBS-containing media and incubating for 4 hours, the positive control 100 nM IGF-1 and the peptide consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4 were treated and cultured for 72 hours, and the medium was Recover. The content in the medium was measured using a Procollagen1a ELISA kit (Usbiological lifescience, USA), and the results are shown in FIGS. 28 to 31 and Table 6.

Procollagen1a expression(%)Procollagen1a expression(%) 도 28Fig. 28 ControlControl SEQ ID NO: 1SEQ ID NO: 1 IGF-1
(100nM)
IGF-1
(100nM)
10uM10uM 50uM50uM 100100 9898 157157 140140 도 29Fig. 29 ControlControl SEQ ID NO: 2SEQ ID NO: 2 IGF-1
(100nM)
IGF-1
(100nM)
10uM10uM 50uM50uM 100100 145145 146146 140140 도 30Fig. 30 ControlControl SEQ ID NO: 3SEQ ID NO: 3 IGF-1
(100nM)
IGF-1
(100nM)
10uM10uM 50uM50uM 100100 138138 143143 113113 도 31Fig. 31 ControlControl SEQ ID NO: 4SEQ ID NO: 4 IGF-1
(100nM)
IGF-1
(100nM)
10uM10uM 50uM50uM 100100 122122 141141 113113

도 28 내지 31 및 표 6에서 확인할 수 있듯이, 서열번호 1, 2, 3 또는 4의 아미노산 서열로 이루어진 펩타이드 처리시 섬유아세포에서 Pro-collagen1α 단백질의 발현이 증가하는 것을 확인하였다.As can be seen in FIGS. 28 to 31 and Table 6, it was confirmed that the expression of Pro-collagen1α protein was increased in fibroblasts when the peptide was treated with the amino acid sequence of SEQ ID NO: 1, 2, 3 or 4.

실시예 9. HA ELISA Example 9. HA ELISA

인간 각질 형성 세포인 HaCaT을 3x105 cells/well의 밀도로 6-웰 플레이트에 시딩 후 하룻밤 동안 배양하였다. 0.05% FBS-containing media로 바꿔주고 4시간 동안 배양한 후 양성 대조군 100nM IGF-1 및 서열번호 2의 아미노산 서열로 이루어진 펩타이드를 처리하여 72시간 동안 배양하고 배지를 회수한다. HA ELISA 키트(Echelon, USA)를 이용하여 배지 내 함량을 측정하고, 그 결과를 도 32 및 표 7에 나타내었다.Human keratinocytes, HaCaT, were seeded in a 6-well plate at a density of 3×10 5 cells/well and incubated overnight. After changing to 0.05% FBS-containing media and incubating for 4 hours, the positive control 100 nM IGF-1 and the peptide consisting of the amino acid sequence of SEQ ID NO: 2 were treated, cultured for 72 hours, and the medium was recovered. The content in the medium was measured using an HA ELISA kit (Echelon, USA), and the results are shown in FIGS. 32 and 7.

HA expression(ng/ml)HA expression(ng/ml) 도 32Fig. 32 ControlControl SEQ ID NO: 2SEQ ID NO: 2 IGF-1
(100nM)
IGF-1
(100nM)
10uM10uM 50uM50uM 251251 286286 292292 280280

도 32 및 표 7에서 확인할 수 있듯이, 서열번호 2의 아미노산 서열로 이루어진 펩타이드는 각질세포 활성 촉진을 통해 피부 장벽 강화와 관련된 단백질인 HA의 발현을 증가시킴을 확인하였다. As can be seen in Fig. 32 and Table 7, it was confirmed that the peptide consisting of the amino acid sequence of SEQ ID NO: 2 increased the expression of HA, a protein related to skin barrier strengthening, by promoting keratinocyte activity.

<110> CAREGEN CO., LTD. <120> Peptides Having Activity for Wrinkle Relief and Uses Thereof <130> PN160448D2 <160> 16 <170> KoPatentIn 3.0 <210> 1 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Peptide 1 <400> 1 Lys Trp Gly Gly Gly Arg Tyr 1 5 <210> 2 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Peptide 2 <400> 2 Ile Leu Gly Arg Trp Cys Gly 1 5 <210> 3 <211> 4 <212> PRT <213> Artificial Sequence <220> <223> Peptide 3 <400> 3 Gly Pro Val His 1 <210> 4 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Peptide 4 <400> 4 Glu Asp Glu Phe Lys Pro Pro Ala Ala Gly Arg 1 5 10 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Collagen1a_F <400> 5 caccctcaag agcctgagtc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Collagen1a_R <400> 6 agacggctga gtagggaaca 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Fibronectin_F <400> 7 ccaggaaccg agtacaccat 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Fibronectin_R <400> 8 atacccaggt tgggtgatga 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Elastin_F <400> 9 ggacccctga ctcgcgacct 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Elastin_R <400> 10 ggggaggtgg gactgcccaa 20 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_F <400> 11 ggtgtgaacg gatttggccg tattg 25 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_R <400> 12 ccgttgaatt tgccgtgagt ggagt 25 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AQP3_F <400> 13 ccttcttggg tgctggaata 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AQP3_R <400> 14 acacgataag ggaggctctg 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SIRT1_F <400> 15 tcagtggctg gaacagtgag 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SIRT1_R <400> 16 tctggcatgt cccactatca 20 <110> CAREGEN CO., LTD. <120> Peptides Having Activity for Wrinkle Relief and Uses Thereof <130> PN160448D2 <160> 16 <170> KoPatentIn 3.0 <210> 1 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Peptide 1 <400> 1 Lys Trp Gly Gly Gly Arg Tyr 1 5 <210> 2 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Peptide 2 <400> 2 Ile Leu Gly Arg Trp Cys Gly 1 5 <210> 3 <211> 4 <212> PRT <213> Artificial Sequence <220> <223> Peptide 3 <400> 3 Gly Pro Val His One <210> 4 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Peptide 4 <400> 4 Glu Asp Glu Phe Lys Pro Pro Ala Ala Gly Arg 1 5 10 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Collagen1a_F <400> 5 caccctcaag agcctgagtc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Collagen1a_R <400> 6 agacggctga gtagggaaca 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Fibronectin_F <400> 7 ccaggaaccg agtacaccat 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Fibronectin_R <400> 8 atacccaggt tgggtgatga 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Elastin_F <400> 9 ggacccctga ctcgcgacct 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Elastin_R <400> 10 ggggaggtgg gactgcccaa 20 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_F <400> 11 ggtgtgaacg gatttggccg tattg 25 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_R <400> 12 ccgttgaatt tgccgtgagt ggagt 25 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AQP3_F <400> 13 ccttcttggg tgctggaata 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AQP3_R <400> 14 acacgataag ggaggctctg 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SIRT1_F <400> 15 tcagtggctg gaacagtgag 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SIRT1_R <400> 16 tctggcatgt cccactatca 20

Claims (5)

삭제delete 서열번호 3의 아미노산 서열로 이루어진 펩타이드를 포함하는 피부 상태 개선용 화장품 조성물로서,
상기 피부 상태 개선은 주름개선, 피부재생, 피부탄력 개선 또는 상처 재생인 것인, 화장품 조성물.
1. A cosmetic composition for improving skin condition comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 3,
Wherein the skin condition improvement is wrinkle improvement, skin regeneration, skin elasticity improvement, or wound regeneration.
제2항에 있어서, 상기 화장품 조성물은 서열번호 4의 아미노산 서열로 이루어진 펩타이드를 추가로 포함하는 것인, 피부 상태 개선용 화장품 조성물.3. The cosmetic composition for improving skin condition according to claim 2, wherein the cosmetic composition further comprises a peptide consisting of the amino acid sequence of SEQ ID NO: 4. 서열번호 3의 아미노산 서열로 이루어진 펩타이드를 포함하는 피부 상태 개선용 식품 조성물로서,
상기 피부 상태 개선은 주름개선, 피부재생, 피부탄력 개선 또는 상처 재생인 것인, 식품 조성물.
1. A food composition for improving skin condition comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 3,
Wherein said skin condition improvement is wrinkle improvement, skin regeneration, skin elasticity improvement or wound regeneration.
제4항에 있어서, 상기 식품 조성물은 서열번호 4의 아미노산 서열로 이루어진 펩타이드를 추가로 포함하는 것인, 피부 상태 개선용 식품 조성물.5. The composition for improving skin condition according to claim 4, wherein the food composition further comprises a peptide consisting of the amino acid sequence of SEQ ID NO: 4.
KR1020190004868A 2019-01-14 2019-01-14 Peptides Having Activity for Wrinkle Relief and Uses Thereof KR101959020B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020190004868A KR101959020B1 (en) 2019-01-14 2019-01-14 Peptides Having Activity for Wrinkle Relief and Uses Thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020190004868A KR101959020B1 (en) 2019-01-14 2019-01-14 Peptides Having Activity for Wrinkle Relief and Uses Thereof

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
KR1020170111211A Division KR101943081B1 (en) 2017-08-31 2017-08-31 Peptides Having Activity for Wrinkle Relief and Uses Thereof

Publications (2)

Publication Number Publication Date
KR20190024915A KR20190024915A (en) 2019-03-08
KR101959020B1 true KR101959020B1 (en) 2019-03-18

Family

ID=65801065

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020190004868A KR101959020B1 (en) 2019-01-14 2019-01-14 Peptides Having Activity for Wrinkle Relief and Uses Thereof

Country Status (1)

Country Link
KR (1) KR101959020B1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150259398A1 (en) * 2008-11-24 2015-09-17 Bristol-Myers Squibb Company Bispecific egfr/igfir binding molecules

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101831977B1 (en) * 2015-08-25 2018-02-23 (주)피앤피바이오팜 A peptide having activity of Epidermal growth factor activity and production method therefor

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150259398A1 (en) * 2008-11-24 2015-09-17 Bristol-Myers Squibb Company Bispecific egfr/igfir binding molecules

Also Published As

Publication number Publication date
KR20190024915A (en) 2019-03-08

Similar Documents

Publication Publication Date Title
KR101943081B1 (en) Peptides Having Activity for Wrinkle Relief and Uses Thereof
KR101959012B1 (en) Peptides Having Activity for Wrinkle Relief and Uses Thereof
KR101167285B1 (en) Niacin-peptides having skin whitening effect and uses thereof
KR101163171B1 (en) Noggin derived Peptides and Uses Thereof
EP2078035B1 (en) Peptides having activities of epidermal growth factor and its uses
KR101021197B1 (en) Growth Factor?Mimicking Peptides and Uses Thereof
KR101187871B1 (en) FGF10-derived Peptides and Uses Thereof
KR101841748B1 (en) Peptides Having Activity for Promoting Melanin Synthesis and Uses Thereof
KR102077983B1 (en) Composition for improving skin wrinkles and skin whitening
KR20130028403A (en) Peptides inhibiting the activity of matrix metalloproteases and use thereof
EP2740740A1 (en) Edar ligand-derived peptide and uses thereof
KR101957352B1 (en) Peptides Having Activity for Wrinkle Relief and Uses Thereof
KR101041390B1 (en) Activin A?derived Peptides and Uses Thereof
KR101959020B1 (en) Peptides Having Activity for Wrinkle Relief and Uses Thereof
KR101054519B1 (en) Human Growth Hormone-Derived Peptides and Uses thereof
KR102160566B1 (en) Conjugate of minoxidil and peptide
KR101920052B1 (en) Peptides Having Activity for Promoting Melanin Synthesis and Uses Thereof
KR101719354B1 (en) Peptides Having Growth Factor Activity and Uses Thereof
KR20230099481A (en) Peptide having activities of skin condition improvement and uses thereof
KR20230099482A (en) Peptide having activities of skin condition improvement and uses thereof
CN118451093A (en) Peptides having skin condition improving activity and uses thereof

Legal Events

Date Code Title Description
A107 Divisional application of patent
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant